CN101008032A - Uses and method for polymorphic point genetype for predicting sulfaurea drugs effect - Google Patents

Abstract

The invention relates to the prediction of sulfonylureas drug effect by measuring polymorphism site genetype of sulfonylureas recepted gene, and the method. It predicts the effect of sulfonylureas drug in reducing blood sugar, improving and restoring Langer-hans' insula beta cell function and/ or intensifying insulin sensitive function by measuring polymorphism site genetype of sulfonylureas recepted gene; and predicts the effect of sulfonylureas drug in reducing blood sugar, improving and restoring Langer-hans' insula beta cell function and/ or intensifying insulin sensitive function by making use of polymorphism parting oligonucleotide to detect polymorphism site genetype of sulfonylureas recepted gene in biological sample. The invention can indicate doctor to choose medicine according to individual gentic difference, increase the effective rate of clinical medicine treating and safty of clinical midicine usage, reduce toxic and side effect of medicine and economical load, and reduce diabetes complication generation.

Description

The purposes of polymorphic point genetype for predicting sulfaurea drugs effect and method

Technical field

The present invention relates to the purposes and the method for polymorphic point genetype for predicting sulfaurea drugs effect, the pleomorphism site that particularly comprises the sulfonylurea receptor gene of the Ser1369Ala (rs757110), the C/T (rs2074312) that are selected from sulfonylureas receptor 1 gene and C/T (rs1799854) is at least predicted and the purposes and the method for sulfonylurea drugs action effect is belonged to field of medicaments.

Background technology

The sulfourea antidiabetic medicine is a kind of Drugs Promoting Insulin Secretion, can reduce on an empty stomach and postprandial blood sugar.For the diabetes B patient of the new diagnosis of great majority, the sulfourea antidiabetic medicine can make fasting plasma glucose decline 50～80mg/dl, makes glycolated hemoglobin (HbAlc) descend 1.0%～2.5%.Because diabetes B patient's β cell function is decayed in time, the sulfourea antidiabetic medicine reduces very effective to diabetic subject's blood sugar of new diagnosis clinically.Sulfourea antidiabetic medicine and K _ATPThe subunit of passage---high-affinity sulfonylurea drugs acceptor (SUR1) is in conjunction with promoting the endogenous insulin secretion.Sulfonylurea drugs with close K after SUR1 combines ⁺Passage makes the subregion depolarize on the cytolemma cause voltage-dependent L-type Ca ²⁺Channel opener, Ca ²⁺Enter in the cell Ca in the endochylema ²⁺Concentration raises, thereby stimulates insulin secretion.Can also strengthen insulin action in target organ (liver, muscle, adipocyte) by the outer effect of pancreas islet.The sulfourea antidiabetic medicine of widespread use comprises tolbutamide (Tolbutamide) clinically, P-607 (Chlorpropamide), Glyburide (Glibenclamide), glibornuride (Glibornuride), tolhexamide (Glycyclamide), glyhexamide (Glyhexamide), glisamuride (Glisamuride), Glisentide (Glisentide), glisolamide (Glisolamide), glyoctamide (Glyoctamide), gliclazide (Gliclazide), Glipizide (Glipizide), Glipizide sustained-release sheet (Glucotrol XL), gliquidone (Gliquidone) and glimepiride (Glimepiride).

Sulfonylurea drugs is 50～80% for the total effective rate that is suitable for crowd (non-overweight or non-fat diabetes B patient), has part to be suitable for the crowd and exists sulfonylurea drugs primary to lose efficacy and secondary failure.Common side effect is hypoglycemia, tic, accidental gastrointestinal reaction, fash, headache.Genetic background not only may influence the generation of disease, and influences the individual difference of curative effect of medication.Deepening continuously and develop along with pharmacogenetics research, in following medication of Diabetes Mellifus, may utilize the genetics screening method, the individuation clinical application target that realization varies with each individual, effectively avoid non-rational use of drug, mistake medication and even Drug abuse tendency, reduce the expense that is used for the treatment of adverse drug reaction, the waste of avoiding invalid medication to cause.

The validity and the security of pharmacological agent are of crucial importance, and a lot of people belong to invalid medication aspect validity, and perhaps curative effect is relatively poor; And aspect drug safety, various untoward reactions, toxic side effect can occur even cause death.Remove the reason of medicine itself and patient's sex, age, other diseases interaction, gestation, diet situation and living environment etc., inherited genetic factors is playing an important role aspect individuation medical treatment, the particularly personalized medicine.Be used to predict the clinical experience of the method for curative effect of medication clinically simply by virtue of the doctor, strictly observe the treatment guide, clinical examination according to patient's routine, select a kind of pharmacological agent empirically, treat after one period, judge curative effect according to change of illness state and corresponding the inspection,, promptly change drug dose or associating or change the other medicines treatment if prompting unsatisfactory curative effect or side effect just will consider adjustment pharmacological agent when big.This Forecasting Methodology has tangible hysteresis quality and blindness, and can not really predict the curative effect of a certain medicine, more can not select medicine that individuation information accurately is provided to the doctor.Therefore, Forecasting Methodology based on present clinical medicine curative effect, the doctor still can not carry out the selection of medicine and dosage thereof and the compatibility of medicine according to the patient individual difference when medication, can not control or treat disease and reduction quickly and effectively or avoid the generation of toxic side effect, and increase patient's misery and economical load to some extent.

The individual difference of curative effect of medication and side effect is relevant with inherited genetic factors.The medicine genetic polymorphism shows as the polymorphism of drug metabolism enzyme, the polymorphism of drug receptor and the polymorphism of drug targets etc.The existence of these polymorphisms may cause individual difference [Science, 2000 of drug effect and untoward reaction in many pharmacological agenies; 287:1977-1978] [J Clin Invest, 1994; 94:1872-1882].

Pharmacogenomics is based on the DNA detection means of gene pleiomorphism, detect as single nucleotide polymorphism (SNP) the some diseases genes involved, or to certain drug have susceptibility or resistivity ill crowd carry out SNP and detect, can predict what kind of reaction (curative effect or side effect aspect etc.) patient will produce to a certain specific medicine, thereby solve safety and effective two problems of pharmacological agent, and then optimize best methods of treatment, instruct the doctor to draft the dosage regimen of individuation for the patient; In addition, it is improper also to help to reduce clinical application, improves curative effect, reduces toxic side effect, reduces medical expense, has high social benefit and health economics meaning.

SNP is meant the single nucleotide variations on gene level between Different Individual, and a SNP, nearly 3,000,000 SNP between two irrelevant individualities appear in average per 1000 pairs of bases.SNP is very important on personalized medicine.The principal element that influences drug effectiveness comprises that prodrug activates because of metabolism, the binding ability of medicine and target cell, and medicine combines and activity with the medicine target, and active medicine is by metabolism, degraded and discharge; Medicine metabolism, degraded and discharge link and medicine non-specific binding and activity in vivo in vivo then depended in security.Different Individual is the difference of each link SNP therein, the final difference that all may cause to same drug reaction, sometimes the difference of mountain on genetics between this individuality, same medicine in Different Individual effect and the difference of toxic side effect can reach 300 times more than.

Candidate gene about diabetes mainly concentrates on drug metabolism enzyme gene, the gene relevant with active receptors, the gene relevant with the β cell function, the gene of being correlated with insulin resistant or insulin sensitivity in recent years.Tolbutamide is a first-generation sulfonylurea drugs, and dihydroxylation process is to be undertaken by Cytochrome P450 2C9 (CYP2C9) catalysis in vivo.The cohort study finds to exist the poor metabolizer of tolbutamide, approximately is 500: 1.CYP2C9 has two SA amino acid variation Arg144Cys (CYP2C9 ^*2) and Ile359Leu (CYP2C9 ^*3).Discover that the poor metabolizer carries CYP2C9 ^*3 homozygote or heterozygote.The expression of recombinant yeast systematic study finds that the genotype of this variation compares the hydroxylation of tolbutamide with other genotype the highest Km and minimum Vmac are arranged. ^*3/ ^*3 genotype carrier's oral clearance is lower than ^*1/ ^*Half of 1, ^*3/ ^*3 genotype carrier insulin secretions are higher than other genotype carrier.【Sullivan-Klose TH，1996；Inoue K，1997；Yamazaki H，1998；Kidd RS，1999；Kirchheiner J，2002；Niemi M，2002】

Hansen T[Hansen, T.et al.Diabetes 1998; 47,598-605] etc. the people whole SUR1 gene is studied, research comprises 39 exons and intron and the exon intersection of SUR1, result of study is found two missense mutation, the sudden change of 5 nonsense mutations and 4 introns.But do not find sudden change mark new and phenotypic correlation.They find that in the right joint study of genotype the reactive of change of serum C-peptide and Regular Insulin significantly reduces behind double heterozygote exon 18 C/T and the 16-3 c/t abdominal injection tolbutamide.The such genovariation of this research prompting may make the sulfonylurea drugs result of treatment not good.

Owing to there is the individual difference of drug reaction, can't carry out medicament selection and compatibility of drugs when the doctor selects medicine with cutting the garment according to the figure, can not improve curative effect of medication and reduce the generation of toxic side effect, thus may delay treatment opportunity, cause patient's financial loss.Therefore press for the doctor and when selecting antidiabetic drug, can select best methods of treatment especially, instruct the doctor to draft the dosage regimen of individuation for the patient according to the reaction that the patient produces specific medicine.

Summary of the invention

The technical problem to be solved in the present invention is: provide the pleomorphism site genotype by sulfonylurea receptor gene in the detection of biological sample, the purposes of prediction sulfonylurea drugs action effect.

Another technical problem that the present invention will solve is: the blindness that overcomes the selection of clinical sulfonylurea drugs, for personalized medicine provides a kind of method of predicting the sulfonylurea drugs action effect, predict the action effect of sulfonylurea drugs by the pleomorphism site genotype of measuring sulfonylurea receptor gene.

For achieving the above object, the present invention is by the following technical solutions:

One aspect of the present invention relates to the pleomorphism site genotype by sulfonylurea receptor gene in the detection of biological sample, the purposes of prediction sulfonylurea drugs action effect.

Wherein, sulfonylurea receptor gene is preferably sulfonylureas receptor 1 (SUR1) gene.The pleomorphism site genotype of described SUR1 gene comprises at least and is selected from Ser1369Ala (rs757110), pleomorphism site among C/T (rs2074312) and the C/T (rs1799854), and comprise and be selected from T/C (rs1319447), pleomorphism site among A/G (rs2237984) and the A/G (rs2237981), can also further comprise and be selected from the pleomorphism site that has linkage disequilibrium with above-mentioned polymorphism genotype site, and the gene polymorphism sites of other prediction sulfonylurea drugs action effects, comprise the nonsense mutation site, missense mutation site and be positioned at the gene intron position, the pleomorphism site at generegulation position.

Sulfonylurea drugs among the present invention is selected from Glyburide (Glibenclamide), glibornuride (Glibomuride), tolhexamide (Glycyclamide), glyhexamide (Glyhexamide), glisamuride (Glisamuride), Glisentide (Glisentide), glisolamide (Glisolamide), glyoctamide (Glyoctamide), gliclazide (Gliclazide), Glipizide (Glipizide), gliquidone (Gliquidone) and glimepiride (Glimepiride).The present invention is preferably gliclazide or glimepiride.

The action effect of sulfonylurea drugs is mainly blood sugar reducing function, improvement and recovery beta Cell of islet function, increases insulin sensitivity among the present invention.Concrete, when: when the pleomorphism site genotype of (1) described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs; When (2) the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, prediction reaches the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs bigger, and it is relatively poor repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs; When the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, prediction reached the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs less, and it is better repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs; When (3) the pleomorphism site genotype of described SUR1 gene was CC (rs2074312) homozygous wildtype, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene is TT (rs2074312) homozygous mutation type, a little less than the action effect of prediction sulfonylurea drugs;

When (4) the pleomorphism site genotype of described SUR1 gene was TT (rs1799854) homozygous mutation type, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene is CC (rs1799854) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs.

Another aspect of the present invention relates to the pleomorphism site genotype by sulfonylurea receptor gene in the detection of biological sample, the method for prediction sulfonylurea drugs action effect.

This method is measured the pleomorphism site genotype of individual sulfonylurea receptor gene by gathering individual biological specimen, the action effect of prediction sulfonylurea drugs.

This method comprises the steps: 1) utilize the polymorphism parting oligonucleotide to detect pleomorphism site genotype from sulfonylurea receptor gene described in the biological sample of individuality; 2) judge the action effect of sulfonylurea drugs according to described pleomorphism site genotype.

The polymorphism parting oligonucleotide of taking is: (1) allele-specific nucleic acid primer, it can detect the pleomorphism site genotype of sulfonylurea receptor gene, perhaps (2) are used to detect the genotypic oligonucleotide probe of pleomorphism site of sulfonylurea receptor gene, its can be specifically with sulfonylurea receptor gene on the nucleic acid hybridization of pleomorphism site, preferably, the length of oligonucleotide probe is 15-50 Nucleotide.

Wherein, sulfonylurea receptor gene is preferably the SUR1 gene.The polymorphism genotype of described SUR1 gene comprises at least and is selected from Ser1369Ala (rs757110), pleomorphism site among C/T (rs2074312) and the C/T (rs1799854), and comprise and be selected from T/C (rs1319447), pleomorphism site among A/G (rs2237984) and the A/G (rs2237981), can also further comprise and be selected from the pleomorphism site that has linkage disequilibrium with above-mentioned polymorphism genotype site, and the gene polymorphism sites of other prediction sulfonylurea drugs action effects, comprise the nonsense mutation site, missense mutation site and be positioned at the gene intron position, the pleomorphism site at generegulation position.

Sulfonylurea drugs among the present invention is selected from Glyburide, glibornuride, tolhexamide, glyhexamide, glisamuride, Glisentide, glisolamide, glyoctamide, gliclazide, Glipizide, gliquidone and glimepiride.The present invention is preferably gliclazide or glimepiride.

The action effect of sulfonylurea drugs is mainly blood sugar reducing function, improvement and recovery beta Cell of islet function, increases insulin sensitivity among the present invention.Concrete, when

When (1) the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs;

When (2) the pleomorphism site genotype of described SUR1 gene was Ser1369Ser (rs757110) homozygous wildtype, prediction reached the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs bigger, and it is relatively poor repeatedly to adjust behind the dosage curative effect of sulfonylurea drugs; When the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, prediction reached the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs less, and it is better repeatedly to adjust behind the dosage curative effect of sulfonylurea drugs;

When (3) the pleomorphism site genotype of described SUR1 gene was CC (rs2074312) homozygous wildtype, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene is TT (rs2074312) homozygous mutation type, a little less than the action effect of prediction sulfonylurea drugs;

When (4) the pleomorphism site genotype of described SUR1 gene was TT (rs1799854) homozygous mutation type, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene is CC (rs1799854) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs.

Forecasting Methodology among the present invention is applicable to normal population, impaired fasting glucose (IFG) crowd, the impaired crowd of sugar tolerance and diabetic population, also be applicable to and exist suffer from diabetes high risk factor crowd, be specially adapted to that weight index is higher, overweight, islet function is relatively poor, insulin sensitivity is relatively poor, the course of disease is long, the diabetic population of complicated hypertension or merging hyperlipidemia.

The ideal hypoglycemic effect that reaches among the present invention refers to that diabetic individual takes fasting plasma blood glucose value (FPG)≤7.0mmol/l behind the antidiabetic drug, and FPG compared decline 〉=20% before perhaps diabetic individual was taken behind the antidiabetic drug fasting plasma blood glucose value (FPG) and taken medicine.Method of the present invention, can use the following difference foranalysis of nucleic acids technology that is selected from that comprises: polymerase chain reaction (PCR), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), PCR-alleles-specific oligonucleotide probe method (PCR-allele specific oligonucleotide, PCR-ASO), the special oligonucleoside acid system (PCR-SSO of PCR-order, sequence specific oligonucleitide), sequencing, PCR-sequence specific primers method (PCR-SSP, sequence specific primer), the PCR-fluorescent method, PCR finger-printing method (PCR-fingerprints), oligonucleotide connects to be analyzed, the detection method of fluorescent energy resonance transfer, biochip, nucleic acid chip, mass-spectrometric technique, genescan, single strand conformation polymorphism (SSCP), denaturing gradient gel electrophoresis, enzyme or chemical mispairing patterning method, the Taqman biological detecting method, or be selected from test kit, a kind of in the detection paper carrier.

PCR, PCR-RFLP, biochip, sequencing, genescan genotype detection method are the conventional methods of using of those skilled in the art.The Taqman technology is a kind of method of using fluorescence technique to carry out real-time quantitative PCR.Biochip is meant methods such as adopting the synthetic or micro-sampling of Hiroshima original position, with the large number of biological macromole such as nucleic acid fragment, peptide molecule even tissue slice, biological samples such as cell solidify in upholder in an orderly manner (as slide, silicon chip, polyacrylamide gel, carriers such as nylon membrane) surface, form intensive two-dimentional molecular arrangement, then with the molecular hybridization that hits of the biological sample to be measured of mark, by specific instrument such as laser confocal scanning instrument or electric charge coupling photographic camera (CCD) intensity of hybridization signal is carried out fast, parallel, check and analysis efficiently, thereby the quantity of target molecule or quality in the judgement sample.Wherein preferred detection method is PCR, PCR-RFLP, Taqman technology, biochip, nucleic acid chip or test kit.The present invention is not to be qualification for detection method for the explanation of the genotypic detection method of pleomorphism site, any those skilled in the art adopt conventional biotechnological means to predict that by detecting pleomorphism site genotype of the present invention the action effect of sulfonylurea drugs all belongs to content of the present invention, can further include the drug effect that the pleomorphism site that adopts conventional biotechnological means to be associated by the indirect reflection of the difference that detects the genotypic transcript and expression product of pleomorphism site functional type of the present invention is predicted sulfonylurea drugs.

Biological sample described in purposes of the present invention and the method is selected from: blood sample, humoral sample, tissue sample and culturing cell, preferred, described sample is a blood sample.Wherein blood sample comprises peripheral blood cells, white corpuscle, serum etc., humoral sample comprises urine, saliva, tissue juice, cerebrospinal fluid, body cavity transudate etc., and tissue sample comprises oral mucosa examination son, hair, skin, biopsy, organizes sample secretory product, fecal matter sample etc.

The ATP responsive type potassium-channel on beta Cell of islet surface is one of key position in the insulin secretion process.This passage is made up of two parts: (sulphonylureareceptor 1 for the acceptor of some oral antidiabetic drug (as sulfourea and meglitinide) for a part, SUR1, gene title ABCC8), another part is inward rectifier potassium channels (inwardly rectifyingK+channel, Kir6.2, gene title KCNJ11) albumen.On the beta Cell of islet film, the K passage (K of ATP sensitivity _ATP) by sulfonylureas receptor 1 (SUR1) subunit and inward rectification K passage (Kir6.2) subunit composition of proportions KATP heteromultimeric with 4: 4.Wherein, Kir6.2 constitutes pass structure, and SUR1 controls K _ATPThe active condition of passage.The site of identification sulfourea molecule is arranged on the SUR1 subunit, and these binding sites combine postactivated with respective ligand, cause K _ATPPathway closure, thus make the subregion depolarize on the cytolemma cause voltage-dependent L type Ca ²⁺Channel opener causes stream in the calcium, Ca ²⁺Enter in the cell Ca in the endochylema ²⁺Concentration raises, thereby the Regular Insulin that triggers in the vesica discharges to the extracellular, thereby causes secretion of insulin.Human SUR1 (ABCC8) assignment of genes gene mapping is in No. 11 the short arm of a chromosome 15.1 districts (11p15.1), and total length is about the single-copy sequence of 100kb, contains 39 exons.Wherein NBF1 is by 13～No. 22 exons codings, and NBF2 is by the 31st～No. 39 exons coding.Common single nucleotide polymorphism (SNP) site can be positioned at exon, intron position and the non-coding region position of gene, is preferably the exon position, especially can change the pleomorphism site of amino acid sequence coded.

What the present invention relates to discovers:The common pleomorphism site of SUR1 shows as but is not limited to following form: Ser1369Ala (rs757110), C/T (rs2074312), C/T (rs1799854), T/C (rs1319447), A/G (rs2237984), A/G (rs2237981), is preferably Ser1369Ala (rs757110), C/T (rs2074312), C/T (rs1799854).The pleomorphism site genotype of SUR1; especially be positioned at the pleomorphism site that can have influence on the corresponding encoded aminoacid sequence at exon position; usually can influence the function and the activity of SUR1 gene encoding production, therefore direct or remote effect arrive the action effect of sulfonylurea drugs.Promptly, can predict the action effect of sulfonylurea drugs by measuring the pleomorphism site genotype of SUR1.The pleomorphism site genotype of SUR1 gene, one of indication mechanism as the action effect of prediction sulfonylurea drugs, can indicate the activity and the functional status of the gene encoding production of SUR1 gene pleiomorphism correspondence, the function target spot as new drug instructs the research and development of compound antihypelipidemic medicine; And can indicate compound antihypelipidemic medicine in conjunction with development, the more individual dose,optimum of choose reasonable sulfonylurea drugs and the compatibility of suitable combination drug.

At the Ser1369Ala of known SUR1 gene (TG, rs757110) under the polymorphism situation, the diabetic subject is after the sulfonylurea drugs treatment, taking medicine back the 57th day, genotype be Ala1369Ala (GG, rs757110) individuality of homozygous mutation type and genotype be Ser1369Ala (TG, rs757110) heterozygous or genotype are Ser1369Ser (TT, rs757110) compare mutually between the individuality of homozygous wildtype, the action effect of sulfonylurea drugs has difference.When the pleomorphism site genotype of results suggest SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene was Ser1369Ala (rs757110) heterozygous, the action effect of prediction sulfonylurea drugs was stronger; When the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs.

The inventor's research is found again, the icp gene type is that CC (rs2074312) homozygous wildtype individuality, genotype are that CT (rs2074312) heterozygous individuality and genotype are TT (rs2074312) homozygous mutation type individuality, the action effect of sulfonylurea drugs has difference, when the polymorphism genotype of the described SUR1 gene of results suggest was CC (rs2074312) homozygous wildtype, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene was CT (rs2074312) heterozygous, the action effect of prediction sulfonylurea drugs was stronger; When the pleomorphism site genotype of described SUR1 gene is TT (rs2074312) homozygous mutation type, a little less than the action effect of prediction sulfonylurea drugs.

The inventor further discovers, relatively the pleomorphism site genotype of SUR1 gene is that TT (rs1799854) homozygous mutation type individuality, genotype are that CT (rs1799854) heterozygous individuality and genotype are CC (rs1799854) homozygous wildtype individuality, and the action effect of sulfonylurea drugs has difference.When the pleomorphism site genotype of the described SUR1 gene of results suggest was TT (rs1799854) homozygous mutation type, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene was CT (rs1799854) heterozygous, the action effect of prediction sulfonylurea drugs was stronger; When the pleomorphism site genotype of described SUR1 gene is CC (rs1799854) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs.

The inventor discovers by further layering, higher for the baseline blood glucose value, the baseline insulin level is higher, weight index is higher, overweight, islet function is relatively poor, insulin sensitivity is heavier, the course of disease is long, complicated hypertension and/or merge the individuality of hyperlipidemia, generally for the action effect of sulfonylurea drugs a little less than.Under the Ser1369Ala of known SUR1 gene (rs757110), C/T (rs2074312) and C/T (rs1799854) pleomorphism site genotype situation, the homozygous wildtype of more above-mentioned pleomorphism site, heterozygous and homozygous mutation type individuality, the action effect of finding sulfonylurea drugs has difference, trend is identical as a result with not stratified crowd for the trend of difference, and difference more is added with significance with the difference that not stratified result compares between the different genotype.Especially surprisedly find that when the Ser1369Ala of SUR1 gene (rs757110) pleomorphism site genotype was Ala1369Ala (rs757110) homozygous mutation type, the action effect of sulfonylurea drugs was strong than Ser1369Ala (rs757110) heterozygous.

Especially, further carry out layering, analyze when reaching desirable hypoglycemic curative effect after the sulfonylurea drugs treatment, when different SUR1 Ser1369Ala (rs757110) pleomorphism site genotype individual needs is taken the dosage of sulfonylurea drugs, surprisedly find, the dosage difference of the sulfonylurea drugs that need take when different SUR1 genotype individualities reaches desirable hypoglycemic curative effect, wherein, need not to increase the initial dose difference that dosage promptly can reach desirable hypoglycemic curative effect, and, after increasing medication dose gradually according to blood glucose value, the different genotype individuality can reach the ratio difference of desirable hypoglycemic curative effect, and there was a significant difference.Promptly when the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, prediction reaches the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs bigger, and it is relatively poor repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs; When the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, prediction reached the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs less, and it is better repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs.

The action effect of the sulfonylurea drugs described in the present invention is blood sugar reducing function, improvement and recovery beta Cell of islet function and the action effect that strengthens insulin sensitivity.

In the content of the present invention, our special primer sequence that is used to measure polymorphism genotype site that designed, and according to this primer sequence and target sequence characteristics determined the amplification efficiency height, specificity is good and the timesaving detection method, make things convenient for those of ordinary skill in the art to grasp and use, good practical value is arranged.

The present invention has particularly designed following pcr amplification primer at SUR1 Ser1369Ala (rs757110) pleomorphism site genotype, compares with the amplimer of routine, and amplification efficiency height, specificity be good, save time, and better use value is arranged.The genotypic pcr amplification primer of the Ser1369Ala of SUR1 (rs757110) pleomorphism site is as follows:

Forward primer: 5 '-GGA GAG GGG TGG GGA AGA-3 '

Reverse primer: 5 '-GTC CTG CAG CAT TGG GTT G-3 '

Advantage of the present invention is: a kind of purposes and the method that the invention provides the action effect that utilizes functional gene prediction sulfonylurea drugs, can be used as the indication mechanism of the action effect of sulfonylurea drugs, by measuring the pleomorphism site genotype of sulfonylurea receptor gene, the action effect of prediction sulfonylurea drugs.According to purposes provided by the invention and method, measure the pleomorphism site genotype of sulfonylurea receptor gene, be convenient to the doctor carries out curative effect of medication according to individual difference when medication prediction, further can therefore select medicine, carry out the individuation medical treatment, improve the efficient and security of clinical application and treatment, reduced risk and economical load that toxic side effect takes place.Use the invention achievement of this class functional gene polymorphism, select medicine, prediction medication curative effect and instruct new drug development to have the using value of industry and service instructing the clinical of antidiabetic drug from now on more economically effectively.The invention will be further described below in conjunction with embodiment, every this area of having done according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.

Embodiment

Embodiment 1: (dsSNP ID:rs757110, the pleomorphism site genotype of TCC → GCC) is also predicted the action effect of sulfonylurea drugs to measure the Ser1369Ala of SUR1 gene

(1) the rs757110 Ser1369Ala pleomorphism site genotype of mensuration SUR1 gene:

(1) genomic dna of extraction host cell:

(a) add the 30ml erythrocyte cracked liquid in whole blood, slowly shake up, room temperature left standstill 10 minutes, during, shake for several times, thoroughly splitting erythrocyte;

(b) in 4 ℃, 2000 rev/mins centrifugal 10 minutes, remove supernatant, the white corpuscle that will precipitate is broken up on the oscillator in rotation, adds proteolytic enzyme 40ul, RNA enzyme 50ul, shakes up, and adds write cell lysis buffer and puts 15ml, 37 ℃ of water-baths of mixing were taken out after 20 minutes, put in the cold water;

(c) add cold albumen precipitation liquid 4ml, be placed on-20 ℃ of refrigerators 5 minutes behind the mixing, take out in 4 ℃, 3000 rev/mins centrifugal 10 minutes.Supernatant liquor poured into slowly shake in the 50ml centrifuge tube that oneself has added the 15ml Virahol for several times, separate out to the DNA floss;

(d) the DNA floss of separating out is moved in another 1.5ml centrifuge tube, add 0.5ml 75% ethanol and wash precipitation, discard ethanol, the air at room temperature drying;

(e) add DNA hydrating fluid 1.5ml, put shaking table, shaken over night, standby;

(f) mensuration of DNA concentration adopts ultraviolet spectrophotometry, measures the OD value under two wavelength of 260nm and 280nm respectively, is DNA concentration with OD260nm * 50 income values.And with OD260nm/OD280nm ratio estimation DNA purity;

(2) use the Taqman method to detect the rs757110 Ser1369Ala pleomorphism site genotype of SUR1 gene:

(a) with PCR instrument amplification SUR1 gene polymorphism sites and flanking sequence thereof, in 5ul PCR reaction system, contain genomic dna 10ng, 2.5ul Taqman 2 * Universal PCR Master Mix No AmpErase UNG (composition comprises: AmpliTaq Gold DNA Polymerase, dNTPs with Dutp, Passive Reference, the damping fluid of having optimized), and the forward primer of 0.72uM, each 0.16uM of allele-specific probe of the reverse primer of 0.72uM and two sections band fluorescence report groups.

Primer sequence is:

Forward primer: 5 '-GGGAAGATCCAGATCCAGAACCT-3 '

Reverse primer: 5 '-CCGTGCTCTGACCTTCTGT-3 '

The sequence of allele-specific probe is:

VIC-5’-TGCCCTCATCGCCCCT-3’-NFQ，

Corresponding to " G " allelotrope, carry VIC fluorescence report group.

FAM-5’-ATGCCCTCATCTCCCCT-3’-NFQ

Corresponding to " T " allelotrope, carry FAM fluorescence report group.

The PCR reaction conditions:

95 ℃ of 10min, 1 circulation; 92 ℃ of 15s, 60 ℃ of 1min, 50 circulations.

(b) on 7900 type quantitative real time PCR Instruments, detect fluorescence information

The PCR plate of finishing the PCR reaction is put on the 7900 type quantitative real time PCR Instruments, is selected for use " AllelicDiscrimination " program, scan judgement with the result:

The genotype of sending FAM fluorescence person is Ser 1369 Ser wild-types;

The genotype of sending VIC fluorescence person is Ala 1369 Ala homozygous mutation;

The genotype of sending two kinds of fluorescence persons is Ser 1369 Ala heterozygotes.

(2) prediction drug effect:

SUR1 rs757110 Ser1368Ala pleomorphism site genotype is that the individuality of homozygous mutation type is compared with the individuality of heterozygous or homozygous wildtype, and is better for the action effect of sulfonylurea drugs.Along with the quantity increase at seats such as sudden change, the action effect of sulfonylurea drugs strengthens.

When the pleomorphism site genotype of described SUR1 gene was rs757110 Ala1369Ala homozygous mutation type, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene was rs757110 Ser1369Ala heterozygous, the action effect of prediction sulfonylurea drugs was stronger; When the pleomorphism site genotype of described SUR1 gene is rs757110 Ser1369Ser homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs.

When the pleomorphism site genotype of described SUR1 gene was Ser1369Ser (rs757110) homozygous wildtype, prediction reached the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs bigger, and it is relatively poor repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs; When the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, prediction reached the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs less, and it is better repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs.

SUR1 Ser1369Ala homozygous mutation genotype is compared with heterozygous or homozygous wildtype, and the action effect of sulfonylurea drugs is better in the individuality especially higher in the baseline glucose level, that the course of disease is long, and there was a significant difference; And along with the quantity at seats such as sudden change increases, the action effect of sulfonylurea drugs strengthens.

SURl Ser1368Ala homozygous mutation genotype is compared with heterozygous or homozygous wildtype, and especially the action effect of sulfonylurea drugs is better in the higher individuality of baseline insulin level; And along with the quantity at seats such as sudden change increases, the action effect of sulfonylurea drugs strengthens.

SUR1 Ser1368Ala homozygous mutation genotype is compared with heterozygous or homozygous wildtype, and especially the action effect of sulfonylurea drugs is better in the relatively poor individuality of basic islet function; And along with the quantity at seats such as sudden change increases, the action effect of sulfonylurea drugs strengthens.

SUR1 Ser1368Ala homozygous mutation genotype is compared with heterozygous or homozygous wildtype, and the action effect of sulfonylurea drugs is better in the individuality especially higher at BMI, that islet function is relatively poor or insulin sensitivity is relatively poor; And along with the quantity at seats such as sudden change increases, the action effect of sulfonylurea drugs strengthens.

SUR1 Ser1368Ala homozygous mutation genotype is compared with heterozygous or homozygous wildtype, and especially the action effect of sulfonylurea drugs is better in the individuality that has merged hypertension and/or hyperlipidemia; And along with the quantity at seats such as sudden change increases, the action effect of sulfonylurea drugs strengthens.

In an embodiment of the present invention, the action effect of sulfonylurea drugs comprises lowering blood glucose, reduction glycolated hemoglobin, improvement or recovers beta Cell of islet function, enhancing insulin sensitivity, refers in particular to lowering blood glucose.

In an embodiment, sulfonylurea drugs is gliclazide or glimepiride.But result of the present invention is not limited to a certain sulfonylurea drugs.Those skilled in the art can be generalized to the embodiment result among the present invention any sulfonylurea drugs, and can result of the present invention be generalized to other other drug compositions by combining and work with the SUR1 acceptor according to general knowledge such as similar pharmacological mechanism etc., as the meglitinide medicine, particularly including repaglinide and nateglinide.

Above result verifies by epidemiological study, earlier with diabetic individual according to SUR1 Ser1369Ala (rs757110, TCC-GCC) pleomorphism site genotype is divided into three groups: Ser1369Ser (rs757110, TT) homozygous wildtype group, Ser1369Ala (rs757110, TG) heterozygous group and Ala1369Ala (rs757110, GG) homozygous mutation type group, take sulfonylurea drugs gliclazide treatment 56 days, measure the fasting blood sugar (FPG) before and after taking medicine respectively, the glycolated hemoglobin value, serum insulin level, the beta Cell of islet function, the situation of indexs such as insulin sensitivity, observe the drug effect effect, the result is as follows:

(whether (FPG0-FPG57)/FPG0) reaches 20% crowd that the crowd who takes the sulfonylurea drugs treatment can be divided into glycemic control good (FPG descends 〉=20%) or glycemic control poor (FPG decline＜20%) to the decline percentage ratio of comparing with the baseline blood glucose value (FPG0) before the treatment according to the fasting blood sugar (FPG57) of treatment after 56 days, two groups of crowds that promptly crowd have been divided into good effect (FPG descends 〉=20%) and curative effect bad (FPG descends＜20%) according to this index, classify according to the different genotype of SUR1 Ser1369Ala (TCC-GCC) simultaneously, analyze the relation of different genotype and sulfonylurea drugs hypoglycemic curative effect.The result is as shown in table 1, find out carry SUR1 Ser1369Ala (TCC-GCC) mutation allele especially the genotypic crowd FPG of homozygous mutation descend and reach 20% number ratio apparently higher than homozygous wildtype crowd ratio, quantity increase along with seats such as sudden changes, FPG descends and to reach 20% number ratio and increase among the crowd, and FPG 20% the number ratio of reaching that descends is the highest among the genotypic crowd of homozygous mutation.Through statistical test, there was a significant difference.The mutation allele carrier is described for the wilder allelotrope carrier of sulfonylurea drugs sensitivity, and the hypoglycemic curative effect increases along with the increase of sudden change equipotential quantum count.

In addition, we according to the fasting blood sugar (FPG) of treatment after 56 days whether be less than or equal to crowd that 7.0mmol/L will take the sulfonylurea drugs treatment be divided into glycemic control good (≤7.0mmol/L) or poor (＞7.0mmol/L) the crowd of glycemic control, promptly the crowd good effect and two groups of bad crowds of curative effect have been divided into according to this index, classify according to the different genotype of SUR1Ser1369Ala (TCC-GCC) simultaneously, analyze the relation of different genotype and sulfonylurea drugs hypoglycemic curative effect.The result is as shown in table 1: the mutation allele that carries SUR1 Ser1369Ala (TCC-GCC) the especially genotypic crowd of the homozygous mutation back FPG that takes medicine descends 〉=20% number ratio apparently higher than homozygous wildtype crowd descend 〉=20% the number ratio of back FPG of taking medicine, and the back FPG that takes medicine descends 〉=20% number ratio along with the quantity increase at seats such as sudden change and increase; The mutation allele that carries SUR1 Ser1369Ala (TCC-GCC) especially the genotypic crowd's glycemic control of homozygous mutation good (≤7.0mmol/L) number ratio is apparently higher than homozygous wildtype crowd ratio, along with the quantity increase at seats such as sudden change, the good number ratio of glycemic control increases among the crowd.The mutation allele carrier is described for the wilder allelotrope carrier of sulfonylurea drugs sensitivity, and the curative effect of hypoglycemic increases along with the increase of sudden change equipotential quantum count.

Each the polymorphism genotype of table 1 SUR1 Ser1369Ala (TCC-GCC) and the relation (frequency) of taking the FPG behind the sulfonylurea drugs

Genotype *	Positive number (n)	Negative number (n)	Add up to (n)	Efficient (%)	P# (chi square test)
						The back FPG that takes medicine descends 〉=20%
TT TG GG adds up to	127 214 100 441	86 111 23 220	213 325 123 661	59.6 65.8 81.3 66.7	＜0.0001a
						Back FPG≤7.0mmol/l takes medicine
TT TG GG adds up to	82 145 59 286	131 180 64 375	213 325 123 661	38.5 44.6 48.0 43.3	0.0740b

Annotate: ^*Genotype: TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC) heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

This table does not have proofreaies and correct the CMH chi square test: chi-square value is respectively: a (15.1671) b (3.1928) adopts the research method of case-contrast, the study population is divided into two groups of homozygous mutation type and homozygous wildtype according to SUR1 Ser1369Ala (TCC-GCC) pleomorphism site genotype, compares to take the classification of the sulfonylurea drugs percentage ratio that FPG descends after 56 days.Definition: FPG * 100% before FPG decline percentage ratio=(FPG-treats back FPG before the treatment)/treatment serves as effectively with FPG decline percentage ratio 〉=20%, and FPG decline＜20% is invalid.The result is as shown in table 2, and FPG descended 〉=20% after the individuality that adds up to 67.5% (227/336 * 100%) was taken sulfonylurea drugs; Wherein the homozygous mutation type individuality of 81.3% (100/ (100+23) * 100%) FPG after taking sulfonylurea drugs descends 〉=20%; Only there is homozygous wildtype individuality FPG after taking sulfonylurea drugs of 59.6% (127/ (127+86) * 100%) to descend 〉=20%.Take curative effect difference after the gliclazide between the results suggest different genes group, be more prone to reduce FPG, good effect after the individuality that carries mutation allele is taken sulfonylurea drugs.

Table 2 is effective standard with FPG decline 〉=20%

	Effectively (FPG descends 〉=20%)	Invalid (FPG descends＜20%)	Add up to
				GG (homozygous mutation type)	100	23	123
TT (homozygous wildtype)	127	86	213
				Add up to	227	109	336

(susceptibility=100/227 * 100%=44.1% specificity=86/109 * 100%=78.9%

PPV＝100/123×100％＝81.3％ NPV-＝86/213*100％＝40.4％)

Adopt the research method of case-contrast, the study population is divided into two groups of homozygous mutation type and homozygous wildtype according to SUR1 Ser1369Ala (TCC-GCC) pleomorphism site genotype, classify and compare to take the FPG value of sulfonylurea drugs after 56 days.Definition: treatment back FPG≤7.0mmol/L is effectively, and treatment back FPG＞7.0mmol/L is invalid.The result is as shown in table 3, the individuality that adds up to 41.9% (141/336 * 100%) is taken FPG≤7.0mmol/L behind the sulfonylurea drugs, homozygous mutation type individuality FPG≤7.0mmol/L after taking sulfonylurea drugs of 47.9% (59/123 * 100%) wherein only has homozygous wildtype individuality FPG≤7.0mmol/L after taking sulfonylurea drugs of 38.5% (82/213 * 100%).Take curative effect difference after the gliclazide between the results suggest different genes group, be more prone to reduce FPG, good effect after the individuality that carries mutation allele is taken sulfonylurea drugs.

Table 3 is effective standard with 57 days FPG≤7.0mmol/l

	Effectively (FPG57day≤7.0mmol/l)	Invalid (FPG57day＞7.0mmol/l)	Add up to
				GG (homozygous mutation type)	59	64	123
TT (homozygous wildtype)	82	131	213
				Add up to	141	195	336

Susceptibility=59/100 * 100%=41.8% specificity=131/195 * 100%=67.2%

PPV＝59/100×100％＝48.0％ NPV＝131/213×100％＝61.5％

Further carry out data analysis, observe each the pleomorphism site genotype of SUR1 Ser1369Ala (TCC-GCC) and the relation that FPG descends according to the multiple regression analysis method.We define: FPG-treatment back FPG before FPG decline absolute value=treatment; FPG before FPG decline percentage ratio=FPG decline absolute value/treatment * 100%.The result is as shown in table 4, can see during with multiple linear regression analysis that the crowd FPG decline absolute value and the FPG decline per-cent that carry SUR1 Ser1369Ala (TCC-GCC) mutation allele are all big than homozygous wildtype gene carrier fall, fall increases along with the increase of sudden change equipotential quantum count, especially the amplitude of FPG decline absolute value and FPG decline percentage ratio is all maximum among the homozygous mutation genotype crowd, compare difference highly significant (P＜0.0001) with wild-type, the result has statistical significance.

The multiple regression analysis of the changing value that each the polymorphism genotype of table 4 SUR1 Ser1369Ala (TCC-GCC) and the back FPG that takes medicine descend

Genotype *	N	Mean±SD	β#	StdE#	P#
						Back FPG decline absolute value (mmol/L) a takes medicine
TT TG GG	213 325 123	2.75±2.31 3.03±2.4 3.78±2.53	0.47 0.84	0.17 0.21	0.0055 ＜0.0001
						Back FPG decline per-cent (%) b takes medicine
TF TG GG	213 325 123	24±19 26±18 32±16	0.03 0.08	0.02 0.02	0.0461 ＜0.0001

Annotate: ^*Genotype: TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC) heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

The # correction factor: age, sex, weight index (BMI), tobacco and wine history, ofhypoglycemic medicine are taken in the correction factor of history, baseline triglyceride level (TG), FPG (fasting plasm glucose, fasting plasma blood sugar) decline per-cent does not have FPG

FPG-treatment back FPG before FPG decline absolute value=treatment after a takes medicine

FPG * 100% before FPG decline per-cent after the b takes medicine=back FPG decline absolute value/treatment of taking medicine

The pleomorphism site genotype crowd of more different SUR1 Ser1369Ala (TCC-GCC) takes the gliclazide treatment, before the treatment and treatment back individuality carries out oral glucose tolerance (OGTT) test respectively, clothes before and after the treatment back 30 minutes blood sugar of sugar and 120 minutes changes of blood glucose are analyzed, found same result.Be that the SUR1 Ser1369Ala homozygous mutation genotype crowd of carrying obeys effect that sugar back blood sugar reduces through the sulfonylurea drugs treatment and isozygotys than SUR1 Ser1369Ala that to carry the crowd good for the wild gene type.Table 5, table 6 are represented respectively individual to compare through before taking sulfonylurea drugs gliclazide treatment back and treating, and the blood sugar drop-out value and the decline per-cent of 30 minutes or 120 minutes compares in the different genotype crowd behind the oral glucose.The effect that can see homozygous mutation type individuality blood sugar after reducing clothes sugar after the sulfonylurea drugs treatment is better than homozygous wildtype and heterozygous individuality, and difference has significance,statistical.Promptly carry the genotypic individuality of SUR1 Ser1369Ala pleomorphism site homozygous mutation and compare with the homozygous wildtype individuality, taking sulfonylurea drugs has better therapeutic for reducing postprandial blood sugar.

The multiple regression analysis of the back 30 minutes change of blood sugar of pleomorphism site genotype kimonos sugar of table 5 SUR1 Ser1369Ala (TCC-GCC)

Genotype *	N	Mean±SD	β#	StdE#	P#
						Back 30 minutes blood sugar drop-out value (mmol/l) a of clothes sugar
TT TG GG	170 261 98	3.43±2.98 3.56±3.53 4.28±3.14	0.13 0.90	0.26 0.33	0.6143 0.0060
						Back 30 minutes blood sugar decline per-cent (%) b of clothes sugar
TT TG GG	171 259 98	19.60±15.90 17.05±21.20 24.55±15.72	-0.02 0.05	0.02 0.02	0.2673 0.0463

Annotate: ^*Genotype: TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC) heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

The # correction factor: age, sex, weight index (BMI), tobacco and wine history, ofhypoglycemic medicine are taken history, baseline triglyceride level (TG), back 30 minutes blood sugar (wherein per-cent is proofreaied and correct does not have this factor) of baseline clothes sugar.

Back 30 minutes blood sugar-back 30 minutes blood sugar of treatment back clothes sugar of clothes sugar before the blood sugar drop-out value=treatment in back 30 minutes of a clothes sugar

Back 30 minutes blood glucose value * 100% of clothes sugar before the blood sugar decline per-cent=clothes sugar blood sugar drop-out value/treatment in back 30 minutes in back 30 minutes of b clothes sugar

The multiple regression analysis of the changing value of the pleomorphism site genotype kimonos sugar blood sugar decline in back 120 minutes of table 6 SUR1 Ser1369Ala (TCC-GCC)

Genotype *	N	Mean±SD	β#	StdE#	P#
						Back 120 minutes blood sugar drop-out value (mmol/l) a of clothes sugar
TT TG GG	171 259 98	4.45±4.35 4.69±4.52 6.02±4.26	1.14 1.81	0.37 0.46	0.0019 ＜.0001
						Back 120 minutes blood sugar decline percentage ratio (%) b of clothes sugar
TT TG GG	171 259 98	21.15±20.86 22.69±23.98 30.05±18.96	0.02 0.09	0.02 0.03	0.3232 0.0035

Annotate: ^*Genotype: TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC) heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

The # correction factor: age, sex, weight index (BMI), tobacco and wine history, ofhypoglycemic medicine are taken history, baseline triglyceride level (TG), 120 minutes blood sugar (wherein per-cent is proofreaied and correct does not have this factor) of baseline.

Back 120 minutes blood sugar-back 120 minutes blood sugar of treatment back clothes sugar of clothes sugar before the blood sugar drop-out value=treatment in back 120 minutes of a clothes sugar

Back 120 minutes blood glucose value * 100% of clothes sugar before the blood sugar decline per-cent=clothes sugar blood sugar drop-out value/treatment in back 120 minutes in back 120 minutes of b clothes sugar

The polymorphism genotype crowd of more different SUR1 Ser1369Ala (TCC-GCC) took the gliclazide treatment after 57 days, the percentage ratio ((HbAlc0-HbAlc57)/HbAlc0 * 100) that glycolated hemoglobin descends.The result is as shown in table 7, can see that carrying the genotypic crowd of SUR1 Ser1369Ala (TCC-GCC) homozygous mutation compares with the crowd who does not carry mutation allele through the value decline of sulfonylurea drugs treatment back glycolated hemoglobin that there was a significant difference, it is better that the crowd who carries mutation allele reduces the effect of glycolated hemoglobin, and the fall of treatment back glycolated hemoglobin increases progressively along with the increase of sudden change equipotential quantum count, the value fall maximum of homozygous mutation type individuality glycolated hemoglobin after the sulfonylurea drugs treatment, there was a significant difference.

The relation of the pleomorphism site genotype of table 7 SUR1 Ser1369Ala (TCC-GCC) and gliclazide treatment glycolated hemoglobin decline percentage ratio (%) after 57 days

Genotype	Example number (n)	Mean±SD(％)	Compare between group (ANOVA)
					The F value	The P value
			TT TG GG	213 325 123			12.1±11.1 16.8±15.4 20.5±12.2	3.05	0.0327

Annotate: TT, represent SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC) heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

Our research has further been analyzed SUR1 Ser1369Ala pleomorphism site genotypic individuality and has been taken the relation that reaches behind the sulfonylurea drugs between needed drug dose of desirable hypoglycemic effect and the genotype.Research approach is: the predose that diabetic individual is taken gliclazide is 40mg, every day 2 times; Having 2 chances at the 15th day and the 29th day can be according to FPG horizontal adjustment medication dose, concrete, as FPG＞7.0mmol/l, all increases medication dose 40mg on former medication dose basis at every turn; If FPG≤7.0mmol/l, it is constant then to keep former medication dose.Be 57 days observation course of treatment of taking gliclazide.

Patient is divided into adjusts overtreatment (no matter be once or twice) and do not adjust two groups of crowds of overtreatment (table 8), can see and totally have 61.72% patient to adjust overtreatment, and homozygous mutation and assorted and sub-genotype are carried the ratio that crowd's dose titration crosses and significantly are lower than the ratio (three is respectively 58.54%, 54.77% and 74.18%) that the wild gene type that isozygotys carries the crowd, the OR value of adjusting dosage with respect to needs is also less, has statistical significance.The result shows: when individuality is seat carrier such as SUR1 Ser1369Ala (TCC-GCC) G sudden change, the sulfonylurea drugs that only needs to take less predose just can reach the ideal hypoglycemic effect, promptly need not repeatedly adjust medication dose according to blood glucose value and just can reach the ideal hypoglycemic effect; And when the pleomorphism site genotype of individual SUR1 Ser1369Ala (TCC-GCC) is homozygous wildtype, the sulfonylurea drugs of big predose of need taking medicine just can reach the ideal hypoglycemic effect, promptly needs repeatedly to adjust medication dose according to blood glucose value and just can reach desirable hypoglycemic effect.

Relation between the pleomorphism site genotype of table 8 SUR1 Ser1369Ala (TCC-GCC) and the adjustment sulfonylurea drugs dosage

Genotype	Do not adjust n (%)	Adjusted n (%)	Add up to	Logistic
							OR	95％Cl	P
				TT TG GG adds up to	55(25.82) 147(45.23) 51(41.46) 253(38.28)	158(74.18) 178(54.77) 72(58.54) 408(61.72)				213 325 123 661	1.00 0.42 0.49	0.29-0.61 0.31-0.79	＜.0001 0.0032

Annotate: TT, represent SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC) heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type

We analyze the patient took after the gliclazide the 15th day and all to need to adjust dosage on the 29th day, just in the time of the 15th day because FPG 〉=7.0mmol/L checked FPG 〉=7.0mmol/L after adjusting dose at the 29th day, need the crowd of the 2nd adjustment dosage, analyze the pleomorphism site genotype of different SUR1 Ser1369Ala (TCC-GCC) and the relation of therapeutic effect of sulfonylurea drugs (seeing Table 9).Can see that blood sugar still can continue to descend if homozygous mutation type individuality continues to take sulfonylurea drugs after twice is adjusted dosage, the decline average is 1.02mmol/l, and the percentage ratio of decline is 9%; And after the homozygous wildtype crowd continued to take sulfonylurea drugs, the fall average of blood sugar was 0.17mmol/l, and the percentage ratio of decline is 0%.Promptly no matter be to continue to take the percentage ratio that blood sugar descends behind the sulfonylurea drugs absolute value or blood sugar descend, comparing between different genotype all has marked difference statistically.The result shows, when the pleomorphism site genotype of the SUR1 of individuality Ser1369Ala is the TT homozygous wildtype, when taking sulfonylurea drugs one month and still do not reach after the medication dose of sulfonylurea drugs (during can repeatedly adjust according to the FPG value) desirable hypoglycemic curative effect, prompting continues to increase hypoglycemic curative effect behind the medication dose almost without any improvement; When the pleomorphism site genotype of individual SUR1 Ser1369Ala is GG homozygous mutation type, when taking sulfonylurea drugs one month and still do not reach after the medication dose of sulfonylurea drugs (during can repeatedly adjust according to the FPG value) desirable hypoglycemic curative effect, the hypoglycemic curative effect that prompting continues to increase behind the medication dose still can continue to increase.

The pleomorphism site genotype of table 9 SUR1 Ser1369Ala (TCC-GCC) and the bad crowd of curative effect adjust the curative effect behind the sulfonylurea drugs dosage

Genotype *	N	Mean±SD	T value #	P#
					Absolute value (mmol/l) a that FPG descends
TT GG	91 40	0.17±1.76 1.02±1.92	-2.48	0.0143
					Per-cent (%) b that FPG2 descends
TT GG	91 40	0±20 9±18	-2.54	0.0123

Annotate: ^*TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type

Absolute value=FPG29 days of descending of a FPG-FPG57 days

Absolute value/FPG29 days * 100 of the per-cent that b FPG descends=FPG decline

Further relatively the pleomorphism site genotype of SUR1 Ser1369Ala (TCC-GCC) is individual through adjusting the relation that continues behind the sulfourea medication dose to take medicine with curative effect for we.The result is as shown in table 10, and reducing by 20% with FPG is example, adjusts for twice after the individuality of homozygous mutation type continues to take sulfonylurea drugs after the dosage, has 27.50% individual blood sugar still can continue to reduce by 20%; And after the homozygous wildtype individuality continues to take sulfonylurea drugs, only there is 7.69% individual blood sugar still can continue to reduce by 20%, it is 4.56 times of wild gene type of isozygotying that pure and mild mutator gene type blood sugar reduces by 20% individuality, and there was a significant difference (P＜0.005) through statistical test.Simultaneously, whether we drop to normal level (6.1mmol/L) according to blood sugar is come two kinds of genotype crowds of comparison through adjusting the hypoglycemic curative effect that continues to take medicine behind the sulfonylurea drugs medication dose, obtained similar result, as shown in table 11, homozygous mutation genotype crowd is through after adjusting the sulfonylurea drugs medication dose, 10% the individual FPG of continuing to take medicine descends and reaches normal level, and behind the homozygous wildtype crowd process adjustment sulfonylurea drugs medication dose, only continuing to take medicine, 3.3% individual FPG decline reaches normal level.The two compares OR value 3.26, and difference has statistical significance.

The relation that FPG descends after the pleomorphism site genotype of table 10 SUR1 Ser1369Ala (TCC-GCC) and the adjusted two doses

Genotype *	FPG decline per-cent a＜20%n (%)	FPG decline per-cent a 〉=20%n (%)	Add up to	Logistic
							OR	95％CI	P
				TT	84(92.31)	7(7.69)				91	1.00
GG	29(72.50)	11(27.50)	40				4.56	1.61-12.85	0.0042
				Add up to	113(86.26)	18(13.74)				131

Annotate: ^*TT represents SUR1 Ser1369Ala homozygous wildtype; GG represents SUR1 Ser1369Ala homozygous mutation type

The per-cent that aFPG descends=(FPG29 days-FPG57 days)/FPG29 days * 100

The relation of FPG after the pleomorphism site genotype of table 11 SUR1 Ser1369Ala (TCC-GCC) and the adjustment two doses

Genotype *	FPG57＞6.1mmol/l n(％)	FPG57≤6.1mmol/l n(％)	Add up to	Logistic
							OR	95％CI	P
				TT	88(96.70)	3(3.30)				91	1.000
GG	36(90.00)	4(10.00)	40				3.260	0.694-15.302	0.1342
				Add up to	124(94.66)	7(5.34)				131

Annotate: ^*TT represents SUR1 Ser1369Ala homozygous wildtype; GG represents SUR1 Ser1369Ala homozygous mutation type

Carry out layer analysis according to baseline Regular Insulin, the result is as shown in table 12.Higher or the lower crowd of baseline insulin level no matter, the crowd who carries SUR1 Ser1369Ala mutation allele is better for the hypoglycemic curative effect of sulfonylurea drugs, and, along with the decline per-cent of the increase fasting plasma glucose of sudden change equipotential quantum count increases gradually, carry FPG decline per-cent maximum after the genotypic individual treatment of homozygous mutation, there was a significant difference to learn check by statistics; In the higher individuality of baseline insulin level, this difference is more remarkable.The individuality that individuality that the baseline insulin level is higher and baseline insulin level are lower compares hypoglycemic curative effect poor slightly (statistics nonsignificance).In the higher crowd of baseline insulin level,, then take sulfonylurea drugs and still can reach hypoglycemic curative effect preferably if the polymorphism genotype of individual SUR1 Ser1369Ala (TCC-GCC) is the homozygous mutation type.The polymorphism genotype of prompting SUR1 Ser1369Ala (TCC-GCC) is relevant with the hypoglycemic curative effect of sulfonylurea drugs, the hypoglycemic curative effect strengthens along with the increase of sudden change equipotential quantum count, the hypoglycemic curative effect of the genotypic individual sulfonylurea drugs of homozygous mutation is best, and the individuality that carries SUR1 Ser1369Ala mutation allele in the higher crowd of baseline Regular Insulin is taken sulfonylurea drugs and still can be reached hypoglycemic curative effect preferably.

The multiple regression analysis (carrying out layer analysis) of the different polymorphism genotype crowds of table 12 SUR1 Ser1369Ala (TCC-GCC) and fasting plasma glucose (FPG) decline per-cent (%) according to baseline Regular Insulin

Genotype *	N	Mean±SD(％)	β#	StdE#	p#
						Baseline Regular Insulin≤median
TT TG GG	91 139 56	26±18 27±18 32±18	0.00298 0.04978	0.02449 0.03157	0.9033 0.1162
						Baseline Regular Insulin＞median
TT TG GG	97 17 54	22±21 25±18 32±13	0.02909 0.09743	0.02590 0.03296	0.2625 0.0034

Annotate: ^*TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC)

Heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

# correction factor: age, sex, BMI, smoking, the history of drinking, take medicine, baseline blood sugar

The polymorphism genotype crowd of more different SUR1 Ser1369Ala (TCC-GCC) takes the gliclazide treatment situation that islet function improves after 57 days, and (we are with HOMA-B index assessment beta Cell of islet function, and calculation formula is as follows: HOMA-B (%)=20 * fasting insulin (mIU/L)/[fasting plasma glucose (mmoL/L)-3.5] * 100).The result is as shown in table 13, can see that carrying amplitude that the genotypic crowd of SUR1 Ser1369Ala (TCC-GCC) homozygous mutation improves through sulfonylurea drugs treatment back islet function compares with the crowd who does not carry mutation allele that there was a significant difference, it is higher to carry the amplitude that crowd's islet function of mutation allele improves, and the amplitude that treatment back islet function improves increases progressively along with the increase of sudden change equipotential quantum count, the homozygous mutation genotype individuality amplitude amplitude maximum that islet function improves after the sulfonylurea drugs treatment, there was a significant difference.The result shows that the polymorphism genotype of SUR1 Ser1369Ala (TCC-GCC) is relevant with the action effect that the islet function of sulfonylurea drugs improves, the improvement of islet function strengthens along with the increase of sudden change equipotential quantum count, and it is best that the islet function of the genotypic individual sulfonylurea drugs of homozygous mutation improves effect.

The different polymorphism genotype of table 13 SUR1 Ser1369Ala (TCC-GCC) and islet function change (mmol/l) multiple regression analysis

Genotype *	The example number	Means standard deviation (%)	β#	StdE#	p#
						TT	185	23.33±20.84
TG	168	25.83±23.92	4.37160	2.57770	0.0910
						GG	106	30.30±24.00	9.75189	3.41819	0.0046

Annotate: ^*TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC) heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

# correction factor: age, sex, BMI, smoking, the history of drinking, take medicine, baseline insulin level, baseline blood sugar

The polymorphism genotype crowd of more different SUR1 Ser1369Ala (TCC-GCC) takes the situation of gliclazide treatment insulin sensitivity property improvement after 57 days, and (we are with HOMA-S index assessment insulin sensitivity degree, and calculation formula is as follows: HOMA-S=22.5/ (fasting insulin (mIU/L) * fasting plasma glucose (mmol/L)).The result is as shown in table 14, can see that carrying the genotypic crowd of SUR1 Ser1369Ala (TCC-GCC) homozygous mutation compares with the crowd who does not carry mutation allele through the amplitude of sulfonylurea drugs treatment back insulin sensitivity property improvement that there was a significant difference, the amplitude of crowd's insulin sensitivity property improvement that carries mutation allele is higher, and the amplitude of treatment back insulin sensitivity property improvement increases progressively along with the increase of sudden change equipotential quantum count, the amplitude amplitude maximum of homozygous mutation genotype individuality insulin sensitivity property improvement after the sulfonylurea drugs treatment, there was a significant difference.The result shows that the polymorphism genotype of SUR1 Ser1369Ala (TCC-GCC) is relevant with the action effect of the insulin sensitivity property improvement of sulfonylurea drugs, the improvement of insulin sensitivity strengthens along with the increase of sudden change equipotential quantum count, and the insulin sensitivity property improvement effect of the genotypic individual sulfonylurea drugs of homozygous mutation is best.

Different polymorphism genotype and the insulin sensitivity of table 14 SUR1 Ser1369Ala (TCC-GCC) sexually revise multiple regression analysis

Genotype *	The example number	Means standard deviation (%)	β#	StdE#	p#
						TT	185	1.45±2.67
TG	168	2.6±6.84	3.32	1.29	0.60
						GG	106	11.3±14.1	15.58	1.80	0.04

Annotate: ^*TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC) heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

# correction factor: age, sex, BMI, smoking, the history of drinking, take medicine, baseline insulin level, baseline blood sugar

Further carry out layer analysis, observe the relation of different genotype and FPG drop-out value and FPG decline per-cent according to weight index (BMI).The result is shown in table 15, table 16: no matter among the crowd that less crowd of BMI value or BMI are bigger, the crowd who carries SUR1 Ser1369Ala (TCC-GCC) mutation allele is better for the hypoglycemic curative effect of sulfonylurea drugs, and, along with the decline per-cent of the increase fasting plasma glucose of sudden change equipotential quantum count increases gradually, carry FPG decline per-cent maximum after the genotypic individual treatment of homozygous mutation, this significant difference very obviously (＜0.0001) in the bigger crowd of BMI.When the results suggest weight index is big, after taking sulfonylurea drugs, the individuality that carries mutation allele still can obtain reasonable curative effect.Clinically give antidiabetic drug when treatment for the bigger crowd of weight index, the general use N1,N1-Dimethylbiguanide class medicine of recommending, but consider the influence of inherited genetic factors, carry so SUR1 Ser1369Ala (TCC-GCC) mutant allele especially homozygous mutation genotype person take sulfonylurea drugs and still reasonable curative effect can be arranged.

The different polymorphism genotype of table 15 SUR1 Ser1369Ala (TCC-GCC) and fasting plasma glucose (FPG) decline per-cent (%) multiple regression analysis (according to the BMI layering)

Genotype *	N	Mean±SD(％)	β#	StdE#	p#
						BMI≤median
TT	106	25±16
						TG	159	27±17	0.00931	0.02273	0.6825
GG	64	30±18	0.03609	0.02887	0.2124
						BMI＞median
TT	107	22±0.21
						TG	162	26±0.19	0.05570	0.02381	0.0201
GG	58	33±0.13	0.12791	0.03023	＜.0001

Annotate: ^*TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC)

Heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

The # correction factor: age, sex,, smoking, the history of drinking, take medicine

The different polymorphism genotype of table 16 SUR1 Ser1369Ala (TCC-GCC) and FPG decline absolute value (mmol/l) multiple regression analysis (according to the BMI layering)

Genotype *	N	Mean±SD(％)	β#	StdE#	p#
						BMI≤median
TT	106	2.87±1.95
						TG	159	3.09±2.30	0.25703	0.25576	0.3159
GG	64	3.68±2.83	0.45316	0.32698	0.1670
						BMI＞median
TT	107	22±0.21
						TG	162	26±0.19	0.65679	0.25313	0.0101
GG	58	33±0.13	1.42683	0.32114	＜.0001

Annotate: ^*TT represents SUR1 Ser1369Ala (TCC-GCC) homozygous wildtype; TG represents SUR1 Ser1369Ala (TCC-GCC)

Heterozygous; GG represents SUR1 Ser1369Ala (TCC-GCC) homozygous mutation type.

The # correction factor: age, sex,, smoking, the history of drinking, take medicine, baseline insulin level, baseline blood sugar

(3) by measuring genes of individuals shape parameter and other physiological parameters, the Forecasting Methodology of prediction sulfonylurea drugs action effect:

1, obtains the data information result similar, i.e. SUR1 Ser1369Ala (rs757110) pleomorphism site genotype parameter and basic physiological parameter: age, sex, height, body weight, smoking history, history of drinking history, occupation, education degree, basic β cell function as present embodiment.

2,, obtain being used for predicting the predictive model of the action effect of sulfonylurea drugs according to multiple linear regression analysis.

Predictive equation is respectively:

According to the predictive equation of above-mentioned SUR1 Ser1369Ala (rs757110) polymorphism genotype parameter and basic physiological parameter prediction therapeutic effect of sulfonylurea drugs, comprising following 2 predictive equations:

(1) the individual predictive equation of taking the absolute value of FPG behind the sulfonylurea drugs of prediction, be 95% credibility interval in the bracket: rear FPG=3.81965 (1.75335～5.88595)-0.46511 * TG that takes medicine (assorted and genotype) (0.79271～-0.13752)-0.84731*GG (homozygous mutation) (1.26443～-0.43018)+0.40753 * baseline fasting blood-glucose (0.35121～0.46384)-0.01530 * age (0.03386～0.00325)-0.40884 * sex (0.83215～0.01448)+0.00472 * BMI (0.04624～0.05567)-0.005488 * LOG (baseline triglycerides) (0.29113～0.18137)-0.01250 * cigarette (0.41135～0.38634)-0.16479 * wine (0.52264～0.19305)+0.99207 * antidiabetic drug is taken history (0.66737～1.31678)

(2) FBG after the prediction sulfonylurea drugs treatment compares the equation of decline percentage with FPG before the treatment, is 95% credibility interval in the bracket: (FPG0-FPG57)/and FPG0=0.32291 (0.13396～0.51187)+0.02127 * TG (0.01098～0.05352)+0.07335 * GG (0.03222～0.11449)+0.00091233 * age (0.00091596～0.00274)+0.05588 * sex (0.01429～0.09747)-0.00450 * BMI (0.00949～0.00048012)+0.01238 * log (TG) (0.01091～0.03567)+0.03118 * cigarette (0.00788～0.07025)+0.01589 * wine (0.01940～0.05118)-0.09763 * antidiabetic drug takes history (0.12956～-0.06570)

More than the value mode of genotype parameter value in the predictive equation of (1) and (2) as follows: according to the genotype value in SUR1Ser1369Ala (rs757110) the genotype polymorphism site of measuring.When the genotype of individuality was GG homozygous mutation type, GG genotype parameter value was 1 in the predictive equation, and TG genotype parameter value is 0; When the genotype of individuality was the TG heterozygous, GG genotype parameter value was 0 in the predictive equation, and TG genotype parameter value is 1; When the genotype of individuality was the TT homozygous wildtype, GG genotype parameter value was 0 in the predictive equation, and TG genotype parameter value is 0.

More than the value mode of basic physiological parameter value in the predictive equation of (1) and (2) as follows: the age parameter is got actual age numerical value, and unit is year; BMI (weight index) parameter is body weight (kilogram)/height (rice) ²(kg/m ²); Baseline fasting plasma glucose parameter unit is mmol/l; Baseline TG is that unit is the numerical value after the numerical value of mmol/l carries out the log conversion; The sex parameter gets 1 for the male sex, and the women gets 2; The history of drinking history parameter gets 0 for never touching liquor, and once drinks or drinks now and get 1; The smoking history parameter is for to get 0 from non-smoking, and smoking once or smoking now get 1; The height parameter is got actual height values, and unit is centimetre (cm); The body weight parameter is got the ABW value, and unit is a kilogram (kg); Antidiabetic drug is taken the history parameter not to be had antidiabetic drug and takes history and get 1, has antidiabetic drug to take history and gets 2.

3, the action effect of the sulfonylurea drugs of quantitative forecast as a result that calculates according to predictive equation.

According to following judgement hypoglycemic efficacy criteria, the prediction hypoglycemic curative effect data that will calculate according to above-mentioned predictive equation compare with the hypoglycemic curative effect data that the measured value according to blood sugar obtains, and the results are shown in Table 17, table 18.

Table 17 SUR1 gene Ser1369Ala (TG, rs757110) pleomorphism site genotype predicting the outcome to hypoglycemic effect

	The actual measurement hypoglycemic is (FPG descends 〉=20%, number) effectively	Actual measurement hypoglycemic invalid (FPG＜20%, number)	Add up to (number)
				The prediction hypoglycemic is (positive number) effectively	286	105	391
Prediction hypoglycemic invalid (negative number)	51	71	122
				Add up to (number)	337	176	513

Susceptibility=286/337 * 100%=84.9% specificity=71/176 * 100%=40.3%

PPV＝286/391×100％＝73.1％ NPV＝71/122×100％＝58.2％

By table 17 as seen, measure individual Ser1369Ala (TG, rs757110) polymorphism genotype, and measure some individual physiological parameter simultaneously, according to predictive equation provided by the invention, prediction is 84.9% for the susceptibility of the hypoglycemic effect of sulfonylurea drugs, specificity is 40.3%, and positive predictive value (PPV) is 73.1%, and negative predictive value (NPV) is 58.2%, good accuracy is arranged, therefore very high actual application value is arranged.In the present invention, definition treatment back fasting plasma blood sugar (FPG) declines 〉=20% of comparing with FPG before the treatment is effective for glucose-lowering treatment, and definition treatment back fasting plasma blood sugar (FPG) is that glucose-lowering treatment is invalid with treating preceding FPG decline＜20% of comparing.

Table 18 SUR1 gene Ser1369Ala (TG, rs757110) pleomorphism site genotype predicting the outcome to hypoglycemic effect

	The actual measurement hypoglycemic is (treatment back FPG≤6.1mmol/L) effectively	Invalid (the treatment back FPG＞6.1mmol/L) of actual measurement hypoglycemic	Add up to
				The prediction hypoglycemic is (positive number) effectively	125	50	175
Prediction hypoglycemic invalid (negative number)	105	233	338
				Add up to (number)	230	283	513

Susceptibility=125/230 * 100%=54.3% specificity=233/283 * 100%=82.3%

PPV＝125/175×100％＝71.4％ NPV＝233/338×100％＝97.9％

Table 18 result as seen, measure individual Ser1369Ala (TG, rs757110) polymorphism genotype, and measure some individual physiological parameter simultaneously, according to the present invention in the aforementioned predictive equation that provides, prediction is 54.3% for the susceptibility of the hypoglycemic effect of sulfonylurea drugs, specificity is 82.3%, and positive predictive value (PPV) is 71.4%, and negative predictive value (NPV) is 97.9%, good accuracy is arranged, therefore very high actual application value is arranged.In the present invention, definition treatment back fasting plasma blood sugar (FPG) value≤6.1mmol/L is that glucose-lowering treatment is effective, and fasting plasma blood sugar (FPG)＞6.1mmol/L is that glucose-lowering treatment is invalid in definition treatment back.

Embodiment 2: measure CT (rs2074312) the pleomorphism site genotype of SUR1 gene and predict the blood sugar reducing function of sulfonylurea drugs

(1) CT (rs2074312) the pleomorphism site genotype of mensuration SUR1 gene:

(1) according to the operating process of routine, adopts the genomic dna that extracts host cell with embodiment 1 similar methods

(2) use the Taqman method to detect CT (rs2074312) the pleomorphism site genotype of SUR1 gene

(a) with PCR instrument amplification SUR1 functional gene polymorphic site and flanking sequence thereof, in 5ul PCR reaction system, contain genomic dna 10ng, 2.5ul Taqman 2X Universal PCR Master Mix No AmpErase UNG (composition comprises: AmpliTaq Gold DNA Polymerase, dNTPs with Dutp, Passive Reference, with the damping fluid of optimizing), and the forward primer of 0.72uM, each 0.16uM of allele-specific probe of the reverse primer of 0.72uM and two sections band fluorescence report groups.

Primer sequence is:

Forward primer: 5 ' GGTGGGAGAGAGCATGCTACTG 3 '

Reverse primer: 5 ' CAGGCATGGTTTCACACTCACT 3 '

The sequence of allele-specific probe is:

VIC-5’TGGAGACATGTGGGAG 3’-NFQ，

Corresponding to " A " allelotrope, carry VIC fluorescence report group.

FAM-5’TGGAGACGTGTGGGA 3’-NFQ

Corresponding to " C " allelotrope, carry FAM fluorescence report group.

The PCR reaction conditions:

95 ℃ of 10min, 1 circulation; 92 ℃ of 15s, 60 ℃ of 1min, 50 circulations.

(b) on 7900 type quantitative real time PCR Instruments, detect fluorescence information

The PCR plate of finishing the PCR reaction is put on the 7900 type quantitative real time PCR Instruments, is selected for use " AllelicDiscrimination " program, scan judgement with the result:

The genotype of sending FAM fluorescence person is CC (rs2074312) homozygote;

The genotype of sending VIC fluorescence person is TT (rs2074312) homozygote;

The genotype of sending two kinds of fluorescence persons is CT (rs2074312) heterozygote.

(2) prediction drug effect:

SUR1 CT (rs2074312) polymorphism genotype is that the individuality of homozygous wildtype is compared with the individuality of heterozygous or homozygous mutation type, and is better for the action effect of sulfonylurea drugs.There was a significant difference for the result.

When genotype was SUR1 CC (rs2074312) homozygous wildtype, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene was CT (rs2074312) heterozygous, the action effect of prediction sulfonylurea drugs was stronger; When the pleomorphism site genotype of described SUR1 gene is TT (rs2074312) homozygous mutation type, a little less than the action effect of prediction sulfonylurea drugs.

In the present embodiment, the action effect of sulfonylurea drugs comprises lowering blood glucose, reduction glycolated hemoglobin, improvement or recovers beta Cell of islet function, enhancing insulin sensitivity, refers in particular to the action effect of lowering blood glucose.

In the present embodiment, sulfonylurea drugs is preferably a kind of in gliclazide or the glimepiride.But result of the present invention is not limited to a certain sulfonylurea drugs.Those skilled in the art can be generalized to the embodiment result among the present invention any sulfonylurea drugs, and can result of the present invention be generalized to other other drug compositions by combining and work with the SUR1 acceptor according to general knowledge such as similar pharmacological mechanism etc., as the meglitinide medicine, particularly including repaglinide and nateglinide.

Above method is verified by epidemiological study, earlier the diabetic subject is divided into three groups at random according to SUR1 CT (rs2074312) pleomorphism site genotype: homozygous wildtype group, heterozygous group, homozygous mutation type group, give sulfonylurea drugs gliclazide treatment 56 days, measure the fasting blood sugar (FPG) of medication front and back respectively, observe the blood sugar reducing function of medicine.Result of study is as follows: the different genotype according to SUR1 CT (rs2074312) pleomorphism site is classified diabetic population, relatively treat absolute drop-out value and decline percentage ratio that the fasting blood sugar (FPG57) after 56 days is compared with the baseline fasting blood sugar (FPG0) before the treatment respectively, analyze the relation of different genotype and sulfonylurea drugs hypoglycemic curative effect.The result is shown in table 19.Carry the genotypic mutation allele of SUR1 CT (rs2074312) pleomorphism site especially the genotypic crowd FPG of homozygous mutation decline absolute value be starkly lower than the homozygous wildtype crowd, quantity increase along with seats such as sudden changes, FPG decline absolute value reduces gradually among the crowd, and the trend of successively decreasing is arranged.Through statistical test, there was a significant difference.We find equally, carry the genotypic mutation allele of SUR1 CT (rs2074312) pleomorphism site especially the percentage ratio that descends of the genotypic crowd FPG of homozygous mutation be starkly lower than the homozygous wildtype crowd, quantity increase along with seats such as sudden changes, FPG decline percentage ratio reduces gradually among the crowd, and the trend of successively decreasing is arranged.Through statistical test, there was a significant difference.The result shows that SUR1CT (rs2074312) mutation allele carrier is insensitive for the wilder allelotrope carrier of sulfonylurea drugs, and the curative effect of hypoglycemic reduces along with the increase of sudden change equipotential quantum count.

The multiple regression analysis of the changing value that table 19 SUR1 CT (rs2074312) the pleomorphism site genotype and the back fasting plasma glucose (FPG) of taking medicine descend

Genotype *	N	Mean±SD	β#	StdE#	P#
						Back FPG decline absolute value (mmol/L) a takes medicine
CC	166	3.38±2.63
						CT	337	3.03±2.28	-0.25173	0.18734	0.1796
TT	160	2.76±2.45	-0.67880	0.21865	0.0020
						Back FPG decline per-cent (%) b takes medicine
CC	166	28±18
						CT	337	27±17	-0.02255	0.01762	0.2011
TT	160	23±23	-0.05748	0.02056	0.0054

Annotate: ^*Genotype: CC represents SUR1 CC (rs2074312) homozygous wildtype; CT represents SUR1 CT (rs2074312) heterozygous; TT represents SUR1 TT (rs20743 12) homozygous mutation type.

The # correction factor: age, sex, weight index (BMI), tobacco and wine history, ofhypoglycemic medicine are taken history, baseline triglyceride level (TG), baseline insulin level, baseline fasting plasma glucose (per-cent does not have this correction factor)

FPG-treatment back FPG before FPG decline absolute value=treatment after a takes medicine

FPG * 100% before FPG decline per-cent after the b takes medicine=back FPG decline absolute value/treatment of taking medicine

Embodiment 3: CT (rs1799854,16-3c/t) the pleomorphism site genotype and predict the blood sugar reducing function of sulfonylurea drugs of measuring the SUR1 gene

(1) measure the SUR1 gene CT (rs1799854,16-3c/t) pleomorphism site genotype:

(1) genomic dna of extraction host cell:

On the basis of the working specification of standard, use salt precipitation method, genomic dna in the extracting saliva cell.DNA is in-20 ℃ of preservations.

(2) use the TaqMan method detect the SUR1 gene CT (rs1799854,16-3c/t) polymorphic site genotype:

(a) CT (rs1799854 of usefulness PCR instrument amplification SUR1 gene, 16-3c/t) gene polymorphic site and flanking sequence thereof, in 5ul PCR reaction system, contain genomic dna 10ng, 2.5ul the PCR Master Mix No AmpErase UNG of TaqMan 2X Universal (composition comprises: AmpliTaq Gold DNA Polymerase, dNTPs with Dutp, Passive Reference, with the damping fluid of optimizing), and the forward primer of 0.72uM, 0.72uM reverse primer and each 0.16uM of allele-specific probe of two sections band fluorescence report groups.The remaining ddH that uses ₂O supplies reaction system.

Primer sequence is:

Forward primer: 5 ' CGG CCC CAC TCACAT CTG 3 '

Reverse primer: 5 ' GGA GGA TGG TTA AAA GGA G 3 '

The sequence of allele-specific probe is:

VIC-5’CTCCCTGCAGGCCAGC3’-NFQ

Corresponding to " C " allelotrope, carry VIC fluorescence report group.

FAM-5’CTCCCTGTAGGCCAGC 3’-NFQ

Corresponding to " T " allelotrope, carry FAM fluorescence report group.

The PCR reaction conditions:

95 ℃ of 10min, 1 circulation; 92 ℃ of 15s, 60 ℃ of 1min, 50 circulations.

(b) on 7900 type quantitative real time PCR Instruments, detect fluorescence information

The PCR plate of finishing the PCR reaction is put on the 7900 type quantitative real time PCR Instruments, is selected for use " AllelicDiscrimination " program, scan judgement with the result:

The genotype of sending VIC fluorescence person is CC (rs1799854) homozygote;

The genotype of sending FAM fluorescence person is TT (rs1799854) homozygote;

The genotype of sending two kinds of fluorescence persons is CT (rs1799854) heterozygote.

(2) prediction drug effect:

SUR1 CT (rs1799854) polymorphism genotype is that the genotypic individuality of homozygous mutation is compared with the individuality of heterozygous or homozygous wildtype, and is better for the action effect of sulfonylurea drugs.Along with the quantity increase at seats such as sudden change, the action effect of sulfonylurea drugs strengthens.There was a significant difference for the result.

When genotype was SUR1 TT (rs1799854) homozygous mutation genotype, the action effect of prediction sulfonylurea drugs was strong; When the pleomorphism site genotype of described SUR1 gene was CT (rs1799854) heterozygous, the action effect of prediction sulfonylurea drugs was stronger; When the pleomorphism site genotype of described SUR1 gene is CC (rs1799854) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs.

In the present embodiment, the action effect of sulfonylurea drugs comprises lowering blood glucose, reduction glycolated hemoglobin, improvement or recovers beta Cell of islet function, enhancing insulin sensitivity, refers in particular to lowering blood glucose.

In the present embodiment, sulfonylurea drugs is preferably a kind of in gliclazide or the glimepiride.But result of the present invention is not limited to a certain sulfonylurea drugs.Those skilled in the art can be generalized to the embodiment result among the present invention any sulfonylurea drugs, and can result of the present invention be generalized to other other drug compositions by combining and work with the SUR1 acceptor according to general knowledge such as similar pharmacological mechanism etc., as the meglitinide medicine, particularly including repaglinide and nateglinide.

Above method is verified by epidemiological study, earlier the diabetic subject is divided into three groups at random according to SUR1 CT (rs1799854) pleomorphism site genotype: homozygous wildtype group, heterozygous group, homozygous mutation type group, give sulfonylurea drugs gliclazide treatment 56 days, measure fasting blood sugar (FPG), glycolated hemoglobin (HBAlc), β cell function and the insulin-sensitivity parameters of medication front and back respectively, observe the blood sugar reducing function effect of medicine.Result of study is as follows:

Different genotype according to SUR1 CT (rs1799854) pleomorphism site is classified diabetic population, relatively treat decline absolute value and decline percentage ratio that the fasting blood sugar (FPG57) after 56 days is compared with the baseline fasting blood sugar (FPG0) before the treatment, analyze the relation of different genotype and sulfonylurea drugs hypoglycemic curative effect.The result is shown in table 20.Carry the genotypic mutation allele of SUR1 CT (rs1799854) pleomorphism site especially the genotypic crowd FPG of homozygous mutation decline absolute value apparently higher than the homozygous wildtype crowd, quantity increase along with seats such as sudden changes, FPG decline absolute value increases gradually among the crowd, and the trend that increases progressively is arranged.Equally, result of study shows, carry the genotypic mutation allele of SUR1 CT (rs1799854) pleomorphism site especially the genotypic crowd FPG of homozygous mutation decline percentage ratio apparently higher than the homozygous wildtype crowd, quantity increase along with seats such as sudden changes, FPG decline percentage ratio increases gradually among the crowd, and the trend that increases progressively is arranged.The mutation allele carrier is described for the wilder allelotrope carrier of sulfonylurea drugs sensitivity, and the curative effect of hypoglycemic increases along with the increase of sudden change equipotential quantum count.

The multiple regression analysis of the changing value that table 20 SUR1 CT (rs1799854) the pleomorphism site genotype and the back fasting plasma blood sugar (FPG) of taking medicine descend

Genotype *	The example number	Means standard deviation	β#	P#
					FPG decline absolute value (mmol/L) after taking medicine
CC	215	2.67±2.74
					CT	335	3.03±2.50	0.265	0.2613
TT	105	3.27±2.63	0.585	0.0234
					FPG decline per-cent (%) after taking medicine
CC	215	23.54±18.14
					CT	335	25.08±16.73	0.019	0.1320
TT	105	28.23±16.35	0.042	＜0.05

Annotate: ^*Genotype: CC represents SUR1 CC (rs1799854) homozygous wildtype; CT represents SUR1 CT (rs1799854) heterozygous; TT represents SUR1 TT (rs1799854) homozygous mutation type.

The # correction factor: age, sex, weight index (BMI), tobacco and wine history, ofhypoglycemic medicine are taken history, baseline triglyceride level (TG), baseline fasting plasma glucose (per-cent does not have this correction factor).

FPG-treatment back FPG before FPG decline absolute value=treatment after a takes medicine

FPG * 100% before FPG decline per-cent after the b takes medicine=back FPG decline absolute value/treatment of taking medicine

The polymorphism genotype crowd of more different SUR1 CT (rs1799854) takes gliclazide and treats glycolated hemoglobin decline absolute value (HbAlc0-HbAlc57) after 56 days.The result is shown in table 21, can see that carrying the genotypic crowd of SUR1 TT (rs1799854) homozygous mutation compares with the crowd who does not carry mutation allele through the absolute value of sulfonylurea drugs treatment back glycolated hemoglobin decline that there was a significant difference, the effect that the crowd who carries mutation allele reduces glycolated hemoglobin is obvious, and the fall of treatment back glycolated hemoglobin increases progressively the value fall maximum of homozygous mutation genotype individuality glycolated hemoglobin after the sulfonylurea drugs treatment along with the increase of sudden change equipotential quantum count.

The multiple regression analysis of the pleomorphism site genotype of table 21 SUR1 CT (rs1799854) and gliclazide treatment glycolated hemoglobin decline percentage ratio (%) after 57 days

Genotype *	The example number	Means standard deviation	β#	P#
					CC	215	1.03±1.59
CT	335	1.37±1.45	0.030	0.7322
					TT	105	2.01±1.43	0.231	＜0.05

Annotate: #CC, represent SUR1 CC (rs1799854) homozygous wildtype; CT represents SUR1 CT (rs1799854) heterozygous; TT represents SUR1 TT (rs1799854) homozygous mutation type.

The # correction factor: age, sex, weight index (BMI), tobacco and wine history, ofhypoglycemic medicine are taken history, baseline triglyceride level (TG).

The polymorphism genotype crowd of more different SUR1 CT (rs1799854) takes gliclazide treatment, the situation that islet function improves after 57 days and the situation of insulin sensitivity property improvement.We are with HOMA-B index assessment beta Cell of islet function, and calculation formula is as follows: HOMA-B (%)=20 * fasting insulin (mIU/L)/[fasting plasma glucose (mmoL/L)-3.5] * 100.With HOMA-S index assessment insulin resistant degree, calculation formula is as follows: HOMA-S=22.5/ (fasting insulin (mIU/L) * fasting plasma glucose (mmol/L)).The result is shown in table 22, can see that carrying amplitude that the genotypic crowd of SUR1 TT (rs1799854) homozygous mutation improves through sulfonylurea drugs treatment back islet function compares with the crowd who does not carry mutation allele that there was a significant difference, it is higher to carry the amplitude that crowd's islet function of mutation allele improves, and the amplitude that treatment back islet function improves increases progressively along with the increase of sudden change equipotential quantum count, the homozygous mutation genotype individuality amplitude amplitude maximum that islet function improves after the sulfonylurea drugs treatment, there was a significant difference.The result shows that the polymorphism genotype of SUR1 CT (rs1799854) is relevant with the action effect that the islet function of sulfonylurea drugs improves, the improvement of islet function strengthens along with the increase of sudden change equipotential quantum count, and it is best that the islet function of the genotypic individual sulfonylurea drugs of homozygous mutation improves effect.The result is shown in table 22, can see that carrying the genotypic crowd of SUR1 TT (rs1799854) homozygous mutation compares with the crowd who does not carry mutation allele through the amplitude of sulfonylurea drugs treatment back Regular Insulin that there was a significant difference, crowd's the amplitude that carries mutation allele is higher, and the amplitude after the treatment increases progressively along with the increase of sudden change equipotential quantum count, the amplitude maximum of homozygous mutation genotype individuality Regular Insulin after the sulfonylurea drugs treatment, there was a significant difference.The result shows that the polymorphism genotype of SUR1 CT (rs1799854) is relevant with the action effect of the Regular Insulin of sulfonylurea drugs, the effect of Regular Insulin strengthens along with the increase of sudden change equipotential quantum count, and the effect of the genotypic individual sulfonylurea drugs Regular Insulin of homozygous mutation is best.

The pleomorphism site genotype of table 22 SUR1 CT (rs1799854) and gliclazide treatment improve the multiple regression analysis of (D57-D0) with the β cell function after 57 days

Genotype *	The example number	Means standard deviation	β#	P#
					CC	215	22.01±18.25
CT	335	25.32±23.01	1.833	0.4233
					TT	105	28.23±24.97	6.211	0.0212

Annotate: #CC, represent SUR1 CC (rs1799854) homozygous wildtype; CT represents SUR1 CT (rs1799854) heterozygous; TT represents SUR1 TT (rs1799854) homozygous mutation type.

The # correction factor: age, sex, weight index (BMI), tobacco and wine history, ofhypoglycemic medicine are taken history, baseline triglyceride level (TG), baseline islet function.

Embodiment 4: about the linkage disequilibrium analysis of SUR1 Ser1369Ala (rs757110) and SUR1 CT (rs2074312) pleomorphism site

As the result among embodiment 1 and the embodiment 2, for SUR1 Ser1369Ala (TG, rs757110) and the single pleomorphism site of SUR1CT (rs2074312) analyze, find that all genotype is relevant with the action effect of sulfonylurea drugs.In the present embodiment, we have carried out the linkage disequilibrium analysis to corresponding zone on the karyomit(e) at this place, two sites, the result is shown in table 23, SUR1 Ser1369Ala (TG, rs757110) polymorphic position point gene is that G and SUR1 CT (rs2074312) the polymorphic position point gene haplotype frequency when being G is very high, shows the unbalanced degree height of this region linkage.Use haplotype multiple regression analysis (seeing Table 24), can see that this haplotype of G/G has remarkably influenced to sulfonylurea drugs hypoglycemic curative effect, consistent with the result who obtains in the single snp analysis.Because we needn't analyze the existence of linkage disequilibrium all SNP in this zone, only need to analyze wherein some SNP, just can infer the individual type that these other pleomorphism sites of zone, and infer the relation that this zone and disease or curative effect of medication.Therefore, as long as by analyzing SUR1 Ser1369Ala (TG, rs757110) relation of pleomorphism site or SUR1 CT (rs2074312) pleomorphism site and curative effect of medication just can be judged the relation of this certain haplotype of zone and curative effect, promptly so long as and SUR1 Ser1369Ala (TG, rs757110) " G " allelotrope is in the site of linkage disequilibrium, all has the prediction of the efficacy result of similar sulfonylurea drugs.

Table 23 SUR1 Ser1369Ala (rs757110) and the genotypic haplotype frequency analysis of SUR1 CT (rs2074312) pleomorphism site

SUR1 Ser1369Ala(rs757110)	SUR1 CT(rs2074312)	The haplotype frequency
			T (wild)	C (wild)	0.12274
G	C	0.38035
			T	T	0.44382
G	T	0.05308

The multiple regression analysis (GLM) of table 24 SUR1 Ser1369Ala (rs757110) and the genotypic haplotype of SUR1 CT (rs2074312) pleomorphism site and FPG decline per-cent

Haplotype (rs757110/rs2074312)	coef	StdE	p
				T/T
T/C	0.029710	0.017369	0.0877
				G/C	0.036189	0.011353	0.00151
G/T	0.081515	0.023822	0.000666

Claims (12)

1. by the pleomorphism site genotype of SUR1 gene in the detection of biological sample, predict the purposes of sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity action effect.

2. purposes as claimed in claim 1 is characterized in that: the pleomorphism site genotype of described SUR1 gene comprises Ser1369Ala (rs757110), C/T (rs2074312) and C/T (rs1799854) pleomorphism site that is selected from the SUR1 gene at least.

3. purposes as claimed in claim 1, it is characterized in that: the pleomorphism site genotype of described SUR1 gene can also comprise the pleomorphism site that is selected among T/C (rs1319447), A/G (rs2237984) and the A/G (rs2237981), can also further comprise and be selected from the pleomorphism site that has linkage disequilibrium with above-mentioned polymorphism genotype site, and gene polymorphism sites of other prediction sulfonylurea drugs action effects comprise nonsense mutation site, missense mutation site and the pleomorphism site that is positioned at gene intron position, generegulation position.

4. purposes as claimed in claim 1, it is characterized in that: described sulfonylurea drugs is selected from Glyburide, glibornuride, tolhexamide, glyhexamide, glimepiride, glypinamide, glisamuride, Glisentide, glisolamide, glyoctamide, gliclazide, Glipizide and gliquidone, is preferably gliclazide or glimepiride.

5. purposes as claimed in claim 1 is characterized in that:

When (1) the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity was strong; When the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity;

When (2) the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, prediction reaches the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs bigger, and it is relatively poor repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs; When the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, prediction reached the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs less, and it is better repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs;

When (3) the pleomorphism site genotype of described SUR1 gene was CC (rs2074312) homozygous wildtype, the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity was strong; When the pleomorphism site genotype of described SUR1 gene is TT (rs2074312) homozygous mutation type, a little less than the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity;

When (4) the polymorphism genotype of described SUR1 gene was TT (rs1799854) homozygous mutation type, the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity was strong; When the pleomorphism site genotype of described SUR1 gene is CC (rs1799854) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity.

6. one kind by utilizing the pleomorphism site genotype of sulfonylurea receptor gene in the polymorphism parting oligonucleotide detection of biological sample, prediction sulfonylurea drugs lowering blood glucose, improve and recover the method for beta Cell of islet function and/or enhancing insulin sensitivity action effect, wherein, described polymorphism parting oligonucleotide is: (1) allele-specific nucleic acid primer, it can detect the pleomorphism site genotype of sulfonylurea receptor gene, perhaps (2) are used to detect the genotypic oligonucleotide probe of pleomorphism site of sulfonylurea receptor gene, its can be specifically with sulfonylurea receptor gene on the nucleic acid hybridization of pleomorphism site, preferably, the length of oligonucleotide probe is 15-50 Nucleotide.

7. method as claimed in claim 6 is characterized in that: the pleomorphism site genotype of described sulfonylurea receptor gene comprises Ser1369Ala (rs757110), C/T (rs2074312) and C/T (rs1799854) pleomorphism site that is selected from the SUR1 gene at least.

8. method as claimed in claim 6, it is characterized in that: the pleomorphism site genotype of described SUR1 gene can comprise and is selected from T/C (rs1319447), pleomorphism site among A/G (rs2237984) and the A/G (rs2237981), can also further comprise and be selected from the pleomorphism site that has linkage disequilibrium with above-mentioned polymorphism genotype site, and other prediction sulfonylurea drugs lowering blood glucose, the gene polymorphism sites of improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity action effect comprises the nonsense mutation site, missense mutation site and be positioned at the gene intron position, the pleomorphism site at generegulation position.

9. method as claimed in claim 6, it is characterized in that: described sulfonylurea drugs is selected from Glyburide, glibornuride, tolhexamide, glyhexamide, glimepiride, glypinamide, glisamuride, Glisentide, glisolamide, glyoctamide, gliclazide, Glipizide and gliquidone, is preferably gliclazide or glimepiride.

10. the method described in claim 6 is characterized in that:

When (1) the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity was strong; When the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, a little less than the action effect of lowering blood glucose, improvement and the recovery beta Cell of islet function of prediction sulfonylurea drugs and/or enhancing insulin sensitivity;

When (2) the pleomorphism site genotype of described SUR1 gene is Ser1369Ser (rs757110) homozygous wildtype, prediction reaches the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs bigger, and it is relatively poor repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs; When the pleomorphism site genotype of described SUR1 gene was Ala1369Ala (rs757110) homozygous mutation type, prediction reached the ideal hypoglycemic effect and needs the initial dose of sulfonylurea drugs less, and it is better repeatedly to adjust behind the dosage hypoglycemic effect of sulfonylurea drugs;

When (3) the polymorphism genotype of described SUR1 gene was CC (rs2074312) homozygous wildtype, the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity was strong; When the pleomorphism site genotype of described SUR1 gene is TT (rs2074312) homozygous mutation type, a little less than the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity;

When (4) the polymorphism genotype of described SUR1 gene was TT (rs1799854) homozygous mutation type, the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity was strong; When the pleomorphism site genotype of described SUR1 gene is CC (rs1799854) homozygous wildtype, a little less than the action effect of prediction sulfonylurea drugs lowering blood glucose, improvement and recovery beta Cell of islet function and/or enhancing insulin sensitivity.

11. method as claimed in claim 6 is used the following difference foranalysis of nucleic acids technology that is selected from that comprises: polymerase chain reaction, the PCR-restriction fragment length polymorphism is analyzed, PCR-alleles-specific oligonucleotide probe method, PCR-sequence specific oligonucleoside acid system, sequencing, PCR-sequence specific primers method, the PCR-fluorescent method, the PCR finger-printing method, oligonucleotide connects to be analyzed, the detection method of fluorescent energy resonance transfer, biochip, nucleic acid chip, mass-spectrometric technique, genescan, single strand conformation polymorphism, denaturing gradient gel electrophoresis, enzyme or chemical mispairing patterning method, with the Taqman biological detecting method.

12. the biological sample described in the claim 1,6 is selected from blood sample, humoral sample, tissue sample and culturing cell, preferred, described biological sample is a blood sample.