KR102623198B1 - Compositions for preventing, ameliorating or treating for muscle strengthening, muscle development, muscle differentiation, muscle regeneration or sarcopenia comprising Glycine soja extract as effective component - Google Patents

Abstract

The present invention relates to a composition for strengthening muscle strength, muscle augmentation, muscle differentiation, muscle regeneration, or preventing or improving muscle loss, containing a soybean extract as an active ingredient. The active ingredient of the present invention, a soybean extract, restores cell viability, Since it not only suppresses the expression of proteins and genes related to muscle loss, but also increases the expression of muscle proteins and has the effect of regenerating muscles from increased grip strength in animal models of sciatic nerve damage, the composition of the present invention is effective in treating muscle diseases. It can be usefully used in related health functional food or pharmaceutical industries.

Description

Compositions for preventing, ameliorating or treating for muscle strengthening, muscle development, muscle differentiation, muscle regeneration containing stone bean extract as an active ingredient or sarcopenia comprising Glycine soja extract as effective component}

The present invention relates to a composition for preventing, improving, or treating muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, containing a soybean extract as an active ingredient.

The muscles in our body are attached to the bones and perform various functions, such as protecting the bones and maintaining the correct body shape. Additionally, muscles promote calcium influx and increase bone density. However, as the body ages, redistribution of body fat and body protein occurs due to changes in composition, and human muscle gradually decreases after the age of 40, and it is known that 50% of maximum muscle mass is reduced by the age of 80. Muscle loss in old age is recognized as the most important factor that reduces overall physical function, and as aging progresses, changes in body shape, including muscle and fat content and skeletal distortion, are recognized. The prevalence of obesity due to muscle loss in old age is Worldwide, it is showing a continuous increase at more than 30%. In addition, if insulin secretion is abnormal, energy cannot be properly supplied to cells, which can cause muscle development problems, so sarcopenia increases in diabetic patients compared to the general population. Muscle loss causes an increase in arthritis, back pain, and chronic pain, and can worsen symptoms of urinary incontinence due to abdominal obesity. Injuries due to fractures can increase depression in old age, which can lead to death. The decline not only harms mental health, but is also linked to chronic geriatric diseases and is a major cause of lowering quality of life. Since it is closely related to such geriatric chronic diseases, the decline in physical activity due to aging can be suppressed through the prevention, improvement, or treatment of muscle strength strengthening, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss.

The global market for treatments for progressive ataxia and muscle weakness recorded approximately $14 billion in 2011, and is expected to grow at a compound annual growth rate of 94% thereafter, reaching approximately $23.5 billion in 2017. Treatments for muscle loss include increasing mitochondrial production, inhibiting muscle protein breakdown, and anti-inflammatory drugs, but there is no clear cure. In addition, the dietary method proposed to prevent sarcopenia in the elderly indicates that 25 to 30 g of high-quality protein should be consumed per meal. This requires consuming 4-5 eggs or about 120g of chicken breast with each meal, which is difficult for the average person in their daily lives to realistically practice. Therefore, many people have recently chosen protein supplements as an alternative, but protein supplements can cause excessive protein intake and have a high possibility of side effects. Moreover, if you have kidney disease, you cannot eat a high-protein diet, and kidney function also decreases with aging, so alternatives other than high-protein intake are needed to prevent sarcopenia.

Meanwhile, Glycine soja is a climbing annual plant belonging to the legume family (Zingiberaceae), is 2m long, and has rough brown hairs all over. The leaves are alternate, the petioles are long and have 3 leaves. The fruit is 2-3 cm long and hairy and similar to a bean pod, and the seeds are oval or kidney-shaped and slightly flat. Rock soybeans are considered to be the origin of soybeans (Glycine max), and are currently recognized as edible, but are rarely actually used for food. Most of them grow naturally in nature, and because they have strong genes, some are cultivated for research on genetic improvement of soybeans.

As for technology related to soybeans, Korean Patent No. 1400368 discloses a composition for the prevention and treatment of diabetes and diabetic complications using heat-treated powder or extract of soybeans as an active ingredient, and Korean Patent Publication No. 2019-0107894 discloses a composition using the heat-treated soybean powder or extract as an active ingredient. Although compositions for preventing and improving female menopausal symptoms have been disclosed, they are still used for preventing, improving or treating muscle strength, muscle enhancement, muscle differentiation, muscle regeneration or muscle loss containing the soybean extract of the present invention as an active ingredient. No composition has been disclosed.

The present invention has been developed in response to the above-mentioned needs, and the present invention provides a composition for preventing, improving or treating muscle strength, muscle enhancement, muscle differentiation, muscle regeneration or muscle loss containing a soybean extract as an active ingredient, The active ingredient of the present invention, the soybean extract, restores cell viability, suppresses the expression of proteins and genes related to muscle loss, increases the expression of muscle proteins, and increases grip strength in an animal model of sciatic nerve damage. The present invention was completed by confirming that it is effective in regenerating muscles.

In order to achieve the above object, the present invention provides a health functional food composition for preventing or improving muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, containing a soybean extract or a fermented extract thereof as an active ingredient.

In addition, the present invention provides a health functional food composition for increasing muscle mass or promoting muscle production, comprising a soybean extract or a fermented extract thereof as an active ingredient.

Additionally, the present invention provides a pharmaceutical composition for the prevention or treatment of muscle disease comprising a soybean extract or a fermented extract thereof as an active ingredient.

The present invention relates to a composition for preventing, improving, or treating muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, containing stone bean extract as an active ingredient. The active ingredients of the present invention, such as stone bean extract and fermented stone bean extract, It restores cell viability, suppresses the expression of proteins and genes related to muscle loss, increases the expression of muscle proteins, and has the effect of regenerating muscles by increasing grip strength in animal models of sciatic nerve damage.

Figure 1 shows the results confirming that the cell survival rate reduced by oxidative stress (A) and dexamethasone (B) induction was recovered by treatment with ethanol extract and water extract of Dakkun. ### indicates a statistically significant decrease in the cell survival rate of the oxidative stress group compared to the normal group (N), p<0.001, and *, **, ***, **** indicate the cell survival rate of the oxidative stress group compared to the oxidative stress group. This means that the cell survival rate of the group treated with the inventive soybean extract was statistically significantly increased, * is p < 0.05, ** is p < 0.01, *** is p < 0.001, and **** is p < It is 0.0001.
Figure 2 shows the cell proliferation rate reduced by oxidative stress induction by treatment with ethanol extract of soybean (GS), ethanol extract of fermented soybean with lactic acid bacteria (GS-F), ethanol extract of medicinal bean (RN), and ethanol extract of fermented soybean with lactic acid bacteria (RN-F). This is the result of confirming recovery. ## indicates a statistically significant decrease in the cell proliferation rate of the oxidative stress group compared to the normal group (N), p < 0.01, and ** indicates the ethanol extract of the radish bean of the present invention compared to the oxidative stress group (H ₂ O ₂ ). GS), the cell proliferation rate of the lactic acid bacteria fermented stone bean extract (GS-F), the comparative example lactic acid bacteria fermented yak bean extract (RN-F), and the positive control group oxymetholone (OXM) treated group showed a statistically significant increase, p It is <0.01. +++ indicates that the cell proliferation rate of the lactic acid bacteria fermented stone bean extract (GS-F) treated group was statistically significantly increased compared to the lactic acid bacteria fermented medicinal bean extract (RN-F) treated group, p<0.001.
Figure 3 shows the results of confirming the creatine kinase (CK) activity according to the treatment of ethanol extract of dried bean (GS) and lactic acid bacteria fermented dried bean extract (GS-F). ## indicates a statistically significant decrease in CK activity in the oxidative stress group compared to the normal group (N), p<0.01, **, *** indicate the ethanol extract (GS) of soybean of the present invention compared to the oxidative stress group. And the CK activity of the lactic acid bacteria-fermented soybean extract (GS-F) treatment group was statistically significantly increased, ** is p < 0.01, and *** is p < 0.001.
Figure 4 shows the results of confirming changes in the expression levels of myostatin (A), a protein related to muscle loss, and muscle protein MyoD (B), according to treatment with the dandelion bean extract of the present invention.
Figure 5 shows the results of confirming changes in the mRNA expression levels of MuRF1 (A), Atrogin-1 (B), and myostain (C), which are proteins related to muscle loss, according to treatment with the dandelion bean extract of the present invention. #### indicates a statistically significant increase in the mRNA expression levels of MuRF1 (A), Atrogin-1 (B), and myostain (C) in the oxidative stress group (H ₂ O ₂ ) compared to the normal group (N), p <0.0001, *, **, **** indicate a statistically significant decrease in the mRNA expression levels of MuRF1 (A), Atrogin-1 (B), and myostain (C) in the group treated with the soybean extract of the present invention compared to the oxidative stress group. That is, * means p<0.05, ** means p<0.01, and **** means p<0.0001.
Figure 6 shows the preparation process for establishing a sciatic nerve injury animal model and analyzing grip strength tests.
Figure 7 shows the results of confirming the grip force according to the administration of the soybean extract in the sciatic nerve injury group. ## indicates a statistically significant decrease in the grip strength of the sciatic nerve injury group (SN) compared to the normal group (Con), which is p<0.01, and *, ** are the positive control group (Oxyme) and soybean extract compared to the sciatic nerve injury group. The grip strength of the administration group (GS-E150, GS-E300) increased statistically significantly, * means p<0.05, ** means p<0.01.
Figure 8 confirms the contents of TNF-α (A), IL-6 (B), and IL-1β (C) in the serum according to administration of the soybean extract in the sciatic nerve injury group. #, ##, ### indicate a statistically significant increase in the content of TNF-α, IL-6, and IL-1β in the serum of the sciatic nerve injury group (SN) compared to the normal group (Con). p<0.05, ## is p<0.01, and ### is p<0.001. *, ** indicate a statistically significant decrease in the contents of TNF-α, IL-6, and IL-1β in the serum of the positive control group (Oxyme) and the stone bean extract administration group (GS-E150, GS-E300) compared to the sciatic nerve injury group. That is, * means p<0.05, and ** means p<0.01.
Figure 9 shows the results of Mallory PTAH (Mallory phosphotungstic acid hematoxylin) staining according to the administration of D. soybean extract (GS-E150, GS-E300) in the sciatic nerve injury group (SN). Con is a normal group that was not treated with anything, and Oxymetholone is a positive control group that is administered oxymetholone.
Figure 10 shows the level of intramuscular inflammatory factors and important factors related to muscle production (TNF-α, MCP-1, TRPV4, and c-fos) following administration of soybean extract (GS-E150) in the sciatic nerve injury group (SN). This is the result of immunofluorescence staining in muscle tissue. Hoechst stains cell nuclei and is used to confirm that the number of cells in each group is constant.

The present invention relates to a health functional food composition for preventing or improving muscle strength, muscle augmentation, muscle differentiation, muscle regeneration, or muscle loss, containing a soybean extract or a fermented extract thereof as an active ingredient.

The soybean extract can be prepared by a method comprising the following steps, but is not limited to this:

(1) Extracting dried soybeans by adding an extraction solvent;

(2) centrifuging the extract of step (1); and

(3) Preparing an extract by drying the centrifuged extract of step (2).

In step (1), the extraction solvent is preferably selected from water, C ₁ -C ₄ lower alcohol, or a mixture thereof, more preferably water or ethanol, but is not limited thereto. In the above manufacturing method, the extraction method can be any conventional method known in the art, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction. The extraction solvent is preferably added at 1 to 20 times the weight of the soybean for extraction, more preferably at 5 to 15 times, and even more preferably at 2 to 5 times. The extraction temperature is preferably 60 to 100°C, but is not limited thereto. In addition, the extraction time is preferably 15 to 120 minutes, more preferably 20 to 40 minutes, and most preferably 30 minutes, but is not limited thereto. In step (3), the drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying, or freeze drying, and more preferably freeze drying, but is not limited thereto.

The fermented extract is preferably a fermented extract by yeast or lactic acid bacteria, and the lactic acid bacteria are not particularly limited, but include Lactobacillus plantarum , Lactobacillus casei , Lactobacillus acidophilus ( Lactobacilus acidophilies ) or Enterococcus faecium are preferred.

In addition, the present invention relates to a health functional food composition for increasing muscle mass or promoting muscle production, comprising a soybean extract or a fermented extract thereof as an active ingredient.

The health functional food composition is preferably manufactured in a dosage form selected from powder, granule, pill, tablet, capsule, candy, syrup and beverage, but is not limited thereto. The health functional food composition of the present invention can be prepared by adding the extract of the soybean extract as is or by mixing it with other foods or food ingredients, and can be prepared appropriately according to conventional methods. Examples of foods to which the stone bean extract or fermented extract thereof can be added include caramel, meat, sausages, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, and various soups. , it may be in any form selected from beverages, teas, drinks, alcoholic beverages, and vitamin complexes, and includes all health functional foods in the conventional sense. That is, there are no particular restrictions on the type of food. The health functional food composition includes various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, and protective colloidal thickeners. , pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Additionally, it may contain pulp for the production of natural fruit juice and vegetable drinks. The above components can be used independently or in combination. In addition, the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, and the natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, dextrins, and cyclosaccharides. These are polysaccharides such as dextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The ratio of the natural carbohydrate is not very important, but is preferably 0.01 to 0.04 g, more preferably 0.02 to 0.03 g, per 100 g of the composition of the present invention, but is not limited thereto. As sweeteners, natural sweeteners such as thaumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame can be used.

Additionally, the present invention relates to a pharmaceutical composition for the prevention or treatment of muscle disease comprising a soybean extract or a fermented extract thereof as an active ingredient.

The muscle disease is a muscle disease caused by decreased muscle function, muscle atrophy, muscle wasting, or muscle degeneration, and is more preferably atony, muscular atrophy, muscular dystrophy, myasthenia gravis, and cachexia ( cachexia, rigid spine syndrome, amyotrophic lateral sclerosis, Charcot-Marie-Tooth disease, and sarcopenia. However, it is not limited to this.

Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in preparation, and include saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, lactose, and water. Cloth, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate. Includes, but is not limited to, nitrite, talc, magnesium stearate, and mineral oil. In addition to the above ingredients, it may further include antioxidants, buffers, bacteriostatic agents, diluents, surfactants, binders, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, or preservatives. The appropriate dosage of the pharmaceutical composition of the present invention may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. You can. The administration route of the pharmaceutical composition for preventing or treating muscle diseases of the present invention may be administered through any generally accepted route as long as it can reach the target tissue. The pharmaceutical composition of the present invention is not particularly limited thereto, but depending on the purpose, intramuscular administration, eye drop administration, intraperitoneal administration, intravenous administration, subcutaneous administration, intradermal administration, transdermal patch administration, oral administration, intranasal administration, intrapulmonary administration, It may be administered through routes such as intrarectal administration, and specifically, may be administered through intramuscular administration.

Hereinafter, the present invention will be described in more detail using examples. These examples are only for illustrating the present invention in more detail, and it is obvious to those skilled in the art that the scope of the present invention is not limited thereto.

Example 1. Preparation of rock bean extract

(1) Preparation of soybean water extract (GS-W)

15 liters of distilled water was added to 1 kg of soybeans collected from Gapcheon Riverside in Daejeon, and the extract was refluxed at 100°C for 3 hours and then filtered. The filtrate was concentrated and dried to obtain 18.1 g of soybean water extract.

(2) Preparation of ethanol extract of soybean (GS-E)

15 liters of 70% ethanol was added to 1 kg of Glycine soja , refluxed and extracted at 85°C for 3 hours, filtered, and the filtrate was concentrated and dried to obtain 14.1 g of Glycine soja ethanol extract.

As a comparative example, 28.3 g of Yakkong ethanol extract was obtained by preparing Rhynchosia nulubilis ethanol extract (RN-E) using the same method as the preparation method for the ethanol extract of Rhynchosia nulubilis.

(3) Manufacture of yeast fermented rock bean extract

Add 3 liters of water to 1kg of rock bean powder, soak for 24 hours, boil at 100℃ for 15 minutes, cool, and homogeneously inoculate finely ground malt (Hwawangsan Traditional Koji™) into the rock bean powder at a 1% ratio and incubate for 72 hours at 42℃. After fermentation for a period of time, it was freeze-dried. 1kg of the obtained fermented rock bean extract was taken, 15 liters of 70% ethanol was added, refluxed and extracted at 85°C for 3 hours, filtered, and the filtrate was concentrated and dried to obtain 17.2 g of yeast fermented rock bean extract.

(4) Production of lactic acid fermented rock soybean extract

Add 3 liters of water to 1 kg of stone bean powder, soak for 24 hours, boil at 100°C for 15 minutes, cool, and incubate with Lactobacillus plantarum (manufactured by Hannam Bio Co., Ltd.), a complex lactic acid bacterium prepared at 1×10 ⁷ cfu/ml. Lactobacillus plantarum , Lactobacillus casei , Lactobacillus acidophilies , and Enterococcus faecium were inoculated at a ratio of 0.1%, fermented at 42°C for 72 hours, and then freeze-dried. did. 1kg of the obtained rock bean lactic acid bacteria fermentation extract was taken, 15 liters of 70% ethanol was added, refluxed at 85°C for 3 hours, filtered, and the filtrate was concentrated and dried to obtain 17.8 g of lactic acid bacteria fermented rock bean extract.

Meanwhile, 33.1 g of ethanol extract of lactic acid bacteria-fermented medicinal soybean was obtained in the same manner as that of stone soybean.

Example 2. Confirmation of muscle atrophy activity inhibition activity

( 1) Cell culture

Mouse myoblast cell line (C2C12 cell) was purchased from ATCC (Manassas, VA, USA), and the purchased cells were grown using 10% fetal bovine serum media (Gibco-BRL). Cultured in a 37°C, 5% CO ₂ incubator. When the cultured cells become 80% confluent, they are differentiated into myotube cells using 2% horse serum media (Gibco-BRL), and then mixed with 100, 200, and 400 μg/ml of ethanol extract of D. soybean and D. soybean. Water extract and fermented soybean extract were treated.

(2) Induction of muscle atrophy

Muscle atrophy was induced by treating C2C12 cells with 250 μM hydrogen peroxide (H ₂ O ₂ ) or 100 μM dexamethasone (DEX, Sigma-Aldrich) for 24 hours from the 4th day of differentiation.

(3) Evaluation of cell activity recovery ability of muscle cells

C2C12 cells were dispensed into a 96-well plate and cultured to about 80% (confluent) of the plate. Afterwards, the medium was replaced with DMEM (Gibco) containing 2% horse serum, 100 units/ml of penicillin, and 100 mg/ml of streptomycin, and cultured for 5 days to induce cell differentiation. During the differentiation process, the medium was changed every two days. DEX (Sigma-Aldrich) was treated to a final concentration of 100 μM, and at the same time, the soybean extract obtained in Example 1 was treated to a final concentration of 100, 200, and 400 μg/ml. After treatment with the soybean extract and culturing for 24 hours, the medium was replaced with a medium containing 10% of CCK8 (Dojindo) solution. After reacting for 2 hours, cell activity was measured by measuring absorbance at 450 nm. Each sample was measured three times and the average value was derived.

As a result, H ₂ O ₂ or Compared to the Dexamethasone (DEX)-treated group, the survival rate of muscle cells increased in the group treated with ethanol extract (GS-E) and water extract (GS-W).

On the other hand, 100㎍/㎖ of ethanol extract of rock bean (GS), lactic acid fermented rock bean extract (GS-F), ethanol extract of medicinal beans (RN), fermented rock bean extract of lactic acid bacteria (RN-F), and positive control group prepared in Example 1. Cell proliferation rate according to treatment with oxymetholone was confirmed. As a result, as shown in Figure 2, the cell proliferation rate of the oxidative stress group compared to the normal group was statistically significantly reduced, and compared to the oxidative stress group, ethanol extract of ginseng bean (GS), ethanol extract of lactic acid bacteria fermented sage bean (GS-F), ethanol extract of yakkong (RN), the cell proliferation rate of the group treated with the lactic acid bacteria fermented medicinal bean extract (RN-F) and the positive control group oxymetholone increased, especially compared to the lactic acid bacteria fermented medicinal bean extract (RN-F) of the present invention. It was confirmed that the cell proliferation rate of the group treated with stone bean extract (GS-F) was significant.

(4) Creatine kinase measurement

Creatine kinase activity, known as an indicator of myotube formation (muscle differentiation), was measured using the Creatine Kinase Activity Assay Kit (Abcam, AB155901). The treated cells (2×10 ⁶ cells) were washed with cold PBS, then treated with refrigerated CK assay buffer to disrupt tissue, and centrifuged at 4°C for 5 minutes to separate the supernatant. 50 μl of supernatant and 50 μl of CK enzyme mixture (34 μl of CK assay buffer, 2 μl of CK enzyme, 2 μl of CK Developer, 2 μl of ATP, 10 μl of CK substrate) were mixed at 200 μg/ml. of ethanol extract (GS) and 200 ㎍/㎖ of lactic acid bacteria fermented rock bean extract (GS-F) were added to each and mixed well, then transferred to a 96-well microplate and the absorbance was measured at 450 nm.

As a result, as shown in Figure 3, the creatine kinase activity of the oxidative stress group (H ₂ O ₂ ) compared to the normal group (N) was statistically significantly decreased, and compared to the oxidative stress group, 200 μg/ml of ethanol There was a statistically significant increase in creatine kinase activity in both the extract (GS) treatment group and the 200 ㎍/㎖ lactic acid bacteria fermented soybean extract (GS-F) treatment group.

(5) Inhibition of protein expression related to muscle breakdown by soybean extract

Protein expression in C2C12 cells was confirmed by Western blotting. After removing the medium, 500㎕ of 100mM Tris-HCl, pH 7.4, 5mM EDTA, 50mM sodium pyrophosphate, 50mM NaF, 100mM orthovanadate, 1% Triton , 1mM phenylmethanesulfonyl fluoride, 2㎍/㎖ aprotinin, 1㎍/㎖ pepstatin A and 1㎍/㎖ leupeptin. After adding lysis buffer and harvesting, centrifugation was performed at 1,300 40 μg of protein was electrophoresed on an SDS polyacrylamide gel and then transferred to nitrocellulose membranes (Amersham, Buckinghamshire, UK). Afterwards, the membrane was washed by immersing it in TBS-T solution three times at 10-minute intervals and then blocked using 5% skim milk. Afterwards, the membrane was added to the primary antibody diluted at a ratio of 1:1,000, incubated for 12 hours with gentle shaking at 4°C, and then washed using TBS-T. The membrane was then added to the secondary antibody diluted at a ratio of 1:2,000. Incubated for 60 minutes and washed. At this time, the primary antibodies used were MyoD (Santa Cruz, sc-377460), myostatin (R&D systems, AF788), and β-actin (Cell signaling Tech. #4967), and the secondary antibodies were anti- Rabbit IgG (HRP-linked, Cell singling Tech. #7074) was used. Visualization was performed using an ECL Western blot detection kit (RPN2106, Amersham, Arlington Heights, USA). Quantification was performed using quantitative 1-D analysis software (Quantity One 1-D Analysis Software, Bio-Rad).

As a result, as shown in Figure 4, myostatin, an inhibitor of myogenesis, increased in the cytoplasm of C2C12 cells induced by oxidative stress, and myostatin was increased in the experimental group treated with ethanol extract of pine bean (GS-E). It was confirmed that statin (myostatin) decreased.

In addition, the expression level of MyoD decreased due to oxidative stress, but it was confirmed that the expression level of MyoD increased in the experimental group treated with ethanol extract of soybean (GS-E) compared to the oxidative stress group.

(6) Inhibition of muscle breakdown-related gene expression by soybean extract

The inhibitory effect of the soybean extract on the overexpression of Murf1, Atrogin-1, and myostatin mRNA in a H ₂ O ₂ induced muscle loss model was evaluated.

In (5) of this Example 2, the experimental group and the control group were washed twice with cold saline solution (PBS) 6 hours after treatment with the soybean extract, and then RNA was incubated with TRIzol reagent (Invitrogen). was extracted. Afterwards, cDNA was synthesized using 1 μg/μl of the extracted and quantified RNA and a reverse transcription system (Bio-Rad). The expression pattern of each gene was measured using pre-designed primers (Table 1) and probes (Bio-Rad) for the synthesized cDNA and genes Murf1, Atrogin-1, myostatin, and GAPDH. PCR (polymerase chain reaction) reaction and analysis were performed using the Rotor-Jin 3000 system (Bio-Rad system). To increase reliability, each sample was measured three times and the average value was derived.

Mouse primers used for real time PCR sequence number Gene 5' -> 3' order Accession No. One GAPDH Forward ACAATGAATACGGCTACAGCAACAG NM_008084 2 Reverse GGTGGTCCAGGGGTTTCTTACTCC 3 MuRF-1 Forward ACCTGCTGGTGGAAAACATC NM_001039048 4 Reverse CTACACGTTCCTTGTGCTTC 5 Atrogin-1 Forward GCAAACACTGCCACATTCTCTC NM_026346 6 Reverse GCAGAGTGAAAGGGGAGTTC 7 myostatin Forward ACGCTACCACGGAAACAATC NM_010834.2 8 Reverse AAAGCAACATTTGGGCTTTC

As a result, as shown in Figure 5, it was confirmed that the expression levels of MuRF-1, Atrogin-1, and myostatin overexpressed by oxidative stress were statistically significantly reduced by treatment with the soybean extract.

Example 3. Confirmation of the effect of reducing muscle pain and inflammatory factors caused by sciatic nerve injury following the administration of stone bean extract

(1) Inducing sciatic nerve injury

The animal model used was an adult SD rat (Sprague-Dawley) weighing approximately 300 g. The animal model was acclimatized for 5 days in a laboratory environment while providing sufficient solid feed and water, and then 3 days prior to sciatic nerve injury. Soybean extract was administered orally.

After administering general anesthesia by intraperitoneally injecting ketamine hydrochloride (15mg/100g), hair on both thighs is removed, the surgical site is disinfected with 10% betadine solution and 70% ethanol, and surgery for sciatic nerve damage is performed under aseptic conditions. carried out. Make an incision of approximately 2cm in the superficial layer between the greater trochanter and the knee joint, dissect the gluteal and hamstring muscles to expose the sciatic nerve, and use forceps with a diameter of 1mm 1cm above the bifurcation of the tibial and common peroneal nerves. After applying pressure for 30 seconds to cause nerve damage, the muscles and skin were sutured.

The normal group (con) underwent surgery in the same manner as the experimental group and positive control group, except that nerve damage was done with forceps. Normal group (n=6), induced group (SN, n=6), experimental group (GS-E150, 150mg/kg, n=6; GS-E300, 300mg/kg, n=6), positive control group (oxymetholone, The study was divided into groups (n=6).

(2) Grip force test

Using an animal model of sciatic nerve injury, a grip strength test was performed to check muscle function. As shown in Figure 6, a grip strength test was conducted 21 days after the sciatic nerve injury was induced. For the forelimb grip strength test, the experimental animal was guided into a posture so that it could hold on well with both forelimbs, and the mouse was held by the tail, holding the bar held by the rat with the forelimbs. A grip strength test was conducted continuously on each experimental animal as a method of measuring the maximum grip strength at the moment of missing the bar, and the time the rat held the bar with its forelimbs was measured.

As a result, as shown in FIG. 7, the grip strength of the sciatic nerve damaged group (SN) was statistically significantly reduced compared to the normal group (Con), and the grip strength of the positive control group (Oxyme) and the group administered the soybean extract of the present invention was lower than the sciatic nerve There was a statistically significant increase compared to the injured group.

(3) Changes in inflammatory factors in blood and muscle tissue

As a result of checking the content of inflammatory factors TNF-α, IL-6, and IL-1β in the blood, as shown in Figure 8, the inflammatory factors in the sciatic nerve injury group (SN) compared to the normal group (Con) were statistically significantly higher. increased, and the inflammatory factors of the positive control group (Oxyme) and the group administered the dandelion bean extract of the present invention decreased statistically significantly compared to the sciatic nerve injury group. The increased expression of TNF-α in the muscles of the sciatic nerve injury group (SN) was decreased in the positive control group (Oxyme) and the soybean extract administration group (GS-E).

(4) PTAH and immunofluorescence staining in muscle

The slides that had gone through the deparaffinization and hydration process were treated with PTAH (phosphotungstic acid hematoxylin) staining solution, stained in a constant temperature bath at 56°C for 2 hours, washed, dehydrated, and encapsulated to confirm the shape of muscle fibers and smooth muscle fibers.

As a result, as shown in Figure 9, PTAH staining was very different in the form of muscle fibers and smooth muscle fibers between the normal group (Con) and the sciatic nerve injury group (SN), but the positive control group (Oxyme) and the sciatic nerve injury group (SN) according to the present invention were very different. The muscle shape of the group administered with the soybean extract (GS-E) was found to be similar to that of the normal group.

Meanwhile, immunofluorescence staining was performed in muscle tissue for intramuscular inflammatory factors and important factors related to muscle creation.

As a result, as shown in Figure 10, the expression levels of TNF-α and MCP-1 were increased in the sciatic nerve injury group (SN), and in contrast, the positive control group (Oxyme) and the group administered the soybean extract of the present invention (GS-E) ), the expression levels of TNF-α and MCP-1 were decreased. In addition, changes in the expression levels of TRPV4 and c-fos were decreased in the sciatic nerve injury group (SN), but increased in the positive control group (Oxyme) and the group administered the dol bean extract of the present invention (GS-E). confirmed.

<110> Korea Institute of Oriental Medicine <120> Compositions for preventing, ameliorating or treating for muscle strengthening, muscle development, muscle differentiation, muscle regeneration or sarcopenia comprising Glycine soja extract as effective component <130> PN20240 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-F <400> 1 acaatgaata cggctacagc aacag 25 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-R <400> 2 ggtggtccag ggtttcttac tcc 23 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223>MuRF-1F <400> 3 acctgctggt ggaaaacatc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MuRF-1 R <400> 4 ctacacgttc cttgtgcttc 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Atrogin-1 F <400> 5 gcaaacactg ccaattctc tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Atrogin-1 R <400> 6 gcagagtgaa aggggagttc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> myostatin F <400> 7 acgctaccac ggaaacaatc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> myostatin R <400> 8 aaagcaacat ttgggctttc 20

Claims (7)

A health functional food composition for preventing or improving muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, containing water or ethanol extract as an active ingredient. delete A health functional food composition for preventing or improving muscle strength, muscle enhancement, muscle differentiation, muscle regeneration, or muscle loss, containing lactic acid fermented soybean water or ethanol extract as an active ingredient. Soybean water or ethanol extract; Or a health functional food composition for increasing muscle mass or promoting muscle production, comprising as an active ingredient: lactic acid bacteria fermented soybean water or ethanol extract. Soybean water or ethanol extract; Or a pharmaceutical composition for the prevention or treatment of muscle diseases caused by decreased muscle function, muscle atrophy, muscle wasting or muscle degeneration, comprising as an active ingredient: lactic acid bacteria-fermented soybean water or ethanol extract. delete The method of claim 5, wherein the muscle disease is atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia, rigid spine syndrome, and amyotrophic lateral sclerosis. A pharmaceutical composition for the prevention or treatment of muscle disease, characterized in that it is at least one selected from the group consisting of lateral sclerosis, Charcot-Marie-Tooth disease, and sarcopenia.