KR20210108916A - Compositions for preventing, ameliorating or treating for muscle strengthening, muscle development, muscle differentiation, muscle regeneration or sarcopenia comprising Glycine soja extract as effective component - Google Patents

Abstract

The present invention relates to a composition for strengthening, enhancing, differentiating or regenerating muscle, or preventing, ameliorating or treating sarcopenia comprising Glycine soja extract as an effective component. The Glycine soja extract, an effective component of the present invention, restores cell viability, inhibits the expression of muscle loss-related proteins and genes, increases the expression of muscle proteins, and has the effect of regenerating muscles from an increase in grip strength in an animal model with sciatic nerve injury. Therefore, the composition of the prevent invention can be usefully used in a health functional food or pharmaceutical industry related to muscle disease.

Description

A composition for preventing, improving or treating muscle strength, muscle enhancement, muscle differentiation, muscle regeneration or muscle loss containing Dol bean extract as an active ingredient TECHNICAL FIELD [0002] Compositions for preventing, ameliorating or treating for muscle strengthening, muscle development, muscle differentiation, muscle regeneration or sarcopenia comprising Glycine soja extract as effective component}

The present invention relates to a composition for preventing, improving, or treating muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, comprising a dol bean extract as an active ingredient.

The muscles of our body attach to the bones and perform various functions, such as protecting the bones and maintaining the correct body shape. In addition, muscle promotes calcium influx and increases bone density. However, as the body ages, redistribution of body fat and body protein occurs due to changes in composition, and human muscle gradually decreases after the age of 40, and it is known that at the age of 80, the level of 50% of the maximum muscle mass decreases. Muscle loss in old age is recognized as the most important factor that reduces overall physical function, and as aging progresses, changes in body shape such as muscle and fat content and skeletal distortion are recognized. Globally, it is showing a continuous increase at the level of 30% or more. In addition, if the insulin secretion is abnormal, the energy cannot be properly supplied to the cells, which may cause muscle development disorders, so sarcopenia increases in diabetic patients than in the general population. Muscle loss in old age causes increased arthritis, back pain, and chronic pain, can exacerbate urinary incontinence caused by abdominal obesity, and fracture injuries can increase depression in old age and lead to death. The decline not only harms mental health, but is also linked to geriatric chronic diseases and is a major cause of lowering the quality of life. Since it is closely related to such geriatric chronic diseases, it is possible to suppress the decrease in physical activity due to aging through the prevention, improvement or treatment of muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss.

The global progressive ataxia and muscle weakness treatment market was valued at about $14 billion in 2011, and after that, it is expected to grow at a compound annual growth rate of 94% to reach about $23.5 billion in 2017. As a treatment for muscle loss, increased mitochondrial production, inhibition of muscle protein degradation, and anti-inflammatory drugs have been suggested, but there is no clear therapeutic agent. In addition, it was found that 25-30g of high-quality protein should be consumed for each meal as a dietary method suggested to prevent sarcopenia in the elderly. This means that 4-5 eggs or about 120g of chicken breast must be consumed for each meal, which is difficult for ordinary people in everyday life to practice realistically. Therefore, many people are choosing protein supplements as an alternative recently, but protein supplements cause excessive protein intake, and there is a high possibility of side effects. Moreover, if you have kidney disease, you cannot eat a high-protein diet, and kidney function also decreases with aging.

On the other hand, Dolkong ( Glycine soja ) is a creeping annual plant belonging to the legume family (Zingiberaceae) and has a length of 2m and has brown rough hairs throughout. The leaves are alternate, and the petiole is long and has three leaves. The fruit is 2~3cm, hairy and similar to a bean pod, and the seeds are oval or kidney-like, and slightly flat. Dol-bean is considered to be the origin of soybean (Glycine max), and is currently recognized as edible, but is rarely used for actual food. Most of them grow wild in nature, and because they have strong genes, some are cultivated for research on genetic improvement of soybeans.

Korean Patent No. 1400368 discloses a composition for the prevention and treatment of diabetes and diabetic complications using heat-treated powder or extract of dol bean as an active ingredient in Korean Patent No. 1400368, and Korean Patent Publication No. 2019-0107894 discloses dol bean Although a composition for the prevention and improvement of female menopausal symptoms is disclosed, it is still for the prevention, improvement or treatment of muscle strength, muscle enhancement, muscle differentiation, muscle regeneration or muscle loss containing the dolkong extract of the present invention as an active ingredient No composition has been disclosed.

The present invention has been derived by the above needs, and the present invention provides a composition for preventing, improving, or treating muscle strength, muscle enhancement, muscle differentiation, muscle regeneration or muscle loss, containing Dol soybean extract as an active ingredient, Dol soybean extract, the active ingredient of the present invention, restores cell viability, suppresses the expression of muscle loss-related proteins and genes, as well as increases the expression of muscle proteins, and increases grip strength in an animal model of sciatic nerve injury. By confirming that there is an effect of regenerating muscles, the present invention has been completed.

In order to achieve the above object, the present invention provides a health functional food composition for preventing or improving muscle strength, muscle enhancement, muscle differentiation, muscle regeneration or muscle loss, comprising a dol bean extract or a fermented extract thereof as an active ingredient.

In addition, the present invention provides a health functional food composition for increasing muscle mass or promoting muscle production, comprising a dol bean extract or a fermented extract thereof as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of muscle diseases, comprising a dolphin extract or a fermented extract thereof as an active ingredient.

The present invention relates to a composition for preventing, improving, or treating muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, comprising a dolphin extract as an active ingredient. It has the effect of restoring cell viability, suppressing the expression of muscle loss-related proteins and genes, as well as increasing the expression of muscle proteins, and regenerating muscles from an increase in grip strength in an animal model of sciatic nerve injury.

1 is a result confirming that the cell viability reduced by oxidative stress (A) and dexamethasone (B) induction is restored by the treatment of dolkong ethanol extract and water extract. ### indicates that the cell viability of the oxidative stress group was statistically significantly decreased compared to the normal group (N), p<0.001, and *, **, ***, **** were the results compared to the oxidative stress group. The cell viability of the dolkong extract treatment group of the invention was statistically significantly increased, * is p<0.05, ** is p<0.01, *** is p<0.001, **** is p< It is 0.0001.
Figure 2 shows that the cell proliferation rate reduced by the induction of oxidative stress by the treatment of dolkong ethanol extract (GS), lactic acid bacterium fermented dolkong extract (GS-F), yak soybean ethanol extract (RN) and lactic acid bacterium fermented yak bean extract (RN-F) It is the result of confirming the recovery. ## indicates that the cell proliferation rate of the oxidative stress group was statistically significantly decreased compared to the normal group (N), p<0.01, and ** denotes the oxidative stress group (H ₂ O ₂ ) compared to the ethanol extract of the present invention ( GS), lactobacillus fermented soybean extract (GS-F), comparative example, lactic acid fermented soybean extract (RN-F), and positive control, oxymetholone (OXM) treatment group showed a statistically significant increase in the cell proliferation rate, p <0.01. +++ indicates that the cell proliferation rate of the lactic acid bacterium fermented soybean extract (RN-F) treated group compared to the lactic acid fermented fermented soybean extract (GS-F) treated group was statistically significantly increased, p<0.001.
Figure 3 is a result confirming the creatine kinase (CK) activity according to the treatment of dolkong ethanol extract (GS) and lactobacillus fermented dolphin extract (GS-F). ## indicates that the CK activity of the oxidative stress group was statistically significantly decreased compared to the normal group (N), p<0.01, and ** and *** indicate the ethanol extract of the present invention compared to the oxidative stress group (GS) And that the CK activity of the lactic acid bacterium fermented soybean extract (GS-F) treatment group was significantly increased, ** is p<0.01, *** is p<0.001.
4 is a result of confirming the change in the expression level of myostatin (A) and muscle protein MyoD (B), which is a muscle reduction-related protein according to the treatment of the dolkong extract of the present invention.
5 is a result confirming the change in the mRNA expression levels of MuRF1 (A), Atrogin-1 (B) and myostain (C), which are muscle reduction-related proteins, according to the treatment of the dolkong extract of the present invention. #### indicates that the mRNA expression levels of MuRF1(A), Atrogin-1(B) and myostain(C) in the _{oxidative stress group (H 2} O ₂ ) were statistically significantly increased compared to the normal group (N), p <0.0001, *, **, **** are statistically significant decrease in the mRNA expression levels of MuRF1 (A), Atrogin-1 (B) and myostain (C) in the dolkong extract-treated group of the present invention compared to the oxidative stress group * is p<0.05, ** is p<0.01, and **** is p<0.0001.
6 shows the preparation process for establishing an animal model of sciatic nerve injury and analyzing the grip force test.
7 is a result of confirming the grip force (grip force) according to the administration of dolkong extract in the sciatic nerve injury group. ## indicates that the grip strength of the sciatic nerve injury group (SN) was statistically significantly decreased compared to the normal group (Con), p<0.01, and *, ** indicate the positive control group (Oxyme) and Dolkong extract compared to the sciatic nerve injury group. The grip strength of the administration group (GS-E150, GS-E300) was statistically significantly increased, with * being p<0.05 and ** being p<0.01.
8 is a view showing the contents of TNF-α (A), IL-6 (B) and IL-1β (C) in the serum according to the administration of dolkong extract in the sciatic nerve injury group. #, ##, and ### indicate that the content of TNF-α, IL-6 and IL-1β in the serum of the sciatic nerve injury group (SN) increased statistically significantly compared to the normal group (Con), and # is p<0.05, ## is p<0.01, and ### is p<0.001. *, ** indicate that the content of TNF-α, IL-6, and IL-1β in the serum of the positive control group (Oxyme) and the group administered with Dol soybean extract (GS-E150, GS-E300) was statistically significantly decreased compared to the sciatic nerve injury group that, * is p<0.05, and ** is p<0.01.
9 is a Mallory phosphotungstic acid hematoxylin (PTAH) staining result according to administration of dolkong extract (GS-E150, GS-E300) in the sciatic nerve injury group (SN). Con is the untreated normal group, and Oxymetholone is the oxymetholone-administered group as a positive control.
Figure 10 shows the intramuscular inflammatory factors and important factors (TNF-α, MCP-1, TRPV4 and c-fos) related to muscle production according to the administration of dolkong extract (GS-E150) in the sciatic nerve injury group (SN). Immunofluorescence staining results in muscle tissue. Hoechst stains cell nuclei to confirm that the number of cells in each group is constant.

The present invention relates to a health functional food composition for preventing or improving muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, comprising a dolphin extract or a fermented extract thereof as an active ingredient.

The dolphin extract may be prepared by a method comprising the following steps, but is not limited thereto:

(1) extracting by adding an extraction solvent to the dried stone beans;

(2) centrifuging the extract of step (1); and

(3) drying the centrifuged extract of step (2) to prepare an extract.

The extraction solvent in step (1) _{is preferably selected from water, C 1} to C ₄ lower alcohols or mixtures thereof, more preferably water or ethanol, but is not limited thereto. In the above preparation method, the extraction method may use all conventional methods known in the art, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction. The extraction solvent is preferably added by adding 1 to 20 times the weight of the soybean, more preferably 5 to 15 times, and still more preferably 2 to 5 times. The extraction temperature is preferably 60 ~ 100 ℃, but is not limited thereto. In addition, the extraction time is preferably 15 to 120 minutes, more preferably 20 to 40 minutes, and most preferably 30 minutes, but is not limited thereto. In the step (3), drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, more preferably freeze drying, but not limited thereto.

The fermented extract is preferably a fermented extract by yeast or lactic acid bacteria, and the lactic acid bacteria are not particularly limited, but Lactobacillus plantarum ), Lactobacillus casei ), Lactobacillus acidophilus ( Lactobacilus acidophilies ) or Enterococcus faecium (Enterococcus faecium) is preferred.

In addition, the present invention relates to a health functional food composition for increasing muscle mass or promoting muscle production, comprising a dolphin extract or a fermented extract thereof as an active ingredient.

The health functional food composition is preferably prepared in any one formulation selected from powder, granule, pill, tablet, capsule, candy, syrup and beverage, but is not limited thereto. The health functional food composition of the present invention may be prepared by adding the dolbean extract as it is or by mixing it with other foods or food ingredients, and may be appropriately prepared according to a conventional method. Examples of foods to which the stone bean extract or its fermented extract can be added include caramel, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups , beverages, teas, drinks, alcoholic beverages, and vitamin complexes may be in any one form, and include all health functional foods in a conventional sense. That is, there is no particular limitation on the type of the food. The health functional food composition includes various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavorants, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners , a pH adjuster, a stabilizer, a preservative, glycerin, alcohol, a carbonation agent used in carbonated beverages, and the like. It may also contain pulp for the production of natural fruit juices and vegetable beverages. The above components may be used independently or in combination. In addition, the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, and the natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, dextrin, and cyclo polysaccharides such as dextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The proportion of the natural carbohydrate is not very important, but with respect to 100 g of the composition of the present invention, it is preferably 0.01 to 0.04 g, more preferably 0.02 to 0.03 g, but is not limited thereto. As the sweetener, natural sweeteners such as taumatine and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used.

In addition, the present invention relates to a pharmaceutical composition for the prevention or treatment of muscle diseases comprising a dol soybean extract or a fermented extract thereof as an active ingredient.

The muscle disease is a muscle disease due to decreased muscle function, muscle atrophy, muscle wasting or muscle degeneration, and more preferably, atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia ( cachexia), rigid spinesyndrome, amyotrophic lateral sclerosis, Charcot-Marie-Tooth disease, and sarcopenia but is not limited thereto.

Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in formulation, and include saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, lactose, and water. Cross, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate ate, talc, magnesium stearate and mineral oil, and the like. In addition to the above components, antioxidants, buffers, bacteriostats, diluents, surfactants, binders, lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents or preservatives may be further included. A suitable dosage of the pharmaceutical composition of the present invention may be prescribed variously depending on factors such as formulation method, administration mode, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity of the patient. can The route of administration of the pharmaceutical composition for the prevention or treatment of muscle disease of the present invention may be administered through any generally accepted route as long as it can reach the target tissue. The pharmaceutical composition of the present invention is not particularly limited thereto, but as desired, intramuscular administration, eye drop administration, intraperitoneal administration, intravenous administration, subcutaneous administration, intradermal administration, transdermal patch administration, oral administration, intranasal administration, intrapulmonary administration, It may be administered through a route such as rectal administration, and specifically, it may be administered through a route of intramuscular administration.

Hereinafter, the present invention will be described in more detail using examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited thereto.

Example 1. Preparation of Dolkong Extract

(1) Preparation of Dol soybean Water Extract (GS-W)

15 L of distilled water was added to 1 kg of dol beans collected in Gapcheon-byeon in Daejeon, extracted under reflux at 100° C. for 3 hours, and then filtered. The filtrate was concentrated and dried to obtain 18.1 g of an extract of dolkong water.

(2) Preparation of Dol soybean ethanol extract (GS-E)

15 L of 70% ethanol was added to 1 kg of Glycine soja , extracted under reflux at 85° C. for 3 hours, filtered, and the filtrate was concentrated and dried to obtain 14.1 g of an ethanol extract of Dol-kong.

As a comparative example, 28.3 g of ethanol extract of yak soybean was obtained by preparing an ethanol extract (RN-E) of yak bean ( Rhynchosia nulubilis ) in the same manner as for the preparation of ethanol extract of dolkong.

(3) Manufacture of yeast fermented stone soybean extract

After adding 3 liters of water to 1 kg of dol soybean powder, immersing it for 24 hours, boiling at 100 ° C for 15 minutes and cooling it, homogeneously inoculate finely ground nuruk (traditional yeast from Hwawang ™) in 1% of dol bean powder at 42 ° C. It was fermented for a period of time and then lyophilized. After taking 1 kg of the obtained fermented soybean extract, 15 liters of 70% ethanol was added, followed by reflux extraction at 85° C. for 3 hours, followed by filtration, and the filtrate was concentrated and dried to obtain 17.2 g of fermented fermented soybean extract.

(4) Production of lactic acid bacteria fermented stone soybean extract

After adding 3 liters of water to 1 kg of dolphin powder, immersing it for 24 hours, boiling at 100° C. for 15 minutes and cooling it, Lactobacillus plantarum, a complex lactic acid bacterium (manufacturer: Hannam Bio Co., Ltd.) prepared at ^{1×10 7 cfu/ml (} Lactobacillus plantarum ), Lactobacillus casei ( Lactobacillus casei ), Lactobacillus acidophilies ( Lactobacilus acidophilies ), Enterococcus faecium ( Enterococcus faecium ) Inoculated at a ratio of 0.1% and fermented at 42 ° C. for 72 hours, then freeze-dried did. 1 kg of the obtained fermented lactobacillus lactobacillus extract was added, 15 liters of 70% ethanol was added, and the mixture was extracted under reflux at 85° C. for 3 hours, filtered, and the filtrate was concentrated and dried to obtain 17.8 g of fermented lactobacillus fermented soybean extract.

On the other hand, the lactic acid bacteria fermented soybean ethanol extract was carried out in the same way as the dolkong to obtain 33.1 g.

Example 2. Confirmation of muscle atrophy activity inhibitory activity

( 1) cell culture

Mouse myoblast cell line (C2C12 cell) was purchased from ATCC (Manassas, VA, USA), and the purchased cells were used with 10% fetal bovine serum media (Gibco-BRL). 37° C., 5% CO ₂ Incubated in an incubator. When the cultured cells became 80% confluent, they were differentiated into myotube cells using 2% horse serum media (Gibco-BRL), and then 100, 200, and 400 μg/ml of ethanol extract of Dolkong, Dolkong. Water extract and fermented soybean extract were treated.

(2) induction of muscle atrophy

For 24 hours from the fourth day of differentiation of C2C12 cells, 250 μM hydrogen peroxide (H ₂ O ₂ ) or 100 μM dexamethasone (dexamethasone, DEX, Sigma-Aldrich) was co-treated to induce muscle atrophy.

(3) Evaluation of cell activity recovery ability of muscle cells

C2C12 cells were seeded in a 96-well plate and then cultured to about 80% (confluent) of the plate. Thereafter, cell differentiation was induced by exchanging with DMEM (Gibco) medium containing 2% horse serum, 100 units/ml penicillin, and 100 mg/ml streptomycin, and cultured for 5 days. The medium was changed every 2 days during the differentiation process. DEX (Sigma-Aldrich) was treated to have a final concentration of 100 μM, and at the same time, the dolkong extract obtained in Example 1 was treated to have a final concentration of 100, 200 and 400 μg/ml. After treatment with the dolbean extract and cultured for 24 hours, it was exchanged with a medium containing 10% of CCK8 (Dojindo) solution. After reacting for 2 hours, absorbance was measured at 450 nm to measure cell activity. Each sample was measured three times and the average value was derived.

As a result, as disclosed in FIG. 1 H ₂ O ₂ or Compared to the DEX (Dexamethasone) treatment group, the survival rate of muscle cells was increased in the group treated with ethanol extract (GS-E) and water extract (GS-W).

On the other hand, 100㎍ / ㎖ prepared in Example 1 dolbean ethanol extract (GS), lactic acid bacteria fermented dolbean extract (GS-F), yak soybean ethanol extract (RN), lactic acid bacterium fermented dolphin extract (RN-F) and a positive control group The cell proliferation rate according to the treatment of oxymetholone was confirmed. As a result, as shown in FIG. 2, the cell proliferation rate of the oxidative stress group was statistically significantly decreased compared to the normal group, and compared to the oxidative stress group, the ethanol extract (GS), lactobacillus fermented dolphin extract (GS-F), and the ethanol extract of green soybean (RN), lactic acid bacteria fermented soybean extract (RN-F), and the positive control group, the cell proliferation rate of the treatment group of oxymetholone (oxymetholone) increased, in particular, the lactic acid bacteria fermentation of the present invention compared to the lactic acid bacteria fermented soybean extract (RN-F) It was confirmed that the cell proliferation rate of the dolphin extract (GS-F) treated group was remarkable.

(4) Creatine kinase measurement

Creatine kinase activity, known as an index of myotube formation (muscular differentiation), was measured using a Creatine Kinase Activity Assay Kit (Abcam, AB155901). The treated cells (2×10 ⁶ cells) were washed with cold PBS, treated with refrigerated CK assay buffer to disrupt tissues, and centrifuged at 4° C. for 5 minutes to separate the supernatant. 50 μl supernatant and 50 μl CK enzyme mixture (34 μl CK assay buffer, 2 μl CK enzyme, 2 μl CK Developer, 2 μl ATP, 10 μl CK substrate) were mixed with 200 μg/ml of dolkong ethanol extract (GS) and 200㎍/㎖ of lactic acid bacteria fermented dolphin extract (GS-F), respectively, mixed well, transferred to a 96-well microplate, and absorbance was measured at 450nm.

As a result, as shown in FIG. 3 , _{the creatine kinase activity of the oxidative stress group (H 2} O ₂ ) was significantly reduced compared to the normal group (N), and 200 μg/ml of dolkong ethanol compared to the oxidative stress group Creatine kinase activity was statistically significantly increased in both the extract (GS) treatment group and the lactobacillus fermented soybean extract (GS-F) treatment group of 200 μg/ml.

(5) Inhibition of muscle degradation-related protein expression by Dol soybean extract

Protein expression in C2C12 cells was confirmed by Western blotting. In each well from which the medium was removed, 500 μl of 100 mM Tris-HCl, pH 7.4, 5 mM EDTA, 50 mM sodium pyrophosphate, 50 mM NaF, 100 mM orthovanadate, 1% Triton X-100 , 1mM phenylmethanesulfonyl fluoride (phenylmethanesulfonyl fluoride), 2㎍ / ㎖ aprotinin (aprotinin), 1㎍ / ㎖ pepstatin A (pepstatin A) and 1㎍ / ㎖ containing leupeptin (leupeptin) After adding a lysis buffer and harvesting, centrifugation was performed at 1,300×g and 4° C. for 20 minutes, and then the middle layer was taken and the protein was quantified according to the Bradford method (Bio-Rad). After electrophoresis of 40 μg of protein on SDS polyacrylamide gel, it was transferred to nitrocellulose membranes (Amersham, Buckinghamshire, UK). Thereafter, the membrane was washed by immersion three times at 10-minute intervals using a TBS-T solution, and then blocked using 5% skim milk. After that, the membrane was put in a primary antibody diluted at a ratio of 1:1,000, shaken gently at 4°C, incubated for 12 hours, washed using TBS-T, and the membrane was again diluted with a secondary antibody at a ratio of 1:2,000 was incubated for 60 minutes and washed. In this case, the primary antibody was MyoD (Santa Cruz, sc-377460), myostatin (R&D systems, AF788) and β-actin (Cell signaling Tech. #4967) were used, and the secondary antibody was anti- Rabbit IgG (HRP-linked, Cell singling Tech. #7074) was used. Visualization was performed using the ECL Western Blot Detection Kit (RPN2106, Amersham, Arlington Heights, USA). Quantitation was performed using 1-D Analysis Software (Quantity One 1-D Analysis Software, Bio-Rad).

As a result, as shown in FIG. 4 , myostatin, an intracytoplasmic myogenesis inhibitor, increased in C2C12 cells induced by oxidative stress. It was confirmed that the statin (myostatin) was reduced.

In addition, although the expression level of MyoD was decreased by oxidative stress, it was confirmed that the expression level of MyoD was increased in the experimental group treated with dolkong ethanol extract (GS-E) compared to the oxidative stress group.

(6) Inhibition of muscle degradation-related gene expression by dolkong extract

Inhibitory efficacy of dolkong extract on overexpression of Murf1, Atrogin-1, and myostatin mRNA was evaluated in _{H 2} O _{2 induced muscle loss model.}

In (5) of this Example 2, the experimental group and the control group were washed twice with cold saline (PBS) when 6 hours had elapsed after treatment with the dolkong extract, and then RNA was used with TRIzol agent (Invitrogen). was extracted. Thereafter, cDNA was synthesized using the extracted and quantified RNA of 1 μg/μl and the reverse transcription system (Bio-Rad). For each gene of the synthesized cDNA and Murf1, Atrogin-1, myostatin, and GAPDH, the expression pattern of each gene was measured using pre-designed primers (Table 1) and probes (Bio-Rad). PCR (polymerase chain reaction) reaction and analysis was performed using a rotor-Gene 3000 system (Bio-Rad system;). In order to increase the reliability, each sample was measured three times and the average value was derived.

Mouse primers used for real-time PCR SEQ ID NO: Gene 5' -> 3' order accession No. One GAPDH Forward ACAATGAATACGGCTACAGCAACAG NM_008084 2 Reverse GGTGGTCCAGGGTTTCTTACTCC 3 MuRF-1 Forward ACCTGCTGGTGGAAAACATC NM_001039048 4 Reverse CTACACGTTCCTTGTGCTTC 5 Atrogin-1 Forward GCAAACACTGCCACATTCTCTC NM_026346 6 Reverse GCAGAGTGAAAGGGGAGTTC 7 myostatin Forward ACGCTACCACGGAAACAATC NM_010834.2 8 Reverse AAAGCAACATTTGGGCTTTC

As a result, as shown in FIG. 5 , it was confirmed that the expression levels of MuRF-1, Atrogin-1 and myostatin overexpressed by oxidative stress were statistically significantly decreased by the treatment with the dolkong extract.

Example 3. Confirmation of the effect of reducing muscle pain and inflammatory factors due to sciatic nerve injury according to the administration of dolkong extract

(1) Induction of sciatic nerve injury

Adult SD rats (Sprague-Dawley) weighing about 300 g were used for the animal model, and after acclimatization in the laboratory environment for 5 days while supplying the animal model with solid feed and water, 3 days before sciatic nerve injury Dol soybean extract was orally administered.

After general anesthesia by injecting ketamine hydrochloride (15mg/100g) intraperitoneally, hairs on both thighs are removed, the surgical site is disinfected with 10% betadine solution and 70% ethanol, and then surgery for sciatic nerve injury is performed under aseptic conditions. carried out. The epidermis was incised about 2 cm between the greater trochanter and the knee joint, the gluteal muscle and the popliteal muscle were removed to expose the sciatic nerve. After inducing nerve damage by applying pressure for 30 seconds, the muscles and skin were sutured.

The normal group (con) was operated in the same manner as in the experimental group and the positive control group except that nerve damage was caused by forceps. Normal group (n=6), induction group (SN, n=6), experimental group (GS-E150, 150mg/kg, n=6; GS-E300, 300mg/kg, n=6), positive control group (oxymetholone, n=6) and divided by n=6).

(2) Grip force test

Using an animal model of sciatic nerve injury, a grip strength test was performed to confirm muscle function. As shown in FIG. 6 , a grip strength test was performed 21 days after induction of sciatic nerve injury, and the forelimb grip strength test induced a posture so that the experimental animal could hold it well with both forelimbs, and the rod held by the rat with its forelimbs by grabbing its tail. As a method of measuring the maximum grip force at the moment of missing , a grip strength test was continuously performed on each experimental animal, and the time the rat was holding the bar with its forelimbs was measured.

As a result, as shown in FIG. 7 , the grip strength of the sciatic nerve injury group (SN) was significantly reduced compared to the normal group (Con), and the grip strength of the positive control group (Oxyme) and the group administered with the dolkong extract of the present invention was the sciatic nerve. There was a statistically significant increase compared to the injured group.

(3) changes in inflammatory factors in blood and muscle tissue

As a result of confirming the inflammatory factors TNF-α, IL-6 and IL-1β contents in the blood, the inflammatory factors of the sciatic nerve damage group (SN) compared to the normal group (Con) were statistically significant as shown in FIG. 8 . increased, and the inflammatory factors of the positive control group (Oxyme) and the group administered with the dolkong extract of the present invention were statistically significantly decreased compared to the sciatic nerve injury group. The increased expression of TNF-α in the muscles of the sciatic nerve injury group (SN) was decreased in the positive control group (Oxyme) and the group administered with dolkong extract (GS-E).

(4) PTAH and immunofluorescence staining in muscle

The slides that had been deparaffinized and hydrated were treated with PTAH (phosphotungstic acid hematoxylin) staining solution, stained for 2 hours in a thermostat at 56°C, washed, dehydrated, and then sealed to confirm the shape of muscle fibers and smooth muscle fibers.

As a result, as shown in FIG. 9, PTAH staining showed very different muscle fiber and smooth muscle fiber morphology between the normal group (Con) and the sciatic nerve injury group (SN), but the positive control group (Oxyme) and the The muscle morphology of the dolphin extract administration group (GS-E) was found to be similar to that of the normal group.

Meanwhile, intramuscular inflammatory factors and important factors related to muscle production were subjected to immunofluorescence staining in muscle tissue.

As a result, as shown in FIG. 10 , the expression levels of TNF-α and MCP-1 were increased in the sciatic nerve injury group (SN). ) of TNF-α and MCP-1 expression levels were decreased. In addition, the expression level of TRPV4 and c-fos was decreased in the sciatic nerve injury group (SN), but was increased in the positive control group (Oxyme) and the group administered with the dolkong extract of the present invention (GS-E). confirmed that.

<110> Korea Institute of Oriental Medicine <120> Compositions for preventing, ameliorating or treating for muscle strengthening, muscle development, muscle differentiation, muscle regeneration or sarcopenia comprising Glycine soja extract as effective component <130> PN20240 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-F <400> 1 acaatgaata cggctacagc aacag 25 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-R <400> 2 ggtggtccag ggtttcttac tcc 23 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MuRF-1 F <400> 3 acctgctggt ggaaaacatc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MuRF-1 R <400> 4 ctacacgttc cttgtgcttc 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Atrogin-1 F <400> 5 gcaaacactg ccacattctc tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Atrogin-1 R <400> 6 gcagagtgaa aggggagttc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> myostatin F <400> 7 acgctaccac ggaaacaatc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> myostatin R <400> 8 aaagcaacat ttgggctttc 20

Claims (7)

A health functional food composition for preventing or improving muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, comprising dol bean extract or a fermented extract thereof as an active ingredient. According to claim 1, wherein the extraction solvent of the dolkong extract is water, C ₁ ~ C ₄ Strengthening, muscle enhancement, muscle differentiation, muscle regeneration or muscle reduction, characterized in that any one selected from a lower alcohol and mixtures thereof. A health functional food composition for the prevention or improvement of According to claim 1, wherein the fermented extract is a functional health food composition for preventing or improving muscle strength, muscle enhancement, muscle differentiation, muscle regeneration or muscle loss, characterized in that the fermented extract by yeast or lactic acid bacteria. A health functional food composition for increasing muscle mass or promoting muscle production, comprising dol bean extract or a fermented extract thereof as an active ingredient. A pharmaceutical composition for the prevention or treatment of muscle disease, comprising a dol bean extract or a fermented extract thereof as an active ingredient. [Claim 6] The pharmaceutical composition for preventing or treating muscle disease according to claim 5, wherein the muscle disease is a muscle disease caused by decreased muscle function, muscle atrophy, muscle wasting or muscle degeneration. 7. The method of claim 6, wherein the muscle disease is atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis), Charcot-Marie-Tooth disease (Charcot-Marie-Tooth disease) and muscle atrophy (sarcopenia), characterized in that any one or more selected from the group consisting of a pharmaceutical composition for the prevention or treatment of muscle disease.

Images