CN102516377A - Soybean ethylene responsive factor (ERF) transcription factor, and coding gene and salt tolerance application thereof - Google Patents

Abstract

The invention relates to a soybean ethylene responsive factor (ERF) transcription factor, and a coding gene and salt tolerance application thereof, and belongs to the field of genetic engineering. The amino acid sequence of the soybean ERF transcription factor is Sequence No.2, the amino acid sequence of the coding gene of the soybean ERF transcription factor is Sequence No.1, and the invention provides application of the soybean ERF transcription factor to salt tolerance of a transgenic plant. A GmERF7 transcription factor gene related with the soybean salt tolerance is cloned, and the expression mode of the gene in soybean, the in-vitro combination of the gene with an adversity element, and transcriptional regulation activity of the gene are researched, the salt tolerance of wild type tobacco and tobacco with trans GmERF7 gene is compared, basis is provided for the effective application of the soybean ERF transcription factor, and the invention has significance for improvement on stress resistance of plants, particularly cultivation of soybean varieties with high salt tolerance.

Description

A kind of soybean ERF transcription factor and encoding sox thereof and salt tolerant are used

Technical field

The present invention relates to plant genetic engineering field, be specifically related to the application aspect the transgenic plant salt tolerant of a kind of soybean ERF transcription factor and encoding sox thereof.

Background technology

Soybean is important cash crop, worldwide generally plants, and is not only the main source of human protein and lipid, also is important cattle food and industrial raw material simultaneously, and very big value is medically also being arranged.Yet biology and abiotic stress produce totally unfavorable influence to the g and D of soybean, and wherein, the soil salinization is having a strong impact on output, quality and the benefit of soybean, causes serious economy loss.Therefore, illustrate the response mechanism of soybean, identify that important gene that salt tolerant is relevant and the salt tolerance of utilizing them to improve soybean seem particularly important adverse circumstance.

Plant transcription factor can constantly synthesize under the stimulation of coercing and with signal transmission and amplification, regulate and control a plurality of expression of gene in downstream, thereby the change that causes plant physiology and biochemistry adapts to extraneous adverse environment, becomes people's research focus in recent years gradually.The ERF transcription factor belongs to the ERF subfamily in the distinctive AP2/ERF transcription factor superfamily in the plant, from tobacco, is separated obtaining at first in nineteen ninety-five with Shinshi by Ohme-Takagi.Their expressed proteins contain 1 conservative AP2/ERF that is made up of 58 or 59 amino acid jointly and combine the territory, the 3-D solid structure analysis revealed, and this structural domain almost is made up of with the parallel α spiral of βZhe Die with 13 antiparallel βZhe Dies.Wherein, βZhe Die is discerned all kinds of cis-acting elements to the AP2/ERF structural domain and possibly played a crucial role, and the α spiral possibly participated in the interaction between other transcription factor and the DNA.ERF can with GCC-box and/or DRE/CRT element specific combination, and these elements lay respectively in the promotor of pathogenesis-related proteins gene and high salt, the arid of plant, cold induction phase correlation gene usually.Thereby ERF goes through regulating in biology that these expression of gene participate in plant and the abiotic stress just.The adverse circumstance response of plant is regulated by many barss approach; Wherein, existing certain cross action between ethene, Whitfield's ointment, jasmonic and the dormin pipeline, possibly be to mutually promote between them; Also possibly be mutual antagonism, thereby realize accuracy controlling the adverse circumstance defense response.And the important component of the normally above-mentioned signal pathway infall of some ERF transcription factors.

At present, be separated to the proteic gene of a large amount of coding ERF from different plants such as Arabidopis thaliana, tobacco, tomato, capsicum, paddy rice, wheat, cottons.The JERF3 of tomato can be simultaneously and GCC-box and DRE/CRT combination of elements, can be induced by ethene, jasmonic, low temperature, high salt and dormin, and the while can be improved the salt tolerance of transgene tobacco.The expression of JcERF in the wood peanut can be induced by high salt, arid, ethene and mechanical wounding, but is not induced by ABA, and overexpression JcERF has strengthened plant to salt and cold resistance in Arabidopis thaliana.But the research of ERF transcription factor is less relatively in soybean, only reports the function of 3 ERF, and they all participate in coercing in the response of soybean and go, the positive regulating and controlling effect of performance aspect the raising stress resistance of plant.All possibly there is a large amount of ERF transcription factors in monocotyledons and the dicotyledons; In view of the vital role that ERF brings into play in plant reply adverse circumstance, doing further to other member in the soybean ERF family, evaluation helps the improvement that soybean is coerced anti-(anti-) property with application.

Summary of the invention

The present invention provides a kind of soybean ERF transcription factor and encoding sox and salt tolerant thereof to use.

The relevant ERF transcription factor of soybean salt-tolerance provided by the present invention derives from soybean varieties Jilin 32 (by the Fu Jian researcher of academy of agricultural sciences, Jilin Province present), called after GmERF7

The base sequence of said soybean ERF transcription factor gene is Sequence N0.1.

Said soybean ERF transcription factor gene encoded protein matter, its aminoacid sequence is Sequence N0.2.

Sequence table Sequence N0.1 is by 1179 based compositions; Sequence table Sequence N0.2 is made up of 392 amino-acid residues, comprises an AP2/ERF and combines the territory: from N-terminal the 118th to 175 amino acids residue; The nuclear localization signal of two predictions: first is from N-terminal the 72nd to 76 amino acids residue, and second from N-terminal the 112nd to 116 amino acids residue; The transcription activating domain of a prediction: from N-terminal the 41st to 70 amino acids residue.

Utilize any carrier that can guide foreign gene in plant, to express, with provided by the present invention GmERF7Encoding sox import vegetable cell, can obtain the transfer-gen plant that high salt patience is improved.When using gene constructed plant expression vector of the present invention, can before its transcription initiation Nucleotide, add any enhancing promotor or inducible promoter.Carry the present invention GmERF7Expression vector can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, conventional biological method transformed plant cells or tissue such as agriculture bacillus mediated through using, and the plant transformed tissue cultivating is become plant.By host transformed both can be monocotyledons, also can be dicotyledons.

The invention has the beneficial effects as follows: it is relevant that the present invention has cloned a soybean salt-tolerance GmERF7Transcription factor gene is studied the expression pattern of this gene in soybean, is combined and transcripting regulating activity with the external of adverse circumstance element, has compared wild-type tobacco and commentaries on classics GmERF7The salt tolerance of genetic tobacco, for its effective application provides foundation, to the resistance of improvement plant, it is significant particularly to cultivate the salt tolerant soybean varieties.

Description of drawings

Fig. 1 GmERF7The pcr amplification result of gene.

Fig. 2 GmERF7Gene adverse circumstance abduction delivering pattern.

Fig. 3 GmERF7Gene organization's expression pattern.

Fig. 4 GmERF7 albumen combines with the external of GCC-box.Wherein, 1 duct is GCC+mGCC, and 2 ducts are GmERF7 albumen, and 3 ducts are GmERF7 albumen+GCC, and 4 ducts are GmERF7 albumen+mGCC.

Fig. 5 GmERF7Transcriptional activation activity is analyzed.Wherein, figure A is reporter plasmid, effect plasmid vector structural representation; Figure B is a transient expression GUS fluorescent quantitation measured value, and 1 represents blank, and 2 representatives only transform the reporter plasmid carrier, and 3 represent reporter plasmid carrier and effect plasmid vector cotransformation.

Fig. 6 GmERF7Gene at fractional t1 for the PCR qualification result in the transgene tobacco.

Fig. 7 wild-type tobacco and T1 are for transgene tobacco salt stress result.Wherein, before on behalf of the Nicotiana gossei salt stress, A handle, before on behalf of the transgene tobacco salt stress, B handle, after on behalf of the Nicotiana gossei salt stress, C handle, after on behalf of the transgene tobacco salt stress, D handle.

Fig. 8 wild-type tobacco and T1 handle back chlorophyll measuring result for the transgene tobacco salt stress.

Embodiment

Embodiment 1: GmERF7The clone of gene and sequential analysis

The extraction of soybean RNA and cDNA's is synthetic: extract the total RNA of soybean Jilin 32 blades with RNAplant plus Reagent (available from TIANGEN); Carry out reverse transcription with M-MLV reverse transcriptase (RNase H-) (available from TaKaRa), synthetic cDNA.

Primer design is with synthetic: carry out the Blast comparison among (20,30 and 50 days) immature embryo express spectra order-checking in 3 periods institute calling sequence (the big gene of China is accomplished) the input NCBI with soybean varieties Jilin 32, obtain one with plant in the higher unknown cDNA sequence of ERF transcription factor protein sequence homology.According to acquired unknown cDNA sequence, its nucleotide sequence such as Sequence N0.1 are said, design synthetic primer, F:5 '-GAGACACAGCCATTGTTTGTTTAC-3 ', R:5 '-GGTTTTCTTGCTGTGGATTC-3 '.With above-mentioned cDNA is template; Carry out pcr amplification according to following reaction system and condition: 25 μ L systems include 10 * PCR Buffer, 2.5 μ L, 2.5 mmol/L dNTP mix, 2 μ L; Each 1 μ L of the primers F of 10 μ mol/L and primer R; CDNA 1 μ L, EX Taq (available from TaKaRa) 0.3 μ L mends deionized water to 25 μ L.Reaction conditions: preparatory 94 ℃ of 8min of sex change; 94 ℃ of 40s, 56 ℃ of 40s, 72 ℃ of 1min, 30 circulations; 72 ℃ are extended 8min.Above-mentioned amplified fragments is reclaimed the back be connected with cloning vector pMD18-T (available from TaKaRa), send China big gene sequencing after the evaluation, the checking sequence is correct.

Included through pcr amplification GmERF7The sequence of full length gene OFR, total length 1395bp includes 1179bp's GmERF7The gene complete sequence, the protein of forming by 392 amino-acid residues of encoding, its aminoacid sequence is Sequence N0.2, comprises a conservative AP2/ERF and combines territory, the nuclear localization signal of two predictions and a transcription activating domain.

Embodiment 2: GmERF7The expression pattern of gene under adverse circumstance is induced

The adverse circumstance in soybean Jilin 32 is handled: with Hoagland nutrient solution (Ca (NO ₃) ₂4H ₂O 0.62 g/L, KNO ₃0.34 g/L, KH ₂PO ₄0.06 g/L, NH ₄NO ₃0.053 g/L, MgSO ₄0.24 g/L, MgCl ₂0.67 mg/L, H ₃BO ₃0.38 mg/L, MnSO ₄0.2 mg/L, ZnSO ₄7H ₂O 0.29 mg/L, CuSO ₄0.01 mg/L, FeSO ₄7H ₂O 0.02785 g/L, EDTA-Na ₂0.0373 g/L, PH 5.7-5.8), 28 ℃, 16 h illumination/8 h dark conditions are cultivated soybean water planting seedling, and the water planting seedling of getting for four leaf phases carries out following processing:

High salt (NaCl) is handled: soybean seedling is placed the Hoagland nutrient solution that contains 200 mmol/L NaCl, and sampling respectively places liquid nitrogen rapidly behind processing 0h, lh, 2h, 5h, 10h and the 24h, and-80 ℃ of preservations are subsequent use;

Arid (Drought) is handled: soybean seedling is placed the Hoagland nutrient solution that contains 20% PEG8000, and sampling respectively places liquid nitrogen rapidly behind processing 0h, lh, 2h, 5h, 10h and the 24h, and-80 ℃ of preservations are subsequent use;

Low temperature (Cold) is handled: soybean seedling is placed 4 ℃ of incubators, and sampling respectively places liquid nitrogen rapidly behind processing 0h, lh, 2h, 5h, 10h and the 24h, and-80 ℃ of preservations are subsequent use;

Mechanical wounding (Wound) processing: the scalper with sterilization causes number place wound to the soybean seedling blade, and sampling respectively places liquid nitrogen rapidly behind processing 0h, lh, 2h, 5h, 10h and the 24h, and-80 ℃ of preservations are subsequent use;

Dormin (ABA) is handled: spray soybean seedling with the Hoagland nutrient solution that contains 200 μ mol/L ABA, sampling respectively places liquid nitrogen rapidly behind processing 0h, lh, 2h, 5h, 10h and the 24h, and-80 ℃ of preservations are subsequent use;

Ethene (ETH) is handled: soybean seedling is placed plastic tank with cover, is placed with 500 mL beakers in the bucket, in 200 mL zero(ppm) water, 2 mL, 40% ethrel, 1 g NaHCO are housed ₃, using rubber belt sealing, sampling respectively places liquid nitrogen rapidly behind processing 0h, lh, 2h, 5h, 10h and the 24h, and-80 ℃ of preservations are subsequent use;

The extraction of total RNA and the compound method of cDNA are with embodiment 1.According to GmERF7CDNA sequences Design real-time fluorescence quantitative PCR primer (F:5 '-GCGATTATCTCCGACTTCATTC-3 '; R:5 '-GATTTCACAGTTGTTGCTCCAC-3 ').With soybean constitutive expression gene β-TubuinFor internal reference (F:5 '-GGAAGGCTTTCTTGCATTGGTA-3 '; R:5 '-AGTGGCATCCTGGTACTGC-3 ').Utilize ABI 7500 real-time quantitative PCR appearance, the cDNA that handles sampling spot with each adverse circumstance of soybean is that template is carried out real-time fluorescence quantitative PCR.Reaction system contains 2 * SYBR Premix Ex Taq(available from TaKaRa) 10 μ L, ROX Reference Dye II 0.14 μ L, cDNA 80 ng, Primer F 0.4 μ L, Primer R 0.4 μ L, moisturizing to TV 20 μ L.Response procedures is 95 ℃ of 30s; 95 ℃ of 5s, 58 ℃ of 34s, 72 ℃ of 30s, 40 circulations.Adopt 2 ^{Δ Δ CT}The method analytical data is confirmed the relative expression quantity of gene.Each sampling spot is established 3 technology and is repeated, and test is established 3 secondary pollutants altogether and learned repetition.

Adverse circumstance is handled down GmERF7The relative expression quantity of gene (MV);

The result shows GmERF7All there is up-regulated expression in various degree in gene under various adverse circumstances are handled.

Embodiment 3: GmERF7The expression pattern of gene in soyabean tissue

Root, stem, leaf, flower and the total RNA and the reverse transcription of 20 days embryos of extracting soybean Jilin 32 respectively become cDNA, and method is with embodiment 1.CDNA with above-mentioned, stem, leaf, flower and 20 days embryos is that template is carried out real-time fluorescence quantitative PCR, and method is with embodiment 2.

GmERF7The relative expression quantity (MV) of gene in the soybean different tissues:

Tissue	Leaf		20 days embryos	Root	Stem	Flower
							Relative expression quantity	1	0.71475	3.80061	0.667293	0.131047

The result shows GmERF7Gene expression amount in the root of soybean is the highest, and expression amount is followed successively by: 20 days embryo ﹥ of root ﹥ leaf ﹥ stem ﹥ flower.

Embodiment 4:The proteic external combination experiment of GmERF7

According to GmERF7Gene order design synthetic primer, and above that, introduce respectively in the downstream primer SacI with HindThe III restriction enzyme site, F:5 '-CGAGCTCATGTGTGGTGGTGCGATT-3 '; R:5 '-GGGTTCGAATCAGAAGACTCCTGCCAT-3 '.With the pMD18-T-GmERF7 plasmid is template, carries out pcr amplification.Amplified production behind sepharose DNA purifying and recovering test kit (available from TIANGEN) purifying, is used SacI with HindIII (various restriction enzymes are all available from TaKaRa) double digestion is behind the recovery purifying, with same usefulness SacI with HindThe pET28a of III double digestion (available from Novagen) carrier connects.Connection product conversion dust Xi Shi intestinal bacteria ( E.coli) DH5 α (available from Biovector), after the empirical tests, change among the host bacterium Rosetta (DE3) (available from Novagen) and express.

The prokaryotic expression of recombinant protein: get respectively and positive be connected to 5 mL with empty carrier list bacterium colony and add in the LB substratum (peptone 10 g/L, yeast powder 5 g/L, NaCl 10 g/L) of 50 mg/L kantlex and 15 mg/L paraxin, 37 ℃ of shaking culture are spent the night; Be transferred in the LB substratum of additional 50 mg/L kantlex of 10 mL and 15 mg/L paraxin 37 ℃ of shaking culture to bacterium liquid OD in 1: 100 ratio ₆₀₀During for 0.4-0.6, adding final concentration is the IPTG of 0.1 mmol/L, behind 30 ℃ of shaking culture 3.5h, gets 1 mL bacterium liquid, and the centrifugal 1min of 12000 rpm collects thalline.

The SDS-PAGE of expression product analyzes and carries out according to SDS-PAGE electrophoresis ordinary method.

The purifying of recombinant protein: by above-mentioned condition, with 4 ℃ of 1 L bacterium liquid after inducing, the centrifugal 10min of 5000 rpm; Thalline after collection is induced, per 100 mg thalline add 1-5 mL bacterial lysate (available from sky bounties company), ultrasonic degradation thalline (intermittently 10sec carries out 90min for ultrasound condition: 200-300W, ultrasonic 2sec); 4 ℃, the centrifugal 25min of 20000 rpm; Use one-stop His labelled protein trace purifying suit (available from sky bounties company) that the solubility recombinant protein in the supernatant is carried out purifying.

Gel retardation assay:

The preparation of 1 probe

GCC: F：5′- AATTCATAAGAGCCGCCACTCATAAGAGCCGCCACTCCC -3′；R：5′- GGGAGTGGCGGCTCTTATGAGTGGCGGCTCTTATG -3′；

mGCC：F：5′- AATTCATAAGATCCTCCACTCATAAGATCCTCCACTCCC -3′；R：5′- GGGAGTGGAGGATCTTATGAGTGGAGGATCTTATG -3′；

Send the big synthesizing single-stranded GCC of gene of China, mGCC sequence according to top nucleotide sequence, the annealing reaction system of synthetic dsdna probe is following:

Sequence F(100 μmol/L) 20 μL

Sequence R(100 μmol/L) 20 μL

10×PCR buffer 10 μL

Moisturizing to TV 100 μ L.

Annealing and purifying procedure: 99 ℃ of water-bath 10min, turn off water-bath, naturally cool to normal temperature; 4 ℃ of placements are spent the night, and add 250 μ L absolute ethyl alcohols, place 1h for-80 ℃; 4 ℃, the centrifugal 10min of 13000 rpm abandons supernatant, uses 70% washing with alcohol; Be dissolved in after drying in the 50 μ L deionized waters ,-20 ℃ of storages are subsequent use.

2 probes and proteic association reaction

Combination anchor:

Double-chain probe 0.5 μ L

Transcription factor protein 5-7 μ g

5×binding buffer 2 μL

Moisturizing to 15 μ L.

Room temperature combines 25min, adds 2 μ L, 6 * loading buffer (available from TakaRa), and point sample is in 8% non-denaturing polyacrylamide gel; Leakage of electricity swimming (carrying out on ice) in 0.5 * TBE electrode buffer; The 110V constant voltage arrives apart from 1/4 place, plate bottom to indicator and to stop electrophoresis, tears plate open; The 10min that in EB, dyes, the gel imaging appearance is taken pictures.

Attaches agent prescription: 5 * binding buffer:Tris (1 mol/L, PH 7.5), 10 μ L, EDTA (0.5 mol/L; PH 7.5) 2 μ L, 5 mol/L NaCl, 10 μ L, 1 mol/L DTT, 1 μ L; 80% glycerine, 62.5 μ L, deionized water 14.5 μ L; 8% non-denaturing polyacrylamide gel: 5 * TBE, 2 mL, 40% Arc/Bis, 2 mL, 80% glycerine, 250 μ L, 10% APS, 100 μ L, TEMED 10 μ L, deionized water 5.67 mL.

The result is as shown in Figure 4, GmERF7 albumen can with the GCC-box specific combination.

Embodiment 5: GmERF7Transcriptional activation activity is analyzed

The construction process of plant expression vector is with embodiment 4.Use AtPDF1.2The CaMV35S promotor of promotor (initiator codon ATG upper reaches 346bp sequence comprises GCC-box) replacement pCAMBIA1301 (available from CAMBIA) makes up the reporter plasmid expression vector, uses GmERF7On the replacement pCAMBIA1301 GUSGene constructed effect plasmid expression vector.Order-checking transforms Agrobacterium EHA105 (available from Biovector) respectively with reporter plasmid and effect plasmid after identifying correctly.

Method injection tobacco leaf with reference to (In vivo analysis of plant promoters and transcription factors by agroinfiltration of tobacco leaves, 2000) such as Yang carries out transient expression.

The GUS fluorometric assay: the method with reference to " plant genetic engineering principle and technological second edition " and Jefferson (Assaying chimeric genes in plants:the GUS gene fusion system, 1987) is carried out.Get tobacco leaf agreement that contracts a film or TV play to an actor or actress 100 mg of injection, put into mortar, use the liquid nitrogen grinding powdered, add 600 uL and extract damping fluid, the supernatant after centrifugal is the gus protein crude extract.The sample crude extract is divided into two portions, and a part adopts the Bradford method to measure gus protein content; Another part is used for fluorescent quantitation and detects, and adds the GUS reaction substrate 4-MUG of 2 mmol/L in the crude extract, behind 37 ℃ of insulation 15min, adds 0.2 mmol/L Na ₂CO ₃The reaction terminating liquid termination reaction at excitation wavelength 365nm, under the emission wavelength 455nm, is measured fluorescent value.GUS is active to obtain relative reactivity with the fluorescent value that obtains divided by protein concentration and time.

The fluorometric assay result is as shown in Figure 5, GmERF7Have transcriptional activation activity, can in tobacco, activate the expression that contains the downstream gene of GCC-box in the promotor.

Embodiment 6: GmERF7The conversion of gene pairs tobacco

The construction process of plant expression vector will with embodiment 4 GmERF7The gene complete sequence is cloned on the MCS of plant expression vector pBI121 (available from Clontech), and order-checking transforms Agrobacterium EHA105 after identifying correctly.

Utilize Agrobacterium to infect the tobacco leaf disc method with pBI121-GmERF7 transformation of tobacco NC89 (available from middle cigarette seed ltd).Concrete grammar is following:

Tobacco transforms:

1 places 1.5 mL centrifuge tubes, the Youxiaolin soaking disinfection 3min with 10%, aseptic water washing 4-5 time with tobacco seed;

2 are laid on MS substratum (A revised medium for rapid growth and bio assays with tobacco tissue cultures with tobacco seed; Murashige and Skoog; 1962) on, culture condition: 16h (28 ℃) illumination/8h (22 ℃) dark;

3 get 1-2 month aseptic tobacco leaf of sprouting back growth, and it is cut into 0.5 cm ²Fritter (removing master pulse), and be inoculated in (MS adds 3 mg/L 6-BA and 0.2 mg/L NAA) on the MS division culture medium, cultivated in advance 2 days;

4 picking pBI121-GmERF7 mono-clonals add among the YEP (peptone 10 g/L, yeast powder 10 g/L, NaCl 5 g/L) of 50 μ g/mL Rifampins and 50 μ g/mL kantlex in 5 mL, and 28 ℃, 120 rpm shaking culture 24h;

5 ratios in 1:100 change above-mentioned culture among the YEP of additional 50 μ g/mL Rifampins of 50 mL and 50 μ g/mL kantlex over to, and 28 ℃, 120 rpm shaking culture are to OD ₆₀₀=0.4-0.5;

6 5000 rpm, centrifugal 15min under the room temperature removes supernatant, thalline is resuspended in the MS liquid culture concentrates (adding 100 μ mol/L AS), to OD ₆₀₀About=0.5;

7 tobacco leafs after will cultivating in advance infect 20min in resuspended liquid, blot the bacterium liquid of blade surface, place (MS adds 100 μ mol/L AS, and PH is to transferring to about 5.4) on the common substratum, cultivate altogether 3 days;

8 tobacco leafs after will cultivating altogether clean with the MS liquid nutrient medium that contains 500 mg/L Pyocianils; Transfer to after drying (MS adds 3 mg/L 6-BA, 0.2 mg/L NAA, 500 mg/L Pyocianils and 100 mg/L kantlex) on the screening culture medium, per 15 days subcultures once;

9 when treating resistant buds length to 1 cm, moves into root culture and concentrate (MS adds 200 mg/L Pyocianils and 100 mg/L kantlex), short its long root;

10 treat that the tobacco shoot root is after growing well, to move in the soil Routine Management.

The screening of transgene tobacco and evaluation:

1 gets T0 for tobacco leaf, extracts the total DNA of blade according to the method in Universal Genomic DNA Extraction Kit Ver.3.0 (available from the TaKaRa) specification sheets;

2 with after 50 times of the DNA dilutions of extracting, and getting 1 μ L is template, carries out conventional PCR checking with the primer among the embodiment 1.Wherein with unconverted Nicotiana gossei negative control, the positive contrast of plasmid pBI121-GmERF7;

The seed of the positive tobacco plant of 3 results, promptly T0 is for seed;

4 obtain T1 for the tobacco seedling during T0 buried for the seed kind, it is continued to extract DNA carry out PCR and detect, and get T1 and carry out follow-up resistance test for positive tobacco plant.

Fig. 6 does GmERF7, show for the PCR qualification result in the transgene tobacco at fractional t1 GmERF7Gene successfully is incorporated in the tobacco gene group.

Embodiment 7:T1 analyzes for the transgene tobacco salt tolerance

Get wild-type tobacco and T1 for commentaries on classics with punch tool GmERF7Genetic tobacco blade sequin places MS to add 400 mmol/L NaCl solution, simultaneously with wild-type tobacco and T1 for commentaries on classics GmERF7Genetic tobacco blade sequin places MS solution as contrast, in 25 ℃, cultivates under 16h illumination/8h dark condition 5 days, takes pictures and measures chlorophyll content.

The mensuration of chlorophyll content:

With the wild-type tobacco after handling and T1 for commentaries on classics GmERF7The genetic tobacco blade is weighed, and places 1.5 mL centrifuge tubes, adds an amount of SiO ₂With 1 mL, 80% acetone, fully grind, the centrifugal 10min of 12000 rpm gets supernatant, with the absorbance value of spectrophotometric determination 663 nm and 645 nm wavelength.

Chlorophyll-a concentration (mg/L)=12.72A ₆₆₃-2.59A ₆₄₅

Chlorophyll b concentration (mg/L)=22.88A ₆₄₅-4.68A ₆₆₃

Chlorophyll total concn (mg/L)=chlorophyll-a concentration+chlorophyll b concentration

The bright leaf chlorophyll content of every gram (mg/g)=(chlorophyll total concn * extracting liquid volume * extension rate)/sample fresh weight

Result such as Fig. 7 and shown in Figure 8, the loss of wild-type tobacco chlorophyll content is more, and blade begins to bleach, and on the contrary, the chlorophyll content of the wild tobacco of transgenic is not compared with contrast and is obviously descended, and blade still demonstrates normal green.

< 110>Jilin University

< 120>a kind of soybean ERF transcription factor and encoding sox thereof and salt tolerant are used

<130> jluwqy201103

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 1179

<212> DNA

< 213>soybean

<400> 1

atgtgtggtg gtgcgattat ctccgacttc attccagcgg gtcccgccgg cggggcgcag 60

cgcgtgaccg ccgacatcct gtggccgaat ttgaggaagc ggttctcgaa gtcgctgctg 120

gacgatgatt tcgaggcagg gttcagagaa ttcgaggatg actcggaaat cgaggatgtc 180

gatgatgagg acgatgaaga ggaggaggag ttgaagaaga agaagccctt tgggttctct 240

cgctccaaca acaaggctgc ttctaagcct ctctctcgtg gagcaacaac tgtgaaatct 300

gtggaatcaa aggggcaagc tgagaagtgt gccaagagaa agaggaagaa ccagtatcgc 360

ggaatccgcc agcgtccatg gggaaagtgg gctgctgaga ttcgcgaccc aagaaagggg 420

gttcgtgttt ggcttggaac tttcagcact gctgaagaag ctgcaagagc ttacgatgct 480

gaagcaagga ggatccgtgg caagaaagcc aaggtgaatt tccctgatga gccttcaggc 540

gctgcttcct caaaacgtct caaggcgaat ccagaggctc agccaatgaa gaaaaatctg 600

aactctgtga agccgaaaat aaaccagatg ttcaattttg gtgacaatct tgagggctac 660

tacagcccta tagatcaggt ggaacagaaa ccactggtta accagtatgt taaccgtgcc 720

ccgtttgctg gaaatggagt tcaagtctca cctgttactc catctgctga tgttactgct 780

tacttcagct ctgagcattc gagcagctcg tttgattatt ctgacctcgg atggggtgaa 840

caagtcccca agacacccga gatctcatcc atgctttctg ctgctccttt ggacggtgaa 900

tctcagtttg tgcagggtgc tgctgatcag aatcagaaga agaacaacct gctggatatg 960

gcatctgtgc aagatgattc tgcaaaaact ctttctgagg agcttgcaga cattgaatcc 1020

cagctgaagt tctttgagac cccttctttt cttgatgaag cctgggctga tgctgcattg 1080

gcgtctttgc tcagtgaaga tgcatctcag gatgctgctg gaaaccctat gaacctttgg 1140

agcttcgacg acctgccttc catggcagga gtcttctga 1179

<210> 2

<211> 392

<212> PRT

< 213>soybean

<400> 2

Met Cys Gly Gly Ala Ile Ile Ser Asp Phe Ile Pro Ala Gly Pro Ala

1 5 10 15

Gly Gly Ala Gln Arg Val Thr Ala Asp Ile Leu Trp Pro Asn Leu Arg

20 25 30

Lys Arg Phe Ser Lys Ser Leu Leu Asp Asp Asp Phe Glu Ala Gly Phe

35 40 45

Arg Glu Phe Glu Asp Asp Ser Glu Ile Glu Asp Val Asp Asp Glu Asp

50 55 60

Asp Glu Glu Glu Glu Glu Leu Lys Lys Lys Lys Pro Phe Gly Phe Ser

65 70 75 80

Arg Ser Asn Asn Lys Ala Ala Ser Lys Pro Leu Ser Arg Gly Ala Thr

85 90 95

Thr Val Lys Ser Val Glu Ser Lys Gly Gln Ala Glu Lys Cys Ala Lys

100 105 110

Arg Lys Arg Lys Asn Gln Tyr Arg Gly Ile Arg Gln Arg Pro Trp Gly

115 120 125

Lys Trp Ala Ala Glu Ile Arg Asp Pro Arg Lys Gly Val Arg Val Trp

130 135 140

Leu Gly Thr Phe Ser Thr Ala Glu Glu Ala Ala Arg Ala Tyr Asp Ala

145 150 155 160

Glu Ala Arg Arg Ile Arg Gly Lys Lys Ala Lys Val Asn Phe Pro Asp

165 170 175

Glu Pro Ser Gly Ala Ala Ser Ser Lys Arg Leu Lys Ala Asn Pro Glu

180 185 190

Ala Gln Pro Met Lys Lys Asn Leu Asn Ser Val Lys Pro Lys Ile Asn

195 200 205

Gln Met Phe Asn Phe Gly Asp Asn Leu Glu Gly Tyr Tyr Ser Pro Ile

210 215 220

Asp Gln Val Glu Gln Lys Pro Leu Val Asn Gln Tyr Val Asn Arg Ala

225 230 235 240

Pro Phe Ala Gly Asn Gly Val Gln Val Ser Pro Val Thr Pro Ser Ala

245 250 255

Asp Val Thr Ala Tyr Phe Ser Ser Glu His Ser Ser Ser Ser Phe Asp

260 265 270

Tyr Ser Asp Leu Gly Trp Gly Glu Gln Val Pro Lys Thr Pro Glu Ile

275 280 285

Ser Ser Met Leu Ser Ala Ala Pro Leu Asp Gly Glu Ser Gln Phe Val

290 295 300

Gln Gly Ala Ala Asp Gln Asn Gln Lys Lys Asn Asn Leu Leu Asp Met

305 310 315 320

Ala Ser Val Gln Asp Asp Ser Ala Lys Thr Leu Ser Glu Glu Leu Ala

325 330 335

Asp Ile Glu Ser Gln Leu Lys Phe Phe Glu Thr Pro Ser Phe Leu Asp

340 345 350

Glu Ala Trp Ala Asp Ala Ala Leu Ala Ser Leu Leu Ser Glu Asp Ala

355 360 365

Ser Gln Asp Ala Ala Gly Asn Pro Met Asn Leu Trp Ser Phe Asp Asp

370 375 380

Leu Pro Ser Met Ala Gly Val Phe

385 390

Claims (3)

1. soybean ERF transcription factor, it is characterized in that: its aminoacid sequence is Sequence N0.2.

2. soybean ERF transcription factor as claimed in claim 1 is characterized in that: the nucleotide sequence of its encoding sox is Sequence N0.1.

3. the application of soybean ERF transcription factor as claimed in claim 1 aspect the transgenic plant salt tolerant.

Images