CN114317710A - Primer probe combination for detecting SNP typing of polymorphic site of GLP1R gene, kit and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, in particular to a primer-probe combination for detecting SNP typing of a GLP1R gene polymorphism site, a kit and an application thereof. The primer-probe combination comprises a pair of primers, a probe PA and an application. Probe PG; the above-mentioned primer-probe combination is included in the kit for detecting the rs6923761 polymorphism site of the GLP1R gene. When the kit of the invention detects the gene mutation related to the medication of sitagliptin and vildagliptin, the detection specificity is high, the sensitivity is high, the safety is high, the operation is simple, the time-consuming is short, the result is easy to read, and has the advantages of high detection specificity, high sensitivity and high safety. good clinical application value.

Description

Primer-probe combination, kit and application for detecting SNP typing of GLP1R gene polymorphism sites

technical field

The present invention relates to a primer-probe combination and its application, in particular to a primer-probe combination for detecting SNP typing of a GLP1R gene polymorphism site, a kit and its application.

Background technique

Diabetes is one of the important chronic metabolic diseases that threaten people's health, and its incidence is increasing year by year. In 2017, the prevalence of diabetes in China was 11.2%, and the number of patients was about 156 million, ranking first in the world. Type 2 diabetes is the main type of diabetes. Incretin-like peptide 1 is secreted by intestinal L cells and binds to the Glucagon-like peptide 1 receptor (GLP1R) on the surface of pancreatic islet B cells to regulate insulin secretion through a G protein-coupled pathway. In recent years, studies have found that although the postprandial GLP-1 level in patients with type 2 diabetes does not change, the insulin secretion function is significantly impaired; in addition, some patients with type 2 diabetes are not sensitive to exogenous GLP-1 stimulation, suggesting that the It is related to the abnormal function of the GLP1R gene. The GLP1R gene polymorphism can significantly affect the response of pancreatic islet B cells after GLP-1 infusion in healthy people. The GLP1R rs6923761 gene polymorphism is associated with decreased insulin secretion stimulated by GLP-1. Detection of GLP1R gene polymorphisms may help to clarify the causes of individual differences and guide disease treatment.

Vildagliptin is an oral hypoglycemic drug, a dipeptidyl peptidase 4 inhibitor, also known as a DPP-4 inhibitor, this drug can enhance the sensitivity of insulin, mainly through the inhibition of dipeptidyl peptidase 4 to enhance glucose-dependent insulin secretion. Vildagliptin has a certain hypoglycemic effect on fasting blood sugar, postprandial blood sugar, and hyperglycemia. The GLP1R rs6923761 gene polymorphism was associated with the efficacy of sitagliptin or vildagliptin. Patients with AA genotype and type 2 diabetes may be less responsive to sitagliptin or vildagliptin than patients with GG genotype. Patients with the GG genotype and type 2 diabetes may have an increased response to sitagliptin or vildagliptin compared with patients with the AA genotype. Therefore, before clinical medication, the detection of GLP1R gene polymorphism is of great guiding significance for patients with AA or AG to change the dressing or increase the dose of sitagliptin or vildagliptin. Helps monitor blood sugar levels.

SUMMARY OF THE INVENTION

In view of the above problems, the present invention provides a primer-probe combination, a kit and applications for detecting SNP typing of GLP1R gene polymorphism sites.

For achieving the above object, the technical scheme adopted in the present invention is:

A primer-probe combination for detecting GLP1R gene polymorphism site SNP typing, the forward primer of the primer-probe combination for detecting GLP1R gene rs6923761 polymorphism site SNP typing is shown in SEQ ID NO: 1, reverse The primer is shown in SEQ ID NO: 2, the probe PA is shown in SEQ ID NO: 3, and the probe PG is shown in SEQ ID NO: 4.

A kit comprising the above-mentioned primer-probe combination for detecting GLP1R gene polymorphism site SNP typing.

Further, the kit contains a primer-probe combination solution;

The concentration ratio of forward primer, reverse primer, probe PA, and probe PG in the primer-probe combination solution is 1:1:1:0.5.

Further, the reagents in the kit also include a reaction solution.

Further, the reaction solution was prepared by 0.2 parts by volume of Taq DNA polymerase, 10 parts by volume of buffer Mix for SNP3#, 3 parts by volume of Mega buffer Mix for SNP and 3.8 parts by volume of ddH ₂ O.

An application of the above kit in detecting the polymorphism site of GLP1R gene rs6923761.

Further, the specific steps of the application are to take the nucleic acid of the sample to be tested and the reagents in the kit respectively, shake and mix, centrifuge to prepare a reaction system to be tested, and then carry out a PCR amplification reaction, and each reaction obtains 2 amplification reagents. Amplify the graph and CT value, and then judge the genotype of the nucleic acid of the sample to be tested according to the obtained amplification graph and CT value.

Further, the reaction system to be tested is 17 μL of reaction solution, 1 μL of primer-probe combination solution and 2 μL of sample nucleic acid to be tested;

The concentration ratio of forward primer, reverse primer, probe PA, and probe PG in the primer-probe combination solution is 1:1:1:0.5;

The reaction solution was prepared by 0.2 vol Taq DNA polymerase, 10 vol buffer Mix for SNP 3#, 3 vol Mega buffer Mix for SNP and 3.8 vol ddH ₂ O.

Further, the amplification curve algorithm is set to the absolute fluorescence value method, the manual threshold is adjusted to 100 for analysis, and the standard for judging the genotype of the nucleic acid of the sample to be tested is:

When the CT value of FAM is less than or equal to 38 and the CT value of HEX is greater than 38/no CT value, the genotype is determined as GG type;

When the CT value of HEX≤38 and the CT value of FAM>38/no CT value, the genotype is determined as AA type;

When the CT value of FAM is less than or equal to 38 and the CT value of HEX is less than or equal to 38, the genotype is determined to be AG;

When the CT value of FAM>38/no CT value and the CT value of HEX>38/no CT value, retesting is required.

Further, the conditions of the PCR amplification reaction were pre-denaturation at 95°C for 2 min, followed by denaturation at 95°C for 5s and annealing at 58°C for 15s, for a total of 40 cycles.

The beneficial effects of the primer-probe combination, the kit and the application for detecting the SNP typing of the GLP1R gene polymorphism site of the present invention are as follows:

The primer-probe combination for detecting GLP1R gene polymorphism site SNP typing and the kit thereof of the present invention can detect human GLP1R (rs6923761) gene by fluorescent quantitative PCR, and the accuracy is high. Compared with first-generation sequencing, the accuracy is 100%; the detection limit is lower than the existing market products, which is 0.1ng/μL; the precision CV value is less than or equal to 4.28%; Influence, and there is no cross-reaction with Escherichia coli nucleic acid, Staphylococcus aureus nucleic acid, Enterobacter cloacae nucleic acid, etc.;

When using the kit of the invention to detect the gene mutation related to the medication of sitagliptin and vildagliptin, the detection specificity is high, the sensitivity is high, the safety is high, the operation is simple, the time-consuming is short, and the result is easy to read;

By optimizing the kit, the application process of the entire kit is simple and fast, and the PCR procedure only takes 50 minutes, the cost is low, and the detection speed is significantly faster than the first-generation sequencing detection speed;

The kit of the invention has a low demand for each sample, and only needs 10-50 ng DNA for detection;

The kit of the invention can assist in judging the drug use of sitagliptin and vildagliptin, so as to accurately judge the drug use situation, provide sufficient basis for disease diagnosis, and also provide a solid foundation for treatment plan, and has good clinical Value.

Description of drawings

1 is a graph showing the results of a first group of primer-probe combination screening experiments in Example 1 of the present invention;

2 is a graph showing the results of a screening experiment of the second group of primer-probe combinations in Example 1 of the present invention;

3 is a graph showing the results of a third group of primer-probe combination screening experiments in Example 1 of the present invention;

4 is a graph showing the results of a concentration screening experiment of primer-probe combination solution A in Example 1 of the present invention;

5 is a graph showing the results of a concentration screening experiment of primer-probe combination solution B in Example 1 of the present invention;

6 is a graph showing the results of a concentration screening experiment of primer-probe combination solution C in Example 1 of the present invention;

7 is a graph showing the results of a concentration screening experiment of primer-probe combination solution D in Example 1 of the present invention;

8 is a graph showing the results of a concentration screening experiment of primer-probe combination solution E in Example 1 of the present invention;

Fig. 9 is the result diagram of the detection limit screening experiment of the kit in Example 3 of the present invention;

10 is a graph showing the results of the precision test of the kit in Example 4 of the present invention.

Detailed ways

The technical solutions in the embodiments of the present invention will be clearly and completely described below. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can do so without departing from the connotation of the present invention. Similar promotion, therefore, the present invention is not limited by the specific embodiments disclosed below.

Reagents: AK Taq DNA polymerase, AK buffer Mix for SNP 3#, and Mega buffer Mix for SNP were purchased from Philips Biotechnology Co., Ltd.

Example 1 Design and screening of primer-probe combinations

1) Design of primer-probe combination

1) Design of primer-probe combination

Query the polymorphic site information of GLP1R gene rs6923761 on the NCBI website. The specific gene sequence is as follows:

Among them, the mutation direction: G>A,

Gene frequencies: GG-0.971, AG-0.029, AA-close to 0.

According to the polymorphic site information of GLP1R gene rs6923761 obtained from the query, import it into biological software such as Beacon Designer, oligo, Primer Primer 5, etc., and design primer pairs based on the principles of primer probe design and personal probe design experience; The primer pair is designed, and the two probes (PG and PA) corresponding to the primer pair are designed. In the process of involving probes, in order to use probes to distinguish genotypes in the application process, when designing probes, the 5' of PG probes are modified with FAM fluorescence, and the 5' of PA probes are modified with HEX fluorescence. After the design was completed, the sequences of the designed primer-probe combinations were introduced into NCBI for specific comparison. The specificity was 100%, and was not consistent with other gene sequences. The screening design results are shown in Table 1. It should be noted here that in the process of designing the primer-probe combination, due to the contingency of the application effect of the primer-probe combination, we have carried out multiple designs, and only three of them are listed here.

Table 1 Designed primer-probe combinations for detecting SNP typing of GLP1R gene rs6923761 polymorphism site

name Sequence 5' to 3' 5' modification 3' modification F1 TGGGCTACGCACTCTCCTT R1 TGGGCTGCTTCATTCCTCTATC PA1 TCCTCAGCTTCAGG HEX MGB PG1 TCCTCCTCGGCTTC FAM MGB F2 GTGGGCTACGCACTCTCCTT R2 TTGGGCTGCTTCATTCCTCTA PA2 ATCCCTCCTCAGCTTC HEX MGB PG2 CTCCTCGGCTTCAGGT FAM MGB F3 GTGGGCTACGCACTCTCCTT R3 GTCCGGGCCACCTTACCT PA3 CGATCCTCCTCAGCT HEX MGB PG3 CGATCCTCCTCGGC FAM MGB

The designed primer-probe combinations were entrusted to General Biological Company for synthesis.

2) Primer probe combination screening

PCR amplification experiments were carried out for the primer-probe combinations designed in Table 1, and the specific process was as follows:

Take the primer-probe combination in Table 1 to prepare the primer-probe combination solution. The preparation method is as follows: take 1 μL of the forward primer with a concentration of 100 μM, 1 μL of the reverse primer with a concentration of 100 μM, 1 μL of the probe PA with a concentration of 100 μM, and 1 μL of the reverse primer with a concentration of 100 μM. Probe PG with a concentration of 100 μM was mixed, and DEPC water was added to make up to 10 μL to obtain the corresponding primer-probe combination solution (ie 1 μL of F1 with a concentration of 100 μM, 1 μL of R1 with a concentration of 100 μM, 1 μL of PA1 with a concentration of 100 μM, 1 μL PG1 at a concentration of 100 μM and 6 μL of DEPC in water were used to prepare primer-probe solution 1, and so on).

Take 0.2μL AK Taq DNA polymerase, 10μL AK buffer Mix for SNP 3#, 3μL Megabuffer Mix for SNP and 3.8μL ddH ₂ O, mix well, centrifuge to get the reaction solution (the amount of the reaction solution is required for 1 reaction well When the experimental amount is expanded, it only needs to be expanded by the corresponding multiple).

Entrusted General Biological Company to synthesize the two genotype plasmids in Table 2;

Table 2 GLP1R gene rs6923761 polymorphism site genotype plasmid

Take the two genotype plasmids in Table 2 and use 0.1TE buffer to dilute to a concentration of 0.0005ng/μL, respectively, to obtain AA-type plasmid dilution (diluted GLP1R-A plasmid) and GG-type plasmid dilution (diluted GLP1R-G). plasmids).

Mix equal volumes of AA-type plasmid dilution solution and GG-type plasmid dilution solution to obtain AG-type plasmid dilution solution.

AA type plasmid dilution liquid, GG type plasmid dilution liquid and AG type plasmid dilution liquid are collectively referred to as plasmid dilution liquid.

17 μL of reaction solution, 1 μL of primer-probe combination solution and 2 μL of plasmid diluent were added to each reaction well of the eight strips in sequence, mixed well, and centrifuged to obtain a corresponding reaction system.

Among them, each primer-probe combination solution was added to 6 reaction wells. Two of the 6 reaction wells added AA-type plasmid dilution solution, and the other two reaction wells added GG-type plasmid. Diluent, the last two reaction wells are AG-type plasmid dilution solution (that is, there are 2 reaction wells for adding primer-probe combination solution 1 and AA-type plasmid dilution solution, adding primer-probe combination solution 1 There are also 2 reaction wells for GG-type plasmid dilution solution, and 2 reaction wells for adding primer-probe combination solution 1 and AG-type plasmid dilution solution, and so on).

Take the above reaction system and the control reaction system respectively, move them to the fluorescence quantitative PCR instrument, and carry out the PCR amplification reaction. The reaction conditions are pre-denaturation at 95 °C for 2 min, then denaturation at 95 °C for 5 s, and annealing at 58 °C for 15 s, a total of 40 Cycle, and the detection results obtained are shown in Table 3 and Figures 1 to 3 (the manual threshold is adjusted to 100).

Table 3 List of results of primer-probe combination screening experiments

The quality of the probe is screened according to the CT value and fluorescence intensity. Ideally, the reaction wells that only add the AA-type plasmid dilution should only have HEX fluorescence (green), and the reaction wells that only add the GG-type plasmid dilution should only have The FAM fluorescence (blue) is on-line, while the wells to which the AG-type plasmid dilution is added should have both fluorescence on-line. It can be seen from Figure 1 that in the reaction systems corresponding to the three plasmid dilutions, the FAM fluorescence (blue) has a high starting line, and the HEX fluorescence (green) starting line is very low, indicating that the primer-probe combination cannot distinguish the three types. Plasmid dilution solution; as can be seen from Figure 2, there is almost no starting line in the reaction system corresponding to the AA-type plasmid dilution solution, the HEX fluorescence (green) in the reaction system corresponding to the GG-type plasmid dilution solution is too high, and the FAM fluorescence (blue) is too high. In the reaction system corresponding to the AG-type plasmid dilution, the FAM fluorescence (blue) has no start, and the HEX fluorescence (green) has a slight start, indicating that the primer-probe combination cannot distinguish the three plasmid dilutions. Therefore, this group was discarded; as can be seen in Figure 3, only HEX fluorescence (green) has a starting line in the reaction system corresponding to the AA-type plasmid dilution, and only FAM fluorescence (blue) in the reaction system corresponding to the GG-type plasmid dilution. Starting line, the HEX fluorescence (green) and FAM fluorescence (blue) in the reaction system corresponding to the AG-type plasmid dilution have the starting line, indicating that the three plasmid dilutions can be clearly distinguished, and the experimental results are in line with expectations.

At the same time, the real AA-type nucleic acid samples were used to replace the AA-type plasmid dilution solution, the real GG-type nucleic acid samples were used to replace the GG-type plasmid dilution solution, and the AG-type nucleic acid samples were used to replace the AG-type plasmid dilution solution. The combination of primers and probes claimed in the invention can clearly distinguish the three genotypes.

Therefore, the forward primer of the primer-probe combination for detecting the SNP typing of the GLP1R gene rs6923761 polymorphic site determined by the present invention is shown in SEQ ID NO: 1, the reverse primer is shown in SEQ ID NO: 2, and the probe PA is shown in SEQ ID NO:3, and probe PG is shown in SEQ ID NO:4.

However, in the reaction system corresponding to the AG-type plasmid diluent, the FAM fluorescence (blue) has a higher starting line than the HEX fluorescence (green), and it is necessary to adjust the two fluorescences to be highly consistent. Therefore, it is necessary to adjust the ratio of the primer-probe combination dosage. , reduce the amount of probe PG.

3) Proportion adjustment of primer-probe combination dosage

According to the preparation method in step 2) primer-probe combination screening, different proportions of primer-probe combination solutions are prepared, and the difference from step 2) is only:

Only 0.6 μL of probe PG was added to the primer-probe combination solution A;

Add only 0.7 μL of probe PG to primer-probe combination solution B;

Only 0.8 μL of probe PG was added to the primer-probe combination solution C;

Add only 0.5 μL of probe PG to primer-probe combination solution D;

Only 0.4 μL of probe PG was added to the primer-probe combination solution E;

Then, according to the PCR amplification experiment in step 2) primer-probe combination screening, the primer-probe combination solutions A to E were measured. The measurement results are shown in Tables 4-5 and Figures 4-8.

Table 4 List of experimental results of dosage ratio screening (1)

Table 5 List of experimental results of dosage ratio screening (two)

It can be seen from Tables 4-5 and Figures 4-8 that when using primer-probe combination solution D, in the reaction system corresponding to the AG-type plasmid dilution solution, the starting line of FAM fluorescence (blue) is basically consistent with HEX fluorescence (green). , and 3 genotypes can be clearly identified. Therefore, the final determined primer-probe combination dosage ratio is 1 μL of forward primer, 1 μL of reverse primer, 1 μL of probe PA, 0.5 μL of probe PG and 6.5 μL of DEPC water (this is a formula for 10 people, and the proportion is equal when the dosage is large. can be expanded).

4) Preparation and application of the kit

Utilize the primer-probe combination determined in step 2) primer-probe combination screening and the dosage determined in step 3) the ratio adjustment of primer-probe combination dosage to prepare the kit, wherein, the primer-probe combination solution is a volume ratio of 1: 1:1:0.5:6.5 The forward primer at a concentration of 100 μM, the reverse primer at a concentration of 100 μM, the probe PA at a concentration of 100 μM, and the probe PG at a concentration of 100 μM were mixed with DEPC water (forward primer, The concentration ratio of reverse primer, probe PA, and probe PG is 1:1:1:0.5); the reaction solution is composed of 0.2 μL AK Taq DNA polymerase, 10 μL AK buffer Mix for SNP 3#, 3 μL Megabuffer Mix for SNP Mixed with 3.8 μL ddH ₂ O, and centrifuged to prepare (the amount of the reaction solution is the amount required for one reaction well, when the experimental amount is enlarged, it only needs to be enlarged by the corresponding multiple).

During detection, 17 μL of reaction solution, 1 μL of primer-probe combination solution and 2 μL of sample nucleic acid to be tested were sequentially added to each reaction well of the eight strips, mixed well, and centrifuged to obtain a reaction system to be tested.

The eight consecutive rows were moved to the fluorescence quantitative PCR instrument, and the PCR amplification reaction was carried out. The reaction conditions were pre-denaturation at 95 °C for 2 min, then denaturation at 95 °C for 5 s, and annealing at 58 °C for 15 s, a total of 40 cycles. Each reaction well The amplification curves and CT values of the two fluorescences of FAM and HEX are obtained, and the detection results are analyzed according to the two amplification curves and CT values obtained in each reaction well to determine the genotype of the nucleic acid of the sample to be tested. The amplification curve algorithm is set to the absolute fluorescence value method, and the manual threshold is adjusted to 100 for analysis. The standard for judging the genotype of the nucleic acid of the sample to be tested is:

When the CT value of FAM is less than or equal to 38 and the CT value of HEX is greater than 38/no CT value, the genotype is determined as GG type;

When the CT value of HEX≤38 and the CT value of FAM>38/no CT value, the genotype is determined as AA type;

When the CT value of FAM is less than or equal to 38 and the CT value of HEX is less than or equal to 38, the genotype is determined to be AG;

When the CT value of FAM>38/no CT value and the CT value of HEX>38/no CT value, retesting is required.

The correctness verification test of the test kit of Example 2

Extracted whole blood nucleic acid samples from 50 individuals, determined the concentration, and commissioned Qingke Bio to perform next-generation sequencing on the rs6923761 polymorphism of the GLP1R gene, using the results of next-generation sequencing as the gold standard;

The preparation and application of the kit in Example 1 were used to detect the above-mentioned 50 whole blood nucleic acid samples respectively, and the detected gene results were compared with the first-generation sequencing results to verify the accuracy of the kit and its application. The specific results See the table below:

Table 6 List of correctness verification test results

It can be seen from the above table that the kit of the present invention and its application have good accuracy.

Example 3 Detection limit experiment of the kit

Take the whole blood nucleic acid samples of the two genotypes in Table 6 (the No. 1 and No. 3 whole blood samples selected in this example), and prepare different concentrations of 0.01, 0.1, 0.5, 1, 10, and 100 ng/μL respectively. Concentrations of GG-type nucleic acid sample diluent and different concentrations of AG-type nucleic acid sample diluent;

Using the preparation and application of the kit in Example 1, different concentrations of GG type whole blood nucleic acid sample dilutions and different concentrations of AG type whole blood nucleic acid sample dilutions were measured respectively. The specific results are shown in Table 7 and FIG. 9 .

Table 7 List of detection results of plasmid dilutions with different concentrations

It can be seen from Table 7 and Figure 9 that the kit of the present invention detects three genotypes of whole blood nucleic acid samples with a concentration of 0.1 ng/μL and above.

The detection limits of the GG type whole blood nucleic acid sample diluent and the AG type whole blood nucleic acid sample diluent with a concentration of 0.1 ng/μL were tested for stability again. The specific results are shown in Table 8.

Table 8 List of test results of whole blood nucleic acid sample diluent with a concentration of 0.1ng/μL

It can be seen from Table 8 that the detection rate of the GG type whole blood nucleic acid sample dilution with a concentration of 0.1ng/μL detected by the kit of the present invention is 95%, and the concentration of AG type whole blood with a concentration of 0.1ng/μL is 95%. The nucleic acid sample diluent has a positive detection rate of 95%, which meets the requirements of the industry (generally, the detection limit is 20 times and the positive detection rate is greater than or equal to 90%). Therefore, the minimum detection rate of the three genotypes of the kit of the present invention is The limit (LOD) was 0.1 ng/μL.

The precision test of the test kit of Example 4

Using the preparation and application of the kit in Example 1, 10 repeated tests (same time, place, person and instrument, and within a short period of time) were performed on whole blood nucleic acid samples of 3 genotypes, and CV values were calculated , the specific results are shown in Table 9 and Figure 10.

Table 9 List of test results of precision test

It can be seen from Table 9 and Figure 10 that the CV values of the primer-probe combinations of the present invention are all ≤4.28%, which is lower than the industry standard (CV value≤5%), and the reagents have good precision.

The interference test of the test kit of Example 5

Using the preparation and application of the kit in Example 1, the whole blood of three genotypes with heme concentration≤200g/L, triglyceride concentration≤1000mg/dL or bilirubin concentration≤2mg/dL were added respectively. Nucleic acid extraction, the three extracted nucleic acid samples were detected, and the specific results are shown in Table 10.

Table 10 List of test results of interference test

As can be seen from Table 10, the detection performance of the kit of the present invention is not affected by heme, triglyceride and bilirubin, and has strong anti-interference ability.

The preparation and application of the kit in Example 1 were used again to detect nucleic acid samples added with a concentration of 0.01ng/μL of Escherichia coli nucleic acid, Staphylococcus aureus nucleic acid or Enterobacter cloacae nucleic acid. The specific results are shown in Table 11.

Table 11 List of test results of interference test

As can be seen from Table 11, the kit of the present invention has no cross-reaction with Escherichia coli nucleic acid, Staphylococcus aureus nucleic acid, Enterobacter cloacae nucleic acid, etc. (these are all potential non-human genome nucleic acid interfering substances).

Example 6 Detection of actual clinical samples of the kit

The clinical samples used in this example are from the whole blood samples collected by the Langfang District Hospital (the principle of the voluntary collector), the nucleic acid of the samples to be tested is extracted from the whole blood samples, and the test kit and the detection method of the present invention are used for detection. The internal control substance and the positive control substance were compared, and the genotype of the nucleic acid sample was detected and judged, which took 50 minutes.

For the nucleic acid of the sample to be tested extracted from the whole blood sample, and the nucleic acid of the sample to be tested extracted from the whole blood sample, the company was entrusted to perform next-generation sequencing on the rs6923761 polymorphism of the GLP1R gene, and the sequencing time was 2 days.

The actual clinical sample detection rate of the kit of the present invention is faster than the detection rate of the existing kit.

The specific test results of actual clinical samples are shown in the following table:

Table 12 List of test results of actual clinical samples

Nucleic acid of the sample to be tested The number of samples detected by the kit of the present invention Number of samples tested by existing kits AA 1 1 AG 2 2 GG 141 141

Obviously, the described embodiments are only some, but not all, embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

sequence listing

<110> Langfang Nuodao Chinese Medical Laboratory Co., Ltd.

<120> Primer-probe combination, kit and application for detecting GLP1R gene polymorphism site SNP typing

<130> 2021-12

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Synthetic()

<400> 1

gtgggctacg cactctcctt 20

<210> 2

<211> 18

<212> DNA

<213> Synthetic()

<400> 2

gtccgggcca ccttacct 18

<210> 3

<211> 15

<212> DNA

<213> Synthetic()

<400> 3

cgatcctcct cagct 15

<210> 4

<211> 14

<212> DNA

<213> Synthetic()

<400> 4

cgatcctcct cggc 14

Claims (10)

1. A primer probe combination for detecting SNP typing of a polymorphic site of a GLP1R gene is characterized in that a forward primer of the primer probe combination for detecting SNP typing of the polymorphic site of the GLP1R gene is shown as SEQ ID NO: 1, and the reverse primer is shown as SEQ ID NO: 2, and the probe PA is shown as SEQ ID NO: 3, and the probe PG is shown as SEQ ID NO: 4, respectively.

2. A kit comprising the primer probe combination for detecting SNP typing of polymorphic sites of GLP1R gene according to claim 1.

3. The kit according to claim 2, wherein the kit contains a primer probe combination solution;

the concentration ratio of the forward primer, the reverse primer, the probe PA and the probe PG in the primer probe combination solution is 1: 0.5.

4. The kit according to claim 2 or 3, wherein the reagent in the kit further comprises a reaction solution.

5. The kit according to claim 4, wherein the reaction solution comprises 0.2 parts by volume of Taq DNA polymerase, 10 parts by volume of buffer Mix for SNP # 3, 3 parts by volume of Mega buffer Mix for SNP, and 3.8 parts by volume of ddH₂And O is prepared.

6. Use of the kit of any one of claims 2-5 for detecting rs6923761 polymorphic site of a GLP1R gene.

7. The application of claim 6, wherein the application comprises the specific steps of taking the nucleic acid of the sample to be detected, respectively mixing with the reagents in the kit, oscillating, mixing uniformly, centrifuging to prepare a reaction system to be detected, carrying out PCR amplification reaction, obtaining 2 amplification curve graphs and CT values for each reaction, and judging the genotype of the nucleic acid of the sample to be detected according to the obtained amplification curve graphs and CT values.

8. The kit according to claim 7, wherein the reaction system to be tested is 17 μ L of reaction solution, 1 μ L of primer probe combination solution and 2 μ L of sample nucleic acid to be tested;

the concentration ratio of the forward primer, the reverse primer, the probe PA and the probe PG in the primer probe combination solution is 1: 0.5;

the reaction solution was composed of 0.2 volume parts of Taq DNA polymerase, 10 volume parts of buffer Mix for SNP 3#, 3 volume parts of Mega buffer Mix for SNP and 3.8 volume parts of ddH₂And O is prepared.

9. The use according to claim 7 or 8, wherein the criterion for determining the genotype of the nucleic acid in the test sample is:

when the CT value of FAM is less than or equal to 38 and the CT value of HEX is more than 38/no CT value, the genotype is judged as GG type;

when the CT value of HEX is less than or equal to 38 and the CT value of FAM is more than 38/no CT value, the genotype is judged as AA;

when the CT value of FAM is less than or equal to 38 and the CT value of HEX is less than or equal to 38, determining the genotype as AG type;

when the CT value of FAM is > 38/no CT value and the CT value of HEX is > 38/no CT value, then retesting is required.

10. The use of claim 7 or 8, wherein the PCR amplification reaction is performed under conditions of 5 ℃ pre-denaturation for 2min, 95 ℃ denaturation for 5s, and 58 ℃ annealing for 15s for 40 cycles.

Images