CN111218470A

CN111218470A - Method for regulating and controlling stress resistance of plants

Info

Publication number: CN111218470A
Application number: CN202010101810.1A
Authority: CN
Inventors: 翟红; 刘庆昌; 何绍贞; 赵宁; 杜冰
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2020-02-19
Filing date: 2020-02-19
Publication date: 2020-06-02
Anticipated expiration: 2040-02-19
Also published as: CN111218470B

Abstract

The invention discloses a method for regulating and controlling the stress resistance of plants. The invention firstly discloses a method for cultivating a transgenic plant with high stress resistance, which comprises the steps of improving the expression quantity of a gene of a protein with an amino acid sequence shown as SEQ ID NO.1 in a target plant and/or the content of the protein and/or the activity of the protein to obtain the transgenic plant; the transgenic plant has higher stress resistance than the target plant. The invention further discloses the protein and related biological materials and application thereof. The invention discovers IbATL38 protein and a coding gene thereof, and introduces the gene into Arabidopsis thaliana to obtain a transgenic Arabidopsis thaliana plant over-expressing IbATL38 gene. The transgenic arabidopsis plant is subjected to adversity stress treatment, and the salt tolerance and ABA tolerance of the overexpression transgenic arabidopsis plant is enhanced compared with wild arabidopsis, so that the overexpression transgenic arabidopsis plant has an important application value in the research of improving the stress resistance of plants.

Description

Method for regulating and controlling stress resistance of plants

Technical Field

The invention relates to the field of biotechnology. In particular to a method for regulating and controlling the stress resistance of plants.

Background

According to incomplete statistics, 8 hundred million hm exists worldwide²Salinized land, which accounts for about 6 percent of the total land area and is salinized by about 20 percent of the soil for irrigating agricultural land. China is one of the countries with the most distributed saline-alkali soil in the world. The increase of the world population and the reduction of the arable land area seriously threaten the safety of food, and the challenge of China is more serious. In addition, with the dramatic expansion of the world population and the impact of global warming, shortages of water resources have also become one of the major challenges facing agriculture. Salinization of cultivated land seriously influences sustainable development of agriculture, and research on plant stress resistance mechanism has important significance on agricultural production and ecological construction.

The phytohormone abscisic acid (ABA) plays an important role in plant response to adversity stress, for example, the ABA signal induces the plant to be transformed to a salt-resistant metabolism regulation pathway by regulating stomatal closure and improving various stress response reactions such as gene expression related to salt stress, and finally relieves the harm brought by the salt stress. With the development of molecular biology level and genetic manipulation technology, genetic engineering breeding has become one of the important methods for enhancing crop stress resistance.

Therefore, it is an effective way to improve the stress resistance of plants to explore new genes with stress resistance and to use them by means of bioengineering.

Disclosure of Invention

The technical problem to be solved by the invention is how to improve the stress resistance of plants, particularly the salt tolerance and ABA tolerance.

In order to solve the technical problems, the invention firstly provides a method for cultivating a transgenic plant with high stress resistance.

The method for cultivating the transgenic plant with high stress resistance comprises the steps of improving the expression quantity of the following genes of the protein in a target plant and/or the content of the protein and/or the activity of the protein to obtain the transgenic plant; the stress resistance of the transgenic plant is higher than that of the target plant;

the protein is any one of the following A1) or A2) or A3), is named IbATL38 protein or protein IbATL38, and is derived from sweet potato (Ipomoea batatas):

A1) protein with amino acid sequence shown as SEQ ID NO. 1;

A2) the N end or/and the C end of the amino acid sequence shown in SEQ ID NO.1 is connected with a protein label to obtain a fusion protein;

A3) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1, has more than 90 percent of identity with the protein shown in A1) and has the same function.

Wherein SEQ ID NO.1 consists of 224 amino acid residues.

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

In the above method, the protein-tag (protein-tag) refers to a polypeptide or protein that is expressed by fusion with a target protein using in vitro recombinant DNA technology, so as to facilitate the expression, detection, tracking and/or purification of the target protein. The protein tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others.

In the above methods, identity refers to the identity of amino acid sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and performing a calculation by searching for the identity of a pair of amino acid sequences, a value (%) of identity can be obtained.

In the above method, the 90% or greater identity may be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

In the above method, the method for increasing the expression level of the gene of the protein and/or the content of the protein and/or the activity of the protein in the target plant is to express or overexpress the protein in the target plant.

In the above method, the expression or overexpression is carried out by introducing a gene encoding the protein into a plant of interest.

In the above method, the gene encoding the protein may be introduced into a target plant by a plant expression vector carrying the gene encoding the protein. The plant expression vector carrying the gene encoding the protein of the present invention can be used to transform plant cells or tissues by using conventional biological methods such as Ti plasmid, Ri plasmid, plant viral vector, direct DNA transformation, microinjection, conductance, agrobacterium-mediated transformation, etc., and culture the transformed plant cells or tissues into plants.

In the above method, the nucleotide sequence of the coding gene of the protein is a DNA molecule shown in SEQ ID NO. 2.

In a specific embodiment of the present invention, the plant expression vector carrying the gene encoding the protein of the present invention may be pCB-IbATL 38. Specifically, pCB-IbATL38 was obtained by inserting the DNA molecule shown in SEQ ID NO.2 into pCBGUS using restriction enzymes BglII and PmlI.

In the above method, the stress resistance is salt resistance and ABA resistance.

The invention further provides the application of the protein, and the application is also in the protection scope of the invention.

The application of the protein of the invention is shown in any one of the following steps:

B1) improving the salt tolerance of the plants;

B2) preparing a product for improving the salt tolerance of plants;

B3) improving ABA tolerance of plants;

B4) preparing a product for improving ABA tolerance of plants;

B5) improving the germination rate of plants under the condition of salt and/or ABA stress;

B6) preparing a product for increasing the germination rate of plants under salt and/or ABA stress conditions;

B7) improving the growth vigor of plants under salt and/or ABA stress conditions;

B8) preparing a product for improving the growth vigor of plants under salt and/or ABA stress conditions;

B9) increasing root length of a plant under salt and/or ABA stress conditions;

B10) preparing a product that increases root length of a plant under salt and/or ABA stress conditions;

B11) reducing the active oxygen content of the plant under salt and/or ABA stress conditions;

B12) products are prepared that reduce the active oxygen content of plants under salt and/or ABA stress conditions.

The protein or the related biological materials are also within the protection scope of the invention.

The related biomaterial of the invention is any one of the following C1) -C10):

C1) nucleic acid molecules encoding the above proteins;

C2) an expression cassette comprising the nucleic acid molecule of C1);

C3) a recombinant vector comprising the nucleic acid molecule of C1), or a recombinant vector comprising the expression cassette of C2);

C4) a recombinant microorganism containing C1) the nucleic acid molecule, or a recombinant microorganism containing C2) the expression cassette, or a recombinant microorganism containing C3) the recombinant vector;

C5) a transgenic plant cell line comprising C1) the nucleic acid molecule, or a transgenic plant cell line comprising C2) the expression cassette, or a transgenic plant cell line comprising C3) the recombinant vector;

C6) transgenic plant tissue comprising C1) the nucleic acid molecule, or transgenic plant tissue comprising C2) the expression cassette, or transgenic plant tissue comprising C3) the recombinant vector;

C7) a transgenic plant organ containing C1) said nucleic acid molecule, or a transgenic plant organ containing C2) said expression cassette, or a transgenic plant organ containing C3) said recombinant vector;

C8) a transgenic plant containing C1) the nucleic acid molecule, or a transgenic plant containing C2) the expression cassette, or a transgenic plant containing C3) the recombinant vector;

C9) a tissue culture produced from regenerable cells of the transgenic plant of C8);

C10) protoplasts produced by the tissue culture of C9).

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, among others.

In the above biological material, the C1) nucleic acid molecule encoding the above protein may specifically be any of the following D1) or D2) or D3):

D1) DNA molecule shown in SEQ ID NO. 2;

D2) the coding sequence is DNA molecule shown in SEQ ID NO. 2;

D3) a DNA molecule which hybridizes with the DNA molecule defined by D1) or D2) under strict conditions and codes the protein.

Wherein, SEQ ID NO.2 consists of 675 nucleotides, the Open Reading Frame (ORF) thereof is from 1 st to 675 th from the 5' end, and the encoded amino acid sequence is the protein shown in SEQ ID NO. 1.

The stringent conditions are hybridization and washing of the membrane 2 times 5min at 68 ℃ in a solution of 2 XSSC, 0.1% SDS, and 2 times 15min at 68 ℃ in a solution of 0.5 XSSC, 0.1% SDS.

In the above-mentioned related biological materials, the expression cassette described in C2) refers to a DNA molecule capable of expressing the protein in a host cell, and the DNA molecule may include not only a promoter for initiating the transcription of IbATL38 gene, but also a terminator for terminating the transcription of IbATL38 gene. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter of cauliflower mosaic virus 35S; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al (1999) Plant Physiol 120: 979-992); from smokeA grass chemically inducible promoter, pathogenesis-related 1(PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoters (U.S. patent 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128(CN101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053.) they may be used alone or in combination with other plant promoters⁹⁸⁵) Nature 313: 810; rosenberg et al (1987) Gene,56: 125; guerineau et al (1991) mol.gen.genet,262: 141; proudfoot (1991) Cell,64: 671; sanfacon et al Genes Dev., 5: 141; mogen et al (1990) Plant Cell,2: 1261; munroe et al (1990) Gene,91: 151; ballad et al (1989) Nucleic Acids Res.17: 7891; joshi et al (1987) Nucleic Acid Res, 15: 9627).

In the above-mentioned related biological materials, the recombinant vector described in C3) may contain a DNA molecule shown in SEQ ID NO.2 for encoding the above-mentioned protein.

A recombinant vector containing a gene expression cassette encoding the above protein can be constructed using a plant expression vector. The plant expression vector can be a Gateway system vector or a binary agrobacterium vector and the like, such as pCAMBIA3301, pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1300, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pBI121, pCAMBIA1391-Xa or pCAMBIA 1391-Xb. When the coding gene of the protein is used for constructing a recombinant vector, any one of an enhanced promoter, a constitutive promoter, a tissue-specific promoter or an inducible promoter can be added in front of the transcription initiation nucleotide, such as a cauliflower mosaic virus (CAMV)35S promoter, a ubiquitin gene Ubiqutin promoter (pUbi) and the like, and the promoter can be used alone or combined with other plant promoters; in addition, when the gene of the present invention is used to construct plant expression vectors, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound which can produce a color change (GUS gene, luciferase gene, etc.), an antibiotic marker having resistance (gentamicin marker, kanamycin marker, etc.), or a chemical-resistant marker gene (e.g., herbicide-resistant gene), etc., which can be expressed in plants.

In a specific embodiment of the invention, the recombinant vector is a recombinant plasmid pCB-IbATL 38. The recombinant plasmid pCB-IbATL38 is a recombinant vector obtained by replacing a segment between BglII enzyme cutting sites and PmlI enzyme cutting sites of the vector pCBGUS with a DNA molecule shown in SEQ ID NO.2 and keeping other sequences unchanged.

In the related biological material, the recombinant microorganism C4) can be yeast, bacteria, algae and fungi.

In the above-mentioned related biological materials, C7) the transgenic plant organ may be a root, a stem, a leaf, a flower, a fruit, and a seed of the transgenic plant.

In the above-mentioned related biomaterials, C9) the tissue culture may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

In the related biological material, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not comprise propagation materials.

The application of any one of the following biological materials related to the protein of the invention is also within the protection scope of the invention:

B1) improving the salt tolerance of the plants;

B2) preparing a product for improving the salt tolerance of plants;

B3) improving ABA tolerance of plants;

B4) preparing a product for improving ABA tolerance of plants;

B9) increasing root length of a plant under salt and/or ABA stress conditions;

The application of the protein or the related biological materials in plant breeding is also within the protection scope of the invention.

Among the above applications, the application in plant breeding may be specifically to cross a plant containing the protein or the related biological material (e.g., a gene encoding the protein) with another plant to perform plant breeding.

The above-mentioned salt tolerance and ABA tolerance are exhibited by increasing germination rate, plant root length and growth vigor, and reducing active oxygen content.

The ABA resistance is resistance to ABA.

In the above, the plant is any one of E1) -E7) as follows:

E1) a dicotyledonous plant;

E2) a monocot plant;

E3) a cruciferous plant;

E4) arabidopsis thaliana (Arabidopsis thaliana);

E5) a plant of the family Convolvulaceae;

E6) a plant of the genus Ipomoea;

E7) sweet potatoes (Ipomoea batatas).

The invention discovers IbATL38 protein and a coding gene thereof, and introduces the gene into Arabidopsis thaliana to obtain a transgenic Arabidopsis thaliana plant over-expressing IbATL38 gene. The transgenic arabidopsis plants are subjected to adversity stress treatment, and salt tolerance and ABA tolerance of over-expression transgenic arabidopsis plants are found to be enhanced compared with wild arabidopsis, and the method is specifically characterized by increasing germination rate, root length, growth vigor and active oxygen content. The results show that the IbATL38 gene and the protein coded by the gene play an important role in the stress resistance process of plants. The IbATL38 protein and the coding gene thereof provided by the invention have important application values in research of improving the stress resistance of plants. The invention has wide application space and market prospect in the agricultural field.

Drawings

FIG. 1 shows the PCR amplification result of transgenic Arabidopsis plants; wherein, M is DNA molecule Marker, W is negative control water, P is positive control (pCAMBIA1300-IbATL38-GFP), WT is genome DNA of wild type Arabidopsis thaliana plant, L1-L10 is IbATL38 gene transfer Arabidopsis thaliana positive plant.

FIG. 2 shows the expression of IbATL38 gene in IbATL38 transgenic Arabidopsis positive plant and wild Arabidopsis plant; wherein WT is a cDNA of wild type Arabidopsis thaliana, and L1-L10 is a cDNA of IbATL38 transgenic Arabidopsis thaliana positive plant.

FIG. 3 shows seed salt tolerance and ABA stress identification of transgenic Arabidopsis positive plants and wild Arabidopsis plants over-expressing IbATL 38; wherein A is the germination condition; b is a germination rate statistical result; WT is wild type Arabidopsis thaliana, L1, L3, L9 are transgenic Arabidopsis plants overexpressing IbATL 38.

FIG. 4 shows salt tolerance and ABA stress in vitro identification of transgenic Arabidopsis positive plants and wild Arabidopsis plants overexpressing IbATL 38; wherein A, B is the growth condition and root length statistics of normal 1/2MS culture medium containing 50mM NaCl and 1 μm ABA respectively; WT is wild type Arabidopsis, L1, L3, L9 are overexpression IbATL38 transgenic Arabidopsis lines.

FIG. 5 shows the identification of salt tolerant pots for transgenic Arabidopsis positive plants and wild type Arabidopsis plants overexpressing IbATL 38; wherein A is the growth condition of plants in a control group and a salt stress group; b is the statistical result of survival rate and chloroplast content; WT is wild type Arabidopsis, L1, L3, L9 are overexpression IbATL38 transgenic Arabidopsis lines.

FIG. 6 is the detection of ROS content of transgenic Arabidopsis positive plants and wild type Arabidopsis plants overexpressing IbATL 38; wherein, WT is wild type Arabidopsis thaliana, L1, L3 and L9 are overexpression IbATL38 transgenic Arabidopsis thaliana strains.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Sweet potato variety lushu No. 3 is described in the following documents: acquisition and characterization of IbMIPS1 and IbMVD gene-overexpressed sweet potato plants, doctor academic thesis, university of Chinese agriculture, 2015. After the consent of the authors, the public can obtain the sweet potato genetic breeding research laboratory from the university of Chinese agriculture to repeat the experiment, and can not be used as other applications.

Arabidopsis thaliana Columbia wild-type col-0 is a product of Shanghai Diego Biotechnology Limited.

The cloning vector pMD19-T is a product of Takara Bio-engineering (Dalian) Inc. under the catalog number 6013.

The vector pCAMBIA3301 is a product of Youbao biology, and the product number is VT 1386.

The vector pBI121 is a product of Youbao biology, and the product number is VT 1388.

The plant total RNA extraction kit is a Transzol Up plant total RNA extraction kit of full-scale gold (TransGen Biotech, Beijing), and the catalog number of the product is ET 111.

The pEASY-Blunt simple vector is a product of Beijing all-purpose gold biotechnology, Inc., and the product catalog number is CB 111-01.

The QuantScript RT Kit Quant cDNA first strand synthesis Kit is a product of Tiangen (TIANGEN, Beijing) Limited, and has a product catalog number of KR 103.

1/2 Hoagland nutrient solutions are described in the following documents: LiudeGao, acquisition of sweet potato plants over-expressing IbP5CR, IbERD3, IbELT and IbNFU1 genes and identification of salt tolerance.

Example 1 obtaining of IbATL38 Gene

Firstly, the IbATL38 gene is obtained by the following steps:

1. extracting the total RNA of the young leaves of the sweet potato variety Lushu No. 3 by using a plant total RNA extraction Kit, and carrying out reverse transcription on the total RNA by using a QuantScript RT Kit Quant cDNA Kit to obtain a first-strand cDNA.

2. Primers IbATL38-F and IbATL38-R are designed and artificially synthesized, the cDNA obtained in the step 1 is used as a template, PCR amplification is carried out, and a PCR amplification product of about 675bp is obtained and sequenced.

The primer sequence is as follows:

IbATL38-F：5′-ATGATTTCTTCCGAGACGAATTTG-3′

IbATL38-R：5′-TCAGATGTTTGATGGGCTCTCG-3′

the result shows that the nucleotide sequence of the PCR amplification product is shown as 1 st to 675 th positions from the 5' end of SEQ ID NO.2, the gene shown by the sequence is named IbATL38 gene, the encoded protein is named IbATL38 protein or protein IbATL38, and the amino acid sequence is shown as SEQ ID NO. 1.

Example 2 application of IbATL38 protein in regulation and control of salt tolerance of arabidopsis thaliana

Construction of recombinant plasmid

A. Construction of recombinant plasmid pCB-IbATL38

1. Artificially synthesizing a double-stranded DNA molecule shown in the 1 st to 675 th positions from the 5' end of SEQ ID NO. 2. Taking the double-stranded DNA molecule as a template, and taking OE-F-BglII: 5' -GAAGATCTATGATTTCTTCCGAGACGAATTTG-3′(recognition sequences for the restriction enzyme BglII are underlined) and OE-R-PmlI: 5' -GCCACGTGTCAGATGTTTGATGGGCTCTCG-3' (the bottom line is the recognition sequence of the restriction enzyme PmlI) as a primer to carry out PCR amplification, and double-stranded DNA molecules containing the restriction enzyme BglII at the N end and the restriction enzyme PmlI at the C end are obtained.

2. The double-stranded DNA molecule containing the restriction enzyme BglII at the N-terminal and the restriction enzyme PmlI at the C-terminal is connected to a pEASY-Blunt simple vector to obtain a recombinant plasmid pEASY-IbATL 38.

3. After completion of step 2, the recombinant plasmid pEASY-IbATL38 was double-digested with the restriction enzymes BglII and PmlI, and fragment 1 of approximately 675bp was recovered.

4. The vector pCAMBIA3301 was double-digested with restriction enzymes HindIII and EcoRI, and the vector backbone 1 of about 11256bp was recovered.

5. The vector pBI121 was double digested with the restriction enzymes HindIII and EcoRI, and the fragment 2 comprising about 3032bp was recovered.

6. And connecting the fragment 2 with a vector framework 1 to obtain the recombinant plasmid pCBGUS.

7. The recombinant plasmid pCBGUS was double digested with restriction enzymes BglII and PmlI, recovering vector backbone 2 of about 12388 bp.

8. And connecting the fragment 1 with a vector framework 2 to obtain a recombinant plasmid pCB-IbATL 38.

According to the sequencing results, the recombinant plasmid pCB-IbATL38 was structurally described as follows: the small fragment between the recognition sequences of restriction enzymes BglII and PmlI of the recombinant plasmid pCBGUS is replaced by a DNA molecule shown in the 1 st to 675 th positions from the 5' end of SEQ ID NO.2, and the IbATL38 protein shown in SEQ ID NO.1 is expressed.

The recombinant plasmid pCBGUS is a vector obtained by replacing HindIII and EcoRI double enzyme cutting sites of a pCAMBIA3301 vector by adding a GUS gene sequence to a 35S promoter sequence on a pBI121 vector, and is constructed by the following method:

(1) the pCAMBIA3301 vector (from CAMBIA company) was subjected to HindIII and EcoRI double-enzyme cleavage to recover a large vector fragment;

(2) the pBI121 vector (purchased from Clontech) was digested simultaneously with HindIII and EcoRI to recover a fragment containing the gusA gene;

(3) and (3) connecting the large vector fragment recovered in the step (1) with the fragment containing the gusA gene recovered in the step (2) to obtain the recombinant vector pCBGUS.

Second, obtaining IbATL38 transgenic Arabidopsis plants

1. The recombinant plasmid pCB-IbATL38 is transformed into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium tumefaciens A, which is named as GV3101/pCB-IbATL 38.

2. Seed disinfection treatment: taking a proper amount of seeds of arabidopsis thaliana Columbia wild type (Col-0; hereinafter, referred to as wild type arabidopsis thaliana) to be filled into a 1.5mL centrifuge tube, disinfecting for 10min by using a 1% sodium hypochlorite solution, turning upside down, fully and uniformly mixing, pouring out the sodium hypochlorite after low-speed centrifugation, and adding sterile distilled water to fully wash for 5-6 times; the treated seeds were spread evenly on 1/2MS plates.

3. Vernalization: the 1/2MS plate with the seeds laid thereon is sealed and placed in an environment at 4 ℃ for 3-4 days.

4. Culturing the vernalized plate in a light culture room (light intensity: 5500lx +/-300 lx light time: 12h) at 22 +/-1 ℃, carefully taking out the seedling from the culture medium by using forceps after 3-5 true leaves grow out, removing the culture medium on the seedling as clean as possible, transplanting the seedling into nutrient soil and vermiculite (1:1), and covering the seedling with a plastic film for moisture preservation for about 1 week.

5. And (3) culturing agrobacterium: activating agrobacterium liquid on a resistant plate, selecting a single colony, inoculating the single colony in 5mL of LB liquid culture medium added with corresponding antibiotics, and carrying out shaking culture at the temperature of 28 ℃ and the rpm of 200 until the OD600 value is in the range of 0.8-1.0. Centrifuging at 5000rpm, removing supernatant, resuspending thallus with 1/2MS solution containing 3% sucrose, adding 0.05% Silwet L-77 into the thallus, mixing, and making Agrobacterium suspension OD₆₀₀About 0.8.

6. Inflorescence infection: and (4) putting the agrobacterium tumefaciens suspension obtained in the step (5) into a glass culture dish with the caliber of about 9cm for infection. The Arabidopsis plants with inflorescences were inverted and the inflorescences were fully infiltrated in the Agrobacterium resuspension for about 15 s. The infected plants were placed in the dark for 24h, at which time the soil was kept moist, and the infection was repeated once a week for a total of 3 times.

7. Screening of resistant seeds: t is₁After the surface of the seeds is disinfected and uniformly germinated, the seeds are sown on a 1/2MS solid culture medium containing 12.5mg/L PPT to screen positive plants, the positive plants are transplanted into soil to continue growing, and the seeds are harvested individually to obtain T₂And (5) seed generation. Then T is added₂After the generation seeds are disinfected, sowing the seeds on a 1/2MS solid culture medium containing 12.5mg/L PPT to continuously screen positive plants, counting the separation ratio, and obtaining a strain with positive plants and non-positive plants in a ratio of 3:1 on the screening culture medium, namely a single-copy inserted strain, and performing propagation to obtain T₃And (5) seed generation. Will T₃The seeds are sterilized and sowed on a 1/2MS solid culture medium containing 12.5mg/L PPT, the plant line in which all the seeds can normally grow is a single-copy insertion homozygous plant, the seeds are preserved and marked as T₃The IbATL38 transgenic Arabidopsis thaliana was simulated.

8. Identification and regeneration of transgenic plants:

T₃identification of Arabidopsis thaliana transgenic for IbATL38 Gene was carried out by combining GUS staining and PCR detection.

1) GUS staining

T₃After the Arabidopsis thaliana with the IbATL38 gene is subjected to GUS staining, the plant tissue turns blue, namely the GUS detection positive, the plant tissue can be preliminarily identified as a transgenic positive plant, and the GUS positive T can be further detected₃IbATL38 Arabidopsis positive plants are transferred for PCR detection.

2) PCR detection

Extraction of GUS Positive T₃The DNA of the leaf genome of the positive plant of the Arabidopsis thaliana and the wild Arabidopsis thaliana is transferred by IbATL38, PCR detection is carried out on IbATL38-F and IbATL38-R by using primers, and meanwhile, the plasmid DNA of the vector pCB-IbATL38 is used as a positive control, and the DNA of the wild Arabidopsis thaliana and the water are used as negative controls.

The primer sequence is as follows:

IbATL38-F：ATGATTTCTTCCGAGACGAATTTG

IbATL38-R：TCAGATGTTTGATGGGCTCTCG

and (3) carrying out electrophoretic separation on the PCR product obtained by amplification in 1% (w/v) agarose gel, wherein the PCR positive plant should have a specific 675bp electrophoretic band, and recording the line number of the PCR positive plant.

The results are shown in FIG. 1, and show that only positive control and GUS-positive T are present₃The positive L1-L10 of the transgenic IbATL38 Arabidopsis has an electrophoretic band near 675bp, and the wild Arabidopsis and the negative control have no band, further confirming that the transgenic Arabidopsis plant L1-L10 is obtained by the invention.

The strain which is positive in GUS detection and PCR detection is determined to be an IbATL38 gene-transferred Arabidopsis strain which is T₃Transforming IbATL38 gene Arabidopsis thaliana strain, and transforming T₃Seeds of an IbATL38 gene transgenic Arabidopsis line were preserved.

3)qRT-PCR

Will T₃The IbATL38 gene Arabidopsis thaliana strain is transferred to extract RNA, and cDNA is obtained by reverse transcription, qRT-PCR is carried out, and untransformed wild type is used as a control.

The Atactin gene is internal reference:

Atactin-F:GCACCCTGTTCTTCTTACCGA

Atactin-R:AGTAAGGTCACGTCCAGCAAGG

the sequence of the IbATL38 primer is as follows:

IbATL38-RT-F：TAGGCTCTCATCAACGCCAC

IbATL38-RT-R：TGTTTGATGGGCTCTCGGTT

the results are shown in FIG. 2, which indicates that IbATL38 is expressed to varying degrees in transgenic Arabidopsis plants. Seeds of transgenic Arabidopsis plants L1, L4 and L9 which over-express IbATL38 are selected for subsequent experiments.

Thirdly, identifying stress resistance of transgenic arabidopsis plants overexpressing IbATL38

1. Transgenic arabidopsis seed salt tolerance and ABA stress identification

(1) Identification of transgenic arabidopsis seed salt tolerance

Seeds of transgenic Arabidopsis plants L1, L4 and L9 which overexpress IbATL38 and seeds of wild type Arabidopsis (WT) are sterilized and then dibbled in a 1/2MS culture medium containing 50mM NaCl to obtain transgenic Arabidopsis strains L1, L4 and L9 and wild type Arabidopsis, the transgenic Arabidopsis plants are placed in a greenhouse at 22 ℃, and the germination conditions (white exposure is taken as a standard) are counted every day from the next day.

The same experiment was performed by replacing 1/2MS medium containing 50mM NaCl with 1/2MS medium containing 100mM NaCl.

The same experiment was performed by replacing 1/2MS medium containing 50mM NaCl with normal 1/2MS medium as a control.

As shown in FIG. 3, there was no significant difference in germination between IbATL38 transgenic Arabidopsis lines L1, L4, L9 and wild type Arabidopsis (WT) on normal 1/2MS medium. On a 1/2MS culture medium containing 50mM or 100mM NaCl, the germination rate of the wild type arabidopsis is lower, and the germination is slower; the germination rates of IbATL38 transgenic Arabidopsis strains L1, L4 and L9 are better than those of wild Arabidopsis in different degrees, and the over-expression IbATL38 transgenic Arabidopsis strains are mainly embodied in that the germination is fast and the final germination rate is high.

The results of the salt tolerance experiment preliminarily show that the overexpression of the IbATL38 gene improves the salt tolerance of the Arabidopsis seeds.

(2) Transgenic arabidopsis seed ABA stress identification

Seeds of transgenic Arabidopsis plants L1, L4 and L9 which overexpress IbATL38 and seeds of wild type Arabidopsis (WT) are respectively sown in a 1/2MS culture medium containing 0.2 MuM ABA after being sterilized to obtain transgenic Arabidopsis strains L1, L4 and L9 and the wild type Arabidopsis, the transgenic Arabidopsis plants and the wild type Arabidopsis are placed in a greenhouse at 22 ℃, and the germination conditions (with white exposure as the standard) are counted every day from the next day.

The same experiment was performed by replacing 1/2MS medium containing 0.2. mu.M ABA with normal 1/2MS medium as a control.

As shown in FIG. 3, there was no significant difference in germination between IbATL38 transgenic Arabidopsis lines L1, L4, L9 and wild type Arabidopsis (WT) on normal 1/2MS medium. On a 1/2MS culture medium containing ABA, the germination rate of wild arabidopsis is low, and the germination is slow; the germination rates of the transgenic Arabidopsis strains L1, L4 and L9 which over-express IbATL38 are better than those of wild Arabidopsis in different degrees, and are mainly embodied in that the germination is fast and the final germination rate is high.

ABA stress experiment results preliminarily show that the abscisic acid tolerance of the Arabidopsis seeds is improved by overexpression of the IbATL38 gene.

2. Transgenic arabidopsis salt tolerance and ABA stress in-vitro identification

(1) Transgenic arabidopsis salt tolerance in vitro identification

Seeds of transgenic Arabidopsis plants L1, L4 and L9 which overexpress IbATL38 and seeds of wild type Arabidopsis (WT) are sterilized and then dibbled in a 1/2MS culture medium to obtain transgenic Arabidopsis strains L1, L4, L9 and wild type Arabidopsis, after cotyledons are completely expanded, each strain (3 strains) selects transgenic Arabidopsis plants and wild type plants with consistent growth vigor to be respectively cultured on the 1/2MS culture medium containing 0, 50mM and 100mM NaCl, the growth condition of the plants is observed after 10 days, and the root length of the plants is measured.

As shown in A and B in FIG. 4, there was no significant difference in the growth state and rooting condition between the IbATL38 transgenic Arabidopsis lines L1, L4, L9 and wild type Arabidopsis (WT) after 10 days of growth in normal 1/2MS medium. After 10 days of growth in 1/2MS medium containing 50mM or 100mM NaCl, the wild type Arabidopsis thaliana grew less well and had a shorter root system; the growth state and rooting condition of the transgenic Arabidopsis lines L1, L4 and L9 which overexpress IbATL38 are better than those of wild Arabidopsis in different degrees.

The in vitro identification result preliminarily shows that the salt tolerance of an arabidopsis plant is improved by the overexpression of the IbATL38 gene.

(2) Transgenic arabidopsis ABA stress in-vitro identification

Seeds of IbATL38 transgenic Arabidopsis plants L1, L4 and L9 and wild type Arabidopsis (WT) seeds are sterilized and then dibbled in a 1/2MS culture medium to obtain IbATL38 transgenic Arabidopsis strains L1, L4, L9 and wild type Arabidopsis, after cotyledons are completely expanded, 3 transgenic Arabidopsis plants and wild type Arabidopsis plants with consistent growth vigor are selected from each strain and respectively transferred to a 1/2MS culture medium containing 1 mu M ABA after the cotyledons are completely expanded, the growth condition of the plants is observed after 10 days, and the root length of the plants is measured.

As shown in A and B in FIG. 4, there was no significant difference in the growth state and rooting condition between the IbATL38 transgenic Arabidopsis lines L1, L4, L9 and wild type Arabidopsis (WT) after 10 days of growth in normal 1/2MS medium. After 10 days of growth in a 1/2MS culture medium containing ABA, the wild Arabidopsis has poor growth vigor and short root system; the growth state and rooting condition of the transgenic Arabidopsis lines L1, L4 and L9 which overexpress IbATL38 are better than those of wild Arabidopsis in different degrees.

The in vitro identification result preliminarily shows that the ABA stress tolerance of an Arabidopsis plant is improved by the overexpression of the IbATL38 gene.

3. Transgenic plant salt tolerance potted plant identification

Seeds of transgenic Arabidopsis plants L1, L4 and L9 which overexpress IbATL38 and seeds of wild type Arabidopsis (WT) are sterilized and then dibbled in a 1/2MS culture medium, after 7 days of normal growth, transgenic Arabidopsis strains L1, L4 and L9 and the wild type Arabidopsis are obtained and transplanted to a nutrition pot with the length of 8 cm.

Control, i.e. no stress treatment: transplanting the seedlings to a nutrition pot of 8cm, growing for 4 weeks under normal conditions, and observing the growth condition of the plants;

b salt stress group, i.e. salt stress treatment: transplanting to a nutrition pot with the diameter of 8cm, growing for 1 week under normal conditions, irrigating for 1 time every 2 days by using 1/2 Hoagland nutrient solution containing 200mM NaCl, treating for 2 weeks, and observing the growth condition of plants;

the results are shown in A and B in FIG. 5, and it can be seen that all plants in the control group had substantially the same growth vigor; the salt stress group is irrigated with 1/2 Hoagland nutrient solution containing 200mM NaCl every 2 days for 1 time, after 2 weeks of treatment, the leaves of the wild type Arabidopsis thaliana plant almost completely die off, and the green parts of the leaves of the transgenic Arabidopsis thaliana strains L1, L4 and L9 which overexpress IbATL38 are more. The survival rate of each strain is counted, and the result shows that the survival rate of the transgenic strain is obviously higher than that of the control.

The pot experiment result shows that the IbATL38 gene is overexpressed, and the resistance of an arabidopsis plant to high-salt stress can be obviously improved.

4. Detection of active oxygen content of transgenic plant

Reactive Oxygen Species (ROS) are the products of the one-electron reduction of a type of oxygen in the body, with electrons leaking out of the respiratory chain and consuming approximately 2% of the oxygen before failing to transfer to the terminal oxidaseFormed, including the superoxide anion (O) as a product of the reduction of an electron of oxygen₂ ^-) Hydrogen peroxide (H) as a product of two-electron reduction₂O₂) The three-electron reduction product hydroxyl free radical (-OH), nitric oxide and the like. The active oxygen can directly or indirectly oxidize intracellular biomacromolecules such as nucleic acid, protein and the like, and damage cell membranes, thereby accelerating the aging and disintegration of cells. Therefore, the higher the content of active oxygen, the greater the degree to which the plant suffers stress injury.

(1) Diaminobenzidine method (DAB dyeing method)

Peroxidase in the cell particles can release oxygen in hydrogen peroxide, oxidize Diaminobenzidine (DAB), form golden yellow precipitates and locate at the active site of the peroxidase, and accordingly the activity of the peroxidase in the cells is detected.

The method comprises the following specific steps: 5-day Arabidopsis seedlings were treated with 200mM NaCl for 3 hours, stained with 1mg/ml DAB at 28 ℃ for 6 hours, chlorophyll was removed with 80% ethanol, and the color of the leaves was observed and recorded.

Arabidopsis seedlings were seedlings overexpressing IbATL38 transgenic Arabidopsis lines L1, L4 and L9 and wild-type Arabidopsis (WT) seedlings.

(2)H₂DCFDA

When in a non-fluorescent state H₂When the DCFDA is combined with the ROS, the DCFDA is converted into DCF with high fluorescence, and the DCF emits green fluorescence under 488nm exciting light, so that the ROS content is detected.

The method comprises the following specific steps: 5 days of seedlings were treated with 200mM NaCl solution for 3 hours and the seedlings were treated with 10. mu.M H₂DCFDA staining, and observing the fluorescence condition of the root of the seedling under a fluorescence microscope.

The results are shown in fig. 6, and indicate that ROS content of plants overexpressing IbATL38 transgenic arabidopsis strain L1, L4, and L9 is significantly lower than that of wild type arabidopsis plants.

The results show that the IbATL38 gene is overexpressed to improve the stress resistance of arabidopsis thaliana.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> university of agriculture in China

<120> a method for regulating and controlling plant stress resistance

<130>GNCFY200081

<160>2

<170>PatentIn version 3.5

<210>1

<211>224

<212>PRT

<213> sweet potato (Ipomoea batatas)

<400>1

Met Ile Ser Ser Glu Thr Asn Leu Val Met Thr Val Ile Gly Phe Ala

1 5 10 15

Val Ser Thr Met Phe Ile Val Phe Val Cys Thr Arg Leu Ile Cys Ala

20 25 30

Arg Ile Gln Leu Ser Ser Thr Arg Arg Ser Leu Ala Arg Ala Ser Gly

35 40 45

Ser Asp Leu Ser Ile Leu Glu Arg Gly Leu His Gly Leu Glu Pro Leu

50 55 60

Ala Val Ser Lys Phe Pro Thr Lys Lys Tyr Ser Asp Val Phe Phe Thr

65 70 75 80

Ser Ala Glu Asp Thr Gln Cys Thr Val Cys Leu Ala Asp Tyr Gln Gln

85 90 95

Glu Asp Ser Leu Arg Ile Leu Pro Phe Cys Gly His Tyr Phe His Ala

100 105 110

Thr Cys Ile Asp Val Trp Leu Gln Gln HisSer Thr Cys Pro Val Cys

115 120 125

Arg Ile Ser Leu Arg Glu Val Thr Glu Lys Lys Arg Phe Met Pro Pro

130 135 140

Leu Phe Ser Ser Ala Val Arg Cys His His Ala Met Ala Ser Met Asn

145 150 155 160

Val Asn Pro His Gln Cys Ile Arg Ser Trp Asn Arg Leu Ser Ser Thr

165 170 175

Pro His Asp Arg Ser Gly Ser Asn Ile Thr Ser Ser Asp Asn Arg Thr

180 185 190

Val Ala Ala Ala Glu Cys Asp Ser Val Ser Ile Gln Ala Thr Thr Thr

195 200 205

Val Ala Lys Gly Ser Thr Asn Lys Gln Thr Glu Ser Pro Ser Asn Ile

210 215 220

<210>2

<211>675

<212>DNA

<213> sweet potato (Ipomoea batatas)

<400>2

atgatttctt ccgagacgaa tttggtgatg acagtgattg ggtttgcagt gagtaccatg 60

ttcattgtct ttgtctgcac aaggctaatc tgtgcaagaa ttcaattgag ctccacaagg 120

aggtctctgg ccagggcttc tggatctgac cttagcattt tagaacgcgg gttacacggt 180

cttgaacctc ttgctgtgag caaattcccg actaagaagt atagtgatgt gtttttcacc 240

tcggcagaag acactcaatg cacagtatgt ctcgctgatt accagcaaga agattcgttg 300

cgcatcctac cattctgcgg gcattatttt cacgcgacgt gcattgacgt gtggctgcag 360

cagcactcca cttgtccagt ctgtcgaatt tccctgcgag aggtcaccga gaaaaagcgg 420

tttatgccac cgctgttcag ctcagctgtc cggtgtcacc atgcgatggc atccatgaac 480

gttaatcccc accagtgcat tcgttcctgg aataggctct catcaacgcc acacgacaga 540

tcagggtcga acatcacctc atcagacaat agaacagtag ctgctgcaga gtgcgattct 600

gtctcgattc aagctactac tacagtggct aaaggctcaa cgaataaaca aaccgagagc 660

ccatcaaaca tctga 675

Claims

1. A method for cultivating a transgenic plant with high stress resistance, which is characterized in that: the method comprises the steps of improving the expression quantity of genes of the following proteins in a target plant and/or the content of the proteins and/or the activity of the proteins to obtain a transgenic plant; the stress resistance of the transgenic plant is higher than that of the target plant;

the protein is any one of A1) or A2) or A3) as follows:

A1) protein with amino acid sequence shown as SEQ ID NO. 1;

A3) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1, has more than 90 percent of identity with the protein shown in A1), and has the same function.

2. The method of claim 1, wherein: the method for improving the expression amount of the gene of the protein and/or the content of the protein and/or the activity of the protein in the target plant is to express or over express the protein in the target plant.

3. The method of claim 2, wherein: the expression or overexpression method is to introduce the gene coding for the protein into a target plant.

4. The method of claim 2, wherein: the nucleotide sequence of the coding gene of the protein is a DNA molecule shown in SEQ ID NO. 2.

5. The protein of claim 1.

6. A protein-related biomaterial according to claim 5, characterized in that: the related biomaterial is any one of the following C1) -C10):

C1) a nucleic acid molecule encoding the protein of claim 5;

C2) an expression cassette comprising the nucleic acid molecule of C1);

C10) protoplasts produced by the tissue culture of C9).

7. The related biological material according to claim 6, wherein: the C1) nucleic acid molecule encoding the protein of claim 5 is any one of the following D1) or D2) or D3):

D1) DNA molecule shown in SEQ ID NO. 2;

D2) the coding sequence is DNA molecule shown in SEQ ID NO. 2;

D3) a DNA molecule which hybridizes under stringent conditions with a DNA molecule defined in D1) or D2) and which encodes a protein as claimed in claim 5.

8. Use of the protein of claim 5 or the related biomaterial of claim 6 or 7 in any one of:

B1) improving the salt tolerance of the plants;

B2) preparing a product for improving the salt tolerance of plants;

B3) improving the tolerance of the plant to ABA;

B4) preparing a product for improving the tolerance of plants to ABA;

B9) increasing root length of a plant under salt and/or ABA stress conditions;

9. Use of a protein according to claim 5 or a related biological material according to claim 6 or 7 in plant breeding.

10. The use according to claim 4 or 5, or the method according to any one of claims 6 to 9, wherein: the plant is any one of E1) -E7) as follows:

E1) a dicotyledonous plant;

E2) a monocot plant;

E3) a cruciferous plant;

E4) arabidopsis thaliana;

E5) a plant of the family Convolvulaceae;

E6) a plant of the genus Ipomoea;

E7) sweet potato.