KR20220018448A - Compositions containing Sargassum thunbergii extract - Google Patents

Abstract

The present invention relates to a cosmetic composition including a Sargassum thunbergii extract as an active ingredient. The present invention has excellent antioxidant effect and is effective in skin whitening and improvement of skin wrinkles by including Sargassum thunbergii as an active ingredient.

Description

Compositions containing Sargassum thunbergii extract as an active ingredient

The present invention relates to a cosmetic composition and health functional food for skin whitening and wrinkle improvement comprising an ultrasonic extract of Sargassum thunbergii as an active ingredient.

Recently, interest in beauty and health is increasing with the increase in income of modern people, and accordingly, research on the development of synthetic and natural materials for the purpose of improving functionality is active. As functionalities such as antibacterial, antioxidant, skin aging suppression, moisturizing and whitening effects for the synthetic and natural materials have been proven, the search for and demand for new materials is increasing.

In particular, in relation to the skin whitening effect, melanin is a generic term for black or brown pigments secreted from melanocytes, and melanin synthesis is achieved through the action of tyrosinase present in melanosomes. Tyrosinase catalyzes the conversion of L-tyrosine to dopachrome through hydroxylation and subsequent oxidation. On the other hand, TRP-2 isomerizes dopachrome to produce 5,6-dihydroxyindole-2-carboxylic acid (DHICA), and TRP-1 oxidizes DHICA to produce indole-5,6-quinone2-carboxylic acid (IQCA). It is involved in the synthesis of pheomelanin and eumelanin. Therefore, when the expression of tyrosinase, TRP-1 or TRP-2 is suppressed, a whitening effect can be expected.

In addition, when reactive oxygen species (ROS) are generated by ultraviolet rays that can penetrate to the dermis of the skin, the oxidation of tyrosine mediated by tyrosinase is promoted and the mechanism of melanin formation is accelerated. It is reported to be effective in inhibiting pigment formation.

On the other hand, collagen present in the dermal layer of the skin is known as an important intracellular matrix that protects the skin from pressure or external stimuli applied to the skin through binding with elastin and prevents wrinkles and skin aging. When excessively produced, the activity of collagenase, a type of matrix metalloproteinase (MMP), increases, and collagen degradation is promoted, resulting in skin wrinkles and loss of elasticity.

The matrix metalloproteinase (MMP) is a calcium and zinc-dependent endopeptidase secreted from cells such as macrophages, fibroblasts, and bone cells, and aging and UV rays It is an enzyme that is secreted from the body through exposure and breaks down collagen and elastin, the extracellular matrix proteins of the skin. The types exist from MMP 1 to 28, and among them, the matrix metalloproteinases related to aging are MMP-1, MMP-2, MMP-3, MMP-9, and MMP-12. In particular, MMP-1 and MMP-1 and MMP because MMP-1 cuts the middle of the type I collagen cross-linkage that is most abundant in the skin, and MMP-9 plays a role in subdividing and re-cutting the cut collagen. -9 is intensively studied for skin aging prevention.

As such, the common cause of pigmentation and skin aging is the accumulation of ROS, which disrupts the antioxidant chain reaction in the body and causes irreversible damage to cells and tissues. there is a need to protect

Although synthetic antioxidants such as butylated hydroxytoluene (BHT) and butylated hydroxyanisole (BHA) are widely used as antioxidants in Korea, these antioxidants cause problems such as cancer induction, fat mutation, and liver enlargement, making them safer and more active. The development of high novel antioxidants is required, and polyphenols have recently been attracting attention as an alternative to synthetic antioxidants. It is known that the polyphenol is a secondary metabolite produced by a plant and has a number of hydroxyl groups and can effectively prevent oxidative damage in the body by stabilizing ROS through the substitution of hydroxyl groups. Accordingly, research on extracting polyphenols from terrestrial plants and using them commercially is actively conducted, but there is a limit to the supply and demand of raw materials, so the demand for natural antioxidant production using seaweeds with various biological species and pigments is increasing.

On the other hand, worms have been used as repellents since ancient times, and they are also used as food or compost.

For commercialization, there is a need for a composition that has excellent antioxidant effect and is effective for skin whitening and skin regeneration by using lichen.

Republic of Korea Patent No. 1727788 Republic of Korea Patent No. 1094890

It is an object of the present invention to provide a cosmetic composition comprising the ultrasonic extract of worms as an active ingredient.

In addition, another object of the present invention is to provide a health functional food containing the ultrasonic extract of worms as an active ingredient.

In addition, another object of the present invention is to provide a method for preparing an ultrasonic extract of worms.

The cosmetic composition for skin whitening and wrinkle improvement of the present invention for achieving the above object may include Sargassum thunbergii ultrasonic extract as an active ingredient.

The ultrasonic worm extract may be extracted under water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof.

The mixed solvent may be an aqueous solution of 20 to 99.5% by volume of methanol, ethanol, butanol or propanol.

The ultrasonic worm extract may be processed for 5 to 30 minutes with an ultrasonicator having a frequency of 20 to 50 kHz.

The extraction temperature during the ultrasonic treatment may be 20 to 85 ℃.

The indicator material of the ultrasonic extract of worms may be nobiletin.

In addition, the health functional food for preventing or alleviating skin whitening and wrinkles of the present invention for achieving the above other object may include Sargassum thunbergii ultrasonic extract as an active ingredient.

In addition, the method for preparing the ultrasonic extract of worms of the present invention for achieving the above another object is (A) an extraction solvent that is water, a lower alcohol having 1 to 4 carbon atoms or a mixed solvent thereof, and an extraction temperature of 20 to 85 ℃ , obtaining experimental values for the total polyphenol content of the supernatant obtained by centrifugation after extraction with an ultrasonicator at a frequency of 20 to 50 kHz under extraction conditions of an extraction time of 5 to 30 minutes; (B) deriving a quadratic regression model represented by the following [Equation 1] using the experimental value of step (A); (C) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (B), and obtaining a response surface curve for the extraction conditions; (D) obtaining an experimental value for the total flavonoid content of the supernatant obtained in step (A); (E) deriving a quadratic regression model represented by the following [Equation 2] using the experimental value of step (D); (F) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (E), and obtaining a response surface curve for the extraction conditions; (G) obtaining an experimental value for the DPPH radical scavenging ability of the supernatant obtained in step (A); (H) deriving a quadratic regression model represented by the following [Equation 3] using the experimental values of the step (G); (I) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (H), and obtaining a response surface curve for the extraction conditions; (J) obtaining an experimental value for the tyrosinase inhibitory ability of the supernatant obtained in step (A); (K) deriving a quadratic regression model represented by the following [Equation 4] using the experimental values of the step (J); (L) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (K), and obtaining a response surface curve for the extraction conditions; (M) obtaining an experimental value for the collagenase inhibitory ability of the supernatant obtained in step (A); (N) deriving a quadratic regression model represented by the following [Equation 5] using the experimental values of the step (M); (O) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (M), and obtaining a response surface curve for the extraction conditions; and (P) total polyphenol content, total flavonoid content, and DPPH radical scavenging ability by superimposing the reaction surface curves obtained in steps (C), (F), (I), (L) and (O). , predicting common optimization conditions for tyrosinase inhibitory ability and collagenase inhibitory ability; may include;

[Equation 1]

Y _TPC =+11.87710-0.27813X ₁ +0.062526X ₂ -0.10999X ₃ -0.038357X ₁ ² +0.011033X ₁ X ₂ -8.04762E-004X ₂ ² +9.16875E-003X ₁ X ₃ -2.72059E-004X ₂ X ₃ -9.82967E-004X ₃ ²

[Equation 2]

Y _TFC =+0.29505-0.027059X ₁ -3.97311E-003X ₂ +2.06369E-003X ₃ +6.56102E-004X ₁ ² +2.35575E-004X ₁ X ₂ +1.4523E-005X ₂ ² -5.60826E-005X ₁ X ₃ +4.47917E-005X ₂ X ₃ -9.59741E-006X ₃ ²

[Equation 3]

Y _DPPH =-12.01377-0.23738X ₁ +1.10578X ₂ +1.88331X ₃ -0.18487X ₁ ² +0.065359X ₁ X ₂ -0.015823X ₂ ² +0.018519X ₁ X ₃ +6.53596E-003X ₂ X ₃ -0.027340X ₃ ²

[Equation 4]

Y _TI =+21.89570+2.31910X ₁ +0.73168X ₂ +0.89582X ₃ -0.10956X ₁ ² +6.37868E-003X ₁ X ₂ -7.16647E-003X ₂ ² -1.71875E-003X ₁ X ₃ +2.17402E-003X ₂ X ₃ -7.54092EX ₃ ²

[Equation 5]

Y _CI =7.18898+0.47210X ₁ +1.74516X ₂ +1.05430X ₃ -0.20030X ₁ ² +0.036374X ₁ X ₂ -0.013524X ₂ ² +0.042529X ₁ X ₃ -7.41903E-003X ₂ X ₃ -8.53821E- 003X ₃ ²

In Equations 1 to 5, Y _TPC is total polyphenol content (mg GAE/g DM), Y _TFC is total flavonoid content (mg QE/g DM), Y _DPPH is DPPH radical scavenging activity predicted value (%), Y _TI is the predicted value of tyrosinase inhibition (%), Y _CI is the predicted value of the inhibition of collagenase (%), X ₁ is the extraction time, X ₂ is the extraction temperature, and X ₃ is the concentration of the extraction solvent.

Extraction conditions according to common optimization conditions for the DPPH radical scavenging ability, total polyphenol content, total flavonoid content, tyrosinase inhibitory ability and collagenase inhibitory ability are extraction time of 11.0 minutes, extraction temperature of 81.5 ° C., and ethanol concentration of 50% by volume. have.

The composition comprising the worm worm ultrasonic extract of the present invention is non-toxic, has excellent antioxidant effect, and is effective for skin whitening and skin regeneration.

In addition, it is possible to obtain an ultrasonic worm extract with increased total polyphenol content, total flavonoid content, DPPH radical scavenging ability, tyrosinase inhibitory activity and collagenase inhibitory activity.

In addition, by optimizing ultrasonic-assisted extraction (UAE) conditions using response surface methodology (RSM), the yield of bioactive substances was increased.

1 is a univariate curve showing the conditions in which worms prepared according to an embodiment of the present invention affect the total polyphenol content (TPC) when using an ultrasonic extract.
2 is a three-dimensional response surface curve of the total polyphenol content (TPC) according to the ultrasonic extraction conditions of worms prepared according to an embodiment of the present invention.
Figure 3 is a univariate curve showing the conditions affecting the total flavonoid content (TFC) when using the ultrasonic extract of worms prepared according to an embodiment of the present invention.
4 is a three-dimensional response surface curve of the total flavonoid content (TFC) according to the ultrasonic extraction conditions of worms prepared according to an embodiment of the present invention.
5 is a univariate curve showing the conditions under which worms prepared according to an embodiment of the present invention affect DPPH radical scavenging ability (DSA) when using an ultrasonic extract.
6 is a three-dimensional response surface curve of the DPPH radical scavenging ability (DSA) according to the ultrasonic extraction conditions of worms prepared according to an embodiment of the present invention.
7 is a univariate curve showing the conditions under which tyrosinase inhibitory ability (TIA) is affected when worms prepared according to an embodiment of the present invention use an ultrasonic extract.
8 is a three-dimensional response surface curve of tyrosinase inhibitory ability (TIA) according to ultrasonic extraction conditions of worms prepared according to an embodiment of the present invention.
9 is a univariate curve showing the conditions in which worms prepared according to an embodiment of the present invention affect collagenase inhibitory ability (CIA) when using an ultrasonic extract.
10 is a three-dimensional response surface curve of the collagenase inhibitory ability (CIA) according to the ultrasonic extraction conditions of worms prepared according to an embodiment of the present invention.
11 is a graph showing the method of overlapping the response surface curves of FIGS. 2, 4, 6, 8 and 10 in order to find the optimal ultrasonic extraction conditions for worms prepared according to an embodiment of the present invention.
12 is NMR data obtained by measuring the indicator material of the ultrasonic extract of worms prepared according to Example 12 of the present invention.

The present invention relates to a cosmetic composition and health functional food for skin whitening and wrinkle improvement comprising an ultrasonic extract of Sargassum thunbergii as an active ingredient.

Hereinafter, the present invention will be described in detail.

The cosmetic composition of the present invention contains the ultrasonic worm extract as an active ingredient.

Sargassum thunbergii has an erect and straight central branch and irregularly formed side branches from a small semi-rectum root, and protuberance-shaped leaves are densely grown on the stem surface. Young plants of worms are edible, but are often used as feed and have been used as repellents.

The lichen is extracted through sonication under an extraction solvent, and specifically, the worm and the extraction solvent are mixed in a weight ratio of 1: 5 to 25, preferably 1: 10 to 20, and 20 to 50 kHz, preferably Preferably at a frequency of 30 to 40 kHz and an ultrasonic wave of 50 to 700 W, preferably 150 to 400 W power at 20 to 85 °C, preferably 60 to 80 °C for 5 to 30 minutes, preferably 10 to 20 minutes processed while

In the case of extraction with hot water or alcohol such as ethanol, not ultrasonic extraction, not only a small amount of active ingredients are extracted, but also antioxidant, skin whitening and skin regeneration effects may be low.

When the weight ratio of the lichen and the extraction solvent is out of the above range, the active ingredient of the lichen may be extracted in a small amount in the extract.

In addition, when the frequency and power of the ultrasonicator are less than the lower limit, the active ingredient of the lichen may be extracted in a small amount, and if it exceeds the upper limit, other substances in addition to the active ingredient are extracted in a large amount, thereby reducing the effect.

In addition, when the extraction temperature and extraction time are less than the lower limit, the active ingredient of the worm can be extracted in a small amount, and when it exceeds the upper limit, toxic substances may be generated.

The extraction solvent for extracting the extract is water, a lower alcohol having 1 to 4 carbon atoms, ethylene glycol, ethyl ether, or a mixed solvent thereof. The lower alcohol may be an aqueous solution of methanol, ethanol, butanol or propanol in an amount of 20 to 99% by volume, and preferably an aqueous solution of 30 to 60% by volume of ethanol for excellent antioxidant, skin whitening and skin regeneration effects. .

Ultrasonic extract of C. lichen of the present invention may be used in health functional foods in addition to cosmetic compositions.

In addition, the present invention provides a method for preparing an ultrasonic extract of worms using a response surface analysis method.

The method for preparing an ultrasonic worm extract using the reaction surface analysis method of the present invention is (A) water, an extraction solvent that is a lower alcohol having 1 to 4 carbon atoms or a mixed solvent thereof, an extraction temperature of 20 to 85 ℃, 5 to 30 minutes Obtaining experimental values for the total polyphenol content of the supernatant obtained by centrifugation after extraction with an ultrasonicator of a frequency of 20 to 50 kHz and a power of 50 to 700 W under the extraction conditions of the extraction time; (B) deriving a quadratic regression model represented by the following [Equation 1] using the experimental value of step (A); (C) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (B), and obtaining a response surface curve for the extraction conditions; (D) obtaining an experimental value for the total flavonoid content of the supernatant obtained in step (A); (E) deriving a quadratic regression model represented by the following [Equation 2] using the experimental value of step (D); (F) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (E), and obtaining a response surface curve for the extraction conditions; (G) obtaining an experimental value for the DPPH radical scavenging ability of the supernatant obtained in step (A); (H) deriving a quadratic regression model represented by the following [Equation 3] using the experimental values of the step (G); (I) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (H), and obtaining a response surface curve for the extraction conditions; (J) obtaining an experimental value for the tyrosinase inhibitory ability of the supernatant obtained in step (A); (K) deriving a quadratic regression model represented by the following [Equation 4] using the experimental values of the step (J); (L) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (K), and obtaining a response surface curve for the extraction conditions; (M) obtaining an experimental value for the collagenase inhibitory ability of the supernatant obtained in step (A); (N) deriving a quadratic regression model represented by the following [Equation 5] using the experimental values of the step (M); (O) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (M), and obtaining a response surface curve for the extraction conditions; and (P) total polyphenol content, total flavonoid content, and DPPH radical scavenging ability by superimposing the reaction surface curves obtained in steps (C), (F), (I), (L) and (O). , predicting common optimization conditions for tyrosinase inhibitory ability and collagenase inhibitory ability; Ultrasonic extraction of worms using these predicted conditions shows excellent effects on DPPH radical scavenging ability, total polyphenol content, total flavonoid content, tyrosinase inhibitory ability and collagenase inhibitory ability.

[Equation 1]

Y _TPC =+11.87710-0.27813X ₁ +0.062526X ₂ -0.10999X ₃ -0.038357X ₁ ² +0.011033X ₁ X ₂ -8.04762E-004X ₂ ² +9.16875E-003X ₁ X ₃ -2.72059E-004X ₂ X ₃ -9.82967E-004X ₃ ²

[Equation 2]

Y _TFC =+0.29505-0.027059X ₁ -3.97311E-003X ₂ +2.06369E-003X ₃ +6.56102E-004X ₁ ² +2.35575E-004X ₁ X ₂ +1.4523E-005X ₂ ² -5.60826E-005X ₁ X ₃ +4.47917E-005X ₂ X ₃ -9.59741E-006X ₃ ²

[Equation 3]

Y _DPPH =-12.01377-0.23738X ₁ +1.10578X ₂ +1.88331X ₃ -0.18487X ₁ ² +0.065359X ₁ X ₂ -0.015823X ₂ ² +0.018519X ₁ X ₃ +6.53596E-003X ₂ X ₃ -0.027340X ₃ ²

[Equation 4]

Y _TI =+21.89570+2.31910X ₁ +0.73168X ₂ +0.89582X ₃ -0.10956X ₁ ² +6.37868E-003X ₁ X ₂ -7.16647E-003X ₂ ² -1.71875E-003X ₁ X ₃ +2.17402E-003X ₂ X ₃ -7.54092EX ₃ ²

[Equation 5]

Y _CI =7.18898+0.47210X ₁ +1.74516X ₂ +1.05430X ₃ -0.20030X ₁ ² +0.036374X ₁ X ₂ -0.013524X ₂ ² +0.042529X ₁ X ₃ -7.41903E-003X ₂ X ₃ -8.53821E- 003X ₃ ²

In Equations 1 to 5, Y _TPC is total polyphenol content (mg GAE/g DM), Y _TFC is total flavonoid content (mg QE/g DM), Y _DPPH is DPPH radical scavenging activity predicted value (%), Y _TI is the predicted value of tyrosinase inhibition (%), Y _CI is the predicted value of the inhibition of collagenase (%), X ₁ is the extraction time, X ₂ is the extraction temperature, and X ₃ is the concentration of the extraction solvent.

In the present specification, the term 'extract' used while referring to C. lichen includes not only the crude extract obtained by treating the extract with an extraction solvent, but also the processed product of the C. larvae extract. For example, the ultrasonic extract of C. lichen may be prepared in a powder state by an additional process such as distillation under reduced pressure and freeze-drying or spray-drying.

Meanwhile, in the present specification, the term 'contained as an active ingredient' means that the worm includes an amount sufficient to achieve the efficacy or activity of the ultrasonic extract. As an example, the ultrasonic extract of L. worms is used at a concentration of 10 to 1500 μg/ml, preferably 100 to 1000 μg/ml. Since the ultrasonic worm worm extract is a natural product and there is no side effect on the human body even when used in excess, the upper limit of the quantitative upper limit of the worm worm ultrasonic extract contained in the composition of the present invention can be selected and carried out by those skilled in the art within an appropriate range.

In the cosmetic composition of the present invention, in addition to the above cosmetic composition, other ingredients commonly formulated in cosmetics may be blended as needed. Examples of these blending ingredients include oil and fat ingredients, moisturizing agents, emollients, surfactants, organic and inorganic pigments, Organic powder, UV absorber, preservative, disinfectant, antioxidant, pH adjuster, alcohol, colorant, flavoring agent, blood circulation promoter, cooling agent, limiting agent, purified water, water-soluble vitamin, fat-soluble vitamin, polymer peptide, polymer polysaccharide, sphingolipid and seaweed an extract, etc. are mentioned.

The cosmetic composition of the present invention may be prepared in the form of emulsified formulations and solubilized formulations commonly used in the art.

In addition, the ingredients included in the cosmetic composition of the present invention may include ingredients commonly used in cosmetic compositions in addition to the ingredients as active ingredients, for example, conventional adjuvants such as stabilizers, pigments and natural fragrances; It may further include a carrier.

Products to which the composition of the present invention can be added include, for example, mist, skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, sunscreen cream , moisture cream, hand cream, foundation, essence, nourishing essence, mask pack, press powder, loose powder, eye shadow, etc., and soap, cleansing foam, cleansing lotion, cleansing cream, body lotion and body cleanser.

When the formulation of the present invention is a paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane , butane or propellants such as dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

In addition, the present invention provides a health functional food composition containing the ultrasonic extract of worms as an active ingredient.

Health functional food is a food prepared by adding ultrasonic extract of worms to food materials such as beverages, teas, spices, gum, and confectionery, or by encapsulating, powdering, or suspension, etc. However, unlike general medicines, it has the advantage that there are no side effects that may occur when taking the medicine for a long period of time by using food as a raw material. The health functional food of the present invention obtained in this way is very useful because it can be ingested on a daily basis. The added amount of the ultrasonic extract of worms in such health functional food cannot be uniformly defined as it varies depending on the type of health functional food, but it can be added within the range that does not impair the original taste of the food, and for the target food It is usually in the range of 0.01 to 50% by weight, preferably 0.1 to 20% by weight. In addition, in the case of a health functional food in the form of pills, granules, tablets or capsules, it is usually added in an amount of 0.1 to 100% by weight, preferably 0.5 to 80% by weight. In one embodiment, the health functional food of the present invention may be in the form of a pill, tablet, capsule or beverage.

Hereinafter, preferred examples are presented to help the understanding of the present invention, but the following examples are merely illustrative of the present invention, and it will be apparent to those skilled in the art that various changes and modifications are possible within the scope and spirit of the present invention, It goes without saying that such variations and modifications fall within the scope of the appended claims.

Examples 1 to 17.

The worms purchased from ParaJeJu. Ltd., Juju, Korea were dried in a hot air dryer (FC 49, Lab house, Korea) at 60 ° C for 16 hours to confirm that the weight did not decrease any more, and the dried sample was crushed (HMF-3000S, Hanil, Korea) and then passed through a 40-100 mesh filtration net and stored in a desiccator. The pulverized worms and an aqueous ethanol solution having different concentrations were mixed in a weight ratio of 1:20, put into an ultrasonicator (JAC Ultrasinic, Hwaseng, Korea), and then extracted using ultrasonic waves (40 kHz, 200 W). The extracted extract was subjected to solid-liquid separation (4 °C, 5000 rpm, 3 minutes) using a centrifuge, and only the supernatant was used.

At this time, each extract was obtained by varying the extraction time, extraction temperature, and ethanol concentration of the extraction process.

Comparative Example 1. Hot water extract

ParaJeJu. Ltd. (ParaJeJu. Ltd., Juju, Korea) was mixed with water in a weight ratio of 1:20 and extracted at 80 °C for 20 minutes to obtain a hot water extract of worms.

Comparative Example 2. Ethanol extract

ParaJeJu. Ltd. (ParaJeJu. Ltd., Juju, Korea) was mixed with a 50% by volume aqueous ethanol solution in a weight ratio of 1:20 and extracted at 80° C. for 20 minutes to obtain an ethanol extract of wormwood.

<Test Example>

DPPH scavenging activity, total polyphenols, total flavonoids, tyrosinase inhibition activity (TIA) and collagenase inhibition activity (CIA ) was measured.

The DPPH is a stabilized water-soluble free radical and is a stable compound in an organic solvent, and antioxidants can scavenge free radicals, thereby decolorizing DPPH to yellow. Therefore, it is possible to evaluate the antioxidant efficacy of the sample by measuring the degree of changing the purple color of DPPH to yellow.

In addition, the Tyrosinase is an enzyme that synthesizes a substrate L-tyrosine to 3,4-dihydroxy-L-phenylananine (DOPA), oxidizes L-DOPA to phenylanine-3,4-quinone, and finally synthesizes melanin, It plays a major role in determining whether skin color or pigmentation occurs, and the activity of inhibiting tyrosinase in skin whitening is considered important.

In addition, collagen and elastin form a network structure in the dermal tissue of the skin. In particular, collagen accounts for about 70-80% of the total dry weight of the skin, and when decomposed, the network structure sags, reducing skin elasticity and creating wrinkles cause of Therefore, in order to suppress the generation of wrinkles, it is necessary to minimize the degradation and loss of collagen, and in the functional analysis of skin wrinkle improvement, the activity of inhibiting collagenase, an enzyme that decomposes collagen, is important.

Test Example 1. Measurement of DPPH radical scavenging activity (DSA), total polyphenol content (TPC), and total flavonoid content (TFC)

5 steps of -1.68, -1, 0, 1 and 1.68 for extraction time (X ₁ ), extraction temperature (X ₂ ), and solvent concentration (X ₃ ) using central composite design (CCD) The experimental range was designed by coding with , and experimental values were obtained by testing the following 19 conditions.

1-1. DPPH radical scavenging activity (%): The antioxidant activity was measured by measuring 2,2-diphenyl-1- picrylhydrazyl (DPPH) radical scavenging activity. As a relatively stable free radical, DPPH can be reduced by ascorbic acid, tocopherol, etc. and its antioxidant activity can be measured simply by using the principle that dark purple is discolored. After diluting the sample and mixing 0.25 mL of the diluted sample with 1.25 mL of 0.1 M DPPH, it was stored in the dark at room temperature for 20 minutes, and then absorbance was measured at 517 nm. Ascorbic acid (CAS 50-81-7, Sigma, USA) was used as a control, and the same conditions as the samples were used. The radical scavenging ability was calculated according to the following [Equation 6].

[Equation 6]

Radical scavenging activity (%)=[1-(absorbance of sample / absorbance of control)]X100

1-2. Total polyphenol content (mg GAE/g DM) : It was determined by modifying the Folin-Denis method. To 0.14 mL of the extract obtained under each condition, 0.7 mL of 0.2 N Folin-Ciocalteu solution was added, and the reaction solution was left at room temperature for 8 minutes, then 0.56 mL of 7.5% Na₂CO₃ was added and reacted at room temperature for 1 hour. Then, the absorbance was measured at 765 nm using a spectrophotometer (Optizen 2120UV, KLab. Ltd., DaeJun, Korea), and a calibration curve was prepared using galic acid (Sigma-Aldrich, Minneapolis, USA) as a standard material, and the The TPC content was expressed as mg gallic acid equivalent (GAE)/g dry matter (DM).

1-3. Total flavonoid content (mg QE/g DM): A modified method of Zhishen et al. was used. TFC concentration was measured by measuring absorbance based on the principle that yellow color develops when alkali is applied to flavonoids. After adding 2.5 mL of distilled water and 1.5 mL of 99.5% (v/v) ethanol to 0.5 mL of each sample, 0.1 mL of 1 M potassium acetate and 0.1 mL of 10% aluminum chloride were added, stirred, and left at room temperature for 30 minutes. Absorbance was measured at 415 nm, and a calibration curve was obtained by diluting quercetin (Sigma-Aldrich, Minneapolis, USA) to 25, 50, 100, 200 ug/mL to determine the flavonoid content in mg quercetin equivalent (QE)/g dry matter (DM) indicated as

division extraction time
(min) extraction temperature
(℃) Ethanol concentration (vol%) TPC (mg GAE/g DM) TFC (mg QE/g DM) DPPH scavenging ability (%) Example 1 8.0 34.0 20 11.19 0.17 55.66 Example 2 16.0 34.0 20 4.00 0.11 33.21 Example 3 8.0 68.0 20 10.21 0.14 43.83 Example 4 16.0 68.0 20 8.24 0.16 50.00 Example 5 8.0 34.0 80 1.75 0.30 10.74 Example 6 16.0 34.0 80 1.18 0.23 8.02 Example 7 8.0 68.0 80 2.44 0.38 23.09 Example 8 16.0 68.0 80 2.65 0.36 27.41 Example 9 5.3 51.0 50 7.13 0.20 66.67 Example 10 18.7 51.0 50 7.02 0.21 61.85 Example 11 12.0 22.4 50 2.92 0.08 29.01 Example 12 12.0 79.6 50 13.39 0.30 90.37 Example 13 12.0 51.0 0 12.39 0.02 6.30 Example 14 12.0 51.0 99.5 0.28 0.28 0.74 Example 15 12.0 51.0 50 9.05 0.23 74.94 Example 16 12.0 51.0 50 5.78 0.19 54.94 Example 17 12.0 51.0 50 7.91 0.20 70.49 Comparative Example 1 20.0 80.0 0 2.45 0.01 3.48 Comparative Example 2 20.0 80.0 50 4.11 0.02 5.66

As shown in Table 1 above, the experimental values for the total polyphenol content and DPPH radical scavenging ability confirmed that the extract prepared according to Example 12 was superior to that of other groups, and the experimental values for the total flavonoid content were different from Example 7 It was confirmed that it was superior to the group.

In particular, in Example 13 using purified water (ultrasound), Comparative Example 1 as a hot water extract, and Comparative Example 2 as an ethanol extract, it was confirmed that the total polyphenol content, the total flavonoid content and the DPPH radical scavenging ability were all low.

Test Example 2. Tyrosinase (Tyrosinase) inhibitory effect and collagenase (Collagenase) inhibition Effect measurement

5 steps of -1.68, -1, 0, 1 and 1.68 for extraction time (X ₁ ), extraction temperature (X ₂ ), and solvent concentration (X ₃ ) using central composite design (CCD) The experimental range was designed by coding with , and experimental values were obtained by testing the following 19 conditions.

2-1. Tyrosinase inhibitory ability (%): Tyrosinase is an enzyme that promotes the production of melanin by oxidizing tyrosine in the basal layer of the epidermis. For the experiment, 7 mM sodium phosphate buffer at pH 6.8 was prepared using sodium phosphate monobasic anhydrous and sodium phosphate dibasic anhydrous, and mushroom tyrosinase ( 125 unit) was added and reacted at 25 °C for 30 minutes. After the reaction, absorbance of dopa chrome was measured at a wavelength of 475 nm. As a positive control, kojic acid was used. Tyrosinase inhibitory activity was calculated according to the following [Equation 7].

[Equation 7]

Inhibitory activity (%)=[1-(absorbance of sample / absorbance of control)]X100

2-2. Collagenase inhibitory ability (%): Collagenase is an enzyme that decomposes collagen in the body to cause wrinkle formation and loss of elasticity. The buffer required for the experiment was prepared at pH 7.5 using 1 M Tris(hydroxylmetyl)Aminomethane, 4 mM CaCl ₂ (Calcium chloride), and 1 M HCl, and 4-phenyl azobenzyloxycarbonyl-pro-leu-gly-pro-d- arg and collagenase were prepared. Then, 1.2 mg/ml of 4-phenyl azobenzyloxycarbonyl-pro-leu-gly-pro-d-arg was added to 0.05 mL of the sample, mixed with collagenase, and reacted in a water bath at 37 °C for 30 minutes. After the reaction, 0.25 mL of 20% citric acid was added to stop the collagenase reaction, 1.2 mL of ethyl acetate was added, and the mixture was stirred on a shaker for 10 minutes. After stirring, only the supernatant was measured for absorbance at a wavelength of 320 nm. Ascorbic acid was used as a positive control. Collagenase inhibitory activity was calculated according to the following [Equation 8].

[Equation 8]

Inhibitory activity (%)=[1-(absorbance of sample / absorbance of control)]X100

division extraction time
(min) extraction temperature
(℃) Ethanol concentration (vol%) Tyrosinase inhibitory ability (%) Collagenase inhibitory ability (%) Example 1 8.0 34.0 20 71.2 68.7 Example 2 16.0 34.0 20 66.1 58.3 Example 3 8.0 68.0 20 67.1 93.4 Example 4 16.0 68.0 20 72.4 79.9 Example 5 8.0 34.0 80 75.7 93.7 Example 6 16.0 34.0 80 78.4 90.8 Example 7 8.0 68.0 80 84.7 90.3 Example 8 16.0 68.0 80 80.5 110.3 Example 9 5.3 51.0 50 85.4 89.3 Example 10 18.7 51.0 50 83.9 81.8 Example 11 12.0 22.4 50 74.9 72.4 Example 12 12.0 79.6 50 92.6 94.8 Example 13 12.0 51.0 0 55.3 58.1 Example 14 12.0 51.0 99.5 86.1 88.2 Example 15 12.0 51.0 50 89.8 83.7 Example 16 12.0 51.0 50 83.6 86.9 Example 17 12.0 51.0 50 86.6 88.3 Comparative Example 1 120.0 80.0 50 3.1 18.2 Comparative Example 2 120.0 80.0 50 6.3 22.4

As shown in Table 2 above, the experimental values for the tyrosinase inhibitory ability and the collagenase inhibitory ability confirmed that Example 14 was superior to the other groups.

In particular, it was confirmed that Example 13 using purified water (ultrasound), Comparative Example 1, which is a hot water extract, and Comparative Example 2, which is an ethanol extract, both tyrosinase inhibitory ability and collagenase inhibitory ability were low.

Looking at the experimental values shown in [Table 1] and [Table 2], it was confirmed that Example 12 was the group that was equally excellent in total polyphenol content, total flavonoid content, DPPH radical scavenging ability, tyrosinase inhibitory ability and collagenase inhibitory ability.

Based on the experimental values, a regression equation such as [Equation 1] to [Equation 5] is derived to predict the optimal condition using Design Expert software (V.8.0, State-Ease, Inc, Minneapolis, USA) did

Test Example 3. Search for optimal conditions

division Second order polynomials ^* R ² p Total polyphenol content (mg GAE/g DM) [Equation 1]
Y _TPC =+11.87710-0.27813X ₁ +0.062526X ₂ -0.10999X ₃ -0.038357X ₁ ² +0.011033X ₁ X ₂ -8.04762E-004X ₂ ² +9.16875E-003X ₁ X ₃ -2.72059E-004X ₂ X ₃ -9.82967E-004X ₃ ² 0.8341 0.0430 Total flavonoid content (mg QE/g DM) [Equation 2]
Y _TFC =+0.29505-0.027059X ₁ -3.97311E-003X ₂ +2.06369E-003X ₃ +6.56102E-004X ₁ ² +2.35575E-004X ₁ X ₂ +1.4523E-005X ₂ ² -5.60826E-005X ₁ X ₃ +4.47917E-005X ₂ X ₃ -9.59741E-006X ₃ ² 0.9017 0.0084 DPPH scavenging ability (%) [Equation 3]
Y _DPPH =-12.01377-0.23738X ₁ +1.10578X ₂ +1.88331X ₃ -0.18487X ₁ ² +0.065359X ₁ X ₂ -0.015823X ₂ ² +0.018519X ₁ X ₃ +6.53596E-003X ₂ X ₃ -0.027340X ₃ ² 0.8514 0.0307 Tyrosinase inhibitory ability (%) [Equation 4]
Y _TI =+21.89570+2.31910X ₁ +0.73168X ₂ +0.89582X ₃ -0.10956X ₁ ² +6.37868E-003X ₁ X ₂ -7.16647E-003X ₂ ² -1.71875E-003X ₁ X ₃ +2.17402E-003X ₂ X ₃ -7.54092EX ₃ ² 0.8548 0.0287 Collagenase inhibitory ability (%) [Equation 5]
Y _CI =7.18898+0.47210X ₁ +1.74516X ₂ +1.05430X ₃ -0.20030X ₁ ² +0.036374X ₁ X ₂ -0.013524X ₂ ² +0.042529X ₁ X ₃ -7.41903E-003X ₂ X ₃ -8.53821E- 003X ₃ ² 0.9252 0.0035

3-1. Exploring conditions affecting total polyphenol content (TPC)

The experimental values for the total polyphenol content (TPC) measured according to the conditions derived using the central composite design (CCD), one of the response surface analysis methods, are shown in [Table 1]. The maximum total polyphenol content (TPC) of 19 conditions derived by CCD was Example 12.

When the significance of antioxidant activity was evaluated through analysis of variance (ANOVA) based on the value obtained from the measured value, the R ² value was 0.8341 and the p value was 0.0430, which was significant, so the regression function was suitable model. It was confirmed that

1 is a univariate curve confirming the increase or decrease of total polyphenol content (TPC) according to the change of one independent variable with two independent variables of extraction time, extraction temperature and ethanol concentration fixed at the median value. As a result of confirming the effect on TPC, it was confirmed that the TPC content was greatly affected by changes in ethanol concentration and temperature, and the extraction time had no significant effect on the TPC content.

In order to analyze the interaction effect due to the interaction of the independent variables, the change in the TPC content within the experimental range was visualized as a three-dimensional response surface curve by changing two independent variables at the same time and fixing the other variable to the median value.

As shown in FIG. 2 , it was confirmed that the TPC content increased and then gradually decreased as the extraction time increased, and it was confirmed that the TPC content rapidly decreased as the ethanol concentration increased. In addition, in FIGS. 2a and 2c , as the extraction temperature increased, the TPC content showed a tendency to increase, but the effect on the TPC content was insignificant compared to the ethanol concentration.

3-2. Exploring conditions affecting total flavonoid content (TFC)

Experimental values for total flavonoid content (TFC) measured according to conditions derived using central composite design (CCD), one of the response surface analysis methods, are shown in [Table 1]. The maximum total flavonoid content (TFC) among 19 conditions derived by CCD was Example 7.

When the significance of antioxidant activity was evaluated through Analysis of variance (ANOVA) based on the value obtained from the measured value, the R ² value was 0.9017 and the p value was 0.0084, which was significant, so the regression function was suitable. It was confirmed that The independent variables, extraction temperature ( p = 0.0083) and ethanol concentration ( p = 0.0003) were also confirmed to have high significance, whereas extraction time ( p = 0.5071) was determined to have low significance compared to other conditions. Through this, it was confirmed that the ethanol concentration was a major variable in the TFC yield compared to other conditions.

3 is a univariate curve confirming the increase or decrease of total flavonoid content (TFC) according to the change of one independent variable with two independent variables of extraction time, extraction temperature and ethanol concentration fixed at the median value. TFC yield is ethanol It was confirmed that the concentration was greatly affected.

As a result of schematizing the interrelationship of two independent variables affecting the TFC yield in a three-dimensional graph, it can be seen that the extraction time has no significant effect on TFC as shown in FIGS. 4a and 4b, and in FIGS. 4a and 4c As can be seen, it was confirmed that the TFC yield gradually increased as the extraction temperature increased. The effect of the ethanol concentration on the TFC yield was visualized in FIGS. 4b and 4c, and it was confirmed that the TFC increased proportionally as the concentration increased.

Phenolic compounds are classified into fat-soluble and water-soluble compounds, and it is known that the extracted components vary depending on the extraction solvent. Judging from these results, it seems that the yield of flavonoids increases as the ethanol concentration increases due to the high content of lipid-soluble compounds in the lichen of the present invention.

3-3. Exploration of conditions affecting DPPH radical scavenging capacity (DSA)

Experimental values for DPPH radical scavenging ability (DSA) measured according to conditions derived using central composite design (CCD), one of the response surface analysis methods, are shown in [Table 1]. The maximum DPPH radical scavenging capacity (DSA) among 19 conditions derived by CCD was Example 12.

When the significance of antioxidant activity was evaluated through analysis of variance (ANOVA) based on the value obtained from the measured value, the R ² value was 0.8557 and the p value was 0.0307, which was significant, so the regression function was suitable model. It was confirmed that In evaluating the significance of each independent variable, it was confirmed that the extraction temperature ( p = 0.0463) > ethanol concentration ( p = 0.0757) > extraction time ( p = 0.7073) was affected in the order, so the RSA of the extract I was able to confirm that I received the largest amount.

5 is a univariate curve confirming the increase or decrease of DSA according to the change of one independent variable with two independent variables of extraction time, extraction temperature, and ethanol concentration fixed at the median value. The extraction temperature has the greatest effect on DSA. It has been confirmed that crazy In order to confirm the correlation between the two independent variables, the effect on DSA by changing two independent variables among extraction time, extraction temperature, and ethanol concentration was visualized as a response surface curve (FIG. 6), which was 5), and in FIG. 6a showing the correlation between extraction time and extraction temperature in FIG. 6, it was confirmed that DSA increased as the extraction time increased, and then gradually decreased from around 12 to 15 minutes, The yield increased with the increase of the extraction temperature, but showed a similar tendency to decrease gradually as the extraction time was around 70~80 ℃.

In addition, as shown in FIGS. 6b and 6c, as the ethanol concentration increased, the yield also increased proportionally, and then it was confirmed that the yield decreased sharply from 50% by volume.

3-4. Exploring conditions affecting tyrosinase inhibitory ability

Experimental values for tyrosinase inhibitory ability (TIA) measured according to conditions derived using central composite design (CCD), one of the response surface analysis methods, are shown in [Table 2]. The maximum tyrosinase inhibitory ability among 19 conditions induced by CCD was Example 14.

The significance of this model was verified through analysis of variance (ANOVA), and according to analysis of variance (ANOVA), the coefficient of determination, R2 , which is a measure ^of the fitness of the regression equation, was 0.8548, and the p value was 0.0287, which was recognized as significant. was confirmed to be a suitable model.

7 shows a univariate curve confirming the increase or decrease of tyrosinase inhibitory ability (TIA) according to the change of one independent variable with two independent variables of extraction time, extraction temperature, and ethanol concentration fixed at the median value. At this time, except for one independent variable, two independent variables were fixed at the median value of code 0.

According to FIG. 7, it is a univariate curve confirming the increase or decrease of TIA according to the change of one independent variable with two independent variables of extraction time, extraction temperature, and ethanol concentration fixed at the median value. has been confirmed to have an effect. In order to check the correlation between the two independent variables, the effect on TIA by changing two independent variables among extraction time, extraction temperature and ethanol concentration was visualized as a response surface curve (FIG. 8). As a result, the previous univariate curve (FIG. 7), and in FIG. 8a showing the correlation between the extraction time and the extraction temperature in FIG. 8, it was confirmed that the TIA increased as the extraction time increased, and then gradually decreased from around 12 to 15 minutes, The yield increased with the increase of the extraction temperature, but showed a similar tendency to decrease gradually as the extraction time was around 70~80 ℃.

In addition, as shown in FIGS. 8b and 8c , it was confirmed that the yield also increased proportionally as the ethanol concentration increased, and then rapidly decreased from 50% by volume.

2-3. Exploration of conditions affecting collagenase inhibitory ability

Experimental values for collagenase inhibitory ability (CIA) measured according to conditions derived using central composite design (CCD), one of the response surface analysis methods, are shown in [Table 2]. The maximum collagenase inhibitory ability among 19 conditions induced by CCD was Example 14.

The significance of this model was verified through analysis of variance (ANOVA), and according to analysis of variance (ANOVA), the coefficient of determination, R ² , which is a measure of the fit of the regression equation, was 0.9252, and the p value was 0.0035, which was recognized as significant. was confirmed to be a suitable model.

9 is a univariate curve confirming the increase or decrease of DSA according to the change of one independent variable with two independent variables of extraction time, extraction temperature, and ethanol concentration fixed at the median value. The effect of one independent variable on CAI was shown while fixed at 0.

According to FIG. 9, it is a univariate curve confirming the increase or decrease of CIA according to the change of one independent variable with two independent variables of extraction time, extraction temperature, and ethanol concentration fixed at the median value. has been confirmed to have an effect. In order to confirm the correlation between the two independent variables, the effect on CIA by changing two independent variables among extraction time, extraction temperature, and ethanol concentration was visualized as a response surface curve (Fig. 10). 9), and in FIG. 10a showing the correlation between extraction time and extraction temperature in FIG. 10, it was confirmed that TIA increased as the extraction time increased, and then gradually decreased from around 12 to 15 minutes, The yield increased with the increase of the extraction temperature, but showed a similar tendency to decrease gradually as the extraction time was around 70~80 ℃.

In addition, as shown in FIGS. 10b and 10c , as the ethanol concentration increased, the yield also increased proportionally, and then it was confirmed that the yield decreased sharply from 50% by volume.

2-4. Optimal condition search

11( X ₁ : extraction time, X ₂ : extraction temperature).

At this time, the point where the extraction time and extraction temperature are the lowest in order to secure the optimal point of inhibitory activity of DSA, TPC, TFC, TAI, and CAI while fixing the ethanol concentration among the independent variables, while minimizing the cost during the extraction process to secure economic feasibility was selected as the optimal point. At this time, it was predicted that the optimal extraction conditions for ultrasonic extraction of worms were extracted at an ethanol concentration of 50.0% by volume at a temperature of 81.5°C for 11.0 minutes, and the dependent variable DPPH radical scavenging ability was 90.09%, and the total polyphenol content was 12.02 mg GAE/g. DM, total flavonoid content was 0.22 mg QE/g DM, tyrosinase inhibitory activity was 87.85%, and collagenase inhibitory activity was 91.78%.

As a result of performing the verification experiment under the optimal conditions, the DPPH radical scavenging ability was 90.08%, the total polyphenol content was 13.27 mg GAE/g DM, the total flavonoid content was 0.30 mg QE/g DM, and the tyrosinase inhibitory ability was 87.94% and collagenase Since the inhibitory ability was found to be 91.79%, similar to the predicted value, the reliability of the prediction was confirmed using statistical-based optimization.

Test Example 3. Identification of indicator substances

12 is NMR data obtained by measuring the indicator material of the ultrasonic extract of worms prepared according to Example 12 of the present invention by HPLC.

As shown in FIG. 12 , it was confirmed that the indicator material of the ultrasonic extract of the present invention is nobiletin (nobiletin, peak No. 10, elution time: 7.49 min, m/z: 403.11).

Test Example 4. Confirmation of the expression inhibitory effect of TRP-1, MMP-1 and MMP-9

The inhibitory effect on the expression of TRP-1, MMP-1 and MMP-9 on the ultrasonic extract prepared according to Example 12 of the present invention was confirmed by the reverse transcription-polymerase chain reaction (RT-PCR) method. First, B16F0 cells were inoculated in a 24-well plate at 1x10 ⁶ cells/well, and then treated with 0.25, 0.5, 1.0, and 2.0 μg/mL concentrations of Ultrasonic worm extract for 24 hours. RNA was extracted from the cultured cell line using AccuPrep® Universal RNA Extraction kit (Bioneer, Daejeon, Korea), and cDNA was synthesized from the isolated RNA. The genes of TRP-1, MMP-1 and MMP-9 were amplified using the obtained cDNA as a template, and the β-actin gene was confirmed as an internal control. The primer sequences used at this time are shown in [Table 4] below.

In the case of TRP-1, the amplification process starts at 95.0 °C, 5 minutes (initial denaturation), at 95.0 °C, 5 seconds (denaturation reaction); 60.0 °C, 31 sec (binding reaction); The amplification process consisting of 72.0 °C and 30 seconds (extended reaction) was performed 25 times. The binding reaction temperature was 55.0 ℃, 59 ℃, and 60.4 ℃ for MMP-1, MMP-9 and β-actin, respectively, and each PCR product was electrophoresed on 1.2% agarose gel including gel red, followed by Gel DocTM XR+ System and Quantity One software (Bio-Rad, Hercules, CA, USA) measured and compared the color development intensity.

mRNA Forward (5'-3') Reverse (5'-3') Size (bp) TRP-1 GCTGCAGGAGCCTTCTTTCTC AAGACGCTGCACTGCTGGTCT 268 MMP-1 AACTTTGACACCGTGGCCA CAATGGGCATTGGGTACC 108 MMP-9 AGTTTGGTGTCGCGGAGCAC TACATGAGCGCTTCCGGCAC 754 β-actin AGCACAGAGCCTCGCCTTT CTTAATGTCACGCACGATTTCC 697

13a is a Wiston blot showing the effect of reducing the mRNA expression of TRP-1, MMP-1 and MMP-9, which are major enzymes for melanogenesis and collagen degradation, using the ultrasonic extract of worms prepared according to Example 12 of the present invention; , and FIG. 13B is a graph quantitatively illustrating FIG. 13A.

13A and 13B, after treating the ultrasonic extract of Example 12 with B16F0, a melanoma cell, by concentration, TRP-1, MMP-1 and MMP-, which are major enzymes for melanogenesis and collagen degradation, As a result of evaluating the mRNA expression reduction effect of 9, the extract of Example 12 significantly reduced the expression of TRP-1 as the concentration increased in the 1 mg/mL and 2 mg/mL treatment groups compared to the control group (untreated group) Sikkim was confirmed ( p <0.05).

In addition, it was confirmed that the expression of MMP-1 and MMP-9 by the ultrasonic extract of the worm of Example 12 also decreased in an extract concentration-dependent manner. The expression of MMP-1 showed an expression inhibition of 58.6% in the 2 mg/mL treatment group compared to the control group, and MMP-9 showed an inhibitory ability of 78.8% in the 2 mg/mL treatment group.

Through these results, it was confirmed that the ultrasonic extract of worms extracted under the optimal extraction conditions effectively inhibited the mRNA expression of TRP-1, MMP-1 and MMP-9 in B16F0, thereby inhibiting melanin production and collagen degradation.

Hereinafter, formulation examples of the composition containing the powder of the present invention will be described, but the present invention is not intended to limit the present invention, but merely to describe it in detail.

Formulation Example 1. Preparation of granules

1,000 mg of extract powder obtained in Example 12

appropriate amount of vitamin mixture

70 μg vitamin A acetate

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

0.5 mg of vitamin B6

0.2 μg of vitamin B12

Vitamin C 10 mg

Biotin 10 μg

Nicotinamide 1.7 mg

50 μg of folic acid

Calcium pantothenate 0.5 mg

Mineral mixture appropriate amount

ferrous sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 90 mg

100 mg of calcium carbonate

Magnesium chloride 24.8 mg

The composition ratio of the vitamin and mineral mixture is relatively suitable for granules in a preferred embodiment, but the mixing ratio may be arbitrarily modified. It can be prepared and used in the preparation of a health functional food composition according to a conventional method.

Formulation Example 2. Preparation of functional beverage

1,000 mg of extract powder obtained in Example 12

1,000 mg citric acid

100 g of oligosaccharides

2 g of plum concentrate

1 g taurine

Add purified water to total 900 mL

After mixing the above ingredients according to a conventional health drink manufacturing method, after stirring and heating at 85 ° C for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed and sterilized, then refrigerated. It is used to prepare the functional beverage composition of the present invention.

Although the composition ratio is prepared by mixing ingredients suitable for relatively favorite beverages in a preferred embodiment, the mixing ratio may be arbitrarily modified according to regional and national preferences such as demand class, demanding country, and use.

A preparation example of a cosmetic composition suitable for applying the present invention will be presented.

Preparation example 3: lotion

Table 5 below shows the preparation examples of the lotion among the cosmetics containing the ultrasonic extract of the worm of Example 12.

ingredient content (wt%) Extract of Example 12 5.0 glycerin 6.0 1,3-butylene glycol 3.0 PG 1500 1.0 allantoin 0.1 DL-Panthenol 0.3 EDTA-2Na 0.02 Benzophenone-9 0.04 Sodium Hyaluronate 5.0 ethanol 10.0 Polysorbate 20 0.2 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

Preparation Example 4: Lotion

Table 6 below shows the preparation examples of the lotion in the cosmetic containing the worm worm ultrasonic extract of Example 12.

ingredient content (wt%) Extract of Example 12 3.0 propylene glycol 6.0 glycerin 4.0 triethanolamine 1.2 tocopheryl acetate 3.0 liquid paraffin 5.0 squalane 3.0 Macadamin Nut Oil 2.0 Polysorbate 60 1.5 Sorbitan sesquioleate 1.0 Carboxyvinyl Polymer 1.0 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

Preparation 5: Nourishing Cream

Table 7 below shows a preparation example of a nutritious cream in a cosmetic containing the worm worm ultrasonic extract of Example 12.

ingredient content (wt%) Extract of Example 12 1.0 lipophilic monostearate glycerin 1.5 cetearyl alcohol 1.5 stearic acid 1.0 Polysorbate 60 1.5 Sorbitan Stearate 0.6 Isostearylisostearate 5.0 squalane 5.0 mineral oil 35.0 dimethicone 0.5 Hydroxyethyl Cellulose 0.12 glycerin 6.0 triethanolamine 0.7 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

Preparation Example 6: Essence

Table 8 below shows the preparation examples of the essence in the cosmetic containing the worm worm ultrasonic extract of Example 12.

ingredient content (wt%) Extract of Example 12 1.5 glycerin 10.0 betaine 5.0 PEG 1500 2.0 allantoin 0.1 DL-Panthenol 0.3 EDTA-2Na 0.02 Benzophenone-9 0.04 Hydroxyethyl Cellulose 0.1 Sodium Hyaluronate 8.0 Carboxyvinyl Polymer 0.2 triethanolamine 0.18 Octyldodecanol 0.3 Octyldodeces-16 0.4 ethanol 6.0 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

Preparation Example 7: Emulsion for mask pack

Preparation examples of the emulsion for the mask pack among the cosmetics containing the ultrasonic extract of the worm of Example 12 are shown in Table 9 below.

ingredient content (wt%) Extract of Example 12 1.0 polyvinyl alcohol 15.0 Cellulose Gum 0.15 glycerin 3.0 PEG 1500 2.0 cyclodextrin 0.15 DL-Panthenol 0.4 allantoin 0.1 Monoammonium glycyrrhizinate 0.3 nicotinamide 0.5 ethanol 6.0 PEG 40 hydrogenated castor oil 0.3 preservatives, fragrances, colors a very small amount Distilled water remaining amount Sum 100

Claims (9)

Sargassum thunbergii A cosmetic composition for skin whitening and wrinkle improvement, comprising an ultrasonic extract as an active ingredient. The cosmetic composition according to claim 1, wherein the ultrasonic worm extract is extracted under water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. The cosmetic composition according to claim 2, wherein the mixed solvent is an aqueous solution of 20 to 99.5% by volume of methanol, ethanol, butanol or propanol. [Claim 2] The cosmetic composition according to claim 1, wherein the ultrasonic extract of worms is treated with an ultrasonic wave frequency of 20 to 50 kHz for 5 to 30 minutes. The cosmetic composition according to claim 4, wherein the extraction temperature during the ultrasonic treatment is 20 to 85°C. The cosmetic composition according to claim 1, wherein the indicator material of the ultrasonic extract of the worms is nobiletin. Sargassum thunbergii Health functional food for skin whitening and prevention or alleviation of wrinkles, characterized in that it contains an ultrasonic extract as an active ingredient. (A) Water, an extraction solvent that is a lower alcohol having 1 to 4 carbon atoms or a mixed solvent thereof, extraction temperature of 20 to 85 ° C., extraction time of 5 to 30 minutes under extraction conditions of 20 to 50 kHz frequency ultrasonicator after extraction obtaining an experimental value for the total polyphenol content of the supernatant obtained by centrifugation;
(B) deriving a quadratic regression model represented by the following [Equation 1] using the experimental value of step (A);
(C) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (B), and obtaining a response surface curve for the extraction conditions;
(D) obtaining an experimental value for the total flavonoid content of the supernatant obtained in step (A);
(E) deriving a quadratic regression model represented by the following [Equation 2] using the experimental value of step (D);
(F) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (E), and obtaining a response surface curve for the extraction conditions;
(G) obtaining an experimental value for the DPPH radical scavenging ability of the supernatant obtained in step (A);
(H) deriving a quadratic regression model represented by the following [Equation 3] using the experimental values of the step (G);
(I) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (H), and obtaining a response surface curve for the extraction conditions;
(J) obtaining an experimental value for the tyrosinase inhibitory ability of the supernatant obtained in step (A);
(K) deriving a quadratic regression model represented by the following [Equation 4] using the experimental values of the step (J);
(L) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (K), and obtaining a response surface curve for the extraction conditions;
(M) obtaining an experimental value for the collagenase inhibitory ability of the supernatant obtained in step (A);
(N) deriving a quadratic regression model represented by the following [Equation 5] using the experimental values of the step (M);
(O) verifying reliability by performing analysis of variance (ANOVA) on the quadratic regression model derived in step (M), and obtaining a response surface curve for the extraction conditions; and
(P) Total polyphenol content, total flavonoid content, DPPH radical scavenging ability by superimposing the reaction surface curves obtained in steps (C), (F), (I), (L) and (O) Predicting common optimization conditions for tyrosinase inhibitory activity and collagenase inhibitory activity;
[Equation 1]
Y _TPC =+11.87710-0.27813X ₁ +0.062526X ₂ -0.10999X ₃ -0.038357X ₁ ² +0.011033X ₁ X ₂ -8.04762E-004X ₂ ² +9.16875E-003X ₁ X ₃ -2.72059E-004X ₂ X ₃ -9.82967E-004X ₃ ²
[Equation 2]
Y _TFC =+0.29505-0.027059X ₁ -3.97311E-003X ₂ +2.06369E-003X ₃ +6.56102E-004X ₁ ² +2.35575E-004X ₁ X ₂ +1.4523E-005X ₂ ² -5.60826E-005X ₁ X ₃ +4.47917E-005X ₂ X ₃ -9.59741E-006X ₃ ²
[Equation 3]
Y _DPPH =-12.01377-0.23738X ₁ +1.10578X ₂ +1.88331X ₃ -0.18487X ₁ ² +0.065359X ₁ X ₂ -0.015823X ₂ ² +0.018519X ₁ X ₃ +6.53596E-003X ₂ X ₃ -0.027340X ₃ ²
[Equation 4]
Y _TI =+21.89570+2.31910X ₁ +0.73168X ₂ +0.89582X ₃ -0.10956X ₁ ² +6.37868E-003X ₁ X ₂ -7.16647E-003X ₂ ² -1.71875E-003X ₁ X ₃ +2.17402E-003X ₂ X ₃ -7.54092EX ₃ ²
[Equation 5]
Y _CI =7.18898+0.47210X ₁ +1.74516X ₂ +1.05430X ₃ -0.20030X ₁ ² +0.036374X ₁ X ₂ -0.013524X ₂ ² +0.042529X ₁ X ₃ -7.41903E-003X ₂ X ₃ -8.53821E- 003X ₃ ²
In Equations 1 to 5, Y _TPC is the total polyphenol content (mg GAE/g DM), Y _TFC is the total flavonoid content (mg QE/g DM), Y _DPPH is the DPPH radical scavenging activity predicted value (%), Y _TI is the predicted value of tyrosinase inhibition (%), Y _CI is the predicted value of the inhibition of collagenase (%), X ₁ is the extraction time, X ₂ is the extraction temperature, and X ₃ is the concentration of the extraction solvent. The method according to claim 7, wherein the extraction conditions according to common optimization conditions for the DPPH radical scavenging ability, the total polyphenol content, the total flavonoid content, the tyrosinase inhibitory ability and the collagenase inhibitory ability are: extraction time 11.0 minutes, extraction temperature 81.5° C. and ethanol concentration Method for producing an ultrasonic extract of worms using a response surface analysis method, characterized in that 50% by volume.

Images