CN112795645A - Kit for guiding hyperglycemia medication of human - Google Patents

Kit for guiding hyperglycemia medication of human Download PDF

Info

Publication number
CN112795645A
CN112795645A CN202110308130.1A CN202110308130A CN112795645A CN 112795645 A CN112795645 A CN 112795645A CN 202110308130 A CN202110308130 A CN 202110308130A CN 112795645 A CN112795645 A CN 112795645A
Authority
CN
China
Prior art keywords
seq
kit
dna
hyperglycemia
artificial sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110308130.1A
Other languages
Chinese (zh)
Other versions
CN112795645B (en
Inventor
何熲
石忆湘
魏宁
顾孝平
杨军
王保曼
张辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Kangli Diagnostic Technology Co ltd
Original Assignee
Shanghai Kangli Diagnostic Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Kangli Diagnostic Technology Co ltd filed Critical Shanghai Kangli Diagnostic Technology Co ltd
Priority to CN202110308130.1A priority Critical patent/CN112795645B/en
Publication of CN112795645A publication Critical patent/CN112795645A/en
Application granted granted Critical
Publication of CN112795645B publication Critical patent/CN112795645B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a kit for guiding a human hyperglycemia medicine, which can perform SNP (single nucleotide polymorphism) typing on 18 genetic loci simultaneously, wherein the kit comprises 18 pairs of amplification primers for detecting the 18 genetic loci, and the sequences of the 18 pairs of amplification primers are shown as SEQ ID NO. 1-36. The invention provides a brand-new site combination on the basis of researching a large sample, can be used for helping a patient with hyperglycemia to screen a hyperglycemia medicament from a gene level. The invention can provide certain reference value and clinical guidance significance when a doctor selects the hypoglycemic drug for a patient by explaining the individual applicability of different hyperglycemic drugs from a gene level.

Description

Kit for guiding hyperglycemia medication of human
Technical Field
The invention relates to the field of kits, in particular to a kit for guiding hyperglycemia medication of a human.
Background
Hyperglycemia is obtained when the blood glucose value is higher than the normal range. Hyperglycemia is also one of the three generally known as "high blood sugar". In addition, "two highs" are hypertension and hyperlipidemia, respectively. A normal fasting blood glucose level is 6.1mmol/L or less, a normal postprandial blood glucose level of two hours is 7.8mmol/L or less, and a level higher than this range is called hyperglycemia.
Under normal conditions, a human body can ensure the balance of the source and the route of blood sugar through two major regulating systems of hormone regulation and nerve regulation, so that the blood sugar is maintained at a certain level. However, under the combined action of genetic factors (such as family history of diabetes) and environmental factors (such as unreasonable diet, obesity and the like), the two major regulatory functions are disordered, and the blood sugar level is increased.
Short-time and disposable hyperglycemia does not have serious damage to human bodies. Transient hyperglycemia can occur, for example, in stress conditions or when the mood is excited and highly stressed; a large amount of sugar is taken at a time, and transient hyperglycemia can also occur; subsequently, the blood glucose level gradually returns to normal. However, long-term hyperglycemia causes pathological changes of various tissues and organs of the whole body, which leads to the occurrence of acute and chronic complications. Such as dehydration, electrolyte disorder, nutrient deficiency, resistance reduction, renal function impairment, neuropathy, fundus oculi lesion, cardiovascular and cerebrovascular diseases, diabetic foot, etc. Therefore, it is imperative to control hyperglycemia.
The patent documents for guiding the selection of hyperglycemia drugs are more, but most of the patent documents have the following problems: 1) locus generalization: when detecting the drugs with the same or similar action mechanisms, the detection sites are completely consistent; 2) site incompetence: lack of up-to-date research efforts and data for the chinese population (or the east asian, south asian populations); 3) long operation flow and high price: 4) most of the primers are detected by using RT-PCR or gene chips, the specificity of the primers is insufficient, the flux is low, and the operation process is increased by phase change; the latter is expensive and belongs to a higher-priced class in the consumption level gene detection method.
Disclosure of Invention
The invention aims to provide a kit for guiding hyperglycemia medication of a human, so that the problems that medicines with similar action mechanisms cannot be distinguished by a detection site system, the detection site is not complete, the kit is not suitable for Chinese people, the operation process is long, the price is high and the like in the prior art are solved.
In order to solve the technical problems, the invention adopts the following technical scheme:
according to a preferred scheme of the invention, a kit for guiding a drug for human hyperglycemia is provided, the kit can perform SNP typing on 18 genetic loci simultaneously, the kit comprises 18 pairs of amplification primers for detecting the 18 genetic loci, and the sequences of the 18 pairs of amplification primers are shown as SEQ ID No. 1-36.
Preferably, the kit further comprises 18 extension primers for identifying the 18 gene locus mutations, and the sequences of the 18 extension primers are shown as SEQ ID NO. 37-54.
According to a particularly preferred embodiment of the present invention, there is provided a kit for guiding a drug for hyperglycemia in a human, comprising 18 genetic loci related to 14 genes, wherein the genetic loci, mutation types, primer sequences used, and primer concentration information to be detected are as follows:
1) ADIPOQ rs2241766(T- - > G, T for wild type, G for mutant type, the same below)
PCR amplification primers/final concentration:
SEQ ID NO. 1: ACGTTGGATGCCTTGAGTCGTGGTTTCCTG (upstream primer, same below) (1-1.2. mu.M)
SEQ ID NO. 2: ACGTTGGATGGACAGTGCACATGTGGATTC (downstream primer, same below) (1-1.2. mu.M)
Nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.37：TTGGTTTCCTGGTCATG(7.00-7.15μM)
2)C11orf65 rs11212617(A--->C)
PCR amplification primers/final concentration:
SEQ ID NO.3：ACGTTGGATGATACCAATTACAAAGGGCAG(1-1.2μM)
SEQ ID NO.4：ACGTTGGATGGTGGGTTGCTTGTGGATAAC(1-1.2μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.38：GGAGGGCAGATCAGAGA(7.28-7.49μM)
3)CYP2C8 rs10509681(T--->C)
PCR amplification primers/final concentration:
SEQ ID NO.5：ACGTTGGATGTGGCATTACTGACTTCCGTG(1-1.3μM)
SEQ ID NO.6：ACGTTGGATGCTTATCTAGAAAGTGGCCAG(1-1.3μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.39：CCCGCCGTGCTACATGATGACA(9.35-9.65μM)
4)CYP2C9 rs1057910(A--->C)
PCR amplification primers/final concentration:
SEQ ID NO.7：ACGTTGGATGATGCAAGACAGGAGCCACAT(1-1.2μM)
SEQ ID NO.8：ACGTTGGATGTGTCACAGGTCACTGCATGG(1-1.2μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.40：GGGGACGAGGTCCAGAGATAC(9.15-9.35μM)
5)GLP1R rs6923761(G--->A)
PCR amplification primers/final concentration:
SEQ ID NO.9：ACGTTGGATGGAGTTAGGATGAAGCAGCCC(1-1.2μM)
SEQ ID NO.10：ACGTTGGATGTTCTCTGCTCTGGTTATCGC(1-1.2μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.41：CCACCTTACCTGAAGC(6.16-6.36μM)
6)IGF2BP2 rs1470579(A--->C)
PCR amplification primers/final concentration:
SEQ ID NO.11：ACGTTGGATGGTTTCCAAACAGCTATCATC(1-1.5μM)
SEQ ID NO.12：ACGTTGGATGGCTTGTCTATGAGTGAGAGG(1-1.5μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.42：CTTAGATAAGATCCATACGAGTT(9.66-9.96μM)
7)KCNJ11 rs2285676(G--->A)
PCR amplification primers/final concentration:
SEQ ID NO.13：ACGTTGGATGGCTCTACTTGGTCCCTGAAA(1-1.3μM)
SEQ ID NO.14：ACGTTGGATGTCTCATCAACTGCCCTCCCT(1-1.3μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.43：CCACCTGGTCCCTGAAAAAGCACC(10.14-10.44μM)
8)KCNJ11 rs5219(C--->T)
PCR amplification primers/final concentration:
SEQ ID NO.15：ACGTTGGATGCGTTGCAGTTGCCTTTCTTG(1-1.5μM)
SEQ ID NO.16：ACGTTGGATGAGGAATACGTGCTGACACGC(1-1.5μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.44：CCCCTCACGGTACCTGGGCT(8.37-8.67μM)
9)KCNQ1 rs2237892(C--->T)
PCR amplification primers/final concentration:
SEQ ID NO.17：ACGTTGGATGCAGATGATGGGAGCTGTCAC(1-1.2μM)
SEQ ID NO.18：ACGTTGGATGTGTAAGGCATCTGGTGGAGA(1-1.2μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.45：CCACAGGACTTTGCCACC(7.42-7.62μM)
10)KCNQ1 rs2237895(A--->C)
PCR amplification primers/final concentration:
SEQ ID NO.19：ACGTTGGATGCTCCTATGACTTCGATTCCC(1-1.2μM)
SEQ ID NO.20：ACGTTGGATGAGATGACAGGGCAGTGACAG(1-1.2μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.46：CCTGTCCCCGACCCC(5.43-5.47μM)
11)PPARG rs1801282(C--->G)
PCR amplification primers/final concentration:
SEQ ID NO.21：ACGTTGGATGCAAACCCCTATTCCATGCTG(1-1.3μM)
SEQ ID NO.22：ACGTTGGATGTGTATCAGTGAAGGAATCGC(1-1.3μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.47：GGGAGATTCTCCTATTGAC(7.89-8.13μM)
12)SCNN1B rs889299(G--->A)
PCR amplification primers/final concentration:
SEQ ID NO.23：ACGTTGGATGCTGAGTACCTGCCTCATTTG(1-1.2μM)
SEQ ID NO.24：ACGTTGGATGCTTGAGAACAGTCAAGAGGG(1-1.2μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.48：CCTGCCTCATTTGTGTGATTG(9.02-9.23μM)
13)SLC22A2 rs316019(C--->T)
PCR amplification primers/final concentration:
SEQ ID NO.25：ACGTTGGATGTGGCTTACGCACTTCCTCAC(1-1.3μM)
SEQ ID NO.26：ACGTTGGATGGGACTTACCAGTAATAGAGC(1-1.3μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.49：GGTTGCAGTTCACAGTT(7.08-7.28μM)
14)SLC47A2 rs12943590(G--->A)
PCR amplification primers/final concentration:
SEQ ID NO.27：ACGTTGGATGAGCTTTGTCCAGCGAGCCAC(1-1.3μM)
SEQ ID NO.28：ACGTTGGATGCTCATCCCACAAGTTGCCAT(1-1.3μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.50：CCTTAGGGGCAGGAGGAGG(8.26-8.56μM)
15)SLCO1B1 rs2306283(A--->G)
PCR amplification primers/final concentration:
SEQ ID NO.29：ACGTTGGATGATTAAACAAGTGGATAAGG(1-1.2μM)
SEQ ID NO.30：ACGTTGGATGGATGTTCTTACAGTTACAGG(1-1.2μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.51：GTTGATGTTGAATTTTCTGATGAAT(10.55-10.85μM)
16)SLCO1B1 rs4149056(T--->C)
PCR amplification primers/final concentration:
SEQ ID NO.31：ACGTTGGATGAATCTGGGTCATACATGTGG(1-1.2μM)
SEQ ID NO.32：ACGTTGGATGTATGGGAGTCTCCCCTATTC(1-1.2μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.52：CCTTGGTCATACATGTGGATATATG(10.69-10.99μM)
17)TCF7L2 rs12255372(G--->T)
PCR amplification primers/final concentration:
SEQ ID NO.33：ACGTTGGATGTGCAAATCCAGCAGGTTAGC(1-1.3μM)
SEQ ID NO.34：ACGTTGGATGCAGAGGCCTGAGTAATTATC(1-1.3μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.53：GGAATATCCAGGCAAGAAT(8.21–8.31μM)
18)TCF7L2 rs7903146(C--->T)
PCR amplification primers/final concentration:
SEQ ID NO.35：ACGTTGGATGTCTCTGCCTCAAAACCTAGC(1-1.3μM)
SEQ ID NO.36：ACGTTGGATGAACTAAGGGTGCCTCATACG(1-1.3μM)
nucleic acid mass spectrometry extension primers/final concentration:
SEQ ID NO.54：AGAGCTAAGCACTTTTTAGATA(9.46-9.76μM)
preferably, the reaction system of the multiplex PCR amplification of the kit is as follows:
Figure BDA0002988442900000051
preferably, the kit further comprises an iPLEX extension reaction system, wherein the iPLEX extension reaction system comprises the following steps:
Figure BDA0002988442900000052
the kit provided by the invention adopts the flight time mass spectrometry technology to carry out genotyping, and the whole process is divided into 7 steps: 1) extracting genetic information of the patient, typically DNA from the oral mucosal epithelium of the patient; 2) specific fragment amplification, performing multiplex PCR on specific fragments in the DNA of the patient by using the forward primer and the reverse primer in the table; 3) PCR product purification (alkaline phosphatase treatment); 4) and carrying out single-base extension on the purified PCR product. 5) Purifying the resin; 6) spotting a 384-hole chip; 7) mass spectrum detection and result analysis. The whole experimental process can be completed in one working day, and the detection period is greatly shortened. Meanwhile, the high-throughput characteristic of the time-of-flight mass spectrum meets the requirement of consumer-grade gene detection, and a plurality of samples can be processed at one time.
According to the kit provided by the invention, 18 SNP sites on 14 hyperglycemia-related genes are selected in total, and the sites are finally determined by the inventor through reading a large amount of documents, collecting evidences, grading the evidences and combining genotype frequency data in a self-built Chinese population gene mutation type database. Although there are many gene sites which can be used for the medication guidance of hyperglycemia diseases according to the existing data record, 18 SNP sites selected by people are sites which not only have abundant clinical test evidence support, but also are suitable for the genetic characteristics of Chinese population. Therefore, the key invention of the invention is that the clinical guidance significance is improved on the premise of ensuring the accuracy of the detection result by looking up the latest Chinese and foreign documents and combining the self-established database to select the sites suitable for Chinese population. Particularly, the combination of the 18 gene loci is more comprehensive and deepened compared with the locus combination related to other detection methods in the market, and different 'special genes' among the medicines can be highlighted in the medicines with the same working principle.
The downstream of the detection is the analysis of the detection result and is an important link concerning the usefulness of the detection result. The hyperglycemia medication related gene locus detected in the invention is emphasized to be 'full' and 'quasi'. "all" means all sites, including already recognized sites, and some recent research conclusions are added additionally, and the two are combined, and the detection result is deeply analyzed. The term "quasi" refers to the principle of site selection, and the current pharmacogenomic databases are generally established in western research conclusion, but because of different race, there is a certain difference in SNP ratio or phenotype. Therefore, the selected sites focus more on experiments and conclusions in east Asia population, so that the analysis and summary of the experimental results have stronger guiding significance for clinical medication.
The kit provided by the invention comprises ADIPOQ rs2241766, C11orf65 rs11212617, CYP2C8 rs10509681, CYP2C9 rs1057910, GLP1R rs6923761, IGF2BP2 rs1470579, KCNJ11 (including rs5219 and rs2285676), KCNQ1 (including rs2237895 and rs2237892), PPARG rs1801282, SCNN1B rs889299, SLC22A2 rs316019, SLC47A2 rs12943590, SLCO1B1 (including rs2306283 and rs4149056), TCF7L2 (including rs 790315546 and rs 12249372), and the typing detection of 18 SNP sites of 14 genes.
After the combination of 18 gene loci is determined, the inventor further designs a special primer for each gene locus, and finally selects a primer combination which can achieve the accurate typing of 18 SNP loci for most samples by trying different primer combinations for multiple times, and simultaneously blank control has no abnormal extension, so that the kit with very obvious application effect is obtained. And the accurate typing of 18 SNP sites can be simultaneously carried out, and the abnormal extension can not occur, which is very important for obtaining a qualified kit.
By typing detection and combining the current pharmacogenomic knowledge, the genetic level prediction can be carried out on the related parameters of the metabolic level, the adverse reaction occurrence risk and the like of different medicines. The doctor can combine the prediction result according to the actual situation, and further determine the final medication.
The sulfonylurea medicine is the most applied hypoglycemic medicine with the earliest application and most varieties, and the action mechanism of the sulfonylurea medicine is to stimulate the pancreatic beta cells to secrete insulin so as to achieve the purpose of reducing blood sugar. Common sulfonylurea drugs include Glibenclamide (Glibenclamide), Gliclazide (Gliclazide), Glipizide (Glipizide), Gliquidone (Gliquidone), Glimepiride (Glimepiride), and the like. CYP2C9 in the liver P450 metabolic enzyme family plays an important role in the metabolism of these sulfonylurea drugs. KCNJ11 encodes inward rectifying type potassium channel kir 6.2.2, and the protein and sulfonylurea receptor 1(SUR1) encoded by ABCC8 gene jointly form KATP channel, which has important meaning for normal secretion of insulin. The research shows that the KCNJ11 rs5219 mutant patients have high sensitivity to the Grignard medicines, but have high risk of secondary failure, so that subsequent observation needs to be paid attention to when the medicines are taken for a long time. TCF7L2 (transcription factor 7 analogue 2) is one of the predisposing genes of T2DM (type II diabetes) which is firstly found in human beings, and research shows that if a specific SNP exists, the standard reaching rate of the treatment effect of a patient using sulfonylurea medicines is reduced. The epithelial cell sodium channel beta subunit coding gene SCNN1B is relatively unique, and researchers at glatiramer have found that patients are at increased risk of developing edema when using glyburide in the presence of rs 889299. The meglitinide (Glinide) belongs to insulin secretagogues, is a novel oral quick-acting hypoglycemic agent, and the representative drugs of the meglitinide (repaglinide) and nateglinide (nateglinide) are repaglinide. SLCO1B1 is a kind of transport protein, and is related to the metabolism rate of the drug, and researches show that related SNP on SLCO1B1 can cause the activity of the transport protein to be reduced, so that the metabolism rate of the drug is reduced, and the blood concentration of a patient can be higher. The voltage-gated potassium channel protein encoded by KCNQ1, which is expressed in human heart, epithelial tissue, etc., and affects various physiological processes including insulin secretion, is also considered as one of the risk genes of T2 DM. The polymorphism of KCNQ1 has larger influence on the drug effect of repaglinide which is a hypoglycemic drug, and has smaller influence on nateglinide. IGF2BP2 (insulin-like growth factor 2mRNA binding protein 2) is a cytoplasmic protein that is thought to be involved in the pathogenesis of hyperglycemia (the mechanism is not clear), and studies by the university of central and south have shown that IGF2BP2 can also affect the efficacy of repaglinide. Metformin (metformin) is a biguanide representative drug, which is currently the first line of clinical medicine for treating hyperglycemia, but has great individual variability.
Organic Cation Transporters (OCTs), multidrug and toxin efflux Transporters (MATEs), and the like are one of the research directions for the factors behind the individual differences in metformin in recent years. Both OCTs and MATEs are transporters, of which the OCT2 subtype is encoded by the SLC22A2 gene and is involved in the transport of metformin from blood to renal tubules. The MATE2 subtype, encoded by the SLC47a2 gene, was also able to affect the pharmacokinetics of metformin. C11orf65 is chromosome 11 open reading frame 65, and SNPs in this region were studied abroad to influence therapeutic achievement rates for metformin. CYP2C8 is also a class of P450 metabolizing enzymes involved in the metabolism of the thiazolidinediones hypoglycemic drugs Rosiglitazone (Rosiglitazone) and Pioglitazone (Pioglitazone). Peroxisome proliferator-activated receptor gamma (PPARG) is a ligand-inducible nuclear receptor that primarily regulates glucose and lipid metabolism, and Korean researchers found that the genotype of PPARG could affect the efficacy of rosiglitazone. The ADIPOQ gene encodes C1Q and the collagen domain of adiponectin (adiponectin, C1Q and collagen domain contacting). The gene is mainly expressed in adipose tissues, the coded protein circulates in blood, and the mutation or abnormal expression of the coded protein can cause the metabolic syndrome related to insulin resistance. Researchers in China find that ADIPOQ mutant genotype carriers can obtain better blood sugar reduction effect when using pioglitazone. DPP4-1 inhibitors and GLP-1 receptor agonists are two types of hypoglycemic agents that have been widely used in recent years. The main commercial products of the former include Sitagliptin (Sitagliptin), Vildagliptin (Vildagliptin) and Linagliptin (Linagliptin), and the latter mainly include Linagliptin (injection) and the like. Research shows that KCNJ11 and TCF7L2 can also influence the treatment effect of the DPP4-1 inhibitor. Moreover, GLP1R is a contributing factor common to both classes of drugs and distinct from other drugs. GLP1R (glucagon-like peptide-1receptor) is a glucagon-like peptide-1receptor, can receive GLP-1(GLP-1 belongs to the incretin family, the secretion of the GLP-1 is regulated by eating activity, and the GLP-1 receptor has a blood sugar concentration-dependent blood sugar reduction effect) signal, further enhances the release of insulin, and is one of important targets of T2DM medicaments. European scientists found that polymorphism of GLP1R has certain influence on the drug effects of DPP4-1 inhibitor and GLP-1 receptor agonist.
According to the kit provided by the invention, the medication guiding range comprises 6 general 14 types of common hyperglycemia drugs on the market, 1) sulfonylurea drugs: glibenclamide, gliclazide, glipizide, gliquidone, glimepiride; 2) meglitinide drugs: repaglinide, nateglinide; 3) biguanides: metformin; 4) thiazolidinediones: rosiglitazone, pioglitazone; 5) DPP4-1 inhibitors: sitagliptin, vildagliptin, linagliptin; 6) GLP-1 receptor agonists: liraglutide (injection). By detecting SNP sites in the related genes of the hyperglycemia drugs and combining with medication guidance documents at home and abroad, the method helps patients and doctors judge the effectiveness and safety of specific drugs on the gene level.
In conclusion, the kit for guiding the medication of the hyperglycemia of the human provided by the invention can be used for helping the hyperglycemia patient to screen the hyperglycemia medicine from the gene level. The invention can provide certain reference value and clinical guidance significance when a doctor selects the hypoglycemic drug for a patient by explaining the individual applicability of different hyperglycemic drugs from a gene level.
Detailed Description
The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.
Example 1 detailed description of the kit
1.1 principle of examination
The kit firstly amplifies a DNA template containing the SNP locus region by a PCR technology, and then uses a specific extension primer to carry out single-base extension reaction with a PCR product. Because the different bases of the polymorphic sites lead to the difference of the molecular weights of the extended products due to the different terminal bases of the extended products, the base difference caused by SNP polymorphism is reflected by the difference of the molecular weights, the size of the molecular weight of the extended products is detected by a matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) mass spectrometry technology, and SNP typing detection is carried out by judging the difference of the molecular weights by applying special analysis software.
1.2 major ingredients
The main components of the kit comprise: PCR reaction mixed liquor, Taq Enzyme, amplification primer mixed liquor, SAP Buffer, SAP Enzyme, single base extension reaction mixed liquor, iPlex Enzyme, extension primer mixed liquor and ddH2O, positive control, desalting resin and a mass spectrum chip.
1.3 storage conditions and expiration dates
The kit is stored at the temperature of 20 ℃ below zero, and the shelf life is 9 months.
1.4 matching instruments
A general PCR instrument; DR MassArray.
1.5 sample requirement
The product is suitable for extracting genome DNA from oral mucosa cells, oral exfoliative cells, blood, tissues and dried blood slices, and requires that the ratio of DNA A260/A280 is between 1.8 and 2.0. Frozen DNA samples should be stored below-20 ℃ and repeated freezing and thawing is avoided.
1.6 test methods
1.6.1PCR reaction
1) In the PCR I area, each reagent (kit) is taken out from a refrigerator at the temperature of-20 ℃, placed on ice for thawing, and then the amplification primers are taken out from the refrigerator at the temperature of 4 ℃, vortexed and shaken for 10s and then centrifuged briefly for later use.
2) Adding related reagent components in sequence according to the proportion of the following table to prepare a PCR reaction mixed solution, marking, and subpackaging into 96-well plates (3 mu L/well) at most; after packaging, the DNA is transferred from PCR I to PCR II through the transfer window.
Table 1: PCR mixture
Figure BDA0002988442900000091
3) In the PCR II area, the DNA template is taken out from a refrigerator at the temperature of 20 ℃ below zero, melted on ice, vortexed and shaken for 10s, and then centrifuged briefly, and a certain amount of DNA is sucked out and diluted to 5 ng/mu L for later use.
4) Add 2. mu.L of 5 ng/. mu.L DNA template to each well of 96-well plate, cover the tube cover, vortex and shake for 10s, centrifuge briefly, pass from PCR II to III through the transmission window, and pass from PCR III to IV through the transmission window. Blank control (2. mu. LddH) must be set for each experiment2O), negative control (2 μ LDNA extraction eluate) and positive control.
5. The 96-well plate was placed in the amplification apparatus, and the program was run: the PCR was specifically programmed as follows:
Figure BDA0002988442900000092
1.6.2SAP reaction
1) After the PCR reaction was completed, an SAP mixture was prepared in a 1.5mL EP tube according to Table 2. The numbers in table 2 are calculated as a 96 well plate plus a 38% excess. This configuration was performed in PCR I.
Table 2: SAP reaction mixture
SAP buffer 0.17 μ L of CutSmart buffer (manufacturer NEB)
SAP enzymes 0.5U (manufacturer NEB)
Water (W) Make up to 2 mu L
2) The prepared SAP mixture was transferred from PCR zone i to zone iv, and 2 μ L of SAP mixture was added to each well (total volume after addition of mixture: 7 μ L).
3) The plates were sealed with a membrane (Life's or other company quality membrane), vortexed and centrifuged (4000rpm for 5 seconds).
4) Place the plate on a PCR instrument for the following procedures:
the temperature of the mixture is controlled to be 37 ℃ for 40 minutes,
the temperature of the mixture is 85 ℃ for 5 minutes,
keeping the temperature at 4 ℃.
1.6.3 extension reaction
1) The SAP reaction plate was removed and centrifuged at 2000rpm for 1 min.
2) An iPLEX extension mix was prepared in a 1.5mL tube according to Table 3. The numbers in table 3 are calculated as a 96 well plate plus a 38% excess. Please adjust the number according to the actual number of responses. This configuration was performed in PCR I.
Table 3: iPLEX extension reaction liquid
Single base extension reaction mixture (mixed by buffer + acyNTPs) 0.4 μ L (from NEB)
iPlex Enzyme 1U (produced by NEB)
Extension primer mixture 0.94μL
Water (W) Make up to 2 mu L
3) The iPLEX extension mix was transferred from PCR zone I to zone IV, and 2. mu.L of iPLEX extension mix was added to each well and mixed (total volume after addition of mix: 9 μ L).
4) The plates were sealed with a membrane, vortexed and centrifuged (4000rpm for 5 seconds).
5) The 96-well plate was placed on a PCR instrument for the following thermal cycling:
Figure BDA0002988442900000101
Figure BDA0002988442900000111
1.6.4 Conditioning (sample desalting)
The following procedure was set for one 96-well plate, please adjust the procedure based on the actual number of wells. Wear gloves and goggles.
1) Clean Resin (Resin) was spread flat on 96/15mg crater plates (double plates) and air dried for a minimum of 10 minutes.
Note that: resin is firstly paved on a plate by a spoon, then the resin is scraped from left to right or from right to left by a scraper, so that 96 holes are filled with the resin, and after the 96 holes are filled, the resin is lightly scraped by the scraper and the residual resin on the surface is scraped off, so that the next step of film pasting is prevented from being interfered. When the resin changed from dark yellow to light yellow, it was shown that the resin had dried almost completely.
2) To each well of the sample plate, 41. mu.L of water was added, and the membrane was sealed (using a common membrane), followed by centrifugation.
3) Add 15mg of clean Resin (Resin): the sample plate is turned upside down slightly and placed on the crater plate with the resin placed, the holes are needed to be drilled! The crater plate, along with the sample plate, is then inverted (the two plates are not horizontally movable during the process) to allow the resin to fall into the wells.
4) The plates were sealed with a membrane (using a common membrane) and placed on a rotator and shaken upside down for 15 minutes.
5) Plates were centrifuged for 5 minutes at 3200g (4000rpm of standard plate centrifuge).
1.6.5 spotting
The PCR product was transferred to the chip plate according to the Massarray Nanodispenser protocol.
1.6.6 Mass spectrometric detection
1) And opening the software of the plate management system, editing an experiment plan file, wherein the experiment plan file comprises the position of the sample, the name of the sample and the used primer, and connecting the mass spectrometer with the established experiment plan file.
2) The Start All icon is clicked, the software is started, and the various indicator lights are checked for normality.
3) Click the "chip tray enter/exit" button to place the chip on the tray and then on the chip deck, record the chip position (1 on the left and 2 on the right). Hands do not touch the surface of the chip; placing the 96 plate at the position marked with MTP1/2, and fixing the 96 plate in the direction of A1 at the lower left corner; when the chip is used for the first time, 75 mu L of calibration standard substance is added into the sample adding slot of the calibration substance, and when the chip is not used for the first time, the calibration standard substance does not need to be added. Then click the 'chip tray enter/exit' button and close the clamp plate.
4) Click "add/maintain resin" button, open the resin tank, add resin or supply autoclaving purified water (A. when the instrument is first turned on, 28g of resin need to be added into the resin tank and 16mL of sterile purified water is added and mixed. B. When the resin is used for the first time, 9g of resin is completely poured into a resin tank, 5.2ml of autoclaved purified water is added, and the mixture is uniformly mixed by a gun head. C. When the water is not used for the first time, the liquid level needs to be observed, if the liquid level of the water is lower than the resin surface, a proper amount of high-pressure sterilization purified water needs to be supplemented, and the liquid level of the water is higher than the resin surface. C. The resin solution is added into the resin tank and is used as soon as possible, and can not be placed for more than 30 days. )
5) The program setting parameters are as follows.
Figure BDA0002988442900000121
6) After finishing printing the mass spectrum, clicking a button for removing the old chip from the analyzer, returning the chip to a chip deck, then clicking a button for entering/exiting a chip tray, taking out a 96-well plate, sealing a film and storing at-20 +/-5 ℃; the chip is put back into the packaging box and stored in a dehumidifier (the chip is used as soon as possible after being opened, the storage time does not exceed 30 days), the calibration standard sample is recovered and stored at minus 20 plus or minus 5 ℃, then a button for entering/exiting the chip tray is clicked, and the clamping plate is closed.
1.6.7 interpretation of test results
1) And (3) judging the effectiveness of the kit: the standard substance can be used for detecting corresponding genotype and blank reference substance (ddH)2O) no signal is detected, when the weak positive control can detect the corresponding positive signal, the detection result is valid, otherwise, the detection result is invalid.
1.6.8 limitations of the test method
1) The method may be affected by the quality of the detected sample DNA, and if the quality of the detected sample DNA is poor, a false negative result may occur.
2) The detection result is only used for clinical medication reference, is used for guiding individualized medication, and cannot be used as the only basis of clinical medication.
3) When the genotype of the corresponding site detected by the product is wild, the mutation of other sites of the gene cannot be excluded.
1.6.9 product performance index
The product can detect 1ng of human genome DNA with the A260/A280 purity of 1.70-1.90 at the lowest.
Case one:
mr. Ye, 35 years old, were treated before one year when blood sugar was found to be excessive (9.0 mmol/L fasting and 11.3mmol/L postprandial). The oral hypoglycemic drug Damekang sustained release tablet (gliclazide sustained release tablet) and the metformin enteric-coated tablet of the prescription are used for controlling blood sugar all the time, and the control effect is better. Half a year ago, the number of times of the patient's business trip was reduced, and the office working time was increased. When the dosage of the former medicine is kept, the blood sugar control effect is poor, and the symptoms of postprandial fatigue and polydipsia and diuresis are aggravated. The patients feel nausea and gastrointestinal discomfort after self-increasing the dosage of the metformin for two weeks. When the doctor visits the doctor again, the doctor recommends that the patient consider the drug gene detection.
The following results were obtained by the kit detection.
Figure BDA0002988442900000131
Figure BDA0002988442900000141
Based on the above results, we make the following interpretation.
Gene locus Genotype(s) Interpretation results
ADIPOQ rs2241766 TT Wild homozygous type, normal drug response effect
C11orf65rs11212617 AC Mutation mixed type, normal drug response effect
CYP2C8 rs10509681 TT Wild homozygous type, normal drug metabolism rate
CYP2C9 rs1057910 AA Wild homozygous type, normal drug metabolism rate
GLP1R rs6923761 GG Wild homozygous type, normal drug response effect
IGF2BP2 rs1470579 AA Wild homozygous type, normal drug response effect
KCNJ11rs5219 CC Wild homozygous type, normal drug response effect
KCNJ11rs2285676 GG Wild homozygous type, normal drug response effect
KCNQ1 rs2237895 AA Wild homozygous type, normal drug response effect
KCNQ1 rs2237892 CT Mutation heterozygosis type, good drug response effect
PPARG rs1801282 CC Wild homozygous type, normal drug response effect
SCNN1B rs889299 GG Wild homozygous type, normal risk of adverse reactions (edema)
SLC22A2 rs316019 CC Wild plantHomozygous type, normal drug metabolism rate
SLC47A2 rs12943590 AA Mutation homozygote type, and increased drug metabolism rate
SLCO1B1 rs2306283 GG Mutation and homozygosis type, and accelerated drug metabolism
SLCO1B1 rs4149056 TT Wild homozygous type, normal drug metabolism
TCF7L2 rs7903146 CC Wild homozygous type, normal drug action
TCF7L2 rs12255372 GG Wild homozygous type, normal drug action
Thus, we can recommend the use of the following drugs, as shown in the table below.
Figure BDA0002988442900000142
Figure BDA0002988442900000151
In the above table, 1. the drug metabolism ability is normal; 2. a decrease in the metabolic capacity of the drug; 3. the metabolic capacity of the drug is improved; 4. the drug effect is normal; 5. the drug effect is reduced; 6. the drug effect is increased; 7. the toxicity of the medicine is normal; 8. the toxicity of the medicine is reduced; 9. the toxicity of the drug increases.
The detection result shows that the patient has better response to the gliclazide, but the SLC47A2 of the patient is a mutant type, the clearance rate in vivo of the metformin is higher than that of a wild type patient, and when the activity of the patient is reduced, the normal dosage can not achieve better treatment effect easily. The detection result simultaneously shows that the reaction of the patient to the pioglitazone is better. The attending physician advises the patient to discontinue metformin and change to pioglitazone.
The gliclazide and pioglitazone are used for controlling blood sugar after the leaves are changed, and the blood sugar is checked to be in a normal range continuously for three months. The patients have better self-reported spirit and no other adverse reactions.
Case two:
zheng ladies, age 54 years old, with hyperglycemia symptoms for 5 years (with obesity). During the period, insulin is injected, and daily diabetes pills (glibenclamide) and metformin are used for blood sugar control. The last year patient felt that the visual deterioration was severe, and the thirst symptom was severe. The doctor in the local hospital recommends to replace the diabetes pill with glimepiride and increase the dosage of metformin. After the medicine is changed for a period of time, the patient still feels obvious thirst symptoms. The doctor suggests that the insulin is firstly used for reducing the blood sugar, and the medicine gene detection is simultaneously carried out to guide the medication of the patient.
The following results were obtained by the kit detection.
Figure BDA0002988442900000152
Figure BDA0002988442900000161
Based on the above results, we make the following interpretation.
Figure BDA0002988442900000162
Figure BDA0002988442900000171
Thus, we can recommend the use of the following drugs, as shown in the table below.
Figure BDA0002988442900000172
In the above table, 1. the drug metabolism ability is normal; 2. a decrease in the metabolic capacity of the drug; 3. the metabolic capacity of the drug is improved; 4. the drug effect is normal; 5. the drug effect is reduced; 6. the drug effect is increased; 7. the toxicity of the medicine is normal; 8. the toxicity of the medicine is reduced; 9. the toxicity of the drug increases.
The test results show that the patient has normal response to the glibenclamide and the metformin, and the patient has better response to the pioglitazone. In view of the obesity symptoms of the patients, the doctors recommend the addition of pioglitazone. After one month of treatment of patients with glimepiride, metformin and pioglitazone, the thirst symptom is obviously relieved.
SEQUENCE LISTING
<110> Shanghai Kangli diagnostic technology Co., Ltd
<120> a kit for guiding hyperglycemia medication of human
<160> 54
<170> PatentIn version 3.5
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence
<400> 1
acgttggatg ccttgagtcg tggtttcctg 30
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence
<400> 2
acgttggatg gacagtgcac atgtggattc 30
<210> 3
<211> 30
<212> DNA
<213> Artificial sequence
<400> 3
acgttggatg ataccaatta caaagggcag 30
<210> 4
<211> 30
<212> DNA
<213> Artificial sequence
<400> 4
acgttggatg gtgggttgct tgtggataac 30
<210> 5
<211> 30
<212> DNA
<213> Artificial sequence
<400> 5
acgttggatg tggcattact gacttccgtg 30
<210> 6
<211> 30
<212> DNA
<213> Artificial sequence
<400> 6
acgttggatg cttatctaga aagtggccag 30
<210> 7
<211> 30
<212> DNA
<213> Artificial sequence
<400> 7
acgttggatg atgcaagaca ggagccacat 30
<210> 8
<211> 30
<212> DNA
<213> Artificial sequence
<400> 8
acgttggatg tgtcacaggt cactgcatgg 30
<210> 9
<211> 30
<212> DNA
<213> Artificial sequence
<400> 9
acgttggatg gagttaggat gaagcagccc 30
<210> 10
<211> 30
<212> DNA
<213> Artificial sequence
<400> 10
acgttggatg ttctctgctc tggttatcgc 30
<210> 11
<211> 30
<212> DNA
<213> Artificial sequence
<400> 11
acgttggatg gtttccaaac agctatcatc 30
<210> 12
<211> 30
<212> DNA
<213> Artificial sequence
<400> 12
acgttggatg gcttgtctat gagtgagagg 30
<210> 13
<211> 30
<212> DNA
<213> Artificial sequence
<400> 13
acgttggatg gctctacttg gtccctgaaa 30
<210> 14
<211> 30
<212> DNA
<213> Artificial sequence
<400> 14
acgttggatg tctcatcaac tgccctccct 30
<210> 15
<211> 30
<212> DNA
<213> Artificial sequence
<400> 15
acgttggatg cgttgcagtt gcctttcttg 30
<210> 16
<211> 30
<212> DNA
<213> Artificial sequence
<400> 16
acgttggatg aggaatacgt gctgacacgc 30
<210> 17
<211> 30
<212> DNA
<213> Artificial sequence
<400> 17
acgttggatg cagatgatgg gagctgtcac 30
<210> 18
<211> 30
<212> DNA
<213> Artificial sequence
<400> 18
acgttggatg tgtaaggcat ctggtggaga 30
<210> 19
<211> 30
<212> DNA
<213> Artificial sequence
<400> 19
acgttggatg ctcctatgac ttcgattccc 30
<210> 20
<211> 30
<212> DNA
<213> Artificial sequence
<400> 20
acgttggatg agatgacagg gcagtgacag 30
<210> 21
<211> 30
<212> DNA
<213> Artificial sequence
<400> 21
acgttggatg caaaccccta ttccatgctg 30
<210> 22
<211> 30
<212> DNA
<213> Artificial sequence
<400> 22
acgttggatg tgtatcagtg aaggaatcgc 30
<210> 23
<211> 30
<212> DNA
<213> Artificial sequence
<400> 23
acgttggatg ctgagtacct gcctcatttg 30
<210> 24
<211> 30
<212> DNA
<213> Artificial sequence
<400> 24
acgttggatg cttgagaaca gtcaagaggg 30
<210> 25
<211> 30
<212> DNA
<213> Artificial sequence
<400> 25
acgttggatg tggcttacgc acttcctcac 30
<210> 26
<211> 30
<212> DNA
<213> Artificial sequence
<400> 26
acgttggatg ggacttacca gtaatagagc 30
<210> 27
<211> 30
<212> DNA
<213> Artificial sequence
<400> 27
acgttggatg agctttgtcc agcgagccac 30
<210> 28
<211> 30
<212> DNA
<213> Artificial sequence
<400> 28
acgttggatg ctcatcccac aagttgccat 30
<210> 29
<211> 29
<212> DNA
<213> Artificial sequence
<400> 29
acgttggatg attaaacaag tggataagg 29
<210> 30
<211> 30
<212> DNA
<213> Artificial sequence
<400> 30
acgttggatg gatgttctta cagttacagg 30
<210> 31
<211> 30
<212> DNA
<213> Artificial sequence
<400> 31
acgttggatg aatctgggtc atacatgtgg 30
<210> 32
<211> 30
<212> DNA
<213> Artificial sequence
<400> 32
acgttggatg tatgggagtc tcccctattc 30
<210> 33
<211> 30
<212> DNA
<213> Artificial sequence
<400> 33
acgttggatg tgcaaatcca gcaggttagc 30
<210> 34
<211> 30
<212> DNA
<213> Artificial sequence
<400> 34
acgttggatg cagaggcctg agtaattatc 30
<210> 35
<211> 30
<212> DNA
<213> Artificial sequence
<400> 35
acgttggatg tctctgcctc aaaacctagc 30
<210> 36
<211> 30
<212> DNA
<213> Artificial sequence
<400> 36
acgttggatg aactaagggt gcctcatacg 30
<210> 37
<211> 17
<212> DNA
<213> Artificial sequence
<400> 37
ttggtttcct ggtcatg 17
<210> 38
<211> 17
<212> DNA
<213> Artificial sequence
<400> 38
ggagggcaga tcagaga 17
<210> 39
<211> 22
<212> DNA
<213> Artificial sequence
<400> 39
cccgccgtgc tacatgatga ca 22
<210> 40
<211> 21
<212> DNA
<213> Artificial sequence
<400> 40
ggggacgagg tccagagata c 21
<210> 41
<211> 16
<212> DNA
<213> Artificial sequence
<400> 41
ccaccttacc tgaagc 16
<210> 42
<211> 23
<212> DNA
<213> Artificial sequence
<400> 42
cttagataag atccatacga gtt 23
<210> 43
<211> 24
<212> DNA
<213> Artificial sequence
<400> 43
ccacctggtc cctgaaaaag cacc 24
<210> 44
<211> 20
<212> DNA
<213> Artificial sequence
<400> 44
cccctcacgg tacctgggct 20
<210> 45
<211> 18
<212> DNA
<213> Artificial sequence
<400> 45
ccacaggact ttgccacc 18
<210> 46
<211> 15
<212> DNA
<213> Artificial sequence
<400> 46
cctgtccccg acccc 15
<210> 47
<211> 19
<212> DNA
<213> Artificial sequence
<400> 47
gggagattct cctattgac 19
<210> 48
<211> 21
<212> DNA
<213> Artificial sequence
<400> 48
cctgcctcat ttgtgtgatt g 21
<210> 49
<211> 17
<212> DNA
<213> Artificial sequence
<400> 49
ggttgcagtt cacagtt 17
<210> 50
<211> 19
<212> DNA
<213> Artificial sequence
<400> 50
ccttaggggc aggaggagg 19
<210> 51
<211> 25
<212> DNA
<213> Artificial sequence
<400> 51
gttgatgttg aattttctga tgaat 25
<210> 52
<211> 25
<212> DNA
<213> Artificial sequence
<400> 52
ccttggtcat acatgtggat atatg 25
<210> 53
<211> 19
<212> DNA
<213> Artificial sequence
<400> 53
ggaatatcca ggcaagaat 19
<210> 54
<211> 22
<212> DNA
<213> Artificial sequence
<400> 54
agagctaagc actttttaga ta 22

Claims (7)

1. The invention provides a kit for guiding the administration of hyperglycemia, which is characterized in that the kit can carry out SNP typing on 18 genetic loci simultaneously, the kit comprises 18 pairs of amplification primers for detecting the 18 genetic loci, and the sequences of the 18 pairs of amplification primers are as follows:
gene locus Upstream amplification primer 5 '-3' Downstream amplification primer 5 '-3' rs2241766 SEQ ID NO.1 SEQ ID NO.2 rs11212617 SEQ ID NO.3 SEQ ID NO.4 rs10509681 SEQ ID NO.5 SEQ ID NO.6 rs1057910 SEQ ID NO.7 SEQ ID NO.8 rs6923761 SEQ ID NO.9 SEQ ID NO.10 rs1470579 SEQ ID NO.11 SEQ ID NO.12 rs2285676 SEQ ID NO.13 SEQ ID NO.14 rs5219 SEQ ID NO.15 SEQ ID NO.16 rs2237892 SEQ ID NO.17 SEQ ID NO.18 rs2237895 SEQ ID NO.19 SEQ ID NO.20 rs1801282 SEQ ID NO.21 SEQ ID NO.22 rs889299 SEQ ID NO.23 SEQ ID NO.24 rs316019 SEQ ID NO.25 SEQ ID NO.26 rs12943590 SEQ ID NO.27 SEQ ID NO.28 rs2306283 SEQ ID NO.29 SEQ ID NO.30 rs4149056 SEQ ID NO.31 SEQ ID NO.32 rs12255372 SEQ ID NO.33 SEQ ID NO.34 rs7903146 SEQ ID NO.35 SEQ ID NO.36
。
2. The kit according to claim 1, further comprising 18 extension primers for identifying the 18 gene site mutations, wherein the sequences of the 18 extension primers are specifically as follows:
Figure FDA0002988442890000011
Figure FDA0002988442890000021
3. the kit of claim 1, wherein the molar concentrations of the 18 pairs of amplification primers are as follows:
amplification primerSubstance 5 '-3' Final concentration SEQ ID NO.1，SEQ ID NO.2 Each 1-1.2 mu M SEQ ID NO.3，SEQ ID NO.4 Each 1-1.2 mu M SEQ ID NO.5，SEQ ID NO.6 Each 1-1.3 mu M SEQ ID NO.7，SEQ ID NO.8 Each 1-1.2 mu M SEQ ID NO.9，SEQ ID NO.10 Each 1-1.2 mu M SEQ ID NO.11，SEQ ID NO.12 Each 1-1.5 mu M SEQ ID NO.13，SEQ ID NO.14 Each 1-1.3 mu M SEQ ID NO.15，SEQ ID NO.16 Each 1-1.5 mu M SEQ ID NO.17，SEQ ID NO.18 Each 1-1.2 mu M SEQ ID NO.19，SEQ ID NO.20 Each 1-1.2 mu M SEQ ID NO.21，SEQ ID NO.22 Each 1-1.3 mu M SEQ ID NO.23，SEQ ID NO.24 Each 1-1.2 mu M SEQ ID NO.25，SEQ ID NO.26 Each 1-1.3 mu M SEQ ID NO.27，SEQ ID NO.28 Each 1-1.3 mu M SEQ ID NO.29，SEQ ID NO.30 Each 1-1.2 mu M SEQ ID NO.31，SEQ ID NO.32 Each 1-1.2 mu M SEQ ID NO.33，SEQ ID NO.34 Each 1-1.3 mu M SEQ ID NO.35，SEQ ID NO.36 Each 1-1.3 mu M
。
4. The kit according to claim 2, wherein the molar concentrations of the 18 extended primers in the assay are as shown in the following table:
Figure FDA0002988442890000022
Figure FDA0002988442890000031
5. the kit according to claim 1, wherein the reaction system of the multiplex PCR amplification of the kit is as follows:
Figure FDA0002988442890000032
6. the kit of claim 4, further comprising an iPLEX extension reaction system, wherein the iPLEX extension reaction system is as follows:
Figure FDA0002988442890000033
7. the kit of claim 1, wherein the kit is for detection using a time-of-flight mass spectrometer.
CN202110308130.1A 2021-03-23 2021-03-23 Kit for guiding hyperglycemia medication of human Active CN112795645B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110308130.1A CN112795645B (en) 2021-03-23 2021-03-23 Kit for guiding hyperglycemia medication of human

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110308130.1A CN112795645B (en) 2021-03-23 2021-03-23 Kit for guiding hyperglycemia medication of human

Publications (2)

Publication Number Publication Date
CN112795645A true CN112795645A (en) 2021-05-14
CN112795645B CN112795645B (en) 2022-11-08

Family

ID=75815671

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110308130.1A Active CN112795645B (en) 2021-03-23 2021-03-23 Kit for guiding hyperglycemia medication of human

Country Status (1)

Country Link
CN (1) CN112795645B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113604556A (en) * 2021-08-03 2021-11-05 山东省千佛山医院 Gene SNP detection kit for determining therapeutic effect correlation of GLP-1 receptor agonist
CN114317710A (en) * 2021-12-24 2022-04-12 廊坊诺道中科医学检验实验室有限公司 Primer probe combination for detecting SNP typing of polymorphic site of GLP1R gene, kit and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109957617A (en) * 2019-04-24 2019-07-02 南京格致医学检验有限公司 For instructing the SNP site detection kit and its application method of diabetic
CN110157798A (en) * 2019-06-27 2019-08-23 中南大学湘雅医院 A kind of primer combination of probe instructing diabetic individual medication gene loci polymorphism and its application and kit
CN111118149A (en) * 2020-03-03 2020-05-08 上海康黎医学检验所有限公司 Kit for guiding medication of people for epileptic diseases and application thereof
CN112210598A (en) * 2019-07-11 2021-01-12 合肥中科普瑞昇生物医药科技有限公司 Primer group and kit for detecting polymorphism of gene related to metabolism of hyperglycemia drug and application of primer group and kit

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109957617A (en) * 2019-04-24 2019-07-02 南京格致医学检验有限公司 For instructing the SNP site detection kit and its application method of diabetic
CN110157798A (en) * 2019-06-27 2019-08-23 中南大学湘雅医院 A kind of primer combination of probe instructing diabetic individual medication gene loci polymorphism and its application and kit
CN112210598A (en) * 2019-07-11 2021-01-12 合肥中科普瑞昇生物医药科技有限公司 Primer group and kit for detecting polymorphism of gene related to metabolism of hyperglycemia drug and application of primer group and kit
CN111118149A (en) * 2020-03-03 2020-05-08 上海康黎医学检验所有限公司 Kit for guiding medication of people for epileptic diseases and application thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHARITY MASILELA，ET AL: "Single Nucleotide Polymorphisms Associated with Metformin and Sulphonylureas’ Glycaemic Response among South African Adults with Type 2 Diabetes Mellitus", 《JOURNAL OF PERSONALIZED MEDICINE》 *
何新苗等: "新疆汉族、维吾尔族人群CYP2C8单核苷酸多态性研究", 《中国实用医药》 *
刘谋泽等: "常用口服降糖药的药物基因组学研究进展", 《药学进展》 *
肖笛等: "常用口服降糖药的药物基因组学研究进展", 《中南药学》 *
邢玉华等: "2型糖尿病口服降糖药药物基因组学研究进展", 《中国糖尿病杂志》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113604556A (en) * 2021-08-03 2021-11-05 山东省千佛山医院 Gene SNP detection kit for determining therapeutic effect correlation of GLP-1 receptor agonist
CN114317710A (en) * 2021-12-24 2022-04-12 廊坊诺道中科医学检验实验室有限公司 Primer probe combination for detecting SNP typing of polymorphic site of GLP1R gene, kit and application thereof

Also Published As

Publication number Publication date
CN112795645B (en) 2022-11-08

Similar Documents

Publication Publication Date Title
Moczulski et al. Major susceptibility locus for nephropathy in type 1 diabetes on chromosome 3q: results of novel discordant sib-pair analysis.
US7901885B2 (en) Genes and markers in type 2 diabetes and obesity
CN112795645B (en) Kit for guiding hyperglycemia medication of human
CN111118149B (en) Kit for guiding medication of people for epileptic diseases and application thereof
Zhang et al. Association of sulfonylurea receptor 1 genotype with therapeutic response to gliclazide in type 2 diabetes
CN110331214B (en) Kit for guiding human mental disease medication and detection method thereof
EP1931805A2 (en) Methods and compositions for screening and treatment of disorders of blood glucose regulation
CN106978421B (en) Diabetes typing kit
Liu et al. Leber's hereditary optic neuropathy is associated with the T12338C mutation in mitochondrial ND5 gene in six Han Chinese families
Wang et al. Polymorphism on chromosome 9p21. 3 contributes to early-onset and severity of coronary artery disease in non-diabetic and type 2 diabetic patients
Wei et al. Quantitative candidate gene association studies of metabolic traits in Han Chinese type 2 diabetes patients
Chen et al. Identification of NLRP3 inflammation-related gene promoter hypomethylation in diabetic retinopathy
CN101008032A (en) Uses and method for polymorphic point genetype for predicting sulfaurea drugs effect
Miller et al. Insulin resistance-associated genetic variants in type 1 diabetes
CN111321214B (en) Kit for guiding human depression medication and application thereof
CN112852956A (en) Kit for guiding medication of human hyperlipidemia
Bakhtiyari et al. Association between ABCC8 Ala1369Ser polymorphism (rs757110 T/G) and type 2 diabetes risk in an Iranian population: a case-control study
CN116855601A (en) Application of whole blood transcriptome information in preparation of kit and whole blood transcription marker
Li et al. Contribution of mitochondrial gene variants in diabetes and diabetic kidney disease
Verma et al. CDKAL1 (rs10946398) and TCF7L2 (rs7903146) gene polymorphisms and their association with risk of type-2 diabetes mellitus in population of Uttarakhand, India
Mohamed et al. Association of the peroxisome proliferator-activated receptor-γ2 Pro12Ala but not the C1431T gene variants with lower body mass index in type 2 diabetes
CN113046432A (en) Kit for guiding human hypertension medication
CN111455038B (en) Kit for guiding drug for anxiety disorder of human and application thereof
CN110157798B (en) Primer probe combination for guiding polymorphism of gene locus of diabetes personalized medicine, application and kit thereof
Zhang et al. Heteroplasmy level of the mitochondrial tRNaLeu (UUR) A3243G mutation in a Chinese family is positively associated with earlier age-of-onset and increasing severity of diabetes

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
PE01 Entry into force of the registration of the contract for pledge of patent right
PE01 Entry into force of the registration of the contract for pledge of patent right

Denomination of invention: A reagent kit for guiding medication for high blood sugar in humans

Granted publication date: 20221108

Pledgee: Bank of Nanjing Limited by Share Ltd. Shanghai branch

Pledgor: Shanghai Kangli Diagnostic Technology Co.,Ltd.

Registration number: Y2024310000127