CN111455038B

CN111455038B - Kit for guiding drug for anxiety disorder of human and application thereof

Info

Publication number: CN111455038B
Application number: CN202010265494.1A
Authority: CN
Inventors: 何熲; 石忆湘; 顾孝平; 张国伟; 黄成琛; 王保曼; 张越
Original assignee: Shanghai Kangli Medical Laboratory Co ltd
Current assignee: Shanghai Kangli Medical Laboratory Co ltd
Priority date: 2020-04-07
Filing date: 2020-04-07
Publication date: 2021-03-05
Anticipated expiration: 2040-04-07
Also published as: CN111455038A

Abstract

The invention provides a kit for guiding a drug for anxiety disorder of a human and application thereof, wherein the kit can simultaneously type 14 gene loci, the kit comprises 14 pairs of amplification primers for amplifying 14 gene segments, the 14 gene loci are shown in a table, and the sequences of the 14 pairs of amplification primers are shown in SEQ ID No. 1-SEQ ID No. 28. On the basis of researching a large sample, the invention provides a brand-new locus combination to realize accurate guidance and timely feedback on the treatment of anxiety disorder from the perspective of gene and heredity; and genotyping is carried out based on the flight time mass spectrometry technology, and medium-throughput sequencing is carried out on some genes and variable sites which are selected carefully and most related to anxiety drug administration, so that the detection time and cost can be greatly reduced, and a highly reliable detection result is still obtained, thereby having very important clinical application value.

Description

Kit for guiding drug for anxiety disorder of human and application thereof

Technical Field

The invention relates to the field of anxiety pharmacogenomics diagnosis, and more particularly relates to a kit for guiding a medicament for human anxiety and application thereof.

Background

Anxiety is a mental disorder, with about 12% of the world population suffering from anxiety, with about twice as many female cases as male cases. Other psychiatric disorders may also produce anxiety symptoms such as schizophrenia, obsessive compulsive disorder, and the like. Anxiety disorders are treated primarily by cognitive behavioral therapy and drugs. Currently commonly used anxiolytic drugs include benzodiazepine drugs, beta receptor blockers, buspirone, etc. The invention provides an in-vitro auxiliary diagnosis kit for guiding a medicine for treating anxiety disorder, a design principle and a detection method thereof, which provide early warning information on the aspects of metabolism, response and toxic and side effects for an anti-anxiety disorder medicine used in China by carrying out gene detection on a patient.

The existing anxiety disorder pharmacogenomics products are technically divided into two types, products based on the fluorescent quantitative PCR technology and products based on the gene chip technology. The fluorescent quantitative PCR technology is used for detecting that the gene variation has low flux, large samples cannot be detected in batches, and only a single site can be detected by a single reaction, so that the problem of high cost exists in products applied to multi-site detection; although the gene chip technology can detect a large number of sites at one time, the sensitivity is limited, and the requirement of clinical application cannot be met. The invention uses the time-of-flight mass spectrometry technology, can simultaneously analyze a plurality of sites of ten samples, has high sensitivity, can meet the clinical requirement, and can control the detection cost of each sample within 1000 yuan RMB.

The pharmacogenomics technology is applied to clinical analysis of the influence of gene polymorphism caused by individual gene variation on the action of drugs mainly depending on evidence-based medical evidence reported in open research. Due to the difference of research quality, the screening of research results has a key effect on the clinical application effect of the invention. Most of the same products relate to the combination of detection sites according to literature information provided by PharmGKB database. A large number of results are obtained based on research data of western population, and are different from the research results of Asian population, so that the guiding effect of the Asian population on the Asian population is influenced. The invention refers to the information of PharmGKB database, is combined with the research literature of Asian population, designs the anti-anxiety pharmacogenomics product more suitable for Asian population, and can provide more effective reference information for clinical practice.

Disclosure of Invention

The invention aims to provide a kit for guiding the medication of anxiety disorder of people and application thereof, thereby solving the problems of high cost, insufficient accuracy, low detection efficiency, incomplete coverage of domestic anxiety disorder treatment medicines and incapability of providing comprehensive medication guidance in the prior art.

In order to solve the technical problems, the invention adopts the following technical scheme:

according to a first aspect of the present invention, there is provided a kit for guiding anxiety disorder medication, wherein the kit can simultaneously type 14 gene loci, the kit comprises 14 pairs of amplification primers for amplifying 14 gene fragments, the sequences of the 14 gene loci and the 14 pairs of amplification primers are specifically shown below, and are all written in 5 '-3' order, and the primers are synthesized by Life corporation.

1) CYP2C19 site rs4244285G → A (G for wild type, A for mutant type, the same applies below)

Amplification primer pair:

ACGTTGGATGTCCATCGATTCTTGGTGTTC of SEQ ID NO.1 (upstream primer): ACGTTGGATGTCCATCGATTCTTGGTGTTC

ACGTTGGATGGCAATAATTTTCCCACTATC of SEQ ID NO.2 (downstream primer)

2) CYP2C19 site rs4986893G → A

Amplification primer pair:

SEQ ID NO.3:ACGTTGGATGGACTGTAAGTGGTTTCTCAG

SEQ ID NO.4:ACGTTGGATGAACATCAGGATTGTAAGCAC

3) CYP2C19 site rs12248560C → T

Amplification primer pair:

SEQ ID NO.5:ACGTTGGATGCAAATTTGTGTCTTCTGTTC

SEQ ID NO.6:ACGTTGGATGTGAGCTGAGGTCTTCTGATG

4) CYP3A4 site rs67666821insT (mutant is a T base inserted into the position in wild type)

Amplification primer pair:

SEQ ID NO.7:ACGTTGGATGTTAGGAGGACTTCTTCAACC

SEQ ID NO.8:ACGTTGGATGAATTCAGGCTCCACTTACGG

5) NAT2 locus rs1799930G → A

Amplification primer pair:

SEQ ID NO.9:ACGTTGGATGACGTCTGCAGGTATGTATTC

SEQ ID NO.10:ACGTTGGATGCCTGCCAAAGAAGAAACACC

6) NAT2 site rs1041983C → T

Amplification primer pair:

SEQ ID NO.11:ACGTTGGATGCAGACCACAATGTTAGGAGG

SEQ ID NO.12:ACGTTGGATGCCATGCCAGTGCTGTATTTG

7) NAT2 site rs1801280T → C

Amplification primer pair:

SEQ ID NO.13:ACGTTGGATGCAAATACAGCACTGGCATGG

SEQ ID NO.14:ACGTTGGATGGACCCAGCATCGACAATGTA

8) NAT2 site rs1799929C → T

Amplification primer pair:

SEQ ID NO.15:ACGTTGGATGTGCTTGACAGAAGAGAGAGG

SEQ ID NO.16:ACGTTGGATGCTTCTTTGGCAGGAGATGAG

9) NAT2 locus rs 1208G → A

Amplification primer pair:

SEQ ID NO.17:ACGTTGGATGAACTCTCACTGAGGAAGAGG

SEQ ID NO.18:ACGTTGGATGTTTGGGCACGAGATTTCTCC

10) CYP3A5 site rs776746T → C

Amplification primer pair:

SEQ ID NO.19:ACGTTGGATGGTAATGTGGTCCAAACAGGG

SEQ ID NO.20:ACGTTGGATGACCCAGCTTAACGAATGCTC

11) UGT2B15 site rs1902023A → C

Amplification primer pair:

SEQ ID NO.21:ACGTTGGATGCCATATATCCATCTATCGAG

SEQ ID NO.22:ACGTTGGATGTCTACTCTTGTCAATGCCAG

12) UGT2B7 site CYP3A5 site rs7439366T → C

Amplification primer pair:

SEQ ID NO.23:ACGTTGGATGTGGAGTCCTCCAACAAAATC

SEQ ID NO.24:ACGTTGGATGGCTGACGTATGGCTTATTCG

13) HTR1A site rs 6295C → G

Amplification primer pair:

SEQ ID NO.25:ACGTTGGATGGTCAGTCTCCCAATTATTGC

SEQ ID NO.26:ACGTTGGATGCGAGAACGGAGGTAGCTTTT

14) GABRA1 site rs4263535A → G

Amplification primer pair:

SEQ ID NO.27:ACGTTGGATGTGTAAGAAAGTAGCAGCCCC

SEQ ID NO.28:ACGTTGGATGTACTGGATTCATTCTTGTC

according to the present invention, the kit further preferably comprises 14 extension primers for identifying mutations of the 14 gene fragments, and the sequences of the 14 extension primers designed for the 14 specific gene sites are specifically as follows, all written in 5 '-3' order, and the primers are synthesized by Life corporation.

SEQ ID NO.29:TTGTTAAGTAATTTGTTATGGGTTCC

SEQ ID NO.30:CTTGGCCTTACCTGGAT

SEQ ID NO.31:CCCTCGTGTCTTCTGTTCTCAAAG

SEQ ID NO.32:GACTTCTTCAACCAGAAAAA

SEQ ID NO.33:AATAGACTCAAAATCTTCAATTGTT

SEQ ID NO.34:CACAATGTTAGGAGGGTATTTTTA

SEQ ID NO.35:TCTCCTGCAGGTGACCA

SEQ ID NO.36:ACATAAGAGAGAGGAATCTGGTAC

SEQ ID NO.37:GGTTGAAGAAGTGCTGA

SEQ ID NO.38:CCTTCGGTCCAAACAGGGAAGAGATA

SEQ ID NO.39:TTTCAGAAGAGAATCTTCCAAAT

SEQ ID NO.40:AACATTTGGTAAGAGTGGAT

SEQ ID NO.41:TCGACGACCGAGTGTGTCTTC

SEQ ID NO.42:CACCCCTTGCCACCAAATAAAG

Preferably, the reaction system of the PCR amplification of the kit is as follows:

preferably, the kit further comprises an SAP reaction system, which is as follows:

SAP buffer 0.17. mu.L

SAP enzyme 0.5U

The volume of pure water is made up to 2 μ L.

According to a preferable scheme of the invention, the molar concentration of the amplification primers SEQ ID No. 1-SEQ ID No.2 in the reaction system is 0.3-0.5 mu M, the molar concentration of the amplification primers SEQ ID No. 3-SEQ ID No.24, the molar concentration of the amplification primers SEQ ID No. 27-SEQ ID No.28 in the reaction system is 0.2-0.4 mu M, and the molar concentration of the amplification primers SEQ ID No. 25-SEQ ID No.26 in the reaction system is 0.4-0.8 mu M.

It should be understood that any kit based on MassArray has less extension primers, but the importance of the extension primers is less than that of the amplification primers, the kit provided by the invention has the main invention point of selection of gene sites and design of the amplification primers, and the secondary invention point of design of the extension primers, so that the most accurate guidance and the most timely feedback on the treatment of anxiety disorder from the genetic and heredity points are finally realized.

The method adopts an Agena Bioscience MassARRAY DNA mass spectrum gene analysis system, and the system has the following characteristics:

1) the accuracy is high, the molecular weight of the substance to be detected is directly detected, and the accuracy is over 99.9%; the failure of PCR experiment or the existence of three-allele gene can be detected;

2) the sensitivity is high, and any pmol-level substance can be detected in a detection window;

3) the flux is high, multiple detection of 384 samples can be simultaneously completed on one chip, each reaction hole can realize up to 30 times of reaction, and tens of thousands of genotype analyses can be carried out at most each time;

4) the method is flexible, the number and the position of the samples can be freely selected on one chip, and meanwhile, the pairing of the samples and the SNP sites can be freely selected;

5) the quality control is strict, the mass spectrometry technology is 'one-tube operation', namely, a reaction system is always reacted in one test tube in the biochemical experiment process, and the human error caused by multiple transfers is avoided;

6) the method is simple to operate, and completely changes the disadvantages of high price, long time consumption, complex operation and the like of the traditional sequencing technology in gene detection.

The process of the invention comprises links of specific primer amplification, SAP reaction, single base extension, mass spectrum detection and the like, and the principle is shown in figure 1.

According to a second aspect of the invention, there is also provided the use of the kit as described above in the manufacture of a medicament for use in guiding anxiety in a human.

According to the kit provided by the invention, the variation condition of 14 sites on 8 genes (CYP2C19, CYP3A4, CYP3A5, NAT2, UGT2B7, UGT2B15, HTR1A and GABRA1) which affect the effect of the anxiolytic drug can be detected. CYP2C19 participates in the in vivo metabolism of clobazam, diazepam and etizolam, rs4244285(G > A) and rs4986893(G > A) variation can reduce the metabolic activity of CYP2C19, and rs12248560(C > T) variation can improve the metabolic activity of CYP2C19, so that the drug concentration of the drugs in an individual is influenced. CYP3A4 is involved in the metabolism of clonazepam, tandospirone, buspirone, estazolam and zolpidem. The rs67666821 variation results in a decrease in CYP3a4(insT) metabolic activity, leading to an increase in drug concentration in vivo. CYP3A5 is involved in the metabolism of alprazolam and midazolam in a human body, and rs776746 (T > C) variation causes the reduction of CYP3A5 metabolic activity, slows down the in-vivo metabolic rate of alprazolam and midazolam and influences the in-vivo drug concentration. NAT2 participates in metabolism of clonazepam, rs1801280(T > C), rs1799929(C > T), rs1208(G > A) form NAT2 x 5B, and compared with normal NAT2, the metabolic activity is reduced; rs1799930(G > A), rs1041983(C > T) constitute NAT2 x 6B, which has reduced metabolic activity compared to normal NAT 2. The presence of NAT2 x 5B and NAT2 x 6B both reduced the rate of drug metabolism and increased blood drug concentrations. UGT2B15 is involved in clearance of lorazepam and oxazepam in vivo. The rs1902023(A > C) variation increases drug clearance, possibly resulting in decreased efficacy. UGT2B7 is related to response effect of lorazepam, and rs7439366(T > C) variation has poor drug response effect on lorazepam. HTR1A influences the response effects of tandospirone and buspirone. The rs6295(C > G) variation increases the response effects of tandospirone and buspirone. GABRA1 is associated with the therapeutic effects of estazolam and zolpidem. The rs4263535(a > G) variation increases the response and efficacy of individuals to eszolam and zolpidem.

According to the kit provided by the invention, 14 SNP loci of 8 related genes affecting the action of the anxiolytic drugs can be detected, and 12 common anxiolytic drugs are covered: clobazam, diazepam, etizolam, tandospirone, buspirone, estazolam, zolpidem, alprazolam, clonazepam, lorazepam, midazolam, oxazepam. The medicines are classified into three categories according to the metabolic rate, the response effect and the toxic and side effect according to the detection result, and reference basis is provided for medicine selection in clinical treatment.

According to the kit provided by the invention, a flight time mass spectrometry technology is selected to design a conventional primer aiming at a variant gene locus, a multi-locus primer combination can work simultaneously and accurately detect the situation of locus variation, a 384-pore plate is adopted for experiment, dozens of variant loci of 384 samples can be detected simultaneously, the period from sample preparation to result generation only needs 2 days, the cost does not exceed 1000 RMB, and the accuracy, the low cost and the high flux are considered.

Up to now, more than 80,000 samples have been tested by Shanghai Kangli medical laboratory and research has been conducted in the fields of mental diseases, including depression, schizophrenia, anxiety, epilepsy, hyperactivity, analgesia, sedation and hypnosis, etc. The invention establishes a database based on Chinese multinational, multi-regional and multi-course on the basis of the research of a large sample, develops the kit which has good effect and can be used for clinical medication guidance on the basis of data polymorphism, and provides accurate guidance and timely feedback for the treatment of anxiety disorder in the aspects of gene and heredity.

In conclusion, on the basis of researching a large sample, the invention provides a brand-new locus combination, and realizes accurate guidance and timely feedback on the treatment of the anxiety disorder from the aspects of gene and heredity; the invention carries out genotyping based on the time-of-flight mass spectrometry technology, and carries out medium-flux sequencing on some carefully selected genes and variant sites most related to anxiety medication, so that the time period and the detection cost can be greatly reduced, and a highly reliable detection result is still obtained, thereby ensuring that the technology has practical use value in clinic.

Drawings

FIG. 1 is a schematic workflow diagram of the present invention.

Detailed Description

The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

Details of the kit

1.1 composition of

PCR mixed reaction liquid, Taq enzyme, amplification primer mixed liquid, SAP buffer solution, SAP enzyme, extension primer mixed liquid, iPlex enzyme, single-base extension reaction mixed liquid, deionized water, a positive control product, desalting resin and a mass spectrum chip.

1.2 storage conditions and expiration dates

The reaction reagent and the enzyme are stored at-20 ℃ and the shelf life is 9 months.

1.3 matching instruments

General purpose PCR instrument, DR MassArray analyzer.

1.4 sample requirement

The product is suitable for extracting genome DNA from oral mucosa cells, oral exfoliative cells, blood, tissues and dried blood slices, and requires that the ratio of DNA A260/A280 is between 1.8 and 2.0. Frozen DNA samples should be below-20 ℃ and repeated freeze thawing is avoided.

1.5 Experimental procedures

PCR amplification

In PCR I, the reagents were removed from the freezer at-20 ℃ and placed on ice. The amplification primers were removed from 4 ℃, vortexed for 10s, and briefly centrifuged for use.

Related reagents are added into the components in the following table at one time, PCR reaction liquid is prepared, and the PCR reaction liquid is subpackaged into a 96-well plate with the volume of 3 mu L per well. After completion, the DNA fragment was transferred to PCR II region through the transfer window.

In PCR II area, DNA template was taken out from refrigerator at-20 deg.C, melted on ice (4 deg.C), vortexed for 10s, centrifuged briefly, and a certain amount of DNA was aspirated and diluted to 5 ng/. mu.L for use.

Adding 2 muL of 5 ng/muL DNA template into each well of a 96-well plate, covering a tube cover, performing vortex oscillation for 10s, centrifuging briefly, transferring from a PCR II area to a PCR III area through a transfer window, and transferring from the PCR III area to a PCR IV area through the transfer window, wherein a blank control (2 muL ddH) must be set in each experiment₂O), negative control (2 μ L DNA extraction eluate) and positive control.

The 96-well plate was placed in the amplification apparatus, and the program was run: pcr, the specific procedure is as follows:

SAP reaction

SAP mixtures were prepared in 1.5ml EP tubes according to the following table:

SAP buffer	0.17 μ L of CutSmart buffer (manufacturer NEB)
		SAP enzymes	0.5U (manufacturer NEB)
Water (W)	Make up to 2 mu L

Add 2. mu.L of SAP mixture to the wells of a 96-well plate, seal the 96-well plate with a sealing membrane, vortex, and centrifuge for 5s at 4000 rpm.

The 96-well plate was transferred to a PCR instrument for the following reactions:

37℃40min→85℃5min→4℃

extension reaction

And taking out the 96-well plate after the reaction in the previous step, and centrifuging at 2000 rpm for 1 min. An iPLEX extension reaction solution was prepared in a 1.5ml EP tube according to the following table:

the iPLEX extension reaction was added to the 96-well plate at the end of the previous reaction, 2. mu.L/well, the 96-well plate was resealed, vortexed and centrifuged (supra).

The 96-well plate was transferred to a PCR instrument and the following program was run:

sample desalination

Clean Resin (Resin) was spread flat over 96/15mg crater plate and air dried for at least 10min, changing the Resin from dark yellow to light yellow.

To each well of the sample plate, 41. mu.L of water was added, the membrane was sealed, and then centrifuged.

Add 15mg of clean Resin (Resin): the sample plate was gently inverted in the air and the hole-to-hole placed on the crater plate with resin placed. The crater plate, along with the sample plate, is then inverted (both plates are not horizontally movable during the process) allowing the resin to drop into the wells. The 96 well plate was sealed and shaken upside down on a rotator for 15 minutes.

Plates were centrifuged for 5 minutes at 3200g (4000 rpm of standard plate centrifuge).

Mass spectrometric detection

And opening the software of the plate management system, editing an experiment plan file, wherein the experiment plan file comprises the position of the sample, the name of the sample and the used primer, and connecting the mass spectrometer with the established experiment plan file.

The Start All icon is clicked, the software is started, and the various indicator lights are checked for normality.

Click the "chip tray enter/exit" button to place the chip on the tray and then on the chip deck, record the chip position (1 on the left and 2 on the right). Hands do not touch the surface of the chip; placing the 96 plate at the position marked with MTP1/2, and fixing the 96 plate in the direction of A1 at the lower left corner; when the chip is used for the first time, 75 mu L of calibration standard substance is added into the sample adding slot of the calibration substance, and when the chip is not used for the first time, the calibration standard substance does not need to be added. Then click the 'chip tray enter/exit' button and close the clamp plate.

Clicking a 'resin adding/maintaining' button, opening a resin tank, adding resin or supplementing high-pressure sterilized purified water (when an instrument is started for the first time, 28g of resin needs to be added into the resin tank and 16mL of sterilized purified water needs to be added for uniform mixing, when the instrument is used for the first time, 9g of resin is completely poured into the resin tank, 5.2mL of high-pressure sterilized purified water is added, a gun head is used for uniform mixing, when the instrument is not used for the first time, the liquid level needs to be observed, if the liquid level of the water is lower than the resin level, a proper amount of high-pressure sterilized purified water needs to be supplemented, so that the liquid level of the water is higher than the resin level, and after the resin solution is added into the resin tank, the resin solution needs to be used as

The program set-up parameters are as follows:

after finishing printing the mass spectrum, clicking a button for removing the old chip from the analyzer, returning the chip to a chip deck, then clicking a button for entering/exiting a chip tray, taking out a 96-well plate, sealing a film and storing at-20 +/-5 ℃; the chip is put back into the packaging box and stored in a dehumidifier (the chip is used as soon as possible after being opened, the storage time does not exceed 30 days), the calibration standard sample is recovered and stored at minus 20 plus or minus 5 ℃, then a button for entering/exiting the chip tray is clicked, and the clamping plate is closed.

1.6 the results show

And (3) judging the effectiveness: the standard substance can detect the corresponding genotype, the blank control has no signal detection, and the weak positive control can detect the corresponding positive signal, the detection result is valid, otherwise, the detection result is invalid.

1.7 product Performance index

The product can detect 1ng of human genome DNA with the A260/A280 purity ranging from 1.70 to 1.90 at the lowest.

The method is influenced by the quality of sample DNA, and false negative results can occur in low-quality DNA.

Experimental example:

case one: a patient in Hebei Baoding City Guo and a woman in 55 years old will be called in the hospital in 6 and 18 months in 2019, and the patient complains: vexation, poor mood, malaise 5 years, repeat for 3 months; the main manifestations include: vexation, anxiety, paroxysmal palpitation, sweating due to debility, frequent micturition, bad mood, poor happiness, poor night sleep, etc.; the hysteromyoma resection is carried out before 9 years, and the personal history and the family history are not special; mental examination is characterized by 'uninteresting, self-mutilation, feelings of descent, anxiety and reduced activity'. The identification and diagnosis of the mental disorder are 'organic mental disorder and mental disorder caused by addictive substances'. Lorazepam and olanzapine are taken once, but the problems of anxiety, poor night sleep and the like still exist.

The following results are obtained by adopting the kit provided by the invention for detection:

note that:

(extensive metabolic) drug metabolism is normal, and blood drug concentrations are within the therapeutic window.

(ultrafast metabolic type) accelerated drug metabolism, and the blood concentration may be lower than the effective therapeutic concentration, resulting in poor therapeutic effect.

(intermediary metabolic type) slowing of drug metabolism, blood drug levels may be higher than safe therapeutic levels (or lack of clear data support).

(slow-metabolizing) drug metabolism is significantly slowed, and blood drug concentrations may be higher than safe treatment concentrations, leading to an increased risk of adverse reactions.

5. The drug response is optimal.

6. The drug response is not optimal.

7. The risk of adverse reactions is low.

8. The risk of adverse reactions is high.

Wherein the explanation about lorazepam is as follows:

1. interpretation of the test results:

(1) the patient has a UGT2B15 genotype: mutant forms (CC), with increased drug clearance, may result in decreased efficacy and may be dosed appropriately according to the actual clinical response.

(2) The patient has a UGT2B7 genotype: mutant (CC), has poor drug response and efficacy to lorazepam.

2. And (3) comprehensive medication suggestion:

(1) the patient takes lorazepam, either administered or contraindicated under monitoring: the clearance rate of the medicine is increased, and the medicine can be treated by increasing dosage properly. Closely observing the clinical treatment effect and the occurrence of adverse reaction, and monitoring the blood concentration if necessary; or replacing other medicines and detecting related medicine genes, and reasonably selecting the medicines.

(2) The concomitant use of opioids is to be avoided during the administration of lorazepam.

The total gene detection results are:

1. alprazolam

Serial number	Detection of genes	Detection site	The result of the detection
				1	CYP3A5	C>T	CT

2. Clobazam

Serial number	Detection of genes	Detection site	The result of the detection
				1	CYP2C19	1,2,3,17	Extensive metabolic pattern

3. Clonazepam

Serial number	Detection of genes	Detection site	The result of the detection
				1	CYP3A4	1,20	Extensive metabolic pattern
2	NAT2	4,5B,*6A	Intermediate metabolic type

4. Diazepam

5. Etizolam

6. Lorazepam

Serial number	Detection of genes	Detection site	The result of the detection
				1	UGT2B15	A>C	CC
2	UGT2B7	T>C	CC

7. Midazolam

8. Oxazepam

9. Tandospirone

Serial number	Detection of genes	Detection site	The result of the detection
				1	HTR1A	C>G	CG
2	CYP3A4	1,20	Extensive metabolic pattern

10. Buspirone

11. Estazolam

Serial number	Detection of genes	Detection site	The result of the detection
				1	GABRA1	A>G	GG
2	CYP3A4	1,20	Extensive metabolic pattern

12. Zolpidem

According to the detection result, a doctor decides to stop lorazepam and changes olanzapine into diazepam. Thereafter, the patient had improved anxiety and improved night sleep.

SEQUENCE LISTING

<110> Shanghai Kangli medical laboratory Co., Ltd

<120> kit for guiding anxiety disorder medication of human and application thereof

<160> 42

<170> PatentIn version 3.5

<210> 1

<211> 30

<212> DNA

<213> Artificial sequence

<400> 1

acgttggatg tccatcgatt cttggtgttc 30

<210> 2

<211> 30

<212> DNA

<213> Artificial sequence

<400> 2

acgttggatg gcaataattt tcccactatc 30

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence

<400> 3

acgttggatg gactgtaagt ggtttctcag 30

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<400> 4

acgttggatg aacatcagga ttgtaagcac 30

<210> 5

<211> 30

<212> DNA

<213> Artificial sequence

<400> 5

acgttggatg caaatttgtg tcttctgttc 30

<210> 6

<211> 30

<212> DNA

<213> Artificial sequence

<400> 6

acgttggatg tgagctgagg tcttctgatg 30

<210> 7

<211> 30

<212> DNA

<213> Artificial sequence

<400> 7

acgttggatg ttaggaggac ttcttcaacc 30

<210> 8

<211> 30

<212> DNA

<213> Artificial sequence

<400> 8

acgttggatg aattcaggct ccacttacgg 30

<210> 9

<211> 30

<212> DNA

<213> Artificial sequence

<400> 9

acgttggatg acgtctgcag gtatgtattc 30

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence

<400> 10

acgttggatg cctgccaaag aagaaacacc 30

<210> 11

<211> 30

<212> DNA

<213> Artificial sequence

<400> 11

acgttggatg cagaccacaa tgttaggagg 30

<210> 12

<211> 30

<212> DNA

<213> Artificial sequence

<400> 12

acgttggatg ccatgccagt gctgtatttg 30

<210> 13

<211> 30

<212> DNA

<213> Artificial sequence

<400> 13

acgttggatg caaatacagc actggcatgg 30

<210> 14

<211> 30

<212> DNA

<213> Artificial sequence

<400> 14

acgttggatg gacccagcat cgacaatgta 30

<210> 15

<211> 30

<212> DNA

<213> Artificial sequence

<400> 15

acgttggatg tgcttgacag aagagagagg 30

<210> 16

<211> 30

<212> DNA

<213> Artificial sequence

<400> 16

acgttggatg cttctttggc aggagatgag 30

<210> 17

<211> 30

<212> DNA

<213> Artificial sequence

<400> 17

acgttggatg aactctcact gaggaagagg 30

<210> 18

<211> 30

<212> DNA

<213> Artificial sequence

<400> 18

acgttggatg tttgggcacg agatttctcc 30

<210> 19

<211> 30

<212> DNA

<213> Artificial sequence

<400> 19

acgttggatg gtaatgtggt ccaaacaggg 30

<210> 20

<211> 30

<212> DNA

<213> Artificial sequence

<400> 20

acgttggatg acccagctta acgaatgctc 30

<210> 21

<211> 30

<212> DNA

<213> Artificial sequence

<400> 21

acgttggatg ccatatatcc atctatcgag 30

<210> 22

<211> 30

<212> DNA

<213> Artificial sequence

<400> 22

acgttggatg tctactcttg tcaatgccag 30

<210> 23

<211> 30

<212> DNA

<213> Artificial sequence

<400> 23

acgttggatg tggagtcctc caacaaaatc 30

<210> 24

<211> 30

<212> DNA

<213> Artificial sequence

<400> 24

acgttggatg gctgacgtat ggcttattcg 30

<210> 25

<211> 30

<212> DNA

<213> Artificial sequence

<400> 25

acgttggatg gtcagtctcc caattattgc 30

<210> 26

<211> 30

<212> DNA

<213> Artificial sequence

<400> 26

acgttggatg cgagaacgga ggtagctttt 30

<210> 27

<211> 30

<212> DNA

<213> Artificial sequence

<400> 27

acgttggatg tgtaagaaag tagcagcccc 30

<210> 28

<211> 29

<212> DNA

<213> Artificial sequence

<400> 28

acgttggatg tactggattc attcttgtc 29

<210> 29

<211> 26

<212> DNA

<213> Artificial sequence

<400> 29

ttgttaagta atttgttatg ggttcc 26

<210> 30

<211> 17

<212> DNA

<213> Artificial sequence

<400> 30

cttggcctta cctggat 17

<210> 31

<211> 24

<212> DNA

<213> Artificial sequence

<400> 31

ccctcgtgtc ttctgttctc aaag 24

<210> 32

<211> 20

<212> DNA

<213> Artificial sequence

<400> 32

gacttcttca accagaaaaa 20

<210> 33

<211> 25

<212> DNA

<213> Artificial sequence

<400> 33

aatagactca aaatcttcaa ttgtt 25

<210> 34

<211> 24

<212> DNA

<213> Artificial sequence

<400> 34

cacaatgtta ggagggtatt ttta 24

<210> 35

<211> 17

<212> DNA

<213> Artificial sequence

<400> 35

tctcctgcag gtgacca 17

<210> 36

<211> 24

<212> DNA

<213> Artificial sequence

<400> 36

acataagaga gaggaatctg gtac 24

<210> 37

<211> 17

<212> DNA

<213> Artificial sequence

<400> 37

ggttgaagaa gtgctga 17

<210> 38

<211> 26

<212> DNA

<213> Artificial sequence

<400> 38

ccttcggtcc aaacagggaa gagata 26

<210> 39

<211> 23

<212> DNA

<213> Artificial sequence

<400> 39

tttcagaaga gaatcttcca aat 23

<210> 40

<211> 20

<212> DNA

<213> Artificial sequence

<400> 40

aacatttggt aagagtggat 20

<210> 41

<211> 21

<212> DNA

<213> Artificial sequence

<400> 41

tcgacgaccg agtgtgtctt c 21

<210> 42

<211> 22

<212> DNA

<213> Artificial sequence

<400> 42

caccccttgc caccaaataa ag 22

Claims

1. A kit for guiding a drug for anxiety disorder in a human, which can simultaneously type 14 gene loci, comprises 14 pairs of amplification primers for amplifying 14 gene fragments, wherein the sequences of the 14 gene loci and the 14 pairs of amplification primers are shown as follows:

。

2. the kit according to claim 1, further comprising 14 extension primers for identifying mutations of the 14 gene fragments, wherein the sequences of the extension primers are specifically shown as follows:

。

3. the kit according to claim 1, wherein the reaction system of PCR amplification of the kit is as follows:

buffer solution and Mg²⁺The solution being mixed with dNTPsPCR reaction mixture 2. mu.L

0.48-0.52 mu L of amplification primer mixed solution

Taq enzyme 1U

DNA template 2. mu.L

Make up to 5 μ L with water.

4. The kit of claim 1, further comprising an SAP reaction system, the SAP reaction system comprising:

SAP buffer 0.17. mu.L

SAP enzyme 0.5U

The volume of pure water is made up to 2 μ L.

5. The kit according to claim 1, wherein the molar concentration of the amplification primers SEQ ID No. 1-SEQ ID No.2 in the reaction system is 0.3-0.5. mu.M, the molar concentration of the amplification primers SEQ ID No. 3-SEQ ID No.24, the molar concentration of the amplification primers SEQ ID No. 27-SEQ ID No.28 in the reaction system is 0.2-0.4. mu.M, and the molar concentration of the amplification primers SEQ ID No. 25-SEQ ID No.26 in the reaction system is 0.4-0.8. mu.M.

6. The kit of claim 1, wherein the kit is for detection using a time-of-flight mass spectrometer.

7. Use of a kit for guiding anxiety disorder medication according to any one of claims 1 to 6 in the manufacture of a medicament for guiding anxiety disorder medication in a human.