KR20130054545A - Steip gene enhancing resistance to bacterial wilt and use thereof - Google Patents

Abstract

PURPOSE: A transgenic plant which is prepared by transforming with a bacterial wilt resistant gene is provided to grow a variety with bacterial wilt resistance and to remarkably improve productivity of plants, especially solanaceae plants. CONSTITUTION: A method for improving bacterial wilt resistance in a plant comprises a step of increasing intracellular level of a polypeptide with an amino acid sequence of sequence number 2. The method also comprises a step of overexpressing the polypeptide. A gene encoding the polypeptide has a base sequence of sequence number 1. A method for producing a plant with resistance to bacterial wilt comprises a step of transforming a recombinant expression vector containing a gene encoding the polypeptide into a plant.

Description

Steep gene enhancing resistance to Bacterial wilt and use approximately

The present invention relates to a foot blight resistance improvement gene and a use thereof, and more particularly, a method for improving foot blight resistance of a plant, particularly an eggplant, by regulating intracellular levels of a polypeptide having a specific amino acid sequence. To a plant and its seed.

Foot blight is a disease caused by the Ralstonia solanacearum pathogen, which causes severe damage to major branches and crops such as tomatoes, peppers, eggplants, and tobacco. In addition, almost all horticultural crops such as fruits, vegetables, leafy vegetables, etc. can act as potential hazards, so the risk of damage is very high. In particular, the frequency of occurrence is gradually increasing according to the recent trend of agriculture, where serial cultivation and year-round cultivation of the same crops are prevalent, and the damage situation is known one after another in hydroponic fields as well as inland cultivation. Unlike other plant diseases, the biggest anxiety factor of cultivated farmers against this green blight is that once it occurs, it develops rapidly and spreads throughout the plantation, and the whole crop abandonment kills almost all crops. There is no way.

In order to control the foot blight (bacterial wilt), cultivation techniques such as crop rotation, liver and blending, seedling methods such as hygienic cleanliness of cultivation and packaging, and breeding resistant varieties are applied. In addition, there are no registered drugs in Korea, but in the foreign countries, but if the soil disinfection with chloropicrine, PCNB, etc., there is a control effect, the drugs have a risk of causing side effects in animals, the use is being stir.

On the other hand, the development of plant transformation technology enables the expression of foreign genes that are far from flexible, and by introducing specific genes into susceptible plants, it becomes possible to develop crops that are resistant to disease or pathogens. Therefore, the isolation and development of genes that withstand various disasters and pathogens are indispensable for the development of such crops.

Accordingly, the problem to be solved by the present invention is a method of improving resistance of plants, especially eggplant plants, using Bacterial wilt resistance genes, a method of producing plants with improved foot blight resistance using such genes, and The present invention provides a transgenic plant having improved foot blight resistance.

In order to achieve the above object, the present invention provides a method for increasing the plant's foot blight resistance by increasing the intracellular level of the StEIP polypeptide represented by SEQ ID NO: 2.

In order to achieve another object of the present invention, the present invention comprises the steps of (a) preparing an expression vector overexpressing the StEIP polypeptide represented by SEQ ID NO: 2; And (b) transforming the plant with the expression vector of step (a).

In order to achieve the other object of the present invention, the present invention provides a plant produced by the above production method.

In order to achieve another object of the present invention, the present invention provides a plant seed (seed) obtained from the plant.

That is, the present invention provides a method for improving plant resistance to foot blight by increasing the intracellular level of the polypeptide having the amino acid sequence represented by SEQ ID NO: 2, more preferably the polypeptide having the amino acid sequence represented by SEQ ID NO: 2 It provides a method to improve the plant's foot blight resistance by overexpressing.

The present invention also provides a method for producing foot blight resistant plant, characterized in that the plant is transformed into a recombinant expression vector in which a gene encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 2 is linked to a promoter.

The present invention also provides a recombinant expression vector linking a gene encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 2 to a promoter, and transformants with improved foot blight resistance by transforming with the recombinant expression vector, and their seeds. to provide.

Polypeptides having the amino acid sequence represented by SEQ ID NO: 2 (hereinafter also referred to as StEIP polypeptides) include functional equivalents thereof. The term "functional equivalent" is at least 70%, preferably 80% or more, more preferably 90% or more, and still more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 2 as a result of the addition, substitution, or deletion of the amino acid. Preferably, it refers to a polypeptide having a sequence homology of 95% or more and exhibiting substantially homogeneous physiological activity with a polypeptide having an amino acid sequence represented by SEQ ID NO: 2. "Substantially homogeneous physiological activity" means activity that promotes foot blight resistance in plants. Substitution of the amino acid is preferably a conservative substitution. Examples of conservative substitutions of amino acids present in the wild type are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in portions not directly involved in the physiological activity of the StEIP polypeptide. The functional equivalents also include polypeptide derivatives in which some chemical structures of the polypeptide have been modified while maintaining the basic backbone of the StEIP polypeptide and its physiological activity. For example, fusion polypeptides made by fusion with other polypeptides, such as GFP, while maintaining structural alterations and physiological activities to alter the stability, storage, volatility or solubility of the polypeptides of the present invention. In addition, polypeptides having a bioactivity substantially equivalent to that of a wild-type StEIP polypeptide as a fragment of the polypeptide having the amino acid sequence represented by SEQ ID NO: 2 form another preferred group of functional equivalents of the wild-type StEIP polypeptide. The "fragment" refers to an amino acid sequence corresponding to a part of a polypeptide, which has a common element of origin, structure, and mechanism of action within the scope of the present invention, which is present in the wild type, is cleaved using a protease, or chemically. All cuts are included.

The base sequence of the gene encoding the StEIP polypeptide may include all gDNA, cDNA and RNA. The base sequence includes both base sequences encoding wild type polypeptides and functional equivalents thereof and sequences that hybridize with these sequences under high stringent conditions. High-tension conditions are as described in known literature (Molecular Cloning, Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press, 1989). Preferably, StEIP according to the invention Genes encoding polypeptides may include the nucleotide sequence represented by SEQ ID NO: 1 and sequence variants thereof. Specifically, the sequence variant is a base having at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with the base sequence represented by SEQ ID NO: 1 Sequences may be included.

As used herein, the term “homology” is intended to indicate a degree of similarity between the amino acid sequence of a wild type polypeptide or a nucleotide sequence encoding the same, and the amino acid sequence or the nucleotide sequence of the present invention and the percentage or more as described above. Include sequences with identical sequences. This homology comparison can be performed by using a comparison program that is easy to see with the naked eye. Commercially available computer programs can calculate the percent homology between two or more sequences, and the percent homology can be calculated for adjacent sequences.

The "intracellular level" refers to the amount present in a cell, which can be controlled by various methods known to those skilled in the art. For example, intracellular levels can be regulated through, but not limited to, regulation at the transcriptional stage or at the post-transcriptional stage. Modulation at the transcriptional stage is a method for enhancing the expression of a gene known to those skilled in the art, for example, a method for enhancing the expression of the gene by preparing a recombinant expression vector linking a target gene or a variant thereof to a promoter or the target gene. Or a method of inserting an expression control sequence such that the expression of the gene is enhanced around the variant thereof. Modulation at the post-transcriptional stage is a method for enhancing polypeptide expression known to those skilled in the art, for example, to enhance the stability of mRNA transcribed into a gene of interest or a variant thereof, to enhance the stability of the polypeptide of interest, or It can be carried out by a method for enhancing the activity of the polypeptide.

Preferably, in the present invention, the increase in the intracellular level of the polypeptide of SEQ ID NO: 2 or a functional equivalent thereof may be performed by a method of increasing the expression of the gene encoding the polypeptide. For this increase, a method known to those skilled in the art can be used. For example, a recombinant expression vector is prepared by linking a gene having a amino acid sequence represented by SEQ ID NO: 2 to a promoter or a gene encoding a functional equivalent thereof. By transformation, expression can be enhanced.

As used herein, the term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a polypeptide encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in the wild-type form of the cell in either the sense or antisense form. Recombinant cells can also express genes found in wild-type cells, but the genes are modified and reintroduced into cells by artificial means. The term "vector" in the present invention is used when referring to DNA fragment (s), nucleic acid molecules that are delivered into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. As used herein, the term “recombinant expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable base sequence necessary for expressing the coding sequence operably linked in a particular host organism. In addition, it may further comprise any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. The recombinant vector is preferably a recombinant plant expression vector. A preferred example of a plant expression vector is a Ti-plasmid vector that is capable of transferring a so-called T-region into a plant cell when it is present in a suitable host such as Agrobacterium tumefaciens. Another type of Ti-plasmid vector (see EP 116,718 B1) is currently used to transfer hybrid DNA sequences to protoplasts from which plant cells or new plants can be produced which properly insert hybrid DNA into the genome of the plant. Preferred forms of Ti-plasmid vectors are so-called binary vectors. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly. Suitable recombinant expression vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control sequences such as promoters, operators, initiation codons, termination codons, polyadenylation signals, and enhancers (promoter), and are prepared as desired. Can be. The recombinant expression vector also includes a selection marker for selecting a host cell containing the vector and, in the case of a replicable recombinant expression vector, a replication origin. The selection marker is a nucleotide sequence having properties that can be selected by a conventional chemical method, which corresponds to all genes that can distinguish the transformed cells from non-transformed cells. For example, there are herbicide resistance genes such as glyphosate or phosphinotricin, antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol It is not limited to this.

In the recombinant expression vector according to the present invention, the promoter may be, for example, but not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter. As used herein, the term "promoter" refers to a genome that regulates the expression of a nucleic acid sequence operably linked in a given host cell, in which one nucleic acid fragment is operably linked to another. Refers to a nucleic acid fragment that is affected by its function or expression by another nucleic acid fragment. In addition, it may further comprise any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. A "plant promoter" is a promoter capable of initiating transcription in plant cells. The promoter may be a promoter (constitutive promoter) to induce the expression of the target gene at all times at all times or an inducible promoter (inducible promoter) to induce the expression of the target gene at a specific position, time, and conditions, Examples include RD29A promoter, SV40 promoter, CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108: 193-199, 1991; Monahan et al., Gene Therapy, 7: 24-30, 2000), CaMV 35S promoter (Odell et al., Nature 313: 810-812, 1985), Rsyn7 promoter (US patent application Ser. No. 08 / 991,601), rice actin promoter (McElroy et al., Plant Cell, 2: 163-171 , 1990), ubiquitin promoters (Christensen et al., Plant Mol. Biol. 12: 619-632, 1989), ALS promoters (US Patent Application No. 08 / 409,297), and the like. In addition, U.S. Patent Nos. 5,608,149; The promoters disclosed in 5,608,144 5,604,121 5,569,597 5,466,785, 5,399,680 5,268,463, 5,608,142, and the like can all be used. Preferably, foot blight pathogen inducible promoters can be used. The terminator may use a conventional terminator, for example nopalin synthase (NOS), potato α-amylase RAmy1 A terminator, phaseoline terminator, agrobacterium tumefaciens (ocrobacteriumtumefaciens) Octopine) terminators, etc., but is not limited thereto. Terminator regions are known to increase the certainty and efficiency of transcription in plant cells.

Preferably, the recombinant expression vector provided by the present invention is operably linked to a gene encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 2 or a gene having a nucleotide sequence represented by SEQ ID NO: 1 downstream of a promoter. , More preferably, a gene having a nucleotide sequence represented by SEQ ID NO: 1, or preferably the promoter is a CaMV 35S promoter.

The present invention provides a transformant having improved foot blight resistance transformed with the recombinant expression vector.

Transformation in the present invention can be carried out by a variety of transformation techniques known to those skilled in the art. Preferably microprojectile bombardment, particle gun bombardment, silicon carbide whiskers, sonication, electroporation, PEG-mediated fusion (PEG) mediated fusion, microinjection, liposome-mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method), Agrobacteria spraying method (Agrobacteria spraying method) can be used.

In addition, the transformant may be a plant or a plant cell, but is not limited thereto. Plants include whole plants, parts of plants, callus, plant tissues, plant cells and plant seeds. The plant is preferably an eggplant, and may be, for example, a plant such as potato, tomato, pepper, soybean, eggplant, tobacco or the like. In one embodiment of the present invention, the recombinant expression vector was transformed into Agrobacterium tumefaciens, and inoculated to potato to prepare a transformant.

The present inventors prepared a recombinant expression vector comprising the StEIP gene having the nucleotide sequence represented by SEQ ID NO: 1 and transformed it into potatoes to increase the intracellular expression level of StEIP. As a result of examining the characteristics of the overexpressing transformant of StEIP, it was confirmed that overexpression of StEIP improved foot blight resistance.

In addition, the present invention provides a plant seed (seed) obtained from the plant, as a cultivation method for obtaining plant seeds can be used a method well known to those skilled in the art.

Plants transformed with foot blight resistant genes according to the present invention can be grown as foot blight resistant varieties, thereby significantly improving the productivity of plants, eggplants and the like.

1 is a result showing the expression level of the StEIP gene, a gene induced when the pathogen and salicylic acid (SA) treatment.
Figure 2 is a schematic diagram of a recombinant expression vector overexpressing the StEIP gene according to an embodiment of the present invention.
Figure 3 is an overexpression assay northern blot results of the assay of the potato transformant according to an embodiment of the present invention.
4 is a result of verification of foot blight resistance of the transformant according to the present invention.

Hereinafter, preferred examples and comparative examples are presented to aid in understanding the present invention. However, the following examples are only for illustrating the present invention, and the present invention is not limited thereto.

Example 1 Selection of Genes Induced by Pathogens and Salicylic Acid (SA) Treatment

Potatoes, which were passed two weeks after passage in MS medium, were further incubated for two weeks in the nutrient solution to be used for inoculation. After spraying 2mM salicylic acid (SA), samples were taken after 1, 3, 6, 12, 24 and 48 hours, stored at -80 ° C, and RNA was isolated. The pathogen, Ralstonia solanacearum (Rs), was incubated in CPG agar medium for 2-3 days and then diluted to 10 to 0.5 mM OD ₆₀₀ in 10 mM MgCl ₂ . After this, the roots were cut by 5 cm, immersed, and then sampled after 1, 3, 6, 12, 24, and 48 hours, and stored at -80 ° C to separate RNA. The primer sequences used are as follows.

StTUB-Forward; 5'-ATATCTCTAACA GTGCCAGAGCTTACTCA-3 '

StTUB-Reverse; 5'-TCTGCAACCGGGTCATTCAT-3 '

StEIP-Forward; 5'-ATGGTTTCTTTTTCGAGTCTGAC-3 '

StEIP-reverse; 5'-CTATAACCATGGAGTACTTATGAAACAC-3 '

RT-PCR conditions were 1 μg of Total RNA; oligod T 100 pmol; 10 μl of ddH ₂ O was mixed, heated at 70 ° C. for 10 minutes, and cooled on ice, 4 μl of 5 × first strand buffer; 1 μl 0.1 M DTT; And 2 μl of dNTP (2.5mM) were mixed and reacted at 42 ° C. for 2 minutes, and 1 μl (5 units) of Superscript II was added and reacted at 37 ° C. for 1 hour. Thereafter, the enzyme was inactivated at 70 ° C. for 10 minutes, 1 μl of RNaseH was added thereto, the reaction was performed at 37 ° C. for 20 minutes, and then inactivated at 70 ° C. for 10 minutes. 5 μl of solution, 20 pmol of StTUB-forward primer, 20 pmol of StTUB-reverse primer and 20 pmol of StEIP-forward, 20 pmol of StEIP-reverse, respectively, 0.5 μl of Taq polymerase, 2 μl of 10x PCR buffer, and ddH ₂ O up to 20 ㎖ mixed 95 ℃ 2 minutes predenaturing, 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 1 minutes after 25 cycles of PCR was confirmed by electrophoresis on 1% agarose gel. The expression analysis of the StEIP gene obtained through the experiment is shown in FIG.

Example 2 Preparation of StEIP Overexpression Transformation Vector

A primary PCR was performed using the sequences StEIP- F 5'-AAAAAGCAGGCTTCATGGTTTCTTTTTCGAGTC-3 'and StEIP-R 5'-AGAAAGC TGGGTTCTATAACCATGGAGTACTTATG-3' at both ends of the StEIP gene for insertion into the vector and attB1 and attB2 adaptor primers ( Secondary PCR was performed using 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3 'and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3'). The amplified PCR product was inserted into a pB7WG2D vector containing a 35S promoter using BP clonase (Invitrogen) and LR clonase (Invitrigen) using a GATEWAY system to prepare a pB7WG2D / StEIP vector. A schematic diagram of the vector prepared in Example 2 is shown in FIG. 2.

Example 3 Preparation of Agrobacterium and Potato Transformants

The prepared pB7WG2D / StEIP vector was introduced into Agrobacterium tumefaciens LBA4404 and then transformed into potatoes (variety: Sumi). Agrobacterium tumefaciens LBA4404 containing pB7WG2D / StEIP containing pB7WG2D / StEIP cultured in YEP broth containing 50 ppm of Spectinomycin was cultured for 1 day after pre-cultivation of stems except for the meristem of S. aeruginosa, which was cultured in MS medium for 4 weeks. After the infection was raised to ₆₀₀ = 2.0 for 30 minutes, the water was removed, and cultured in PreM medium for 4 days, the bacteria grown on the stem were removed with distilled water containing cefotaxim. After incubation for 3 weeks in the callus induction medium to induce callus, the induced callus was cut and transferred to callus induction medium containing new phosphinothricin and incubated for 2 weeks, then transferred to shoot induction medium containing phosphinothricin and incubated for 10 weeks. . The induced shoots were transferred to root-inducing medium containing phosphinothricin and cultured for 4 weeks to induce roots.

Example 4 Potato Transformant Overexpression Assay

In order to confirm that the transformants were genomic DNA was isolated and confirmed the insertion of the bar gene and StEIP gene by PCR. The primer base sequence used is as follows, StEIP-reverse primer has the same sequence as the sequence described above.

Bar-forward: CCGTACCGAGCGCAGGAACC

Bar-reverse: GGCAGCCCGATGACAGCGACCAC

pBIN35S-S: 5'-CTCCACTGACGTAAGGGATG-3 '

In addition, in order to confirm that the transformant, the total RNA of the potato transformant was isolated and the overexpression of the StEIP gene was confirmed using northern hybridization. Gene overexpression assay results of potato transformants are shown in FIG. 3, respectively.

Example 5 Foot Blight Resistance Evaluation

Foot blight resistance of the overexpressing transformants was evaluated as follows. The StEIP overexpressing transformant prepared above was seeded in a pot containing horticultural soil and grown in a greenhouse for 3 weeks. Inoculate rifampicin resistant green blight bacteria (Rs KACC10722) to potato leaves at the concentration of OD ₆₀₀ = 0.03, and sample the samples with cork borer (10mm) after 3 days and 4 days, and then dilute them sequentially to obtain rifampicin. The number of pathogens generated after incubation in NBP agar medium was counted. The results are shown in Fig. As shown in Figure 4, unlike the control group after the pathogen inoculation, it was found that in the StEIP gene overexpressing transgenic potatoes did not increase foot blight pathogens.

<110> Rural development administration <120> StEIP gene enhancing resistance to Bacterial wilt and use <130> P11-219 (2011-0199-10-A) <160> 2 <170> Kopatentin 1.71 <210> 1 <211> 1065 <212> DNA <213> StEIP <400> 1 atggtttctt tttcgagtct gactattatc ttattatgcc ttgtttggct ttcatctccg 60 gctgaagctt ccttcagttg cacctccgcc ggaacttgtg acgccattat tgactatacc 120 ttacccaacg ccactacctt taatgccgtc aagaaactct tcaacgtaaa gaacctccgt 180 tcccttctag gcgtcaacaa tctccctgtc aatacccctg ctgatcacaa attacccgcc 240 aatcaaacca tcaaaatccc ctttccttgt ctctgtagaa acggtaccgg aatagccaac 300 aaacgcccca tttacaccgt cgtctccggc gacttcctat cccacatagt taccgacatc 360 ttcgctggtt tattcactgt tcaggaactt cagacggtta acaatatatc taaccccaat 420 ttgatacaac ccggggataa attgtggatc ccacttcctt gcagctgcga cgacgttgac 480 ggtgaaaagg ttgttcatta tggtcgattg gtgagcagtg gcaacagcat tgaggctatt 540 gctcagcagt acaatgtctc ccaggaaacc cttttgaggt tgaatggttt agcaagtcct 600 agagaacttt tagctggcgc tgttcttgac gttcccctta aagcttgcca atcaacggtg 660 agcaatgcct cactggacta tcctttgcta gtgccaaatg acacatatgt cttcactgct 720 gccaattgtg taacgtgcaa gtgtgatgct gcgagcaact ggacgttgca atgccaacca 780 tcccagataa agtcatctct ttggaagaca tgcccgtcaa tgcagtgcca aggtttagat 840 aacttgtaca ttgggaatgt gaccacgtct tcagagtgta attccacatc ttgtgcttat 900 gctggttaca gcaaccagac catttttacc acaagcactc agttaacttg ccctgcttct 960 gacaatagcg ctttgggaat gaggccaggg acatggggat ggagatggaa tgtcatcctg 1020 gttgctgcta tctctatgtg tttcataagt actccatggt tatag 1065 <210> 2 <211> 354 <212> PRT <213> StEIP <400> 2 Met Val Ser Phe Ser Ser Leu Thr Ile Ile Leu Leu Cys Leu Val Trp   1 5 10 15 Leu Ser Ser Pro Ala Glu Ala Ser Phe Ser Cys Thr Ser Ala Gly Thr              20 25 30 Cys Asp Ala Ile Ile Asp Tyr Thr Leu Pro Asn Ala Thr Thr Phe Asn          35 40 45 Ala Val Lys Lys Leu Phe Asn Val Lys Asn Leu Arg Ser Leu Leu Gly      50 55 60 Val Asn Asn Leu Pro Val Asn Thr Pro Ala Asp His Lys Leu Pro Ala  65 70 75 80 Asn Gln Thr Ile Lys Ile Pro Phe Pro Cys Leu Cys Arg Asn Gly Thr                  85 90 95 Gly Ile Ala Asn Lys Arg Pro Ile Tyr Thr Val Val Ser Gly Asp Phe             100 105 110 Leu Ser His Ile Val Thr Asp Ile Phe Ala Gly Leu Phe Thr Val Gln         115 120 125 Glu Leu Gln Thr Val Asn Asn Ile Ser Asn Pro Asn Leu Ile Gln Pro     130 135 140 Gly Asp Lys Leu Trp Ile Pro Leu Pro Cys Ser Cys Asp Asp Val Asp 145 150 155 160 Gly Glu Lys Val Val His Tyr Gly Arg Leu Val Ser Ser Gly Asn Ser                 165 170 175 Ile Glu Ala Ile Ala Gln Gln Tyr Asn Val Ser Gln Glu Thr Leu Leu             180 185 190 Arg Leu Asn Gly Leu Ala Ser Pro Arg Glu Leu Leu Ala Gly Ala Val         195 200 205 Leu Asp Val Pro Leu Lys Ala Cys Gln Ser Thr Val Ser Asn Ala Ser     210 215 220 Leu Asp Tyr Pro Leu Leu Val Pro Asn Asp Thr Tyr Val Phe Thr Ala 225 230 235 240 Ala Asn Cys Val Thr Cys Lys Cys Asp Ala Ala Ser Asn Trp Thr Leu                 245 250 255 Gln Cys Gln Pro Ser Gln Ile Lys Ser Ser Leu Trp Lys Thr Cys Pro             260 265 270 Ser Met Gln Cys Gln Gly Leu Asp Asn Leu Tyr Ile Gly Asn Val Thr         275 280 285 Thr Ser Ser Glu Cys Asn Ser Thr Ser Cys Ala Tyr Ala Gly Tyr Ser     290 295 300 Asn Gln Thr Ile Phe Thr Thr Ser Thr Gln Leu Thr Cys Pro Ala Ser 305 310 315 320 Asp Asn Ser Ala Leu Gly Met Arg Pro Gly Thr Trp Gly Trp Arg Trp                 325 330 335 Asn Val Ile Leu Val Ala Ala Ile Ser Met Cys Phe Ile Ser Thr Pro             340 345 350 Trp Leu        

Claims (10)

A method of improving plant resistance to foot blight by increasing the intracellular level of a polypeptide having an amino acid sequence represented by SEQ ID NO: 2. The method of claim 1, wherein the plant has an overexpression of the polypeptide having the amino acid sequence represented by SEQ ID NO: 2, thereby improving plant resistance to foot blight. The method of claim 2, wherein the method of overexpressing the polypeptide is by producing a recombinant expression vector linking a gene encoding the polypeptide to a promoter and transforming the plant, or by introducing a gene encoding the polypeptide into a plant cell. How is characterized by the thing. The method of claim 1, wherein the gene encoding the polypeptide has a nucleotide sequence represented by SEQ ID NO: 1. The method of claim 1 wherein the plant is potato, tomato, pepper, soybean, eggplant or tobacco. 6. The method of claim 5 wherein the plant is a potato. A plant for producing foot blight resistant plants, characterized by transforming a plant into a recombinant expression vector in which a promoter is linked to a gene encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 2. A recombinant expression vector linking a gene encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 2 to a promoter. A transformant having improved foot blight resistance by transforming with the recombinant expression vector of claim 8. A plant seed obtained from the transformant of claim 9.

Images