KR20220028416A - MicroRNA biomarker for predicting drug response to diabetes treatment and use thereof - Google Patents

Abstract

The present invention relates to a microRNA biomarker for predicting drug response to antidiabetics, and a use thereof. In the present invention, the drug response prediction markers miR-136-3p, miR-150-3p and miR-15a-3p were selected by comparing miRNA profiles of a normal group with those of a diabetic patient group before and after administering an SGLT2 inhibitor which is an antidiabetic. It was confirmed that the expression patterns of the selected markers differ between the normal group and the diabetic patient group, and that the expression patterns for the diabetic patient group are restored so as to be similar to those for the normal group when the antidiabetic SGLT2 inhibitor is administered to the diabetic patient group. Therefore, the marker according to the present invention may be useful as a marker for predicting drug response to antidiabetics.

Description

MicroRNA biomarker for predicting drug response to diabetes treatment and its use {MicroRNA biomarker for predicting drug response to diabetes treatment and use thereof}

The present invention relates to a microRNA (microRNA) biomarker for predicting drug reactivity to a therapeutic agent for diabetes and its use, and more particularly, from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p A biomarker composition for predicting drug reactivity to an antidiabetic agent comprising one or more selected, a composition for predicting drug reactivity to an antidiabetic agent comprising an agent for measuring the expression level of the biomarker, and a drug for an antidiabetic agent using the biomarker It relates to a method of providing information on reactivity.

Diabetes mellitus (糖尿病; diabetes mellitus) is a metabolic disease characterized by hyperglycemia caused by defects in insulin secretion or insulin action. It is a chronic degenerative disease accompanied by

In particular, type 2 diabetes occurs when the blood sugar control fails because insulin secretion is smoothly controlled but insulin does not function properly due to acquired factors caused by lack of exercise, obesity, or stress.

Currently, the prevalence of diabetes is increasing year by year due to changes in diet according to rapid economic development, reaching about 5 to 10% in Korea. As of 2005, the number of diabetic patients exceeded 4 million, 83 out of 100, and by 2025. It is estimated that the number will increase to about 6.8 million in the next year (Korea Diabetes Information Center, 2005) Diabetes is the third most serious disease worldwide and the fourth leading cause of death in Korea. will be shortened to some extent.

Currently known treatment for type 2 diabetes can be classified into four categories: sulfonylureas-based drugs that induce insulin secretion, acetabular drugs that move sugar to muscle cells and inhibit sugar synthesis in the liver Biguanides, α-glucosidase inhibitors that inhibit the enzyme that makes glucose in the small intestine, and thiazolidions that activate PPAR (Peroxisome proliferator-activated receptors)-γ that are involved in adipocyte differentiation (TZD, thiazolidinedione) drugs, etc. (Amir Babiker)and Mohammed Al Dubayee et al., Sudan J Paediatr, 17(2): 11-20, 2017). Recently, SGLT2 (sodium glucose cotransporter 2) inhibitors control blood glucose by inhibiting glucose reabsorption in the kidneys and excreting glucose into the urine.

However, these oral hypoglycemic agents induce hypoglycemia (sulfonylurea drugs), nephrotoxicity (biguanide drugs), lactic acidosis (biguanide drugs), diarrhea and upset stomach (alpha-glucosidase inhibitors), weight loss, etc. There are problems with many side effects.

Therefore, in the present invention, miR-136 is a result of diligent efforts to select a biomarker for predicting drug reactivity to an antidiabetic drug to reduce the side effects of the drug by predicting drug reactivity to the antidiabetic drug, and to select and treat an effective drug. -3p, miR-150-3p and miR-15a-3p markers were selected. Although it was confirmed that these markers had different expression patterns in the normal group and the diabetic group, it was confirmed that the expression pattern was restored similarly to the normal group by taking the SGLT2 inhibitor, which is a diabetes treatment, and completed the present invention.

It is an object of the present invention to provide a biomarker for predicting drug reactivity to a therapeutic agent for diabetes.

Another object of the present invention is to provide a composition for predicting drug reactivity to an antidiabetic agent comprising an agent for measuring the expression level of a biomarker, and a method for providing information on drug reactivity to an antidiabetic agent using the biomarker there is.

Another object of the present invention is to provide a screening method for a therapeutic agent for diabetes using the biomarker.

In order to achieve the above object,

The present invention provides a biomarker composition for predicting drug reactivity of an antidiabetic agent comprising at least one microRNA (microRNA) selected from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p.

In a preferred embodiment of the present invention, the miR-136-3p is the nucleotide sequence of SEQ ID NO: 1, miR-150-3p is the nucleotide sequence of SEQ ID NO: 2, and miR-15a-3p is the nucleotide sequence of SEQ ID NO: 3 It can be represented as a sequence.

In another preferred embodiment of the present invention, the antidiabetic agent may be a sodium glucose cotransporter 2 (SGLT2) inhibitor.

In another preferred embodiment of the present invention, the diabetes may be type 2 diabetes.

to achieve other purposes,

The present invention is for predicting drug response to an antidiabetic agent comprising an agent measuring the expression level of one or more microRNAs (microRNA) selected from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p A composition is provided.

In a preferred embodiment of the present invention, the miR-136-3p is the nucleotide sequence of SEQ ID NO: 1, miR-150-3p is the nucleotide sequence of SEQ ID NO: 2, and miR-15a-3p is the nucleotide sequence of SEQ ID NO: 3 It can be represented as a sequence.

In another preferred embodiment of the present invention, the antidiabetic agent may be a sodium glucose cotransporter 2 (SGLT2) inhibitor.

In another preferred embodiment of the present invention, the agent for measuring the expression level may be sense and antisense primers or probes complementary to microRNA binding.

In addition, the present invention provides a diagnostic kit for predicting drug reactivity to an antidiabetic agent, comprising the composition for predicting drug reactivity to the antidiabetic agent.

In addition, the present invention provides (a) measuring the expression level of one or more microRNAs selected from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p in a biological sample derived from a subject before and after administration of a diabetes treatment agent step; And (b) provides a method for providing information on drug responsiveness of an antidiabetic drug comprising the step of comparing the microRNA expression level before and after administration of the antidiabetic drug.

In a preferred embodiment of the present invention, the miR-136-3p is the nucleotide sequence of SEQ ID NO: 1, miR-150-3p is the nucleotide sequence of SEQ ID NO: 2, and miR-15a-3p is the nucleotide sequence of SEQ ID NO: 3 It can be represented as a sequence.

In another preferred embodiment of the present invention, the agent for measuring the expression level may be sense and antisense primers or probes complementary to microRNA binding.

In another preferred embodiment of the present invention, the expression level is next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase Chain reaction (Real-time PCR), RNase protection assay (RPA), microarray (microarray), and can be measured through one or more methods selected from the group consisting of northern blotting (northern blotting). .

In another preferred embodiment of the present invention, the antidiabetic agent may be a sodium glucose cotransporter 2 (SGLT2) inhibitor.

In a preferred embodiment of the present invention, after administration of the antidiabetic agent, when the miR-136-3p or miR-15a-3p expression increases and the miR-150-3p expression decreases, the information that the antidiabetic agent has a therapeutic effect can provide

In the present invention, miR-136-3p, miR-150-3p and miR-15a-3p, which are drug reactivity predictive markers, were selected by comparing the miRNA profiles of the diabetic group before and after administration of the SGLT2 inhibitor, which is a diabetes treatment, with the normal group. Although it was confirmed that the selected markers had different expression patterns in the normal group and the diabetic group, it was confirmed that the expression pattern was restored similarly to that of the normal group by taking the SGLT2 inhibitor, which is a diabetes treatment. It can be usefully used as a reactive predictive marker.

1 is a comparative analysis of the expression level of microRNAs in exosomes isolated from the serum of the normal group and the diabetic group before taking the SGLT2 inhibitor, (A) shows that the expression level of the diabetic group was significantly reduced by 2 times or more compared to the normal group. Alternatively, it is a heat map result of hierarchical clustering according to the increased expression level of microRNA, and (B) is a volcano plot of the expression level of microRNA to confirm the difference in expression level between the normal group and the diabetic group before taking the SGLT2 inhibitor. ) is the result shown.
2 is a comparative analysis of the expression level of microRNA in exosomes isolated from the serum of a diabetic patient group before taking a SGLT2 inhibitor and a group after taking a SGLT2 inhibitor. It is a heat map result of hierarchical clustering according to the expression level of microRNA with significantly decreased or increased expression by more than 2 times, (B) is the difference in expression level between the diabetic group before taking the SGLT2 inhibitor and the patient group after taking the SGLT2 inhibitor In order to do this, the expression level of microRNA is shown as a volcano plot.
3 is a comparative analysis of the expression level of microRNA in exosomes isolated from the serum of the normal group and the patient group after taking the SGLT2 inhibitor. This is the heat map result of performing hierarchical clustering according to the reduced or increased expression level of microRNA, and (B) is a volcano plot of the expression level of microRNA to confirm the difference in expression level between the normal group and the patient group after taking the SGLT2 inhibitor. plot).
4 is a measurement of the expression levels of miR-136-3p, miR-150-3p and miR-15a-3p between the normal group (HV), the diabetic group before taking the SGLT2 inhibitor (Before), and the patient group after taking the SGLT2 inhibitor (After) is the result of comparison.

Hereinafter, the present invention will be described in detail.

The present invention provides a biomarker composition for predicting drug reactivity of an antidiabetic agent comprising one or more microRNAs (microRNAs) selected from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p from one point of view. it's about

In the present invention, the diabetes may be type 2 diabetes.

In the present invention, the miR-136-3p may be represented by the nucleotide sequence of SEQ ID NO: 1, and 70% or more, preferably 80% or more, more preferably 90% or more of the nucleotide sequence represented by SEQ ID NO: 1 , most preferably a nucleotide sequence having 95% or more sequence homology.

The miR-150-3p may be represented by the nucleotide sequence of SEQ ID NO: 2, and 70% or more, preferably 80% or more, more preferably 90% or more, most preferably from the nucleotide sequence represented by SEQ ID NO: 2 may include a nucleotide sequence having 95% or more sequence homology.

The miR-15a-3p may be represented by the nucleotide sequence of SEQ ID NO: 3, and 70% or more, preferably 80% or more, more preferably 90% or more, most preferably from the nucleotide sequence represented by SEQ ID NO: 3 may include a nucleotide sequence having 95% or more sequence homology.

In the present invention, the antidiabetic agent may be a sodium glucose cotransporter 2 (SGLT2) inhibitor.

In a specific embodiment of the present invention, it was attempted to select a marker for predicting drug reactivity to an antidiabetic drug, and a SGLT2 inhibitor was used as the antidiabetic drug, and the normal group, the diabetic group before taking the SGLT2 inhibitor, and the diabetic group after taking the SGLT2 inhibitor The expression level of microRNA in exosomes isolated from each serum was confirmed.

In order to select a microRNA marker for predicting drug reactivity, as shown in FIGS. 1 to 3 , the normal group and the diabetic group before taking the SGLT2 inhibitor; the diabetic group before taking the SGLT2 inhibitor and the diabetic group after taking the SGLT2 inhibitor; After taking the SGLT2 inhibitor, the group was divided into the normal group and the diabetic group, and the expression level of microRNA, which was significantly decreased or increased by a factor of two or more, was visualized as a heat map and analyzed using a volcano plot.

As a result, as shown in Table 2, microRNAs whose expression levels were different between the normal group and diabetic patients before taking the SGLT2 inhibitor and whose expression pattern was restored to a level similar to that of the normal group by taking the SGLT2 inhibitor were finally selected.

The expression levels of the selected miR-136-3p, miR-150-3p and miR-15a-3p were analyzed by dividing them into normal group (HV), diabetic group before taking SGLT2 inhibitor (Before), and group after taking SGLT2 inhibitor (After). As a result, a significant difference in expression level was observed between the normal group and the diabetic group before taking antidiabetic drugs, and miR-136-3p, miR-150-3p, and miR-15a-3p were all expressed similarly to the normal group by taking the SGLT2 inhibitor. It was confirmed that the level was restored.

Therefore, the markers selected in the present invention can be utilized in a drug reactivity predictive marker to a diabetes treatment agent, a composition for predicting drug reactivity to a diabetes treatment agent, and a method for providing information on drug reactivity of a diabetes treatment agent.

Furthermore, since it was confirmed that the microRNA marker of the present invention shows a significant difference in expression level between the normal group and the diabetic group, it can be used as a marker for diabetes diagnosis as well as a marker for predicting drug reactivity.

In another aspect, the present invention provides a therapeutic agent for diabetes comprising an agent for measuring the expression level of one or more microRNAs (microRNAs) selected from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p. It relates to a composition for predicting drug reactivity.

The composition for predicting drug reactivity to the antidiabetic agent confirms the expression level of the drug reactivity predictive marker for the antidiabetic agent of the present invention, and the specific details are as described above.

In the present invention, the agent for measuring the expression level may be a primer pair or a probe that complementarily binds to microRNA.

As used herein, the term “primer” refers to a fragment recognizing a target gene sequence, including a pair of forward and reverse primers, but preferably a primer pair that provides analysis results with specificity and sensitivity.

As used herein, the term “probe” refers to a substance capable of specifically binding to a target substance to be detected in a sample, and means a substance capable of specifically confirming the presence of a target substance in the sample through the binding. do. The type of probe is not limited as a material commonly used in the art, but preferably PNA (peptide nucleic acid), LNA (locked nucleic acid), peptide, polypeptide, protein, RNA or DNA, and most preferably It is PNA.

In another aspect, the present invention relates to a diagnostic kit for predicting drug reactivity to an antidiabetic agent, comprising the composition for predicting drug reactivity to the antidiabetic agent.

The kit may be prepared by a conventional manufacturing method known in the art. The kit may include, for example, a freeze-dried antibody, a buffer, a stabilizer, an inactive protein, and the like.

The kit may further include a detectable label. The term “detectable label” refers to an atom or molecule that allows for specific detection of a molecule comprising a label among molecules of the same type without a label. The detectable label may be attached to an antibody, an interacting protein, a ligand, a nanoparticle, or an aptamer that specifically binds to the protein or fragment thereof. The detectable label may include a radioactive species (radionuclide), a fluorophore (fluorophore), and an enzyme (enzyme).

The kit is a next-generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time) to analyze the microRNA expression level. PCR), RNase protection assay (RPA), microarray, and the like.

For example, the kit of the present invention may be a kit comprising a primer set specific for the marker gene of the present invention, an appropriate amount of a DNA polymerase, a dNTP mixture, a PCR buffer, and water to perform PCR. The PCR buffer may contain KCl, Tris-HCl and MgCl2. In addition, components necessary for performing electrophoresis that can confirm whether the PCR product is amplified may be additionally included in the kit of the present invention.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing RT-PCR. RT-PCR kits contain, in addition to each primer pair specific for a marker gene, a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterile water, etc. may be included. In addition, a primer pair specific for a gene used as a quantitative control may be included.

In another aspect, (a) the expression level of one or more microRNAs selected from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p in a biological sample derived from a subject before and after administration of an antidiabetic agent measuring; and

(b) relates to a method for providing information on predicting drug responsiveness of antidiabetic drugs, comprising the step of comparing microRNA expression levels before and after administration of antidiabetic drugs.

In the above method, "biological sample" means a tissue, cell, blood, serum, plasma, saliva, cerebrospinal fluid or urine sample, etc. in which microRNA expression levels are different due to the onset of diabetes, preferably blood , plasma or serum, more preferably means exosomes contained in serum.

The expression level of step (a) is next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time PCR ), RNase protection assay (RPA), microarray, and northern blotting may be measured by at least one method selected from the group consisting of.

In the above method, after administration of the antidiabetic agent, when the expression of miR-136-3p or miR-15a-3p increases and the expression of miR-150-3p decreases, the drug reactivity to the antidiabetic agent is excellent, so that it has a diabetes treatment effect. information can be provided. Preferably, when a SGLT2 inhibitor is administered as a therapeutic agent for diabetes, when the expression of miR-136-3p or miR-15a-3p increases and the expression of miR-150-3p decreases by administration of the SGLT2 inhibitor, the drug responsiveness to the SGLT2 inhibitor is excellent. information can be provided.

Specifically, the miR-136-3p expression level in the diabetic patient group after administration of the antidiabetic agent increased by 2 to 3 times, preferably increased by 2.2 to 2.5 times compared to the group of diabetic patients before the administration of the antidiabetic agent; miR-150-3p expression level decreased by 1.5 to 2.5 fold, preferably decreased by 1.8 to 2.2 fold; Alternatively, when the miR-15a-3p expression level increases by 1.5 to 2.5 times, preferably by 1.8 to 2.2 times, it can be considered that the drug has a therapeutic effect on diabetes.

In addition, according to the purpose, before administering the drug directly to the patient, the patient tissue-derived cells, preferably diabetes-related cells, are isolated, then the separated cells are treated with the drug, and then the microRNA expression level change is confirmed to give the patient more It is possible to select a suitable, drug-reactive diabetes treatment agent.

Furthermore, in another aspect, (a) measuring the expression level of one or more microRNAs selected from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p in a biological sample derived from a diabetic patient step; and

(b) comparing the microRNA expression level of a normal control group; relates to a method for providing information on whether or not to administer a therapeutic agent for diabetes, including.

The antidiabetic agent may be a sodium glucose cotransporter 2 (SGLT2) inhibitor, and when the expression of miR-136-3p or miR-15a-3p of diabetic patients is decreased, and the expression of miR-150-3p is increased, the SGLT2 inhibitor is used compared to the normal control group. Dosing can provide information.

Hereinafter, the present invention will be described in more detail through examples.

These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

Patient selection and sequencing

1-1: Patient Selection

In the present invention, in order to select a biomarker for predicting drug reactivity to an antidiabetic drug, 20 diabetic patients whose diabetic symptoms were improved by administration of a SGLT2 inhibitor among 20 normal subjects and diabetic patients who had never taken a SGLT2 inhibitor before (taking SLGT2 inh) group) was selected, and the SLGT2 inh group took serum samples before and after taking the SGLT2 inhibitor for analysis.

The clinical characteristics of the patient are shown in Table 1 below, and the number in parentheses means the number of samples.

Patient's clinical information Normal (20) SLGT2 inh group (20) gender(m/f) 0/20 12/8 age 53.00±4.24 56.20±10.62 height 157.68±5.55 164.43±9.84 weight 54.26±6.00 73.09±10.62 BMI 21.75±1.38 27.02±2.96 waist 72.91±4.05 92.45±10.21 FBS 86.90±3.73 147.05±30.89 HbA1c 5.27±0.22 7.60±0.86 WBC 5.74±1.29(10) 6.89±1.49 (19) AST 23.05±5.37 24.89±10.59(19) ALT 15.05±6.80 26.68±13.29 (19) BUN 14.38±3.70(8) 13.68±3.77 (19) Creatinie 0.66±0.10 0.80±0.20 (19) LDL 116.96±30.48 113.60±40.39(18) M/C ratio -(0) 36.78±68.74(18) eGFR 93.46±16.20(18) 93.78±20.72(19) HOMA-IR 0.32±0.36 3.09±3.30 (15) SBP 118.60±17.55 126.50±20.69 DBP 75.15±7.81 80.05±16.70

1-2 RNA isolation and sequencing from serum

RNA was isolated from the sera of the normal group and the SLGT2 inh group selected in Example 1-1, and the SLGT2 inh group took serum samples before and after taking the SGLT2 inhibitor for analysis.

Specifically, exosomes were isolated using Exoquick (SBI, USA) from serum samples collected from the normal group, the diabetic group before taking the SGLT2 inhibitor, and the diabetic group after taking the SGLT2 inhibitor, and Qiagen Total RNA was extracted using the miRNeasy kit, and the quality of the extracted total RNA was measured using an Agilent RNA Bioanalyzer according to the manufacturer's instructions. Then, using the isolated RNA, a library was prepared by Macrogen using Takara SMARTer smRNA for illumina kit, and then microRNA was detected by performing next-generation sequencing (NGS) with Hiseq 2500.

Selection of biomarkers for predicting drug responsiveness to diabetes treatment

2-1: MicroRNA analysis with difference in expression level in normal group vs. diabetic group before taking SGLT2 inhibitor

First, in order to identify microRNAs (miRNAs) with different expression levels in the blood-derived exosomes of 20 normal group and 20 diabetic patients before taking the SGLT2 inhibitor, each subject according to the method of Example 1-2 Exosomes were isolated from the serum collected from the fields, and NGS analysis was performed on the extracted total RNA. As a result of the analysis, 523 miRNAs were detected, and the expression levels of the detected miRNAs were compared.

As a result, as shown in FIG. 1a , among 523 miRNAs, 105 miRNAs with reduced expression more than twice (p < 005) in the diabetic group (Before) before taking the SGLT2 inhibitor compared to the normal group (HV) were increased in expression 75 miRNAs were found. In addition, the results of a volcano plot according to the expression level of miRNAs showing the significant expression change are shown in FIG. 1B.

2-2: MicroRNA analysis with difference in the expression level of diabetic group before taking SGLT2 inhibitor vs. diabetic group after taking SGLT2 inhibitor

In order to identify miRNAs having different expression levels in the blood-derived exosomes of 20 diabetic patients before taking the SGLT2 inhibitor and 20 diabetic patients after taking the SGLT2 inhibitor, the present inventors conducted a study on total RNA in exosomes obtained in the same manner as above. NGS analysis was performed. As a result of the analysis, 523 miRNAs were detected, and the expression levels of the detected miRNAs were compared.

As a result, as shown in FIG. 2a , among 523 miRNAs, 14 miRNAs whose expression decreased more than twice (p < 005) in the diabetic group after taking the SGLT2 inhibitor compared to the group of diabetic patients before taking the SGLT2 inhibitor (P < 005) , 28 miRNAs with increased expression were found. In addition, the results of the volcano plot according to the expression level of the miRNA showing the significant expression change are shown in Figure 2b.

2-3: MicroRNA analysis with difference in expression level in diabetic group after taking SGLT2 inhibitor compared to normal group

The present inventors performed NGS analysis on total RNA in exosomes obtained in the same manner as above to identify miRNAs with different expression levels in the blood-derived exosomes of 20 patients in the normal group and 20 patients in the diabetic group after taking the SGLT2 inhibitor. did. As a result of the analysis, 523 miRNAs were detected, and the expression levels of the detected miRNAs were compared.

As a result, as shown in FIG. 3a , among 523 miRNAs, 103 miRNAs whose expression decreased more than twice (p < 005) in the diabetic patient group (After) after taking the SGLT2 inhibitor compared to the normal group (HV) were 103 miRNAs with increased expression 77 miRNAs were found. In addition, the results of the volcano plot according to the expression level of the miRNA showing the significant expression change are shown in Figure 3b.

2-4: Selection of biomarkers for predicting drug reactivity

Referring to the results of FIGS. 1 to 3, the expression level is different between the normal group and diabetic patients before taking the SGLT2 inhibitor, and microRNAs whose expression pattern is restored to a level similar to that of the normal group by taking the SGLT2 inhibitor were finally selected, The selected markers and sequence information are shown in Tables 2 and 3 below.

Biomarkers for predicting drug reactivity fold change (+/-) Mature miRNA Before/HV After/Before After/HV ANOVA hsa-miR-136-3p -5.01 2.31 -2.17 *** hsa-miR-150-3p 2.37 -2.05 1.16 *** hsa-miR-15a-3p -4.48 2.06 -2.18 ***

marker sequence information Mature miRNA sequence SEQ ID NO: hsa-miR-136-3p CAUCAUCGUCUCAAAUGAGUCU One hsa-miR-150-3p CUGGUACAGGCCUGGGGGACAG 2 hsa-miR-15a-3p CAGGCCAUAUUGUGCUGCCUCA 3

As shown in Table 2, the miR-136-3p, miR-150-3p and miR-15a-3p markers were finally selected, and the expression level of each marker was determined in the normal group (HV) and the diabetic group before taking the SGLT2 inhibitor (Before). ) and after taking the SGLT2 inhibitor, as a result of analysis, as shown in FIG. 4 , a significant difference in expression level was observed between the normal group and diabetic patients before taking the antidiabetic drug, and the normal group after taking the SGLT2 inhibitor Similarly, it was confirmed that the expression level was restored.

<110> Keimyung University <120> MicroRNA biomarker for predicting drug response to diabetes treatment and use thereof <130> 1067798 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-136-3p <400> 1 caucaucguc ucaaaugagu cu 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-150-3p <400> 2 cuggacagg ccugggggac ag 22 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-15a-3p <400> 3 caggccauau ugugcugccu ca 22

Claims (10)

A biomarker composition for predicting drug reactivity of an antidiabetic agent, comprising at least one microRNA (microRNA) selected from the group consisting of miR-136-3p, miR-150-3p and miR-15a-3p.
The method according to claim 1, wherein miR-136-3p is represented by the nucleotide sequence of SEQ ID NO: 1, miR-150-3p is represented by the nucleotide sequence of SEQ ID NO: 2, and miR-15a-3p is represented by the nucleotide sequence of SEQ ID NO: 3 A biomarker composition for predicting drug reactivity of an antidiabetic agent, characterized in that
The biomarker composition for predicting drug reactivity of an antidiabetic drug according to claim 1, wherein the antidiabetic drug is a sodium glucose cotransporter 2 (SGLT2) inhibitor.
The biomarker composition for predicting drug reactivity according to claim 1, wherein the diabetes is type 2 diabetes.
A composition for predicting drug response to a therapeutic agent for diabetes, comprising an agent for measuring the expression level of the biomarker composition of any one of claims 1 to 4.
[Claim 6] The composition for predicting drug reactivity to an antidiabetic agent according to claim 5, wherein the agent for measuring the expression level is a sense and antisense primer or probe that complementarily binds to microRNA.
[Claim 5] A diagnostic kit for predicting drug response to a therapeutic agent for diabetes, comprising an agent for measuring the expression level of the biomarker composition of any one of claims 1 to 4.
(a) measuring the expression level of the biomarker composition of any one of claims 1 to 4 in a biological sample derived from a subject before and after administration of a diabetes treatment agent; and
(b) comparing the microRNA expression level before and after administration of the diabetes treatment agent;
A method of providing information on drug reactivity of an antidiabetic agent comprising a.
The method of claim 8, wherein the expression level in step (a) is next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain Reaction (Real-time PCR), RNase protection assay (RPA), microarray (microarray), characterized in that measured through one or more methods selected from the group consisting of northern blotting (northern blotting) A method of providing information on drug reactivity of antidiabetic drugs.
The method of claim 8, wherein after administration of the antidiabetic agent, when the miR-136-3p or miR-15a-3p expression increases and the miR-150-3p expression decreases, the drug reactivity to the antidiabetic agent is excellent, so that there is a diabetes treatment effect. A method of providing information on drug reactivity of an antidiabetic agent, characterized in that the information is provided as one.

Images