KR20210075469A - Composition for herbicide-resistant gene modified grass dertermination and grass-breed determination and uses thereof - Google Patents

Abstract

The composition for discriminating turf varieties of the present invention includes a primer set for discriminating the varieties of Zoysia japonica and Zoysia matrella and further includes a primer set for discriminating herbicide-resistant genetic modification. Therefore, it is possible to specifically detect Zoysia japonica and Zoysia matrella and at the same time specifically detect herbicide-resistant genetically modified turf. In particular, since it is possible to test the herbicide-resistant genetically modified turf and the derived varieties using the turf as a model, the composition can be used to confirm breeding models. Therefore, the herbicide-resistant turf can be tested qualitatively and by variety.

Description

Composition for herbicide-resistant gene modified grass dertermination and grass-breed determination and uses thereof

The present invention relates to a composition for determining a turf cultivar and herbicide resistance genetic modification, and a use thereof.

Genetically Modified Organism (GMO) is a generic term for organisms that increase productivity by artificially separating and combining useful genes of animals and plants or microorganisms, unlike the development of varieties by conventional crop breeding. In general, in order to increase the productivity of genetically modified crops, genes related to herbicide resistance, insect resistance, disease resistance, cold resistance, etc. are introduced into crops. As a genetically modified (GM) crop, tomatoes were first commercialized in the United States in 1994, and GM corn and soybeans began to be grown in the United States, Canada and Argentina in 1996. After that, many countries around the world began to cultivate GM crops, and as of 2018, the number of countries growing GM crops increased to 26, and the cultivated area was 1.9 million hectares, of which herbicide-resistant crops accounted for 46%. .

On the other hand, for the commercialization of genetically modified crops, environmental risk, human health and food safety evaluation are required, and developers are developing various detection markers in terms of the safety of genetically modified crops. We are developing a test method that can be practically applied to the labeling of crops and foods.

Methods for identifying genetically modified crops include a method of detecting a genetically modified protein and a method of detecting DNA. The protein-based assay method uses an antibody protein that specifically recognizes a protein produced by a transgene, and includes a strip kit and an Enzyme Linked Immunosobent Assay (ELISA). have. However, the amount of protein expression varies depending on the genetically modified crop, and the state of the specimen, that is, in the case of storage or processed products, the protein may be destroyed by treatment such as heating during processing, thereby limiting the assay. The analysis method using DNA is currently the most common as an assay by polymerase chain reaction (PCR), and isolates DNA from a genetically modified variant and detects it using a specific primer having a base complementary to the transgene is the principle

On the other hand, although many genetically modified crops have been commercialized worldwide and many efforts are being made to develop genetically modified crops, there are no commercialized genetically modified crops in Korea. have. For the commercialization of genetically modified crops, it is necessary to submit data containing professional and detailed information on the environmental and human effects and genetic modification according to the use of the genetically modified crop. In the environmental and human safety evaluation review data, it is required to present a detection method that can be tested to secure the safety of genetically modified crops and trace the agricultural products distribution.

Zoysia ( Zoysia ) is an important ground cover plant cultivated all over the world, and is an environmentally friendly plant that is used in various ways in gardens of homes and apartments, school grounds, parks, and cemeteries. Turf functionally has the ability to prevent soil inundation and loss, reduce surface temperature rise, reduce dust and noise, and purify air. Environmentally, it provides emotional stability through landscaping and park construction, and provides a resting space for sports activities and recreation, etc. It is one of the very important genetic resources that are indispensable in our life.

According to data from the Korea Forest Service, the production value of grass belonging to ornamental forest plants is about 34.9 billion won, which is higher than that of wild flowers or bonsai. The turf production area in 2011 was 3,056 ha, an increase of about 17.8% compared to 2001, and the demand for turf is increasing every year with the growth of the turf industry. Although the business scale related to turf is expanding along with such a rapid increase in demand for turf, there are insufficient types of turf to satisfy consumer needs, such as pest resistance, herbicide resistance, shade resistance, and thawing extension. So far, turfgrass has been developed using traditional breeding methods (cross breeding), and traits that cannot be developed with traditional breeding techniques are being developed using molecular biological methods to develop new types of turfgrass.

Accordingly, the present inventors repeated research to find a method for qualitatively detecting herbicide-resistant genetically modified turf by cultivar. As a result, using the primer according to the present invention, it is possible to qualitatively test herbicide-resistant genetically modified turf. The present invention was completed by discovering that not only there is, but also test for each variety is possible.

Korean Patent Publication No. 1997-0021314

SUMMARY OF THE INVENTION An object of the present invention is to provide a primer set for identifying grass varieties including a primer pair consisting of nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

Another object of the present invention is to provide a composition for identifying grass varieties comprising the primer set.

Another object of the present invention is to provide a kit for identifying grass varieties comprising the composition.

Another object of the present invention is to isolate genomic DNA from a grass sample, use the isolated genomic DNA as a template, and perform an amplification reaction using a primer pair consisting of nucleotide sequences of SEQ ID NOs: 1 and 2 to obtain a target sequence It is to provide a method for determining a grass variety comprising the steps of amplifying and detecting the amplification product.

The present inventors prepared a specific primer based on the intrinsic gene and transgene nucleotide sequence of the herbicide-resistance genetically modified turf to develop a method for testing the cultivar of turfgrass and whether or not the herbicide resistance gene was modified. The present invention was completed by confirming that it can be used for star analysis.

In the present invention, it is possible to specifically detect herbicide-resistant genetically modified turfgrass and specifically detect wild grass ( Zoysia japonica ) and golden grass ( Zoysia matrella ), in particular, herbicide-resistant genetically modified turfgrass and derivatives using the same as a model. Since it is possible to test, it can be used to confirm the breeding model. Therefore, herbicide-resistant turfgrass can be tested qualitatively and by cultivar.

In one aspect for achieving the above object, there is provided a primer set for identifying grass varieties comprising a primer pair consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

In the present invention, "grass" is a plant of the genus Zoysia , and the grass variety includes Zoysia japonica or Zoysia matrella .

In an embodiment of the present invention, general grass ( Zoysia japonica ), golden grass ( Zoysia matrella ), herbicide resistance genetically modified turf JG21 (herbicide resistance genetically modified turf of wild grass) and JG21-MJ (a hybrid of JG21 and gold grass) Genomic DNA was isolated, and PCR analysis was performed using a primer pair of a ZJM forward primer (SEQ ID NO: 1) and a ZJM reverse primer (SEQ ID NO: 2) to determine the cultivar of grass.

As a result of the analysis, a specific PCR product with a size of about 359 bp (SEQ ID NO: 4) was found in JG21 and wild grass, and a specific PCR product of about 1,465 bp (SEQ ID NO: 3) in size was confirmed in Geum grass. In addition, two PCR amplification products having a size of 360 bp (SEQ ID NO: 4) and 1,465 bp (SEQ ID NO: 3) were identified in JG21 and JG21-MJ, which is a hybrid of JG21.

That is, the primer pair of ZJM forward primer (SEQ ID NO: 1) and ZJM reverse primer (SEQ ID NO: 2) is wild grass ( Zoysia japonica ), golden grass ( Zoysia matrella ), herbicide resistance genetically modified turf JG21 (herbicide resistance genetically modified turf of wild grass pattern) ) and JG21-MJ (hybrid of JG21 and Geumzanji) confirmed that the endogenous gene was specifically detected, specifically, the gene of SEQ ID NO: 4 (359bp) in the wild grass variety or its hybrids (Wildgrass, JG21, JG21-MJ) was confirmed to detect, and it was confirmed that the gene of SEQ ID NO: 3 (1,465bp) was detected in Geumjandi varieties or hybrids thereof (Geumjandi, JG21-MJ).

Therefore, the primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 of the present invention can be used as a primer set for discrimination of grass varieties. Specifically, it can be used as a composition for identifying varieties of wild grass ( Zoysia japonica ) or golden grass ( Zoysia matrella ).

Specifically, the primer set is capable of detecting the gene of the endogenous gene of SEQ ID NO: 4 (359bp) of a variety of deuljandi (Zoysia japonica) or mobon this, also, Jandi of (Zoysia matrella) or breed them into mobon SEQ ID NO: 3 (1,465 bp), which is an endogenous gene, can be detected.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and serves as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow synthesis of the extension product to begin, and the specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required as well as the conditions of use of the primer, such as temperature and ionic strength. something to do.

In the present invention, the primer may further include a material emitting DNA intercalating fluorescence, phosphorescence, or radioactivity, but is not limited thereto.

The labeling material may be FAM or HEX. When PCR is performed by labeling the 5'-end of the allele-specific primer with FAM or HEX during amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material.

As used herein, the term “primer set” refers to a plurality of primers. In addition, the primer set may further include a container for accommodating the primers. A primer is a nucleotide sequence with a short free 3' hydroxyl group at the end. It means a short nucleotide sequence that can form base pairs with a complementary template and serves as a starting point for template strand copying. . The primer is capable of initiating DNA synthesis in the presence of four nucleosite triphosphates and reagents for polymerization in an appropriate buffer and temperature. The primer may be an oligonucleotide, and the oligonucleotide may comprise a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid, or an insert ( intercalating agent). The primer may be prepared through a chemical synthesis method using a phosphoramidite method, a phosphodiester method, a diethylphosphoramidite method, or the like. In addition, the primer sequence may be modified by means known in the art.

In order to solve the above problems, the present invention provides a composition for identifying a grass variety comprising the primer set in another aspect.

The composition for discrimination of grass varieties of the present invention includes a primer set for discrimination of grass varieties including a primer pair consisting of nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

In the present invention, the description of the grass “primer set” and “grass variety” is the same as described above.

In an embodiment of the present invention, Ubipo forward primer (SEQ ID NO: 5) and Bar reverse primer (SEQ ID NO: 6) were prepared to check whether the herbicide resistance gene was introduced, and the Ubipo forward primer (SEQ ID NO: 5) and Bar reverse primer ( SEQ ID NO: 6) using common grass ( Zoysia japonica ), golden grass ( Zoysia matrella ) and herbicide-resistant genetically modified turf JG21 (herbicide-resistant genetically modified turf of wild grass) and JG21-MJ (a hybrid of JG21 and golden grass) Genomic DNA was isolated from and PCR analysis to identify herbicide-resistant genetically modified varieties.

As a result of the analysis, PCR products were not detected in wild grass and golden grass, which are common grasses, but the gene of SEQ ID NO: 7 (507bp) was detected in herbicide-resistant genetically modified grass (JG21, JG21-MJ). That is, it was confirmed that Ubipo forward primer (SEQ ID NO: 5) and Bar reverse primer (SEQ ID NO: 6) can be used to discriminate herbicide-resistant genetically modified grass.

Therefore, a composition comprising a primer pair consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6 can be used for determining herbicide resistance genetically modified turfgrass.

Therefore, the composition of the present invention further comprises a pair of primers consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, and at the same time may be for discriminating herbicide resistance genetically modified turf.

The primer pair formed by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6 may be for detecting the gene of SEQ ID NO: 7 (507bp).

The "herbicide" of the present invention is a chemical agent used to remove weeds, and there are non-selective herbicides and selective herbicides depending on the scope of application. The non-selective herbicide shows a herbicidal action regardless of the type of plant. For example, there is glufosinate. The selective herbicide has a different herbicidal action depending on the type of plant, and 2,4-D (2,4-dichlorophenoxyacetic acid) shows a selective herbicidal effect on broad-leaved plants.

In the present invention, "herbicide resistance genetically modified turf" refers to a genetically modified turf produced by introducing a gene having herbicide resistance. "Genetically modified turf" generally refers to turfgrass developed to have traits or genes that cannot be exhibited by conventional breeding methods using genetic engineering technology for increased production, distribution, and processing convenience.

The genetically modified grass is a grass resistant to phosphinotricin, the main component of glufosinate, and a phosphinothricin encoding a phosphinotricin acetyltransferase (PAT). An acetyltransferase; PAT) gene or a bialaphos resistance (bar) gene has been introduced.

In order to solve the above problems, the present invention provides a kit for identifying grass varieties comprising the composition in another aspect.

In the present invention, the description of the “composition for identifying grass varieties” is the same as described above.

The kit of the present invention includes a composition for discrimination of grass varieties including a primer pair consisting of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 1. In addition, it may include a composition for identifying grass varieties further comprising a primer pair consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6.

It was confirmed that herbicide resistance genetically modified grass can be discriminated using a primer pair consisting of nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6 in the above-described embodiment, the kit of the present invention is the base of SEQ ID NO: 5 and SEQ ID NO: 5 A composition comprising a primer pair consisting of a sequence may be included, and at the same time, it may be for discriminating herbicide-resistant genetically modified turfgrass.

The kit for discrimination of the present invention may be a kit including essential elements necessary for performing PCR analysis or multiplex-PCR analysis. The kit contains, in addition to each primer set specific for each polynucleotide, a test tube or other suitable container, reaction buffer (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase. , DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. In addition, identification criteria for components or known genes required for electrophoresis that can confirm whether or not the PCR product is amplified may be additionally included in the kit of the present invention.

In addition, the kit of the present invention may further include a user's guide describing optimal conditions for performing the reaction. Handbooks are printed out instructions explaining how to use the kit, eg, how to prepare PCR buffers, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

In another aspect, the present invention provides an amplification reaction using the steps of isolating genomic DNA from a grass sample, using the isolated genomic DNA as a template, and using a pair of primers represented by SEQ ID NOs: 1 and 2 It provides a method for identifying a grass variety comprising the steps of amplifying a target sequence by performing a step and detecting the amplification product.

The discrimination method of the present invention comprises the steps of isolating genomic DNA from a grass sample, using the isolated genomic DNA as a template, and performing an amplification reaction using the primer pair shown in SEQ ID NOs: 1 and 2 to amplify the target sequence. and detecting the amplification product.

It was confirmed that the primer pair consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 in the above-described embodiment specifically detected the gene of SEQ ID NO: 7 (507bp) in grass varieties introduced with the herbicide resistance gene. Using the primer pair consisting of the nucleotide sequences of Nos. 5 and 6, further comprising the step of amplifying the target sequence by performing an amplification reaction, it may be to discriminate the herbicide-resistant genetically modified turf at the same time.

In the present invention, DNA isolation can be performed by a conventional method known in the art. For example, a CRAB method, a phenol/chloroform extraction method, an SDS extraction method, etc. may be used, or a commercially available DNA extraction kit may be used, but is not limited thereto.

The target sequence may be amplified by using the genomic DNA of the isolated grass sample as a template and performing an amplification reaction using one or more primer sets according to an embodiment of the present invention. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, There is strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art.

Among them, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used. PCR can be performed using a PCR reaction mixture containing several components known in the art required for the PCR reaction. The PCR reaction mixture contains genomic DNA extracted from the grass sample to be analyzed and an appropriate amount of DNA polymerase, dNTP, PCR buffer, and water in addition to the primer set provided in the present invention. The PCR buffer includes Tris-HCl (Tris-HCl), MgCl ₂ , KCl, and the like.

In the present invention, detection of the PCR product may be performed through a DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement. As one of the methods for detecting the amplification product, capillary electrophoresis may be performed. Capillary electrophoresis may use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used for gel electrophoresis depending on the size of the amplification product. Most preferably, 6% acrylamide gel electrophoresis can be used. In addition, in the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the primer with Cy-5, Cy-3 or 6-FAM, the target sequence is labeled with a detectable fluorescent labeling material. can be measured using In addition, the radioactive measurement method includes ^{adding a radioisotope such as 32} P or ³⁵ S to the PCR reaction solution during PCR to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter

The composition of the present invention includes a primer set for discriminating grass varieties and a primer set for discriminating herbicide resistance. Therefore, it is possible to specifically detect herbicide-resistant genetically modified turfgrass and specifically detect wild grass ( Zoysia japonica ) and golden grass ( Zoysia matrella ). Therefore, it can be used to confirm the breeding model. Therefore, herbicide-resistant turfgrass can be tested qualitatively and by cultivar.

1 shows ZJM Forward primer (ZJM Forward primer, SEQ ID NO: 1) and ZJM Reverse primer (SEQ ID NO: 2) using the genomic DNA of Geumzan grass (ZM), JG21-MJ, wild grass (ZJ) and JG21 as a template. This is the result of PCR using
FIG. 2 is a result of cloning a band of about 1,465bp detected in Geumjandi and JG21-MJ in FIG. 1 and analyzing the nucleotide sequence.
FIG. 3 is a result of cloning a band of about 359bp detected in wild grass and JG21 in FIG. 1 and analyzing the nucleotide sequence.
Figure 4 shows that the genomic DNA of Zinnia grass (ZM), JG21-MJ, wild grass (ZJ) and JG21 was used as a template, and PCR was performed using Ubipo positive "‡ primer (SEQ ID NO: 5) and Bar reverse primer (SEQ ID NO: 6). It is the result.
5 is a nucleotide sequence analysis result by cloning a band of about 507 bp detected in JG21 and JG21-MJ in FIG. 4 .
6 is a map of the pGPTV-HB plasmid vector used for transformation of wild grass. Specifically, A, a plasmid map, and B, a linear map showing the position and direction of a gene in an easy-to-understand manner.
7 is a schematic diagram of gene confirmation probing without missing genes as a whole in Southern blot analysis. ①, bar DNA; ②, ubiquitin promoter (Pubi) DNA; ③, Arabidopsis rbcS terminator (TArbcS) DNA; ④, hygromycin phosphotransferase (hpt) and nos promoter (Pnos) DNA; DNA containing backbone 1, ori and ParB; DNA containing backbone 2, aadA. B, BamHI. E, EcoRI. H, HindIII. X, XhoI. LB, left border of T-DNA. RB, the right border of T-DNA.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

1. Preparation of primers for identification and detection by grass varieties

Wild grass ( Zoysia japonica ) and golden grass ( Zoysia matrella ) ZJM forward primer (ZJM Forward primer, SEQ ID NO: 1) and ZJM reverse primer (SEQ ID NO: 2) specific to the endogenous gene were prepared. When PCR was performed using the primer pair, it was expected that an amplification product of 359 bp in wild grass and 1,465 bp in amplification would be detected in wild grass.

2. Identification of grass varieties using ZJM forward primer and ZZJM reverse primer

Genomic DNA was isolated from common turfgrass, turfgrass, and herbicide-resistance genetically modified turf, JG21 (herbicide-resistant genetically modified turf of wild turf) and JG21-MJ (a hybrid of JG21 and golden turf), and the ZJM forward/reverse primer set Using PCR was performed to determine the grass varieties.

2.1. Isolation of genomic DNA from plants

Genomic DNA was isolated from common grass (wild grass, golden grass) and herbicide gene-transformed grass (JG21, JG21-MJ). Fresh leaves of each grass were put into a mortar and finely ground with liquid nitrogen, then 1 g of ground plant powder was placed in a 15 ml tube, and genomic DNA was isolated and purified using the Qiagen DNeasy Plant Maxi Kit (Qiagen 68163). The extracted DNA was a DNA solution having an A260/A280 nm value between 1.8 and 2.0 using a NanoDrop Spectrohotometer ND-1000 (NanoDrop Technologies Inc., USA). In addition, each plant genomic DNA was used after constant dilution to a concentration of 20 ng.

2.2. PCR analysis

A PCR reaction was performed using 20 ng of the genomic DNA of each grass isolated above as a template. For a basic PCR reaction, a total of 25 μl per sample, 2.5 μl of 10×PCR buffer (Ampliqon, Herlev, Denmark), 2 μl of dNTP (2.5 mM each, Ampliqon), 1.5 μl of 1.5 mM MgCl2 (Ampliqon), each 10 μM of forward and reverse primers and Taq DNA polymerase were prepared by adding 1.25 units of TEMPase Hot Start DNA polymerase (Ampliqon) to the reaction composition, and Dyad Peltier Thermal cycler (Bio-Rad, Hercules). , USA) using a PCR instrument.

The PCR reaction was carried out under the conditions of step 1 (95° C. 5 min), step 2 (95° C. 30 sec, 58° C. 30 sec, 72° C. 30 sec) 35 repetitions, and step 3 (72° C. 5 min). Each experiment was performed in consideration of NTC (non template control) with the experimental group and other comparative groups. The obtained amplified PCR product was electrophoresed with 1.2% agarose gel and the reaction pattern was analyzed by UV.

2.3. Grass Type Discrimination Analysis

Referring to FIG. 1, PCR using JG21 and wild grass genomic DNA as a template showed a specific PCR product with a size of about 359 bp, and PCR using the genomic DNA of Geum grassland as a template showed a specific PCR product with a size of about 1,465 bp. This was confirmed. In PCR using the genomic DNA of JG21-MJ, a JG21-Golden grass hybrid, as a template, two PCR amplification products with a size of 359 bp and 1,465 bp were identified.

That is, it was confirmed that golden grass or wild grass varieties could be discriminated using the ZJM forward primer (ZJM Forward primer, SEQ ID NO: 1) and ZJM reverse primer (SEQ ID NO: 2).

2.4. PCR product sequencing

Using the pGEMT-easy vector system (Promega), a nucleotide sequence analysis was performed by cloning a band of about 1,465 bp detected in Geumzan grass and JG21-MJ and a band of approximately 359 bp detected in wild grass and JG21. The analysis results are shown in Table 2.

gene base sequence Base sequence of Geumjandi (ZM) and JG21-MJ (1,465bp)
SEQ ID NO:3 gaaacgggtg gcttgagcac cttctcgagg gttgcatcca cgactggacc gacctccgtt 60
gcatcttcgt cgacaacttt caggggacct acacacgccc gcggaactct tgggatctga 120
agagctgcaa gcagcagcct ggtgaatcgc tccgcgacta catccttttc acgcaagtga 180
aacgagctgc ccacgtgagc gacgccgatg tcatcaacgt cttcacctgc gacacgacat 240
ctaaggcgct cgttcacaag ctggggtgta aaaagcctcg gacggcacgc gctcttctca 300
acatcacccc cacattcgcc actagggagg aggctgtcca agccaacttc gaccgggacc 360
ggggcaagga caaggagaag tccaagcccg actgcaaaac tgacaaccgc tctgaccggc 420
actcctatcg caggacgacs gatccggggg cggctcgagc agcaagaaat acaagaacca 480
gcggcaagat aatgagatca tgggcgtcac cgagcaacag cctcgacccc aagcaagaaa 540
gccgactgac cacaacaacc acttcgagaa gatgctcgac aaccctacca tcatccactc 600
gaccctttgt caagcacacc ctttagagac tgccacctga tgcggatgtt cttcaaaggt 660
aacttccgat ccgactcccg tcaacctccg catcctgacc cttctgtgaa ggaagccgag 720
ggcaacgccg acaatgcctt ctccgagccg gaggactgcc tgggtggcct atgagtcacg 780
acgccaccag aagcagacct ggcgaggggt caacatcgct gaccccgcca ttcatatcta 840
cctcaagtgg tcgaaagccc cgatcacctt tgacagatcc gaccatcctg actacatacc 900
ccagccgggg cgcctgcctc tggtgctcga tccgatcatc ggcaccacgc acctcactaa 960
ggtcttcatg gatggcggca gtgccctcaa catcttctac atcgacacct ttaaggccat 1020
gaagctctcg gtgttcggcc tccatccaag ccactcccca ttccacgagg tcattctcta 1080
gattagcgcg atgcccctag gttagattac cctcctggtc accttcggca accacgacaa 1140
cttcaggacc aagaaacgcc ccttcgaggt ggtttatttc gccagcacct accacgccgt 1200
cctcggtcaa ccctgctaca ccaagttcat ggctatcccc ggctacatct acctaaagct 1260
aaagatgcca agacccaagg gcatcatcac tgtggcgtcc cgcttcaagc atgcgctcgc 1320
ctgcgagcag gaaagctttg agctagacgt caccctcgca gggtcggccc agcttgaaga 1380
gatttgaaag accaaggact cggcctcgac cctcaattcc aatccttcaa cctctacgtc 1440
cttcgagcca gcgaacacca ctaga
Base sequence of wild grass (ZJ) and JG21 (359bp)
SEQ ID NO:4 gaaacgggtg gcttgagctt gccagtcgac gaagcgtgga tcgacgtagc cggacgatgg 60
cgcaggcgca accagaccca gtcgcccacc gcgaagctga gcgcccggtg atgcttgtcg 120
tagtggcgct tgtacaccgc ctgtgcctgt tccagccgat agcggacgtc ggcgaggaac 180
tcatcgcgtt cctccatggt cttggccacc gcggcgactc gcgtttcacc cggctcgtat 240
gagcggatgg acggaggatc tcggccatag acgatgcgga atggcgtgtc acggagcgcg 300
gtctggaacg cggtgttgta gacgtactcc gcccacggaa gccagcgaac accactaga

3. Preparation of herbicide-resistance genetically modified grass-specific primers

In the present invention, in order to check whether or not the herbicide resistance gene is modified, JG21, a herbicide-resistant variety of wild grass, and JG21-MJ, a hybrid of Geumgrass, were used. JG21, a wild grass resistant variety, was prepared by transducing wild grass with pGPTV-HB plasmid (FIG. 6). The vector used for transformation was the Agrobacterium-dependent binary plasmid vector pGPTV-HB.

Transgene of JG21 and left and right surrounding nucleotide sequences
Left peripheral sequence (bold) 436 bp, right peripheral sequence (bold) 738 bp and other transgene sequences (4780 bp) Base sequence (5' to 3') gene name GTGGTTGACGACATCTATGGACCACTTAAGTTGTACTGCGATAACGAACCCGCAGTAACATATGCACACAACAATAAATCAAGTGGTGCTGCCAAGCACATTGACATAAAGTACTATGTTGTGAAAGATAAAGTTCGGGATCAAATCATAAGTCTTGAGCATATAAGCACCGCAAAGATGCTAGCGGATCCGCTTACTAAAGGCTTACCACCCAGAGTATTTATTGAACATGTTGCCGGCATGGGTTTAAGGGAAAGCCTGTGACTCCTGAACTAAAAGATGGCTCAAAATGTATAATAACTATTTTAGAACAGAAAAATGTATTGTAGCTGTTAAGTCTATCGGCGATTGACCGTGACGATGAGGCAGTTCTACGTATTAATCTGTAATGAAATGAGTGAAGTTAAAAGTAGTAAAGATAAAAGTAAAAAGTTGA
left
(Left) Surrounding nucleotide sequence
(436 bp) TCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGCGGCCGTCTGGACCGATGGCTGGCTGAGTAGAAGGTAGACCGAGCGCC truncated hpt ORF ATGCCGACCGGGATCCCCTTTCTGGAATATTCAGCGTTGATTATTCTGGAACCCATTTCTATGTGGTCAATGCAAATTTAAGAAATTATTTGCCGACTTAAAAGTTGAGGAACTATTGTTTGAAAGTGAAAATGTTATTCCTATCAGTTTCTCTATAATTATAGTTATCATTTCATTTCATTTTTGCCCTTAGCTCTTTGAAATCTTATTTTTCGTTTAGCTCCTTTAAACAACATTGTGGCTCCTTTAAATTATCCTCATAATTCTTGCTTTTGACTCCCTAGACTAACCAATAAACTCTAATAAAAAAAGAAAAACTTGCTACATTGTTTTAAGAAATTTTGCACATGAAAGCAATCAATCAAACCTCGATATTTAAAGAAAAGTTTATGTAAGGGAGTGTAACCATTTTTCAGATGACATAGCCATTGGAGATTTGGAAAAGGTAGTATATACAGAAAATTCAAATGCATCTTTTAAAATTATAAACATAAAACATGTATTCCAAACCCCTAAGTGGGATATTAAGTCAAGAAATAGCATTACATAAAGCAAGGATCGACAAAGACTGAAATTTGTCAAGCATGAAGTTACTAAATTTTGGAAATTTTGTTTACGTTAAATTTGATCATTGGTTATGCATTAAAAGCTGAAACAGTTATTTAGAAGGAAAAGTAGTTAACGTTCCCAAAAAGTTCTAAATAAAACTAGATTCCAAATGATAATGAAAACGTCGCATCTACTATATGTTTG Arabidopsis rbcS (ArbcS) terminator AAGCTTGCATGCCTGCAGTGCAGCGTGACCCGGTCGTGCCCCTCTCTAGAGATAATGAGCATTGCATGTCTAAGTTATAAAAAATTACCACATATTTTTTTTGTCACACTTGTTTGAAGTGCAGTTTATCTATCTTTATACATATATTTAAACTTTACTCTACGAATAATATAATCTATAGTACTACAATAATATCAGTGTTTTAGAGAATCATATAAATGAACAGTTAGACATGGTCTAAAGGACAATTGAGTATTTTGACAACAGGACTCTACAGTTTTATCTTTTTAGTGTGCATGTGTTCTCCTTTTTTTTTTTGCAAATAGCTTCACCTATATAATACTTCATCCATTTTATTAGTACATCCATTTAGGGTTTAGGGTTAATGGTTTTTATAGACTAATTTTTTTAGTACATCTATTTTATTCTATTTTAGCCTCTAAATTAAGAAAACTAAAACTCTATTTTAGTTTTTTTATTTAATAATTTAGATATAAAATAGAATAAAATAAAGTGACTAAAAATTAAACAAATACCCTTTAAGAAATTAAAAAAACTAAGGAAACATTTTTCTTGTTTCGAGTAGATAATGCCAGCCTGTTAAACGCCGTCGACGAGTCTAACGGACACCAACCAGCGAACCAGCAGCGTCGCGTCGGGCCAAGCGAAGCAGACGGCACGGCATCTCTGTCGCTGCCTCTGGACCCCTCTCGAGAGTTCCGCTCCACCGTTGGACTTGCTCCGCTGTCGGCATCCAGAAATTGCGTGGCGGAGCGGCAGACGTGAGCCGGCACGGCAGGCGGCCTCCTCCTCCTCTCACGGCACGGCAGCTACGGGGGATTCCTTTCCCACCGCTCCTTCGCTTTCCCTTCCTCGCCCGCCGTAATAAATAGACACCCCCTCCACACCCTCTTTCCCCAACCTCGTGTTGTTCGGAGCGCACACACACACAACCAGATCTCCCCCAAATCCACCCGTCGGCACCTCCGCTTCAAGGTAC GCCGCTCGTCCTCCCCCCCCCCCCCTCTCTACCTTCTCTAGATCGGCGTTCCGGTCCATGGTTAGGGCCCGGTAGTTCTACTTCTGTTCATGTTTGTGTTAGATCCGTGTTTGTGTTAGATCCGTGCTGCTAGCGTTCGTACACGGATGCGACCTGTACGTCAGACACGTTCTGATTGCTAACTTGCCAGTGTTTCTCTTTGGGGAATCCTGGGATGGCTCTAGCCGTTCCGCAGACGGGATCGATTTCATGATTTTTTTTGTTTCGTTGCATAGGGTTTGGTTTGCCCTTTTCCTTTATTTCAATATATGCCGTGCACTTGTTTGTCGGGTCATCTTTTCATGCTTTTTTTTGTCTTGGTTGTGATGATGTGGTCTGGTTGGGCGGTCGTTCTAGATCGGAGTAGAATTCTGTTTCAAACTACCTGGTGGATTTATTAATTTTGGATCTGTATGTGTGTGCCATACATATTCATAGTTACGAATTGAAGATGATGGATGGAAATATCGATCTAGGATAGGTATACATGTTGATGCGGGTTTTACTGATGCATATACAGAGATGCTTTTTGTTCGCTTGGTTGTGATGATGTGGTGTGGTTGGGCGGTCGTTCATTCGTTCTAGATCGGAGTAGAATACTGTTTCAAACTACCTGGTGTATTTATTAATTTTGGAACTGTATGTGTGTGTCATACATCTTCATAGTTACGAGTTTAAGATGGATGGAAATATCGATCTAGGATAGGTATACATGTTGATGTGGGTTTTACTGATGCATATACATGATGGCATATGCAGCATCTATTCATATGCTCTAACCTTGAGTACCTATCTATTATAATAAACAAGTATGTTTTATAATTATTTTGATCTTGATATACTTGGATGATGGCATATGCAGCAGCTATATGTGGATTTTTTTAGCCCTGCCTTCATACGCTATTTATTTGCTTGGTACTGTTTCTTTTGTCGATGCTCACCCTGTTGTTTGGTGTTACTT CTGCAGGTCGACTCTAGAGGATCC Maize Ubiquitin promoter ATGAGCCCAGAACGACGCCCGGCCGACATCCGCCGTGCCACCGAGGCGGACATGCCGGCGGTCTGCACCATCGTCAACCACTACATCGAGACAAGCACGGTCAACTTCCGTACCGAGCCGCAGGAACCGCAGGAGTGGACGGACGACCTCGTCCGTCTGCGGGAGCGCTATCCCTGGCTCGTCGCCGAGGTGGACGGCGAGGTCGCCGGCATCGCCTACGCGGGCCCCTGGAAGGCACGCAACGCCTACGACTGGACGGCCGAGTCGACCGTGTACGTCTCCCCCCGCCACCAGCGGACGGGACTGGGCTCCACGCTCTACACCCACCTGCTGAAGTCCCTGGAGGCACAGGGCTTCAAGAGCGTGGTCGCTGTCATCGGGCTGCCCAACGACCCGAGCGTGCGCATGCACGAGGCGCTCGGATATGCCCCCCGCGGCATGCTGCGGGCGGCCGGCTTCAAGCACGGGAACTGGCATGACGTGGGTTTCTGGCAGCTGGACTTCAGCCTGCCGGTACCGCCCCGTCCGGTCCTGCCCGTCACCGAGATCTGA bar ORF ACGGAGTGCGCGTGGCATCGCCCGAGTTGGAGCTGGTACGGGAACTCATCGAACTCAACTGGCATACCCGCAATGGTGAGGTGGAACCGCGGCGGATCGCGTACGACCGTGCCCAGGAGGGGGTACCGAGCTCTCCCCTTTCTGGAATATTCAGCGTTGATTATTCTGGAACCCATTTCTATGTGGTCAATGCAAATTTAAGAAATTATTTGCCGACTTAAAAGTTGAGGAACTATTGTTTGAAAGTGAAAATGTTATTCCTATCAGTTTCTCTATAATTATAGTTATCATTTCATTTCATTTTTGCCCTTAGCTCTTTGAAATCTTATTTTTCGTTTAGCTCCTTTAAACAACATTGTGGCTCCTTTAAATTATCCTCATAATTCTTGCTTTTGACTCCCTAGACTAACCAATAAACTCTAATAAAAAAAGAAAAACTTGCTACATTGTTTTAAGAAATTTTGCACATGAAAGCAATCAATCAAACCTCGATATTTAAAGAAAAGTTTATGTAAGGGAGTGTAACCATTTTTCAGATGACATAGCCATTGGAGATTTGGAAAAGGTAGTATATACAGAAAATTCAAATGCATCTTTTAAAATTATAAACATAAAACATGTATTCCAAACCCCTAAGTGGGATATTAAGTCAAGAAATAGCATTACATAAAGCAAGGATCGACAAAGACTGAAATTTGTCAAGCATGAAGTTACTAAATTTTGGAAATTTTGTTTACGTTAAATTTGATCATTGGTTATGCATTAAAAGCTGAAACAGTTAT Arabidopsis rbcS (ArbcS) terminator TTAGAAGGAAAAGTAGTTAACGTTCCCAAAAAGTTCTAAATAAAACTAGATTCCAAATGATAATGAAAACGTCGCATCTACTATATGTTTGGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGAGCTTGCATGCCGGTCGGCTGAGTGGCTCCTTCAACGTTGCGGTTCTGTCAGTTCCAAACGTAAAACGGCTTGTCCCGCGTCATCGGCGGGGGTCATAACGTGACTCCCTTAATTCTCCGCTCATGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTT vector DNA AAAGCGTCCTTTGTGTTGGATCGATGGGACGAGGGCGACAGCAGAATGCAGTGACCACCACGTGCCGGTCTCTTTCTCTCTTCCGCGCGGCGCCGCAACCCCCGGACGCTTCCCTTCCTTATCCCGTTACGGCCCGGTGACCACAGAACGGGATCACCCGTCCGCGGCATGCGACGATGATGCCGTGGATAGGGAGACACATCACACACAGCGCCGAGGCCCGCAGTCGGATGCCATCGAGTAGGAGGCGTAAAGGCCCTAAAGGCTGAAGGGCCCCCCCCATGCATCACCGGAGACGCAGGCCTGTACCAAGATACTAGTAGAATAGACGATGGTCCAGAGAAGCACGTGCGGCCCATCTTGCATCGCAACTTTGCGGGCCACAATGAACGAGAGAGAGAGAGAGAGAGAGAGGCCTGCAGCTTTCTGAGCTTTCCGGTCATCTGCACCACCTCTTTCTGCGGCTGCTTTATTTTTATTGTTGTGGTATAAACTTTCAAAAGAGATTTTTTTTTCTTTTCGATTCTACCACTAGGTGCTTCATCAGAGCCGCATGGAGGCGAAGCTAGCAGTAGGATGATTACATTACACACGGAGCAAGAGTCATGGTGGCGTCTATACGGTGGAACTGAAATTTCGATTTTTCCTTGATGCCATGGCGCTCGGGCGTGTCCACCTAGCTTCGCCCTGGTCCCTACGTGACCGTGACGAGTGGCTCAGCTCAGTCAAACCGATCTT Right side
(right)
surrounding nucleotide sequence
(738 bp)

The total size of 5,954 bp of the T-DNA region including the left border (LB) and the right border (RB) and 8,045 bp of the backbone region outside the T-DNA is 13,999 bp. The probe for Southern blot analysis was designed to cover the entire gene in the vector including T-DNA and backbone, and was produced centered on the gene (FIG. 7).

Based on the above analysis results, Ubipo forward primer (SEQ ID NO: 5) and Bar reverse primer (SEQ ID NO: 6) that can discriminate herbicide-resistant genetically modified grass were prepared.

4. Confirmation of specificity for herbicide-resistant genetically modified turf

By using the Ubipo forward primer and the Bar reverse primer, PCR analysis of the genes of wild grass, Geum grass, JG21, and JG21-MJ was performed, and the specificity of the genetically modified grass varieties of the Ubipo forward primer and the Bar reverse primer was confirmed. Isolation of genomic genes and PCR analysis were performed in the same manner as described above.

4.1. PCR analysis of Ubipo forward primer and Bar reverse primer

As a result of the PCR in FIG. 4, PCR using the genomic DNA of JG21 and JG21-MJ as a template showed a specific PCR product with a size of about 507 bp, and in the PCR using the genomic DNA of Geum grass and wild grass as a template, PCR amplification products were confirmed. couldn't That is, it was confirmed that Ubipo forward primer and Bar reverse primer can be used for genetic analysis of herbicide resistance genetically modified turfgrass.

4.2. PCR product sequencing

Using the pGEMT-easy vector system (Promega), about 507 bp (SEQ ID NO: 7) of the band detected in JG21 and JG21-MJ was cloned and nucleotide sequence analysis was performed. The nucleotide sequence analysis results are as follows.

gene base sequence Base sequence of JG21 and JG21-MJ (507bp)
SEQ ID NO:7 atccatgagc ccagaacgac gcccggccga catccgccgt gccaccgagg cggacatgcc 60
ggcggtctgc accatcgtca accactacat cgagacaagc acggtcaact tccgtaccga 120
gccgcaggaa ccgcaggagt ggacggacga cctcgtccgt ctgcgggagc gctatccctg 180
gctcgtcgcc gaggtggacg gcgaggtcgc cggcatcgcc tacgcgggcc cctggaaggc 240
acgcaacgcc tacgactgga cggccgagtc gaccgtgtac gtctcccccc gccaccagcg 300
gacgggactg ggctccacgc tctacaccca cctgctgaag tccctggagg cacagggctt 360
caagagcgtg gtcgctgtca tcgggctgcc caacgacccg agcgtgcgca tgcacgaggc 420
gctcggatat gccccccgcg gcatgctgcg ggcggccggc ttcaagcacg ggaactggca 480
tgacgtgggt ttctggcagc tggactt

<110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for herbicide-regiftant gene modified grass dertermination and grass-breed determination and uses thereof <130> DP20190323 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ZJM Forward primer <400> 1 gaaacgggtg gcttgagc 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZJM Reverse primer <400> 2 tctagtggtg ttcgctggct 20 <210> 3 <211> 1465 <212> DNA <213> Zoysia matrella <400> 3 gaaacgggtg gcttgagcac cttctcgagg gttgcatcca cgactggacc gacctccgtt 60 gcatcttcgt cgacaacttt caggggacct acacacgccc gcggaactct tgggatctga 120 agagctgcaa gcagcagcct ggtgaatcgc tccgcgacta catccttttc acgcaagtga 180 aacgagctgc ccacgtgagc gacgccgatg tcatcaacgt cttcacctgc gacacgacat 240 ctaaggcgct cgttcacaag ctggggtgta aaaagcctcg gacggcacgc gctcttctca 300 acatcacccc cacattcgcc actagggagg aggctgtcca agccaacttc gaccgggacc 360 ggggcaagga caaggagaag tccaagcccg actgcaaaac tgacaaccgc tctgaccggc 420 actcctatcg caggacgacs gatccggggg cggctcgagc agcaagaaat acaagaacca 480 gcggcaagat aatgagatca tgggcgtcac cgagcaacag cctcgacccc aagcaagaaa 540 gccgactgac cacaacaacc acttcgagaa gatgctcgac aaccctacca tcatccactc 600 gaccctttgt caagcacacc ctttagagac tgccacctga tgcggatgtt cttcaaaggt 660 aacttccgat ccgactcccg tcaacctccg catcctgacc cttctgtgaa ggaagccgag 720 ggcaacgccg acaatgcctt ctccgagccg gaggactgcc tgggtggcct atgagtcacg 780 acgccaccag aagcagacct ggcgaggggt caacatcgct gaccccgcca ttcatatcta 840 cctcaagtgg tcgaaagccc cgatcacctt tgacagatcc gaccatcctg actacatacc 900 ccagccgggg cgcctgcctc tggtgctcga tccgatcatc ggcaccacgc acctcactaa 960 ggtcttcatg gatggcggca gtgccctcaa catcttctac atcgacacct ttaaggccat 1020 gaagctctcg gtgttcggcc tccatccaag ccactcccca ttccacgagg tcattctcta 1080 gattagcgcg atgcccctag gttagattac cctcctggtc accttcggca accacgacaa 1140 cttcaggacc aagaaacgcc ccttcgaggt ggtttatttc gccagcacct accacgccgt 1200 cctcggtcaa ccctgctaca ccaagttcat ggctatcccc ggctacatct acctaaagct 1260 aaagatgcca agacccaagg gcatcatcac tgtggcgtcc cgcttcaagc atgcgctcgc 1320 ctgcgagcag gaaagctttg agctagacgt caccctcgca gggtcggccc agcttgaaga 1380 gatttgaaag accaaggact cggcctcgac cctcaattcc aatccttcaa cctctacgtc 1440 cttcgagcca gcgaacacca ctaga 1465 <210> 4 <211> 359 <212> DNA <213> Artificial Sequence <220> <223> Zoysia japonica <400> 4 gaaacgggtg gcttgagctt gccagtcgac gaagcgtgga tcgacgtagc cggacgatgg 60 cgcaggcgca accagaccca gtcgcccacc gcgaagctga gcgcccggtg atgcttgtcg 120 tagtggcgct tgtacaccgc ctgtgcctgt tccagccgat agcggacgtc ggcgaggaac 180 tcatcgcgtt cctccatggt cttggccacc gcggcgactc gcgtttcacc cggctcgtat 240 gagcggatgg acggaggatc tcggccatag acgatgcgga atggcgtgtc acggagcgcg 300 gtctggaacg cggtgttgta gacgtactcc gcccacggaa gccagcgaac accactaga 359 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ubipo Forward primer <400> 5 atccatgagc ccagaacgac 20 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Bar reverse primer <400> 6 aagtccagct gccagaaacc cac 23 <210> 7 <211> 507 <212> DNA <213> Artificial Sequence <220> <223> JG21 or JG21-MJ gene <400> 7 atccatgagc ccagaacgac gcccggccga catccgccgt gccaccgagg cggacatgcc 60 ggcggtctgc accatcgtca accactacat cgagacaagc acggtcaact tccgtaccga 120 gccgcaggaa ccgcaggagt ggacggacga cctcgtccgt ctgcgggagc gctatccctg 180 gctcgtcgcc gaggtggacg gcgaggtcgc cggcatcgcc tacgcgggcc cctggaaggc 240 acgcaacgcc tacgactgga cggccgagtc gaccgtgtac gtctcccccc gccaccagcg 300 gacgggactg ggctccacgc tctacaccca cctgctgaag tccctggagg cacagggctt 360 caagagcgtg gtcgctgtca tcgggctgcc caacgacccg agcgtgcgca tgcacgaggc 420 gctcggatat gccccccgcg gcatgctgcg ggcggccggc ttcaagcacg ggaactggca 480 tgacgtgggt ttctggcagc tggactt 507

Claims (8)

A primer set for identifying grass varieties comprising a primer pair consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2. A composition for identifying grass varieties comprising the primer set of claim 1. in paragraph 2
A composition further comprising a primer pair consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6. The composition of claim 3, wherein the composition is for simultaneously discriminating herbicide-resistant genetically modified turf. A kit for identifying grass varieties comprising the composition of claim 2 or 3. The kit of claim 5 , wherein the kit is for simultaneously discriminating herbicide-resistant genetically modified grass. isolating genomic DNA from a grass sample;
using the isolated genomic DNA as a template and amplifying a target sequence by performing an amplification reaction using a primer pair consisting of nucleotide sequences of SEQ ID NOs: 1 and 2; and
detecting the amplification product,
How to identify grass varieties. in paragraph 7
Using the primer pair consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6, the method further comprises the step of amplifying the target sequence by performing an amplification reaction, and at the same time discriminating herbicide-resistant turfgrass.

Images