KR20220113587A - A cosmetic composition and pharmaceutical composition comprising carnitine, arginine, creatine, and vitamin C as active ingredients - Google Patents

Abstract

The present invention relates to a cosmetic composition comprising carnitine, arginine, creatine, and vitamin C as active ingredients. The cosmetic composition and pharmaceutical composition of one aspect can exhibit an anti-aging effect or an anti-wrinkle effect by promoting collagen biosynthesis and suppressing the production of collagen degrading enzyme, while having low skin irritation and excellent skin stability. In addition, since cosmetic composition has an effect of restoring damaged cells and can regenerate the skin by promoting skin cell regeneration, the skin barrier can be effectively improved.

Description

{A cosmetic composition and pharmaceutical composition comprising carnitine, arginine, creatine, and vitamin C as active ingredients}

It relates to a cosmetic composition containing carnitine, arginine, creatine, and vitamin C as active ingredients, a composition for external application to the skin, and a pharmaceutical composition.

Metabolic processes are affected by reactive oxygen species, sugars, and highly reactive compounds such as aldehydes. These factors result in cumulative changes in the structure, function, and appearance of the skin. Human skin aging is largely divided into internal aging that occurs over time according to biological processes and external aging caused by environments such as continuous light exposure, stress, and smoking. Clinically, intrinsically aged skin is thin, dry, pale, loses elasticity and has many fine wrinkles, whereas in the case of skin aging due to external environment, deep wrinkles, pigmentation of spots and rough skin are observed. will have a big impact Although chronologically aged skin and photo-aged skin are morphologically and histologically different, their appearance is clearly distinguished. They are reported to share important molecular features, including signaling pathways, such as damage to connective tissue. In addition, environmental influences such as UV irradiation are believed to accelerate important aspects of intrinsic aging.

The most representative skin wrinkle-improving substances are retinol and its derivatives called retinoids, which are known to show good effects in various fields such as psoriasis, aging, cancer, and acne. In addition, this retinoid is known to prevent and restore endogenous and photoaging by inhibiting collagenase (MMP-1) when applied to the skin to prevent loss of collagen and stimulate collagen formation. However, despite these effects, it is known to cause local skin irritation reactions such as erythema, itchiness, and psoriasis when applied to the skin.

Therefore, the development of a wrinkle-improving cosmetic containing a material that is safe for the body and has better inhibition of collagen degrading enzyme (MMP-1) and collagen synthesis than existing materials and less skin irritation with anti-aging effect is required. .

One aspect provides a cosmetic composition comprising carnitine, arginine, creatine, and vitamin C as an active ingredient.

Another aspect provides a composition for external application to the skin comprising carnitine, arginine, creatine, and vitamin C as active ingredients.

Another aspect provides a pharmaceutical composition for treating skin damage comprising carnitine, arginine, creatine, and vitamin C as active ingredients.

One aspect provides a cosmetic composition comprising carnitine, arginine, creatine, and vitamin C as an active ingredient.

Carnitine (L-Carnitine) contained in the cosmetic composition is an enzyme that plays a necessary role in transferring fatty acids to the mitochondria in the metabolic process of animals. It plays a role in helping the breakdown of fat, and it also plays a role in excreting toxic substances out of the cell.

Arginine (L-Arginine) contained in the cosmetic composition exists as one of the amino acids constituting the protein, and belongs to the protein protamine present in sperm of fish. It has a protective action against the toxic effects of ammonia and large amounts of amino acids.

Creatine included in the cosmetic composition is an amino acid-like substance and is an organic acid having a guanidine group instead of an amino group. Most of the creatine is stored in skeletal muscle, the rest is distributed in the blood, brain and other tissues. More than 95% of human creatine is stored in skeletal muscle, and creatine can be stored as creatine phosphate in a phosphorylated state by ATP, and creatine phosphate has a high-energy bond like ATP. The stored creatine phosphate is broken down when the muscle needs energy to transfer the phosphate group to ADP, and plays a major role in generating ATP.

Vitamin C included in the cosmetic composition is also called L-ascorbic acid (Asc). Vitamin C is one of the vitamins found in almost all fruits and vegetables. Vitamin C is a powerful reducing agent, has antioxidant action, and is known as a coenzyme for collagen synthetase and various enzymes involved in the energy metabolism of living things.

When the present inventors include carnitine, arginine, creatine, and vitamin C as an active ingredient, specifically, in the case of a cosmetic composition comprising a specific ratio, collagen biosynthesis is promoted and collagen degrading enzyme is produced by inhibiting the skin It was confirmed that it can exhibit anti-aging or anti-wrinkle effects. In addition, it has the effect of restoring damaged cells, so that the skin can be regenerated by promoting skin cell regeneration, it was confirmed in specific experimental examples in the specification that the skin barrier can be effectively improved.

The cosmetic composition contains carnitine, arginine, creatine, and vitamin C, for example, 0.5 to 4: 0.5 to 4: 0.5 to 4: 1 concentration (w/v) ratio, 1.5 to 4: 1.5 to 4: 1.5 to 4 : 1 concentration (w/v) ratio, 2 to 4: 2 to 4: 2 to 4 : 1 concentration (w/v) ratio, 2.5 to 3.5: 2.5 to 3.5: 2.5 to 3.5: 1 concentration (w/v) ) ratio, 1:1:1:1, 3:1:1:1, 1:3:1:1 or 1:1:3:1 concentration (w/v) ratio.

The active ingredient included in the composition according to one aspect may be included in, for example, 0.001 to 30% by weight, 0.01 to 10% by weight, or 0.1 to 10% by weight, 0.1 to 5% by weight based on the total weight of the composition. When the content of the active ingredient carnitine, arginine, creatine, and vitamin C in the composition is less than 0.001% by weight, it is difficult to achieve skin aging prevention or anti-wrinkle effect, and when it exceeds 30% by weight, formulation is difficult and the feeling of use this may be lowered.

The cosmetic composition according to an aspect may be for skin wrinkle improvement, skin regeneration, skin aging improvement, skin elasticity improvement, skin tone improvement, or skin barrier improvement. In addition, the aging includes internal aging that appears over time according to biological processes and external aging caused by the environment such as continuous light exposure, stress, smoking, etc. . In addition, the cosmetic composition significantly lowers the expression level of MMP-1, a collagen degrading enzyme, by UV and heat irradiation, can increase the synthesis of collagen precursors, inhibit photoaging caused by heat or UV rays, and improve the skin barrier. It can be used for skin moisturizing and soothing purposes.

The cosmetic composition according to one aspect can effectively improve the skin barrier by promoting collagen production, inhibiting the production of matrix metalloproteinase (MMP), a collagen degrading enzyme, and/or promoting skin cell regeneration.

The cosmetic composition is a lotion (skin lotion), skin softener, skin toner, astringent, hand cream, foundation, essence, nourishing essence, pack, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, suspension, gel , powder, paste, mask pack, patch, mousse, spray, or sheet or aerosol composition. The composition of such a formulation can be prepared according to a method conventional in the art. The blending amount of the additional ingredients such as the moisturizing agent can be easily selected by those skilled in the art within the range that does not impair the purpose and effect of the present invention, and the blending amount is 0.001 to 5% by weight, specifically 0.01 to 3% by weight, based on the total weight of the composition % by weight.

The cosmetic composition may further include functional additives and components included in general cosmetic compositions in addition to the active ingredients disclosed herein, and commonly used purified water, thickener, preservative, stabilizer, solubilizer, surfactant, carrier or It may further include a combination thereof. The cosmetic composition may further include, for example, purified water, a thickener, a preservative, a stabilizer, a solubilizer, a surfactant, a carrier, or a combination thereof. In addition, the functional additive may include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, sphingolipids and seaweed extract. Other ingredients included include oils and fats, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, UV absorbers, preservatives, fungicides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, blood circulation accelerators, cooling agents, limiting agents, purified water, and the like.

A person skilled in the art can select any additional ingredients and/or amounts thereof such that the advantageous properties of the composition according to the present disclosure are not adversely or substantially not adversely affected by the expected addition. The blending amount of the additional component can be easily selected by those skilled in the art within a range that does not impair the purpose and effect of the present invention, and the blending amount is from about 0.001 to about 30% by weight, specifically from about 0.01 to about, based on the total weight of the composition. 25% by weight.

In addition, in the cosmetic composition of each formulation, appropriate ingredients may be selected and formulated according to the formulation or purpose of use of the cosmetic. Since the compounding component and method may follow conventional techniques, a detailed description thereof will be omitted herein.

Another aspect provides a composition for external application to the skin comprising carnitine, arginine, creatine, and vitamin C as active ingredients.

The composition for external application for skin contains carnitine, arginine, creatine, and vitamin C, for example, 0.5 to 4: 0.5 to 4: 0.5 to 4: 1 concentration (w/v) ratio, 1.5 to 4: 1.5 to 4: 1.5 to 4 : 1 concentration (w/v) ratio, 2 to 4 : 2 to 4: 2 to 4 : 1 concentration (w/v) ratio, 2.5 to 3.5: 2.5 to 3.5: 2.5 to 3.5 : 1 concentration (w) /v) ratio, 1:1:1:1, 3:1:1:1, 1:3:1:1 or 1:1:3:1 concentration (w/v) ratio.

The active ingredient included in the composition for external application for skin according to an aspect may be included in, for example, 0.001 to 30% by weight, 0.01 to 10% by weight, or 0.1 to 10% by weight, or 0.1 to 5% by weight based on the total weight of the composition. .

The external preparation for skin may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof. The external preparation for skin is a component usually used in external preparations for skin such as cosmetics or pharmaceuticals, for example, an aqueous component, an oily component, a powder component, alcohol, a moisturizer, a thickener, an ultraviolet absorber, a whitening agent, a preservative, an antioxidant, a surfactant, a fragrance , colorant, various skin nutrients, or a combination thereof may be appropriately formulated as needed. The external preparation for skin includes metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belapamil, licorice extract, glablidine, and kaline. Fruit hot water extracts, various herbal medicines, drugs such as tocopherol acetate, glitylic acid, tranexamic acid and its derivatives or salts thereof, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can be mix|blended suitably.

Another aspect provides a pharmaceutical composition for treating skin damage comprising carnitine, arginine, creatine, and vitamin C as active ingredients.

The pharmaceutical composition contains carnitine, arginine, creatine, and vitamin C, for example, 0.5 to 4: 0.5 to 4: 0.5 to 4: 1 concentration (w/v) ratio, 1.5 to 4: 1.5 to 4: 1.5 to Concentration (w/v) ratio of 4: 1, 2 to 4: 2 to 4: 2 to 4: 1 concentration (w/v) ratio, 2.5 to 3.5: 2.5 to 3.5: 2.5 to 3.5: 1 concentration (w/v) v) ratio, 1:1:1:1, 3:1:1:1, 1:3:1:1 or 1:1:3:1 concentration (w/v) ratio.

The active ingredient included in the pharmaceutical composition according to an aspect may be included in, for example, 0.001 to 30% by weight, 0.01 to 10% by weight, or 0.1 to 10% by weight, 0.1 to 5% by weight based on the total weight of the composition.

The term "treatment or amelioration" refers to or includes the alleviation, progression inhibition or prevention of a disease, disorder, condition or condition, or one or more symptoms thereof, and "active ingredient" or "pharmaceutically effective amount" refers to the disease, disorder, may mean any amount of a composition employed in the practice of the invention provided herein sufficient to alleviate, inhibit the progression or prevent the condition or condition, or one or more symptoms thereof. The effective amount (or dosage) may be 0.0001 mg to 10,000 mg, 0.001 mg to 1000 mg, 1.0 mg to 100 mg, 0.01 mg to 1000 mg, 0.01 mg to 100 mg, 0.01 mg to 10 mg, or 0.01 mg to 1 mg.

The skin includes all skin parts of the body including the face, hands, arms, legs, feet, chest, belly, back, buttocks, and scalp.

The skin damage is external physical damage (skin trauma), penetration of chemicals, bacteria, fungi, viruses, etc., exposure to UV rays, moisture loss of the skin, wrinkles due to aging, oxidation by free radicals (active oxygen), etc., Damage from a clinical and cosmetic point of view of skin tissue or cells, including skin pigmentation, skin inflammation, seborrheic dermatitis, redness (redness, erythema), edema, lichenification, eczema, pruritus (itchiness), and atopic dermatitis. may include

In addition to the active ingredients disclosed herein, the pharmaceutical composition may further contain pharmaceutical adjuvants such as preservatives, stabilizers, wetting agents or emulsification accelerators, salts and/or buffers for osmotic pressure control, and other therapeutically useful substances. , it can be formulated in various oral or parenteral dosage forms according to a conventional method.

In addition, the composition may be a quasi-drug composition for skin wrinkle improvement, skin regeneration, skin aging improvement, skin elasticity improvement, skin tone improvement, or skin barrier improvement.

The term "quasi-drug" refers to textiles, rubber products or the like, which are used for the purpose of treating, alleviating, treating or preventing diseases of humans or animals, have weak action on the human body or do not directly act on the human body, and are not devices or machines. Articles corresponding to those used for sterilization, insecticidal and similar purposes for the prevention of infection and used for the purpose of diagnosing, treating, alleviating, treating or preventing a human or animal condition or disease It refers to items that are not heavy instruments, machines, or devices, and items used for the purpose of pharmacologically affecting the structure and function of humans or animals, excluding those that are not instruments, machines, or devices. may include

The cosmetic composition and pharmaceutical composition of one aspect have less skin irritation and excellent skin stability, promote collagen biosynthesis, and inhibit the production of collagen degrading enzymes, thereby exhibiting anti-aging or anti-wrinkle effects. In addition, it has the effect of restoring damaged cells, and thus it is possible to regenerate the skin by promoting the regeneration of skin cells, thereby effectively improving the skin barrier.

1 is a diagram showing the results of confirming the collagen production promoting efficacy of Comparative Examples 1 to 4 containing each single component and Examples 1 to 4 compositions containing carnitine, arginine, creatine, and vitamin C.
2 is a view showing the results of confirming whether the compositions of Comparative Examples 1 to 4 including each single component and Examples 1 to 4 including carnitine, arginine, creatine, and vitamin C inhibit MMP-1.
3 is a view showing the results of confirming the cell regeneration ability of Examples 2 to 4 compositions containing carnitine, arginine, creatine, and vitamin C.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes of the present invention, and the scope of the present invention is not limited to these examples.

Preparation Example 1. Preparation of carnitine, arginine, creatine, and vitamin C complex

L-carnitine, L-arginine, creatine, and vitamin C as single components used in the following experimental examples were purchased from Sigma Aldrich, and the purchased raw material was dissolved in distilled water at a concentration of 10 ppm as a dissolving agent to obtain a single composition group. Comparative Example 1 (L-carnitine), Comparative Example 2 (L-arginine), Comparative Example 3 (creatine) and Comparative Example 4 (vitamin C) were respectively, and in the case of a complex, the composition of Table 1 below according to the ratio in units of 10 ppm The compositions of Examples 1 to 4 were prepared and used in the following experiments.

Ingredient name L-Carnitine L-Arginine creatine vitamin C Comparative Example 1 10ppm Comparative Example 2 10ppm Comparative Example 3 10ppm Comparative Example 4 10ppm Example 1 (1:1:1+C) 10ppm 10ppm 10ppm 10ppm Example 2 (3:1:1+C) 30 ppm 10ppm 10pm 10ppm Example 3 (1:3:1+C) 10ppm 30pm 10ppm 10ppm Example 4
(1:1:3+C) 10ppm 10pm 30ppm 10ppm

Experimental Example 1. Measurement of collagen production promoting effect of carnitine, arginine, creatine, and vitamin C complex

Carnitine, arginine, creatine, and an experiment to confirm the effect of promoting collagen production in human primary fibroblasts, which are human fibroblasts, by ratio of single and complex compounds of carnitine, arginine, and vitamin C was performed.

Specifically, human primary fibroblasts were tested under the following conditions. First, fibroblasts were aliquoted at 4x10 ⁵ in a 6-well plate, and then cultured for 24 hours at 37° C., in an incubator under 5% CO ₂ conditions. After removing the medium and adding DPBS, the remaining cell group except for the UVB non-irradiated group was irradiated with UVB of 20mJ/cm ² and then exchanged with a medium containing the compositions of Comparative Examples 1 to 4 and Examples 1 to 4 of Preparation Example 1 Then, it was further cultured for 24 hours. After culture, the medium from each well was collected, the precipitate was removed using a centrifuge, and the supernatant was obtained and the amount of procollagen type I secreted in the medium was measured with a Procollagen type I ELISA kit (TaKaRa). was confirmed and shown in FIG. 1 .

As shown in FIG. 1 , the group treated with the compositions of Examples 1 to 4 confirmed a significant increase in secretion of Procollagen type I compared to Comparative Examples 1 to 4 treated with a single component. In addition, it was confirmed that the group treated with the compositions of Examples 1 to 4 increased the secretion amount of Procollagen type I by about 10% compared to the group treated with Comparative Example 4 or the control group. In particular, in the compositions of Examples 2 to 4 containing the carnitine, arginine, creatine, and vitamin C complex in concentration ratios of 3:1:1:1, 1:3:1:1, and 1:1:3:1, respectively, As compared to the UVB-irradiated group, the collagen secretion increased about 2 times compared to the significantly reduced group, and it was confirmed that the group mixed in the optimal ratio exhibited the highest collagen production promoting effect.

Therefore, it was confirmed that carnitine, arginine, creatine, and vitamin C complex could promote collagen synthesis, and in particular, it was confirmed that there was a remarkable effect in improving wrinkles caused by skin photoaging caused by UV irradiation.

Experimental Example 2. Measurement of the collagenase inhibitory effect of carnitine, arginine, creatine, and vitamin C complex

In order to measure the collagen-degrading enzyme inhibitory effect of carnitine, arginine, creatine, and vitamin C complex, Comparative Examples 1 to 4 and Examples 1 to 4 compositions prepared in Preparation Example 1 were used in the experiment.

Specifically, human primary fibroblasts were tested under the following conditions. First, fibroblasts were aliquoted at 4x10 ⁵ in a 6-well plate, and then cultured for 24 hours at 37° C., in an incubator under 5% CO ₂ conditions. After removing the medium and adding DPBS, 20mJ/cm ² of UVB was irradiated to the remaining cell groups except for the UVB non-irradiated group, and then carnitine, arginine, creatine, vitamin C single (Comparative Examples 1 to 4) and complex Examples 1 to 4 was added in proportions and further cultured for 24 hours. After that, RNA was isolated from the cells of each sample using trizol (RNA iso, DAKARA, Japan), and RNA was quantified at 260 nm with a nanodrop, and then 2 μg of RNA was used in the amplifier. cDNA was synthesized (C1000 Thermal Cycler, Bio-Rad, USA). Real-time polymerase chain reaction was carried out in a real-time PCR machine using a mixture in which the target protein MMP-1 primer and the cyanine dye cyvergreen (SYBR Green supermis, Applied Biosystems, USA) were added to the synthesized cDNA. Finally, the expression level of the MMP-1 gene was confirmed. The result of final analysis of the expression level of the gene through correction for the β-actin gene is shown in FIG. 2 . In addition, the primer sequences used in this experiment are shown in Table 2.

primer sequence (5'-3') MMP-1 (forward) CGAATTTGCCGACAGAGATGA (SEQ ID NO: 1)
(reverse) GTCCCTGAACAGCCCAGTACTT (SEQ ID NO: 2) β-actin (forward) GGCCATCTCTTGCTCGAAGT (SEQ ID NO: 3)
(reverse) GACACCTTCAACACCCCAGC (SEQ ID NO: 4)

As shown in FIG. 2 , the expression level of MMP-1, an enzyme that decomposes collagen, increased in the UVB irradiation group, whereas in the group treated with carnitine, arginine, creatine, and the vitamin C complex Examples 1 to 4, MMP-1 The gene expression level was significantly decreased. In particular, in Example 4 composition containing carnitine, arginine, creatine, and vitamin C complex in a ratio of 1:1:3:1 among the composition examples, a significant inhibition of MMP-1 expression compared to a single component was confirmed.

Therefore, it can be seen that the complex containing carnitine, arginine, creatine, and vitamin C in a specific ratio significantly reduces the expression of MMP-1, which accelerates wrinkle formation by decomposing collagen, thereby exhibiting wrinkle improvement and anti-aging effects. can

Experimental Example 3: Evaluation of cell regeneration promoting ability of carnitine, arginine, creatine, and vitamin C complex

Carnitine, arginine, creatine, and an experiment was conducted using the same cells as in Experimental Example 1 to evaluate the cell regeneration promoting effect of the compositions of Examples 2 to 4, which are complexes of carnitine, arginine, creatine, and vitamin C.

Specifically, fibroblasts were dispensed in a 96-well plate at a concentration of 2x10 ⁴ cells/well, and then cultured for 24 hours in an incubator at 37° C. and 5% CO ₂ condition to create a 100% confluent state. gave. After that, using a pipette tip, a wound was randomly scraped across the center of the well, and the medium was replaced with a medium containing no test substance and a medium containing carnitine, arginine, creatine, and vitamin C complex. 24 Incubated for additional hours. Carnitine, arginine, creatine, and in the case of not containing the carnitine, creatine, and vitamin C complex after 24 hours, an experiment was performed to determine how much the wound was randomly made to the cells, and the degree of wound recovery was relatively quantified, It was graphed and shown in FIG. 3 .

As confirmed in FIG. 3 , it was confirmed that cell regeneration was further promoted in the case of treatment with the compositions of Examples 2 to 4 compared to the case where the carnitine, arginine, creatine, and vitamin C complex were not treated. In particular, the most remarkable cell regeneration efficacy was confirmed in the Example 4 composition containing carnitine, arginine, creatine, and vitamin C in a concentration ratio of 1:1:3:1 compared to the control group.

Formulation Example 1: Preparation of toner formulation

Toner formulations containing carnitine, arginine, creatine, and vitamin C complex (Examples 1 to 4 compositions) obtained in Preparation Example 1 were prepared in a conventional manner according to the composition components and composition ratios shown in Table 3 below.

ingredient content (% by weight) Carnitine, Arginine, Creatine, and Vitamin C Complex 1.0 glycerin 3.0 butylene glycol 2.0 Polyoxyethylene (60) hydrogenated castor oil 0.5 Polysorbate 80 0.5 ethanol 10.0 antiseptic a very small amount Spices a very small amount Purified water remaining amount

Formulation Example 2: Preparation of lotion formulation

A lotion formulation containing the carnitine, arginine, creatine, and vitamin C complex (Examples 1 to 4 compositions) obtained in Preparation Example 1 was prepared in a conventional manner according to the components and composition ratios shown in Table 4 below.

ingredient content (% by weight) Carnitine, Arginine, Creatine, and Vitamin C Complex 1.0 glycerin 7.0 butylene glycol 3.0 Glyceryl Stearate / PEG-100 Stearate 1.0 Polysorbate 60 0.5 Sorbitan sesquioleate 0.5 squalane 3.0 Caprylic/Capric Triglycerides 5.0 shea butter 2.0 stearyl alcohol 0.5 stearic acid 0.5 carboxyl vinyl polymer 0.2 arginine 0.2 antiseptic a very small amount Spices a very small amount Purified water remaining amount

Formulation Example 3: Preparation of cream

A cream containing the carnitine, arginine, creatine, and vitamin C complex (Examples 1 to 4 compositions) obtained in Preparation Example 1 was prepared in a conventional manner according to the composition components and composition ratios shown in Table 5 below.

ingredient content (% by weight) Carnitine, Arginine, Creatine, and Vitamin C Complex 1.0 glycerin 7.0 Butylene Glycol 5.0 Glyceryl Stearate / PEG-100 Stearate 2.0 Polysorbate 60 0.5 Sorbitan Stearate 0.5 Phytosqualane 5.0 jojoba oil 3.0 Caprylic/Capric Triglycerides 10.0 aloe butter 3.0 beeswax 1.0 stearyl alcohol 0.5 behenyl alcohol 0.5 stearic acid 0.5 carboxyl vinyl polymer 0.2 arginine 0.3 dimethicone 0.5 antiseptic a very small amount Spices a very small amount Purified water remaining amount

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Cosmax, Inc. <120> A cosmetic composition and pharmaceutical composition comprising carnitine, arginine, creatine, and vitamin C as active ingredients <130> PN128339 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward sequence of MMP-1 primer <400> 1 cgaatttgcc gacagagatg a 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse sequence of MMP-1 primer <400> 2 gtccctgaac agcccagtac tt 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward sequence of beta-actin primer <400> 3 ggccatctct tgctcgaagt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse sequence of beta-actin primer <400> 4 gacaccttca acaccccagc 20

Claims (10)

Carnitine (Carnitine), arginine (arginine), creatine (creatine), and a cosmetic composition comprising vitamin C (Vitamin C) as an active ingredient. The cosmetic composition of claim 1, wherein the composition contains carnitine, arginine, creatine, and vitamin C in a concentration (w/v) ratio of 0.5 to 4: 0.5 to 4: 0.5 to 4: 1. The cosmetic composition according to claim 1, wherein the active ingredient is included in an amount of 0.001 to 30% by weight based on the total weight of the composition. The cosmetic composition according to claim 1, wherein the composition is for improving skin wrinkles, regenerating skin, improving skin aging, improving skin elasticity, improving skin tone, or improving skin barrier. The cosmetic composition according to claim 4, wherein the aging is aging by ultraviolet rays or heat. The cosmetic composition of claim 1, wherein the composition exhibits at least one activity selected from the group consisting of inhibiting the expression of matrix metalloproteinase (MMP), promoting collagen production, and promoting cell regeneration. The method according to claim 1, wherein lotion, skin, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, moisture cream, hand cream, foundation, essence, nourishing essence, pack, soap , cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, suspension, gel, powder, paste, mask pack, and a cosmetic composition of one or more formulations selected from the group consisting of sheets. The cosmetic composition of claim 1, wherein the composition further comprises purified water, a thickener, a preservative, a stabilizer, a solubilizer, a surfactant, a carrier, or a combination thereof. A composition for external application to the skin comprising carnitine, arginine, creatine, and vitamin C as active ingredients. A pharmaceutical composition for preventing or treating skin damage comprising carnitine, arginine, creatine, and vitamin C as active ingredients.

Images