KR20220036436A - Cosmetic composition for anti-irritation due to the particulate matter and improving skin conditions - Google Patents

Abstract

The present invention relates to: a composition comprising an enzyme hydrolyzate of a subcritical water extract obtained by extracting a mixture of Artemisia princeps, Prunella vulgaris, Cetraria islandica, and Xanthium sibiricum; and a use thereof for improving skin conditions. The composition according to an aspect can be usefully used for preventing, alleviating or treating skin-related conditions or inflammation-related conditions, for example, skin-related conditions or inflammation-related conditions caused by environmental harmful factors such as fine dust.

Description

A cosmetic composition for alleviating skin irritation and improving skin due to fine dust {Cosmetic composition for anti-irritation due to the particulate matter and improving skin conditions}

It relates to a composition comprising a mixed extract of natural substances and its use for improving skin condition.

Recently, air pollution such as particulate matter (PM) is causing various diseases including respiratory diseases. Fine dust is classified into fine dust PM10 with a diameter of 10 μm or less and ultrafine dust PM2.5 with a diameter of 2.5 μm or less according to particle size. Fine dust consists of sulfate, ammonium, nitrate, metal compounds, and carbon compounds, which are ions generated by combustion.

The skin plays a very important role as a barrier function to protect the individual from the outside. The barrier function is a protective function against various external stimuli such as chemicals, air pollutants, dry environment, and ultraviolet rays, and preventing excessive leakage of body moisture through the skin. This protective function can be maintained only when the stratum corneum (horney layer) composed of keratinocytes is normally formed. The skin is histologically composed of three layers: the epidermis, dermis, and subcutis. Since the epidermis is the most external, it plays the most important role in the aspect of skin aging, and thus is the subject of the most intensive research in terms of skin beauty. The components that make up the stratum corneum, the outermost layer of the epidermis, are keratinocytes and skin lipids. Skin lipids are responsible for the barrier function of the skin, and such a barrier function of the skin controls the cell division and differentiation of the keratin to protect the skin from external harmful substances, prevent the outflow of substances from the body, and prevent moisture evaporation of the skin. It can be said that

The skin is the outermost barrier in direct contact with fine dust. In the case of PM2.5, the particles are small and when they come into contact with the skin surface, they easily penetrate into the body through direct interaction with AhR (Aryl hydrocarbon receptor) molecules in the cells of keratinocytes. In addition, fine dust bound to AhR induces intracellular oxidative stress through signal transduction function.

Recently, as well-being trends are changing into a society where all fields are important, interest in cosmetics made from natural products is also increasing. Recently, attempts to increase the effect by stabilizing natural extracts or converting them into stable derivatives that reduce toxicity are increasing. For example, a bio-conversion method using an enzyme is being developed. By bioconversion, natural extracts are converted into low-molecular substances that are easily absorbed by human cells, or are converted from an unstable or inactive form to an active form and absorbed. Attempts to maximize the efficacy of natural extracts using microorganisms or enzymes or to solve safety problems have important meanings in the development of various foods, cosmetics, and the like.

The cosmetic industry is developing a number of products using natural products to reduce skin irritation caused by various chemicals. Natural ingredients have fewer side effects on the skin, and their development value as a cosmetic raw material is gradually increasing as consumers' response to cosmetics using natural ingredients increases.

Accordingly, there is still a need to develop a natural extract that can be usefully used for skin-related conditions.

KR 10-1829553 B1

The research results of this patent were carried out with the support of Gyeonggi-do (Research project name: development of functional cosmetics for wrinkle improvement through fine dust receptor control, project number: D181830).

One aspect provides a composition comprising an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Ayeop, Lamiaceae, Icelandic moss and Changija with subcritical water.

Another aspect provides a method for preparing an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Aeyeop, Lamiaceae, Icelandic moss and Changija with subcritical water.

Another aspect provides a method of preventing, ameliorating, or treating a condition in a subject comprising administering to the subject in need thereof an effective amount of the composition described above.

One aspect provides a composition comprising an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Ayeop, Lamiaceae, Icelandic moss and Changija with subcritical water.

The " Artemisia Princeps Leaf" is also referred to as "wormwood leaf". Ayeop is used to treat menstrual irregularities and gynecological diseases in oriental medicine, as it warms the blood and gyeongmaek (经脈). The pharmacological effects of Ayeop include hemostatic action, antibacterial action, bronchial smooth muscle relaxation action, antitussive action, sleep action, and anaphylactic shock protective action.

The "Lamiaceae ( Prunella vulgaris )" is a perennial herb of the family Lamiaceae (Labiatae) ( Prunella vulgaris var. lilacina ). The stem is 30-40 cm high and has hairs all over the body. The leaves are opposite, long oval, and serrated. Dark purple flowers bloom in the shape of ears in summer. It is a medicinal plant and is used as an herbal medicine, and the young leaves and young shoots are edible.

The "Icelandic moss ( Cetraria islandica )" is a type of moss and has been used as a laryngeal disorder, tuberculosis treatment and health promoter in various countries for centuries. The European Health Organization also approved it as a treatment for sore throat and respiratory disorders.

The above "Changja (蒼耳子, Xanthium Strumarium Fruit)" refers to the fruit of sagebrush. In oriental medicine, it is used for toothpaste, pyungsanje (平散劑), itching, scabies, and headache.

The composition may be a composition for improving skin conditions, improving skin beauty, preventing, improving or treating skin diseases, preventing, improving, or treating skin inflammatory diseases.

The composition may be for improving skin condition.

The skin condition may be skin damage or irritation due to skin inflammation, skin barrier, or environmental harmful factors. The skin inflammation may be an inflammation caused by an environmental harmful factor, but the cause is not limited.

The term, “anti-inflammatory” may be used interchangeably with “inhibiting or improving inflammation”, and may refer to any action in which an immune response is alleviated to suppress NO production.

The improvement of the skin condition may be improvement of skin inflammation, strengthening of the skin barrier, improvement or protection of skin damage caused by environmental harmful factors, or alleviation of skin irritation caused by environmental harmful factors.

The environmental harmful factor may mean an environmental material harmful to the skin. The environmental harmful factors may be fine dust, heavy metals, or a combination thereof. Heavy metals refer to metals having a specific gravity of 4 or more, such as mercury, cadmium, lead, and copper. When heavy metals are absorbed into the body, they combine with substances in the body to form an organic complex that is not easily decomposed. Fine dusts of hazardous heavy metals cause chemical reactions in the atmosphere, creating additional harmful substances such as nitrogen oxides (NO) and sulfur oxides (SO), which can cause skin irritation or skin troubles. Because of their small size, fine dust mixed with harmful substances such as heavy metals can easily penetrate deep into the skin pores and cause inflammation and troubles on the skin.

The "skin barrier strengthening" may refer to any action that enhances the function of the skin barrier that is located at the outermost part of the skin and prevents loss of moisture and nutrients.

The "skin disease" may be a disease caused by damage to the skin barrier function, skin aging, or skin inflammation. The term “prevention” includes inhibiting the development of a disease. The term “treatment” includes inhibiting, alleviating, or eliminating the development of a disease.

The damage to the skin barrier function may refer to any change that appears in the skin as the function of the skin barrier is reduced or damaged. For example, it may include increased skin wrinkles, dryness, dermatitis, atopic dermatitis, allergic dermatitis, acne, and the like.

The skin inflammatory disease may be any one selected from the group consisting of skin wounds, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, weak rash, and acne.

The composition may inhibit AhR (aryl hydrocarbon receptor) gene expression. The composition may have anti-pollution efficacy to inhibit AhR gene expression increased by environmental harmful factors such as fine dust. The composition may have an effect of alleviating skin irritation caused by environmental harmful factors. Accordingly, the composition can improve skin damage caused by environmental harmful factors and protect the skin.

The composition may inhibit TNF-α and/or TSLP gene expression.

The TNF-α is a representative cytokine mainly secreted from inflammatory cells or immune cells in response to external stimuli or infectious agents. TNF-α is a proinflammatory cytokine that plays a central role in mediating infection, inflammation, autoimmune, and allergic diseases together with interleukin-1 (IL-1). Chronic inflammatory diseases in the skin mediated by TNF-α include psoriasis, eczema, or seborrheic dermatitis, and acute inflammatory diseases include contact dermatitis (Mache E Descapms V, Ann. Dermatol. Venereol. 129(12):1374). -9, 2002) and others. In addition, atopic dermatitis is mentioned as a TNF-α-mediated allergic disease.

TSLP (thymic stromal lymphopoietin), also called the master switch of allergic inflammatory response, affects important cells that cause skin inflammation, such as mast cells, basophils, and eosinophils, and affects both innate and acquired immune responses. It induces a Th2 immune response, causing problems with the skin barrier function.

The composition may increase TGase-1 (Transglutaminase-1) gene expression. Therefore, the composition can enhance the skin barrier by increasing TGase-1 gene expression.

In one embodiment, the enzymatic hydrolyzate of the subcritical water extract obtained by extracting the Ayeop, Lamiaceae, Icelandic moss and Changija mixture with subcritical water is each extract of Aeyeop, Lamiaceae, Icelandic moss and Changija, a mixed extract prepared by a conventional extraction method. Compared to the mixed extract obtained by hydrolysis treatment without , and subcritical water extraction, it was confirmed that the skin condition improvement effect was excellent, such as suppressing skin inflammatory factors, strengthening the skin barrier, and alleviating skin inflammation, damage or irritation caused by fine dust.

The mixture of the leaf, Lamiaceae, Icelandic moss and Changija may be a mixture of each dried product.

The mixture is ayeop; flowers, leaves, stems and outposts of Lamiaceae; outpost of Icelandic moss; and a mixture of Changija.

The mixture is a leaf, Lamiaceae, Icelandic moss, and Changija in a weight ratio of 1 to 10:1 to 10:1 to 10:1 to 10, a weight ratio of 1 to 5:1 to 5:1 to 5:1 to 5, or 1 It may be mixed in a weight ratio of ~3:1~3:1~3:1~3. For example, the mixture may be mixed in a weight ratio of 1:1:1:1, 2:3:3:1, or 3:2:1:3 by weight ratio of aloe vera, Lamiaceae, Icelandic moss and Changija. can, but is not limited thereto.

The subcritical water extract is a subcritical water extract obtained by extracting a mixture of Ayeop, Lamiaceae, Icelandic moss and Changija with subcritical water.

The subcritical water extract may be extracted with subcritical water at 120 to 250° C. and 0.1 to 20 MPa.

The subcritical water temperature conditions are 120 to 250 ℃, 120 to 240 ℃, 120 to 230 ℃, 120 to 220 ℃, 120 to 210 ℃, 120 to 200 ℃, 150 to 250 ℃, 150 to 240 ℃, 150 to 230 ℃ , 150 to 220 °C, 150 to 210 °C, 150 to 200 °C, 180 to 250 °C, 180 to 240 °C, 180 to 230 °C, 180 to 220 °C, 180 to 210 °C, or 180 to 200 °C.

The subcritical pressure conditions are 0.1 to 20 MPa, 0.1 to 18 MPa, 0.1 to 16 MPa, 0.1 to 15 MPa, 1 to 20 MPa, 1 to 18 MPa, 1 to 16 MPa, 1 to 15 MPa, 5 to 20 MPa , 5 to 18 MPa, 5 to 16 MPa, 5 to 15 MPa, 10 to 20 MPa, 10 to 18 MPa, 10 to 16 MPa, or 10 to 15 MPa.

The extraction time in the subcritical water condition is 1 minute to 24 hours, 1 minute to 20 hours, 1 minute to 16 hours, 1 minute to 12 hours, 1 minute to 8 hours, 1 minute to 4 hours, 1 minute to 2 hours. , 1 minute to 1 hour, 5 minutes to 24 hours, 5 minutes to 20 hours, 5 minutes to 16 hours, 5 minutes to 12 hours, 5 minutes to 8 hours, 5 minutes to 4 hours, 5 minutes to 2 hours, 5 minutes to 1 hour, or 5 minutes to 30 minutes.

In one embodiment, the subcritical water extract may be extracted with subcritical water at about 200° C. and about 15 MPa for about 15 minutes.

The subcritical water extract may include an extract extracted with subcritical water, a diluted or concentrated solution of the extract, a dried product obtained by drying the extract, or these prepared or purified products, and a fraction obtained by fractionating the same.

The extraction solvent of the subcritical water extract is water, anhydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol, propanediol, butylene glycol, 1,2-hexanediol, caprylic / At least one solvent selected from the group consisting of capric triglyceride, dimethicone, mineral oil, cyclomethicone, octyldodecanol, cetylethylhexanoate, trirethylhexanoin, isopropyl myristate, and vegetable oil can be every day. The vegetable oil refers to an oil obtained by extracting seeds or flesh of a plant by a method such as pressing, for example, olive oil, sunflower seed oil, palm oil, avocado oil, etc. may be used.

The enzymatic hydrolyzate is an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Ayeop, Lamiaceae, Icelandic moss and Changija with subcritical water.

The enzymatic hydrolyzate may be obtained by enzymatically reacting the subcritical water extract with a hydrolytic enzyme.

The enzyme may be β-glucosidase.

The enzymatic reaction may be performed at an appropriate temperature depending on the type of enzyme. For example, the enzymatic reaction is 25 to 65 ℃, 25 to 60 ℃, 25 to 55 ℃, 30 to 65 ℃, 30 to 60 ℃, 30 to 55 ℃, 40 to 65 ℃, 40 to 60 ℃, 40 to It may be carried out at 55 °C, 45 to 65 °C, 45 to 60 °C, or 45 to 55 °C, but is not limited thereto.

The enzymatic reaction may be performed for an appropriate time so that the enzymatic reaction can be sufficiently performed. For example, the enzymatic reaction is 1 minute to 24 hours, 1 minute to 20 hours, 1 minute to 16 hours, 1 minute to 12 hours, 1 minute to 8 hours, 30 minutes to 24 hours, 30 minutes to 20 hours, 30 minutes to 16 hours, 30 minutes to 12 hours, 30 minutes to 8 hours, 1 hour to 24 hours, 1 hour to 20 hours, 1 hour to 16 hours, 1 hour to 12 hours, or 1 hour to 8 hours may be, but is not limited thereto.

The enzymatic hydrolyzate may include an enzyme hydrolyzate obtained by an enzymatic reaction, a diluted or concentrated solution of the enzyme hydrolyzate, a dried product obtained by drying the enzyme hydrolyzate, or these crude products or purified products, and a fraction obtained by fractionating the same. there is.

The enzymatic hydrolyzate may include oleanolic acid.

The composition comprises 0.0001 wt% to 80 wt%, for example, 0.01 wt% to 60 wt%, 0.01 wt% to 40 wt%, 0.01 wt% to 30 wt%, 0.01 wt% to 20 wt%, based on the total weight of the composition %, 0.01% to 10%, 0.01% to 5%, 0.05% to 60%, 0.05% to 40%, 0.05% to 30%, 0.05% to 20% by weight, 0.05% to 10% by weight, 0.05% to 5% by weight, 0.1% to 60% by weight, 0.1% to 40% by weight, 0.1% to 30% by weight, 0.1% to 20% by weight, 0.1% by weight % to 10% by weight, or 0.1% to 5% by weight of the enzyme hydrolyzate.

The term, “included as an active ingredient” means that the enzyme hydrolyzate of the present specification is added to an extent capable of exhibiting the above-mentioned effects. In addition, this may include being formulated in various forms by adding various components as sub-components for drug delivery and stabilization.

The composition may be a cosmetic composition.

The cosmetic composition may be prepared in any conventionally prepared formulation. For example, the cosmetic composition may be a lotion, cream, essence, cleansing foam, cleansing water, pack, ampoule, body lotion, body oil, body gel, shampoo, conditioner, hair conditioner, hair gel, foundation, lipstick, mascara, makeup It may have a cosmetic formulation of a base or skin adhesion type.

Components included in the cosmetic composition may include components commonly used in cosmetic compositions in addition to the composition as an active ingredient, for example, conventional adjuvants and carriers such as stabilizers, solubilizers, vitamins, pigments and fragrances. may include

In addition, the composition may be a composition for external application to the skin.

The external preparation for skin may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof. The external preparation for skin is a component usually used in external preparations for skin such as cosmetics or pharmaceuticals, for example, an aqueous component, an oily component, a powder component, alcohol, a moisturizer, a thickener, an ultraviolet absorber, a whitening agent, a preservative, an antioxidant, a surfactant, a fragrance , colorant, various skin nutrients, or a combination thereof may be appropriately formulated as needed. The external preparation for skin includes metal-blocking agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belapamil, licorice extract, glablidine, and kaline. Fruit hot water extracts, various herbal medicines, tocopherol acetate, glitylittic acid, tranexamic acid and derivatives or salts thereof, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can be mix|blended suitably.

The composition may be a food composition. The composition may be a health functional food composition.

The food composition may be used alone or in combination with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (prophylactic, health or therapeutic treatment). In general, in the production of food or beverage, the composition of the present specification may be added in an amount of 15 parts by weight or less based on the raw material. There is no particular limitation on the type of the health functional food. Among the types of health functional food, the beverage composition may contain various flavoring agents or natural carbohydrates as an additional component like a conventional beverage. The natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The health food composition can also be added to nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonated beverages carbonation agent used, or a combination thereof. The health functional food composition may also contain natural fruit juice, fruit juice beverage, fruit flesh for the production of vegetable beverage, or a combination thereof.

The food composition may be for improving skin condition.

The composition may be a pharmaceutical composition.

The pharmaceutical composition may further include a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, or mannitol, and the lubricant may be magnesium stearate, talc, or a combination thereof. The carrier may be an excipient, a disintegrant, a binder, a lubricant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be carboxymethyl cellulose calcium, sodium starch glycolate, anhydrous calcium monohydrogen phosphate, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

The pharmaceutical composition may be formulated as an oral or parenteral dosage form. Oral dosage forms may be granules, powders, solutions, tablets, capsules, dry syrups, or a combination thereof. The parenteral dosage form may be an injection.

The pharmaceutical composition may be for preventing or treating skin inflammatory diseases.

Another aspect provides a method for preparing an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Aeyeop, Lamiaceae, Icelandic moss and Changija with subcritical water.

The method comprises the steps of: (a) preparing a mixture of Aeyeop, Lamiaceae, Icelandic moss and Changija;

(b) extracting the mixture with subcritical water to prepare a subcritical water extract; and

(c) adding a hydrolytic enzyme to the subcritical water extract to prepare an enzymatic hydrolyzate.

The details of the mixture of the aeyeop, Lamiaceae, Icelandic moss and Changija, its subcritical water extract, and the enzymatic hydrolyzate of the subcritical water extract are as described above.

The step (a) is to prepare a mixture by mixing the dried leaf leaves, flowers of Lamiaceae, leaves, stems and outposts, and Icelandic moss outposts and window seeds in a weight ratio of 1 to 10:1 to 10:1 to 10:1 to 10. may be doing

The step (b) may be to prepare a subcritical water extract by extracting the mixture with subcritical water at 120 to 250° C. and 0.1 to 20 MPa. Subcritical water temperature conditions, pressure conditions, time conditions, and types of solvents are the same as described above.

The step (c) may be to prepare an enzymatic hydrolyzate by adding β-glucosidase to the subcritical water extract.

The method may further include (d) concentrating the enzymatic hydrolyzate after filtration. The filtration and concentration method may use a known conventional method.

Another aspect provides a method of preventing, ameliorating, or treating a condition in a subject comprising administering to the subject in need thereof an effective amount of the composition described above.

The subject's condition may be a condition related to skin or a condition related to inflammation.

The terms "administering", "introducing", and "implanting" are used interchangeably and in one embodiment into a subject by a method or route that results in at least partial localization of the composition according to one embodiment to a desired site. It may refer to the arrangement of the composition according to the example.

Administration may be administered by methods known in the art. Administration can be administered directly to a subject by any means, for example, intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. can The administration may be systemically or locally.

The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be an individual in need of skin beauty improvement, for example, skin moisturizing, skin barrier strengthening, skin inflammation suppression, and skin wrinkle improvement effect.

The administration is 0.1 mg to 1,000 mg, for example, 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1 mg of the composition according to one embodiment per day 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg may be administered. However, the dosage may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity, and those skilled in the art The dosage may be appropriately adjusted in consideration of these factors. The number of administration may be once a day or twice or more within the range of clinically acceptable side effects, and may be administered to one or two or more sites for the administration site, and total daily or at intervals of 2 to 5 days The number of days of administration may range from 1 to 30 days per treatment. If necessary, the same treatment can be repeated after a titration period. For animals other than humans, the dose is the same as that of a human per kg, or the above dose is converted, for example, by the volume ratio (for example, average value) of the target animal and the organ (heart, etc.) of the human One dose can be administered.

A composition comprising an enzyme hydrolyzate of a subcritical water extract obtained by extracting a mixture of Aeyeop, Lamiaceae, Icelandic moss and Changija with subcritical water according to an aspect is a skin-related condition or inflammation-related condition, for example, as environmental harmful factors such as fine dust. It can be usefully used for the prevention, improvement, or treatment of skin-related conditions or inflammation-related conditions caused by the present invention.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Preparation Examples 1-4: Preparation of Ayeop extract, Lamiaceae extract, Iceland moss extract, and Changija extract

100 g each of dried ae leaf, flower/leaf/stem/outpost of Lamiaceae, outpost of Icelandic moss, and lanceolata were prepared, and 70% aqueous ethanol as an extraction solvent was added 5 times by weight. In an extractor with a cooling condenser (Cosmos-660, Kyungseo Machinery), it was heated to 80℃~100℃ and extracted 3 times for 2 hours each.

Each extract extracted by the above method was left at room temperature for 3 days, and the precipitate was filtered with a 300 mesh filter paper, and the precipitate was filtered twice with Adventec No. 5 filter paper (Advantec No. 5) and Whatman GFC 150 mm filter paper. And using a reduced pressure concentrator (Coolace CCA-1100, EYELA) was concentrated at a temperature of 40 ℃ ~ 50 ℃. Using a spray dryer (B-290, BUCHI), the concentrate was applied at an inlet temperature of 180° C., aspirator efficiency of 100% (35 ㎤/hour), and a pump efficiency of 25% (7.5 ml/hour). min), Nozzle Cleaner 4, and a Rotameter of 30 mm (357 liters/hour) to obtain a leaf extract powder, Lamiaceae extract powder, Iceland moss extract powder, and Changija extract powder, respectively.

Preparation Examples 5 to 8: Preparation of Ayeop, Lamiaceae, Icelandic moss and Changija mixed extract

The dried leaf leaves, flowers/leaf/stems/outposts of Lamiaceae, and Icelandic moss outposts and spears were mixed in the weight ratio of Table 1 below so that the total weight was 100 g, and 70% water-containing ethanol as an extraction solvent was added 5 times the weight. added. In an extractor with a cooling condenser (Cosmos-660, Kyungseo Machinery), it was heated to 80℃~100℃ and extracted 3 times for 2 hours each.

The mixed extract extracted by the above method was left at room temperature for 3 days, and the precipitate was filtered with 300 mesh filter paper, and the precipitate was filtered twice with Adventec No. 5 filter paper (Advantec No. 5) and Whatman GFC 150 mm filter paper. And using a reduced pressure concentrator (Coolace CCA-1100, EYELA) was concentrated at a temperature of 40 ℃ ~ 50 ℃. Using a spray dryer (B-290, BUCHI), the concentrate was applied at an inlet temperature of 180° C., aspirator efficiency of 100% (35 ㎤/hour), and a pump efficiency of 25% (7.5 ml/hour). min), nozzle cleaner 4 (Nozzle Cleaner 4), and a flow meter (Rotameter) of 30 mm (357 liters/hour) were dried to obtain a powder of a mixed extract of aeyeop, Lamiaceae, Icelandic moss, and Changija.

weight ratio Ayeop Lamiaceae Icelandic moss window Preparation 5 One One One One Preparation 6 2 3 3 One Preparation 7 2 One 2 2 Preparation 8 3 2 One 3

Preparation Examples 9-12: Preparation of enzymatic hydrolyzate of Ayeop, Lamiaceae, Icelandic moss and Changija mixed extract

500 mL of acetate buffer (pH 4.0) and 25 mL of β-glucosidase enzyme were added to 10 g of the mixed extract powder prepared in Preparation Example 5, and reacted at 55° C. at 100 rpm for 4 hours. Next, the enzymatic reaction was completed by heating to 95° C. for 5 minutes.

The enzyme hydrolyzate obtained by the above method was left at room temperature for 3 days, and the precipitate was filtered with 300 mesh filter paper, and the precipitate was filtered twice with Adventec No. 5 filter paper (Advantec No. 5) and Whatman GFC 150 mm filter paper. And using a reduced pressure concentrator (Coolace CCA-1100, EYELA) was concentrated at a temperature of 40 ℃ ~ 50 ℃. Using a spray dryer (B-290, BUCHI), the concentrate was applied at an inlet temperature of 180° C., aspirator efficiency of 100% (35 ㎤/hour), and a pump efficiency of 25% (7.5 ml/hour). min), Nozzle Cleaner 4, and a Rotameter of 30 mm (357 liters/hour) to obtain a powder of an enzyme hydrolyzate of aleaf, Lamiaceae, Icelandic moss and spearmint mixed extract. This was referred to as Preparation Example 9.

An enzyme hydrolyzate powder of Preparation Example 10 was obtained in the same manner as in Preparation Example 9, except that the mixed extract powder prepared in Preparation Example 6 was used.

An enzyme hydrolyzate powder of Preparation Example 11 was obtained in the same manner as in Preparation Example 9, except that the mixed extract powder prepared in Preparation Example 7 was used.

An enzyme hydrolyzate powder of Preparation Example 12 was obtained in the same manner as in Preparation Example 9, except that the mixed extract powder prepared in Preparation Example 8 was used.

Examples 1-3: Preparation of enzymatic hydrolyzate of subcritical water extract of Ayeop, Lamiaceae, Iceland moss and Changija mixture

The dried ae leaf, the flower/leaf/stem/outpost of Lamiaceae, the outpost of Icelandic moss, and the lanceolata were mixed in the weight ratio shown in Table 2 below to make a total weight of 100 g, and purified water as an extraction solvent was added 10 times by weight. Extraction was performed for 15 minutes under subcritical water conditions of 200° C. and pressure of 15 MPa.

The subcritical water extract extracted by the above method was left at room temperature for 3 days, and the precipitate was filtered with a 300 mesh filter paper, and the precipitate was filtered twice with Adventec No. 5 filter paper and Whatman GFC 150 mm filter paper. And using a reduced pressure concentrator (Coolace CCA-1100, EYELA) was concentrated at a temperature of 40 ℃ ~ 50 ℃. Using a spray dryer (B-290, BUCHI), the concentrate was applied at an inlet temperature of 180° C., aspirator efficiency of 100% (35 ㎤/hour), and a pump efficiency of 25% (7.5 ml/hour). min), Nozzle Cleaner 4, and a Rotameter of 30 mm (357 liters/hour) to obtain a subcritical water extract powder of a mixture of aleaf, Lamiaceae, Icelandic moss and Changija.

To 10 g of the subcritical water extract powder, 500 mL of acetate buffer (pH 4.0) and 25 mL of β-glucosidase enzyme were added, and reacted at 55° C. at 100 rpm for 4 hours. Next, the enzymatic reaction was completed by heating to 95° C. for 5 minutes.

The enzyme hydrolyzate obtained by the above method was left at room temperature for 3 days, and the precipitate was filtered with 300 mesh filter paper, and the precipitate was filtered twice with Adventec No. 5 filter paper (Advantec No. 5) and Whatman GFC 150 mm filter paper. And using a reduced pressure concentrator (Coolace CCA-1100, EYELA) was concentrated at a temperature of 40 ℃ ~ 50 ℃. Using a spray dryer (B-290, BUCHI), the concentrate was applied at an inlet temperature of 180° C., aspirator efficiency of 100% (35 ㎤/hour), and a pump efficiency of 25% (7.5 ml/hour). min), Nozzle Cleaner 4, and a Rotameter of 30 mm (357 liters/hour) to obtain an enzyme hydrolyzate powder of a subcritical water extract of aleaf, Lamiaceae, Icelandic moss and spearmint mixture. .

weight ratio Ayeop Lamiaceae Icelandic moss window Example 1 One One One One Example 2 2 3 3 One Example 3 3 2 One 3

Experimental Example 1: Confirmation of cytotoxicity

The MTT assay method is a representative method for measuring cell viability. MTT (3-(4,5-dimethythiasol-2-yl)-2,5-diphenyl tetrazolium bromide) reagent is absorbed into cells and then forms formazan by mitochondrial succinate dehydrogenase. , the intracellular accumulation of this substance implies mitochondrial activity, broadly cellular activity. Therefore, it was confirmed whether the cytotoxicity of the extracts of Preparation Examples and Examples using the MTT assay method.

Specifically, HaCaT (Human keratinocyte) cells were aliquoted together with 200 μl medium in 96 wells at a density of 1Х10 ⁵ cells/well. As the medium, 10% fetal bovine serum (FBS) was mixed with DMEM medium, and penicillin (100 IU/ml) and streptomycin (100 μg/ml) were added thereto. 5% CO ₂ , After culturing for 24 hours in an incubator at 37° C., the medium was discarded and washed with PBS. Next, each sample dissolved in PBS in each well to which the same amount of medium is added is processed according to various concentrations up to 0.1% (w/w), 0.5% (w/w), or 1.0% (w/w). Incubated for 24 hours. 4 hours before the end of the culture, 20 μl of 5 mg/ml MTT dissolved in PBS was added to each well, shielded with aluminum foil, and incubated in an incubator under 5% CO ₂ and 37° C. conditions for 3 days. After removing the culture solution, adding 200 μl of DMSO solution, and incubating at 37° C. for 1 hour, absorbance was measured and compared at 570 nm using an ELISA reader. As a negative control, PBS to which the sample of Preparation or Examples was not added was used. Cell viability was calculated by Equation 1 below, and the results are shown in Table 3 below.

[Equation 1]

Cell viability (%) = (absorbance of sample added group / absorbance of control group) × 100

sample Cell viability (%) Concentration of 0.1% (w/w) Concentration of 0.5% (w/w) Concentration of 1% (w/w) Preparation Example 1 100 101 100 Preparation 2 100 101 100 Preparation 3 100 100 100 Preparation 4 101 100 100 Preparation 5 100 100 101 Preparation 6 100 101 100 Preparation 7 101 100 100 Preparation 8 100 100 101 Preparation 9 100 100 101 Preparation 10 100 100 101 Preparation 11 100 100 101 Preparation 12 100 100 101 Example 1 100 101 100 Example 2 100 101 100 Example 3 100 101 100

As shown in Table 3, high cell viability was confirmed when the extracts of Preparation Examples and Examples were added. Therefore, since the extracts of Preparation Examples and Examples do not affect cytotoxicity, it was confirmed that there is no problem in safety.

Experimental Example 2: Confirmation of AhR Expression Inhibition Effect

Experiments were performed to confirm the inhibitory effect of AhR (aryl hydrocarbon receptor) expression of the extracts prepared in Preparation Examples 1 to 12 and Examples 1 to 3.

Specifically, keratinocytes (HaCaT) were adjusted to 5Х10 ⁵ cells/well using DMEM (Dulbecco's modified Eagle's medium) medium supplemented with 10% FBS (Fetal Bovine Seum), and then inoculated in a 12 well plate for 36 hours. incubated during Each sample dissolved in 25 ppm of PM (Particulate Matter) and PBS was added at a concentration of 0.1% (w/w), 0.5% (w/w) or 1.0% (w/w) and incubated for 24 hours. RNA was extracted from the cultured cells, and the inhibitory effect of AhR expression was confirmed through RT-PCR (Reverse transcription polymerase chain reaction). Dexamethason was used as a positive control. As a negative control, PBS to which the sample of Preparation or Examples was not added was used. Primer information used for RT-PCR is shown in Table 4. AhR expression inhibition was calculated by Equation 2 below, and the results are shown in Table 5 below.

[Equation 2]

gene Primer sequence (5' to 3') SEQ ID NO: AhR Forward: GTGAGCCACTGCATTCAGCT One Reverse: CTGCACCCGGCCAAAAATTG 2

sample AhR expression inhibition rate (%) Concentration of 0.1% (w/w) Concentration of 0.5% (w/w) Concentration of 1% (w/w) Preparation Example 1 2.2 8.5 11.5 Preparation 2 2.3 7.5 11.5 Preparation 3 2.5 8.2 10.9 Preparation 4 2.8 7.9 10.8 Preparation 5 2.5 8.6 10.2 Preparation 6 2.6 7.6 11.2 Preparation 7 3.1 7.5 11.6 Preparation 8 3.1 7.2 11.3 Preparation 9 3.2 7.4 13.4 Preparation 10 3.5 7.6 12.3 Preparation 11 2.8 7.5 13.2 Preparation 12 2.9 8.1 14.5 Example 1 3.5 8.6 11.5 Example 2 3.9 13.5 19.2 Example 3 7.5 16.8 21.3 Dexamethasone 18.2 20.4 26.8

As shown in Table 5, the enzymatic hydrolysis of the subcritical water extracts of Examples 1 to 3 compared to each extract of Preparation Examples 1 to 4, the mixed extract of Preparation Examples 5 to 8, and the enzymatic hydrolyzate of Preparation Examples 9 to 12 The lysate showed an excellent AhR expression inhibition rate. Among them, Example 3 showed the most excellent effect.

Therefore, it was confirmed that the enzymatic hydrolyzate of the subcritical water extract according to the example inhibited the AhR gene expression increased by environmental harmful factors such as fine dust and heavy metals. Therefore, the enzymatic hydrolyzate of the subcritical water extract according to the embodiment has an anti-pollution effect that inhibits AhR gene expression increased by environmental harmful factors, and has an effect of alleviating skin irritation caused by environmental harmful factors, It was found that it can improve the damage of the skin and protect the skin.

Experimental Example 3: Confirmation of the effect of inhibiting the expression of TNF-α

In order to confirm the anti-inflammatory effect of the extracts prepared in Preparation Examples 1 to 12 and Examples 1 to 3, the expression inhibition rate of the inflammatory mediator TNF-α was confirmed.

Specifically, RAW264.7 cells were adjusted to 5×10 ⁵ cells/well using DMEM medium supplemented with 10% FBS, inoculated in a 12 well plate, and cultured for 18 hours. Then, after maintaining the starvation state for 12 hours, each sample dissolved in 10 ng/mL of LPS (lipopolysaccharide) and PBS was added to 0.1% (w/w), 0.5% (w/w) or 1.0% (w/w) w) and incubated for 24 hours. RNA was extracted from the cultured cells and the inhibition rate of TNF-α expression was confirmed through RT-PCR. Dexamethasone was used as a positive control. As a negative control, PBS to which the sample of Preparation or Examples was not added was used. The inhibition rate of TNF-α expression was calculated by Equation 3 below, and the results are shown in Table 6 below.

[Equation 3]

TNF-α expression inhibition rate (%) = [(control TNF-α expression level - sample TNF-α expression level)/ control TNF-α expression level] × 100

sample TNF-α expression inhibition rate (%) Concentration of 0.1% (w/w) Concentration of 0.5% (w/w) Concentration of 1% (w/w) Preparation Example 1 44.0 46.5 48.5 Preparation 2 41.2 43.2 49.6 Preparation 3 42.3 44.5 50.2 Preparation 4 39.6 45.2 51.2 Preparation 5 33.5 38.2 49.6 Preparation 6 38.5 41.5 51.2 Preparation 7 40.2 46.3 56.5 Preparation 8 37.2 42.5 50.9 Preparation 9 39.6 41.6 51.2 Preparation 10 41.2 43.5 52.3 Preparation 11 40.5 44.5 53.4 Preparation 12 40.6 44.8 54.9 Example 1 50.2 55.2 68.5 Example 2 52.3 58.2 75.8 Example 3 63.7 69.6 78.6 positive control 68.6 75.7 81.3

As shown in Table 6, the enzymatic hydrolysis of the subcritical water extracts of Examples 1 to 3 compared to the respective extracts of Preparation Examples 1 to 4, the mixed extract of Preparation Examples 5 to 8, and the enzymatic hydrolyzate of Preparation Examples 9 to 12 The lysate exhibited an excellent TNF-α inhibitory effect. Among them, Example 3 showed the most excellent effect.

Therefore, it was confirmed that the enzymatic hydrolyzate of the subcritical water extract according to the example has an excellent anti-inflammatory effect.

Experimental Example 4: Confirmation of TSLP expression inhibitory effect

In order to confirm the anti-inflammatory effect of the extracts prepared in Preparation Examples 1 to 12 and Examples 1 to 3, the expression inhibition rate of TSLP (thymic stromal lymphopoietin) was confirmed.

Specifically, keratinocytes (HaCaT) were adjusted to 5×10 ⁵ cells/well using DMEM medium supplemented with 10% FBS, inoculated in a 12 well plate, and cultured for 36 hours. After that, each sample dissolved in PM 25 ppm and PBS was added at a concentration of 0.1% (w/w), 0.5% (w/w) or 1.0% (w/w) and cultured for 24 hours. RNA was extracted from the cultured cells and the expression effect of TSLP was confirmed through RT-PCR. Dexamethason was used as a positive control. As a negative control, PBS to which the sample of Preparation or Examples was not added was used. Primer information used for RT-PCR is shown in Table 7. The TSLP expression inhibition rate was calculated by Equation 4 below, and the results are shown in Table 8 below.

[Equation 4]

gene Primer sequence (5' to 3') SEQ ID NO: TSLP Forward: GTGGACTGGCAATGAGAGGC 3 Reverse: GTGGACACCCAATTCCACCC 4

sample TSLP inhibition (%) Concentration of 0.1% (w/w) Concentration of 0.5% (w/w) Concentration of 1% (w/w) Preparation Example 1 3.1 5.2 10.7 Preparation 2 4.6 6.5 11.2 Preparation 3 5.1 6.8 12.3 Preparation 4 5.2 7.2 11.2 Preparation 5 4.8 8.2 12.3 Preparation 6 5.6 8.2 13.2 Preparation 7 6.8 10.9 11.3 Preparation 8 7.5 11.0 12.5 Preparation 9 8.2 10.8 11.0 Preparation 10 6.8 10.2 13.5 Preparation 11 7.2 9.5 14.2 Preparation 12 6.8 9.5 13.2 Example 1 10.2 13.2 20.2 Example 2 11.2 15.2 24.3 Example 3 13.5 20.3 27.2 Dexamethasone 20.1 25.6 30.1

As shown in Table 8, the enzymatic hydrolysis of the subcritical water extract of Examples 1 to 3 compared to each extract of Preparation Examples 1 to 4, the mixed extract of Preparation Examples 5 to 8, and the enzymatic hydrolyzate of Preparation Examples 9 to 12 The lysate showed an excellent TSLP inhibitory effect.

Therefore, it was confirmed that the enzymatic hydrolyzate of the subcritical water extract according to the example inhibited the TSLP gene expression increased by environmental harmful factors such as fine dust and heavy metals. Therefore, it was found that the enzymatic hydrolyzate of the subcritical water extract according to the example has an anti-inflammatory effect on inflammation induced by environmental harmful factors.

Experimental Example 5: Confirmation of the effect of increasing TGase-1 expression

TGase-1 (Transglutaminase-1) is known to be involved in skin barrier formation. Therefore, in order to confirm the skin barrier strengthening effect of the extracts prepared in Preparation Examples 1 to 12 and Examples 1 to 3, the expression increase rate of TGase-1 was confirmed.

Specifically, HaCaT cells were inoculated in DMEM medium supplemented with 10% FBS, and each sample dissolved in PBS at a concentration of 0.1% (w/w), 0.5% (w/w) or 1.0% (w/w) was added, and incubated at 5% CO ₂ and 37° C. for 24 hours. Dexamethasone was used as a positive control. Then, according to the method described by Komoroski et al. (Drug Metab. Dispos. 32:512-518, 2004), RNA isolation, cDNA synthesis, and RT-PCR were performed in cells to confirm the expression of TGase-1. GAPDH was used as a housekeeping gene to determine the difference in gene expression.

The RT-PCR was performed as follows. Oligo dT-adaptor primer and DEPC (Diethylpyrocarbonate) water to make a total amount of 15 μl. After denaturing at 70℃ for 10 minutes, M-MLV (Moloney murine leukemia virus) RNA cDNA was synthesized at 42°C for 60 minutes and 70°C for 15 minutes by performing reverse transcription. The synthesized cDNA was amplified through PCR reaction, and the total reaction solution was 25 μl. The final concentration of each reaction was 100 pmol of primer, 1.0 μM, 0.2 mM of dNTP mixture, 1x1.5 mM of 5x green or colorless GoTaq reaction buffer, MgCl ₂ (PCR buffer) and 1.25 units of GoTaq DNA polymerase. The PCR reaction conditions for denaturation, annealing and extension were as follows: 95 °C 2 min, 95 °C 30 sec, 60 °C 30 sec, 72 °C 1 min, 72 °C 5 min, 30 ~40 cycles. After PCR reaction, 10 μl of the product was electrophoresed on a 2% agarose gel. The expression level was confirmed using the Gel Documentation system (Korea Labtech, Cat. No DGS-200D). Primer information used for RT-PCR is shown in Table 9.

The increase rate of TGase-1 expression was calculated by Equation 5 below, and the results are shown in Table 10 below.

[Equation 5]

TGase-1 expression increase rate (%) = (sample TGase-1 expression level / control TGase-1 expression level) × 100

gene Primer sequence (5' to 3') SEQ ID NO: GAPDH Forward: GGCATTGCTCTCAATGACAA 5 Reverse: TGTGAGGGAGATGCTCAGTG 6 TGase-1 Forward: TGATCGCATCACCCTTGAGT 7 Reverse: GTAGATCTCATTGCGGGGGT 8

sample TGase-1 expression increase rate (%) Concentration of 0.1% (w/w) Concentration of 0.5% (w/w) Concentration of 1% (w/w) Preparation Example 1 29 33 45 Preparation 2 30 42 50 Preparation 3 31 36 47 Preparation 4 33 39 46 Preparation 5 35 41 53 Preparation 6 32 42 54 Preparation 7 34 43 48 Preparation 8 33 44 51 Preparation 9 35 45 52 Preparation 10 36 46 53 Preparation 11 35 48 50 Preparation 12 36 51 58 Example 1 41 52 70 Example 2 45 54 75 Example 3 50 69 78 Dexamethasone 100 100 100

As shown in Table 10, the enzymatic hydrolysis of the subcritical water extract of Examples 1 to 3 compared to each extract of Preparation Examples 1 to 4, the mixed extract of Preparation Examples 5 to 8, and the enzymatic hydrolyzate of Preparation Examples 9 to 12 The lysate showed an excellent effect of increasing TGase-1 expression.

Therefore, it was confirmed that the enzymatic hydrolyzate of the subcritical water extract according to the example has an excellent skin barrier strengthening effect.

Experimental Example 6: Oleanolic acid content comparison

The content of oleanolic acid, an active ingredient, was measured using HPLC (LC-20A Prominence Series, Shimadzu), and the results are shown in Table 11 below.

analysis conditions

- Column :　Capcell Pak C18, OSAKA SODA (250mm x 4.6mm, 5um)

- Mobile phase: (A) acetonitrile 85% (B) 30 mM KH ₂ PO ₄ (in Water) (pH 5) 15% isocratic elution

- Detector: PDA 215 nm

- Injection Volume: 10 μl

- Retention Time: 17.1 minutes

Sample name Oleanolic acid (μg/ml) Preparation 8 - Example 3 17,942

Example 4: Preparation of Serum

A serum containing the enzymatic hydrolyzate of the subcritical water extract according to Example 3 was prepared according to a conventional method with the composition and content shown in Table 12 below.

Raw material content (wt%) Enzymatic hydrolyzate of subcritical water extract according to Example 3 1.0 beeswax 1.0 Polysorbate 60 1.5 Sorbitan Sesquiolate 0.5 mineral oil 10.0 Sorbitan Stearate 0.5 lipophilic monostearate glycerin 1.0 stearic acid 1.5 Glyceryl Stearate/PEG-400 Stearate 1.0 propylene glycol 3.0 carboxy polymer 0.1 triethanolamine 0.1 Phenoxyethanol appropriate amount Purified water To 100

Example 5: Preparation of cream

A cream containing the enzymatic hydrolyzate of the subcritical water extract according to Example 3 was prepared according to a conventional method with the composition and content shown in Table 13 below.

Raw material content (wt%) Enzymatic hydrolyzate of subcritical water extract according to Example 3 1.0 shea butter 2.0 Polysorbate 60 1.5 Sorbitan Sesquiolate 0.8 mineral oil 10.0 dimethicone 3.0 Sorbitan Stearate 0.5 lipophilic monostearate glycerin 1.0 cetearyl alcohol 2.0 Glyceryl Stearate/PEG-400 Stearate 1.0 propylene glycol 3.0 carboxy polymer 0.25 triethanolamine 0.25 Phenoxyethanol appropriate amount Purified water To 100

Experimental Example 6: Formulation stability confirmation

The formulations prepared in Examples 4 and 5 were placed in an opaque glass container and placed in a room, a refrigerator and an incubator kept constant at room temperature (25° C.), refrigeration (4° C.) and constant temperature (50° C.). After storage and observation (discoloration, discoloration, and separation) for 12 weeks, the stability of each formulation was confirmed. In addition, stability was confirmed even under temperature cycling conditions (-5 to 45°C). The results are shown in Table 14.

temperature condition Stability check (discoloration, discoloration and separation) Example 4 Example 5 Room temperature (25°C) 0 0 Refrigeration (4℃) 0 0 constant temperature (50℃) 0 0 Circulation (-5~45℃) 0 0

< Formulation stability grade >

0: No change 1: Minor change 2: Change 3: Extreme change

As shown in Table 14, the formulations of Examples 4 and 5 were stable without discoloration, discoloration, and separation under the temperature conditions of 25°C, 4°C, and 0°C. In addition, it was stable even under temperature cycling conditions (-5 to 45°C), as no discoloration, discoloration, and separation were observed.

SEQUENCE LISTING <110> Cosmax, INC. <120> Cosmetic composition for anti-irritation due to the particulate matter and improving skin conditions <130> PN134753 <160> 8 <170> PatentIn version 3.2 <210> 1 <211> 20 <212> DNA <213> <220> <223> AhR forward primer <400> 1 gtgagccact gcattcagct 20 <210> 2 <211> 20 <212> DNA <213> <220> <223> AhR reverse primer <400> 2 ctgcacccgg ccaaaaattg 20 <210> 3 <211> 20 <212> DNA <213> <220> <223> TSLP forward primer <400> 3 gtggactggc aatgagaggc 20 <210> 4 <211> 20 <212> DNA <213> <220> <223> TSLP reverse primer <400> 4 gtggacaccc aattccaccc 20 <210> 5 <211> 20 <212> DNA <213> <220> <223> GAPDH forward primer <400> 5 ggcattgctc tcaatgacaa 20 <210> 6 <211> 20 <212> DNA <213> <220> <223> GAPDH reverse primer <400> 6 tgtgagggag atgctcagtg 20 <210> 7 <211> 20 <212> DNA <213> <220> <223> TGase-1 forward primer <400> 7 tgatcgcatc acccttgagt 20 <210> 8 <211> 20 <212> DNA <213> <220> <223> TGase-1 reverse primer <400> 8 gtagatctca ttgcgggggt 20

Claims (10)

A cosmetic composition for improving skin condition, comprising an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Aeyeop, Lamiaceae, Icelandic moss and Changija with subcritical water. The cosmetic composition according to claim 1, wherein the skin condition is skin damage or irritation due to skin inflammation, skin barrier, or environmental harmful factors. The cosmetic composition according to claim 2, wherein the environmental harmful factors are fine dust, heavy metals, or a combination thereof. The method according to claim 1, wherein the mixture is ayeop; flowers, leaves, stems and outposts of Lamiaceae; outpost of Icelandic moss; And a cosmetic composition that is a mixture of Changija. The cosmetic composition according to claim 1, wherein the mixture is aeropsis, Lamiaceae, Icelandic moss, and Changija in a weight ratio of 1 to 3:1 to 3:1 to 3:1 to 3. The cosmetic composition of claim 1, wherein the subcritical water extract is extracted with subcritical water at 120 to 250°C and 0.1 to 20 MPa. The cosmetic composition of claim 1, wherein the enzyme is β-glucosidase. A food composition for improving skin condition, comprising an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Aeyeop, Lamiaceae, Icelandic moss and Changija with subcritical water. A pharmaceutical composition for the prevention or treatment of skin inflammatory diseases, comprising an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Ayeop, Lamiaceae, Icelandic moss and Changija. (a) preparing a mixture of Aeyeop, Lamiaceae, Icelandic moss and Changija;
(b) preparing a subcritical water extract by extracting the mixture with subcritical water at 120 to 250° C. and 0.1 to 20 MPa;
(c) adding β-glucosidase to the subcritical water extract to prepare an enzymatic hydrolyzate,
A method for preparing an enzymatic hydrolyzate of a subcritical water extract obtained by extracting a mixture of Aeyeop, Lamiaceae, Icelandic moss and Changija with subcritical water.