KR101760057B1 - Primer set for Gangdaok identification and method for identification - Google Patents

Abstract

More particularly, the present invention relates to a primer set for the identification of a variety of potato varieties capable of effectively discriminating potato varieties, protecting potato varieties of strong potatoes and purity of F1 seeds, and more particularly, And a primer set for identifying the above-mentioned varieties of potato varieties.

Description

Technical Field [0001] The present invention relates to a primer set for Gangdao variety identification,

More particularly, the present invention relates to a primer set for discriminating rivers, and more particularly to a primer set for discriminating rivers, and more particularly, to a method for effectively discriminating rivers, Set and a primer set for discriminating the strong beryl species.

Maize ( Zea mays L.) is one of the three major crops cultivated globally and is an important crop in the world, but the feed corn consumed in our country depends on imports from foreign countries. Since the feed corn has a high productivity per unit area and high total digestible nutrients, it is important to cultivate corn that has better yield and quality than any other crop in Korea where the land area is narrow.

In recent years, as the price of imported corn and grains has risen, the import prices of feed and forage have soared, and the difficulties of livestock farmers have been increasing. Therefore, the cultivation of forage crops such as corn has been on the increase. Domestic corn for silage cultivation is more than 70% imported paper such as P3394. Domestic cultivated varieties such as Gwangpyeong Okhwa occupy about 29% of total 265 tons of grain supplied in 2010, 78 tons. In the meantime, domestic corn for feed has been widely distributed in livestock farmers because of its low yield and poor quality. However, in recent years, domestic cultivated varieties such as Gwangpyeong Ok and Gangdaok have been found to be more resistant to collapse than conventional corn for imported silage, and the number of cultivated areas of cultivated cultivars has been increasing as it has been found that not only the quantity of the building but also the feed value are high. However, there has not been developed a method for easily and quickly distinguishing a new kind of fermented corn that has been developed as feed corn, and it has been difficult to measure the purity of F1 seed and to preserve and improve the breed.

On the other hand, DNA-based molecular marker technology today provides useful information for genetic diversity and phylogenetic analysis of plant genetic-breeding studies and conservation and management of plant genetic resources. Among them, SNP (Single Nucleotide Polymorphism) analysis is widely used to analyze the genetic diversity of corn. Molecular markers by SNPs can be effectively used to protect crop varieties in corn breeding studies and many researchers have sought to use corn genetic diversity for evaluation and discrimination.

The present invention relates to a specific primer, a probe and a standard plasmid for qualitative and quantitative analysis of genetically modified agricultural products and a test method using the specific primer, A probe and a standard plasmid that amplify all or a part of the target gene or a region including all or a part of the DNA region of the other expression control region by using the recombinant gene of various strains And a PCR primer set which can be detected and detected.

Conventionally, there has not been developed a method for easily and quickly discriminating the developed new variety Kangdok, and it has been difficult to measure the purity of F1 seed and to preserve and improve the variety.

In order to solve the above-mentioned problems, it is proposed to use a primer set for discriminating a variety of potato varieties capable of effectively discriminating varieties of potato varieties, a variety of potato varieties for protecting potato varieties and a purity of F1 seeds, and a primer set for discriminating potato varieties The purpose of this paper is to provide a useful method for discriminating steel bars.

In order to accomplish the above object, the present invention relates to an IBM 911 primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; And an IBM 1798 primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4.

According to another preferred embodiment of the present invention, the IBM 911 primer set is complementary to the nucleotide sequence of chromosome 4 of the maize B73 standard genome, and the IBM 1798 primer set comprises the maize B73 standard genome It may be complementary to the nucleotide sequence of chromosome 9.

The present invention also provides a method for producing a recombinant maize comprising: (a) isolating genomic DNA from maize; (b) an IBM 911 primer set comprising the genomic DNA isolated in step (a) as a template and comprising SEQ ID NO: 1 and SEQ ID NO: 2; And amplifying the target sequence by performing amplification reaction using the IBM 1798 primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4; And (c) identifying the product amplified in the step (b).

According to a preferred embodiment of the present invention, in step (c), a product having a size of 227 bp among the products amplified using the IBM 911 primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2 is detected; At the same time, when the product amplified using the IBM 1798 primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4 is not detected in a product having a size of 345 bp, it can be determined that the product is a ripe variety.

According to a preferred embodiment of the present invention, the amplification reaction may include annealing at a temperature of 44 to 58 ° C.

According to a preferred embodiment of the present invention, the IBM 911 primer set is complementary to the nucleotide sequence of chromosome 4 of the maize B73 standard genome, and the IBM 1798 primer set comprises 9 of the maize B73 standard genome And may be complementary to the nucleotide sequence of the chromosome No. 1.

Hereinafter, terms of the present invention will be described.

The term "primer" of the present invention is a base sequence having a short free 3 'hydroxyl group and can form a base pair with a complementary template and is used as a starting point for template strand copy Quot; short sequence " The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i.e., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. At this time, the PCR conditions, the lengths of the sense and antisense primers can be modified based on those known in the art.

In addition, the term "nucleotide " of the present invention is a deoxyribonucleotide or ribonucleotide present in single-stranded or double-stranded form and includes analogs of natural nucleotides unless otherwise specifically indicated (Scheit, Nucleotide Analogs, John Wiley , New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

The present invention relates to a method for effectively discriminating a variety of potato varieties using a primer set for discriminating potato varieties capable of effectively discriminating potato varieties, protecting potato varieties of strong potatoes, and purity of F1 seeds, and a primer set for discriminating potato varieties There is an effect of providing a discrimination method.

FIG. 1 is a schematic view showing the preparation of a 3 'end mismatch primer in Example 1. FIG.
Fig. 2 shows the result of searching for a specific reaction primer in Example 1. Fig.
FIG. 3 shows the result of checking the degree of correspondence between the varieties through the selected primers and their parents.
Fig. 4 is an electrophoresis image for selecting a marker for discriminating a variety of potato varieties in which the amplification reaction between the cultivars and the cultivars does not show any nonspecific reaction among the 16 primer combinations.
Fig. 5 shows the cultivars of 50 varieties of corn for fodder.
FIG. 6 is a photograph showing electrophoresis of primers IBM 911 and IBM 1798, which are capable of discriminating a variety of potato varieties, with respect to fifty cultivars of a feed corn.

Hereinafter, the present invention will be described in more detail.

As described above, there has not been developed a method for easily and quickly discriminating a new variety of fermented corn that has been developed with feed corn, and it has been difficult to measure the purity of F1 seed and to preserve and improve the breed.

Accordingly, the present invention relates to an IBM 911 primer set comprising SEQ ID NO: 1 and SEQ ID NO: 2; And an IBM 1798 primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, to solve the above-mentioned problem.

Through this, a primer set for identification of a variety of potato varieties capable of effectively discriminating the variety of potato varieties, a variety of potato varieties, and the purity of F1 seeds can be effectively identified, and a primer set for discriminating potato varieties It is effective to provide a useful discrimination method.

Preferably, the IBM 911 primer set is complementary to the nucleotide sequence of chromosome 4 of the maize B73 standard genome, while the nucleotide is not particularly limited as long as it is complementary to some or all of the corn B73 standard genome, The IBM 1798 primer set may be complementary to the nucleotide sequence of chromosome 9 of the maize B73 standard genome.

The corn B73 standard genome is described in 2011 by Ganal et al. (Ganal et al., 2011. PloS ONE 6: e28334) and is described on the MaizeGDB website (http://www.maizegdb.org/sequence.php) Lt; / RTI >

The "complement" means that the nucleotide and all or some of the chromosome are specifically bound.

The "corn B73 standard genome" is a polymorphic sequence comprising a polymorphic site. A polymorphic sequence means a sequence comprising a polymorphic site comprising a SNP in a polynucleotide sequence. The polynucleotide sequence may be DNA or RNA.

Wherein the primer comprises an IBM 911 primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; And an IBM 1798 primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, it is possible to use an appropriate primer set in the appropriate buffer (for example, four different nucleoside triphosphates and DNA, RNA polymerase or reverse transcriptase , And a single-stranded oligonucleotide capable of acting as a starting point of template-directed DNA synthesis under appropriate temperature. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15-30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template.

The primer sequence need not be completely complementary to the SNP marker, but should be sufficiently complementary to hybridize with the maize B73 standard genome.

The primers can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

(A) isolating genomic DNA from maize; (b) an IBM 911 primer set comprising the genomic DNA isolated in step (a) as a template and comprising SEQ ID NO: 1 and SEQ ID NO: 2; And amplifying the target sequence by performing amplification reaction using the IBM 1798 primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4; And (c) identifying the product amplified in step (b); The method comprising the steps of:

First, genomic DNA is isolated from corn.

As a method for isolating genomic DNA from corn, a method known in the art can be used. For example, a CTAB method can be used, a wizard prep kit (Promega) can be used, and Dellaporta et al. , 1983. Plant Mol. Biol., Rep. 1: 19-211983).

Further, the corn is not particularly limited as long as it uses some or all of the corn plants, but preferably at least one of the roots, stems, leaves and fruits of the corn can be used.

Next, using the separated genomic DNA as a template, the IBM 911 primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; And the IBM 1798 primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4 is amplified to amplify the target sequence.

The method of amplifying the target nucleic acid is not particularly limited as long as it is a method for amplifying a nucleic acid sequence, and examples thereof include a polymerase chain reaction (PCR), a ligase chain reaction, a nucleic acid sequence- acid sequence-based amplification, a transcription-based amplification system, a strand displacement amplification or an amplification through a Q [beta] replicase, or any amplification of nucleic acid molecules known in the art Other methods can be used, and preferably PCR can be performed.

The PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In addition, the amplification reaction is not particularly limited as long as the amplification reaction is usually used for nucleic acid sequence amplification. Preferably, the amplification reaction may include annealing at a temperature of 44 to 58 ° C, more preferably 47 to 55 ° C RTI ID = 0.0 > of < / RTI >

The annealing temperature can be determined specifically for the primer set used, which can affect the target sequence amplification effect of the isolated genomic DNA.

The amplified target sequence may be labeled with a detectable labeling substance.

The labeling substance may be a fluorescent, phosphorescent or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-terminal of the primer with Cy-5 or Cy-3, so that the target sequence can be labeled with a detectable fluorescent labeling substance.

When the radioactive isotope such as 32P or 35S is added to the PCR reaction solution in the PCR using the radioactive material, the amplification product is synthesized, and the radioactive substance is incorporated into the amplification product and the amplification product can be labeled as radioactive.

The nucleotide is not particularly limited as long as it is complementary to a part or all of the corn B73 standard genome. Preferably, the IBM 911 primer set is complementary to the nucleotide sequence of chromosome 4 of the corn B73 standard genome , The IBM 1798 primer set may be complementary to the nucleotide sequence of chromosome 9 of the maize B73 standard genome.

The corn B73 standard genome is described in 2011 by Ganal et al. (Ganal et al., 2011. PloS ONE 6: e28334) and is described on the MaizeGDB website (http://www.maizegdb.org/sequence.php) Lt; / RTI >

The "complement" means that the nucleotide and all or some of the chromosome are specifically bound.

The "corn B73 standard genome" is a polymorphic sequence comprising a polymorphic site. A polymorphic sequence means a sequence comprising a polymorphic site comprising a SNP in a polynucleotide sequence. The polynucleotide sequence may be DNA or RNA.

The primer set is not particularly limited as long as it is represented by two or more nucleotides of the group consisting of SEQ ID NOS: 1 to 4, but may be selected from the group consisting of DNA, RNA polymerase, Or a reverse transcriptase) and a single strand oligonucleotide capable of serving as a starting point of template-directed DNA synthesis under a suitable temperature. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15-30 Nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template.

The primer sequence need not be completely complementary to the SNP marker, but should be sufficiently complementary to hybridize with the maize B73 standard genome.

The primer set may be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

Next, the amplification product is detected.

The detection is not particularly limited as long as it is a method used for detecting an amplification product containing a target sequence amplified, for example, by capillary electrophoresis, DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement But is not limited thereto.

For example, the capillary electrophoresis can use an ABi Sequencer, and gel electrophoresis can use agarose gel electrophoresis or acrylamide gel electrophoresis according to the size of the amplification product. In the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is performed, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as 32P or 35S is added to the PCR reaction solution to mark the amplification product, and then the radioactivity is measured using a radioactive measuring device such as a Geiger counter or a liquid scintillation counter A liquid scintillation counter can be used to measure radioactivity.

Further, the detection is not particularly limited as long as it is an amplification product containing the amplified target sequence. Preferably, the product amplified using the IBM 911 primer set of SEQ ID NO: 1 and SEQ ID NO: 2 has a size of 227 bp As the product is detected; At the same time, when the product amplified using the IBM 1798 primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4 is not detected in a product having a size of 345 bp, it can be determined that the product is a ripe variety.

The "amplification product size" differs depending on the position and size of the target sequence, and may vary depending on the primer set used for amplification.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Preparation of varieties of rivers

The seeds of the following examples were purchased from Hanchon Bio Industry Co., Ltd., and the seeds and coppies of Kang Daok were used by the National Institute of Rural Development at the National Institute of Rural Development in 2015, And leaves were collected and used.

2-1: DNA extraction

The maize genomic DNA was extracted from the young leaves of the potato corn obtained in Preparation Example 1 with slight modifications of the method of Dellaporta et al. (1983 Plant Mol. Biol. Rep. 1: 19-211983) Respectively.

Specifically, 0.1 g of the young leaf tissue of Kangxia was cut out, added to the induced liquid nitrogen, completely pulverized with a pestle, and then placed in a 2.0 ml tube. Thereafter, 0.16 g of sodium bisulfate was added to an extraction buffer (1 M Tris-HCl pH 8.0, 0.5 M EDTA, 5 M NaCl, 20% SDS) prepared in a water bath at 65 ° C and then 600 μl of an extraction buffer containing sodium bisulfate And tapping was performed. Then, 600 μl of phenol: chloroform: isoamyl alcohol (25: 24: 1, v / v / v) was added to the tube and the tube was incubated for 15 minutes in a water bath at 65 ° C. and then immediately incubated at 13,000 rpm for 20 minutes After centrifugation, the supernatant was transferred to a new tube.

Then, 600 μl of chloroform: isoamyl alcohol (24: 1 = v: v) solution was added to the supernatant, followed by tapping and centrifugation at 14,500 rpm for 20 minutes. The supernatant was then transferred to a new tube, 600 μl of 95% ethanol and 60 μl of 3M sodium acetate were added, incubated at -20 ° C. for 2 hours and centrifuged at 14,500 rpm for 20 minutes.

Subsequently, all the solution was discarded so that the precipitated pellets did not fall off, and then 600 μl of 70% ethanol was added thereto, followed by light tapping, centrifugation at 10,000 rpm, discarding ethanol, and drying in air. Thereafter, 30 쨉 l of distilled water was added to dissolve, and 1 ㎕ of Ribonuclease (Rnase) (product name of RNase I, manufactured by Thermo Scientific) was added to completely remove RNA to obtain maize DNA.

2-2: Primer production

(Ganal et al., 2011. PloS ONE 6: e28334) SNP array information using the corn B73 standard genome in order to select a primer for the identification of a variety of potato varieties. More than 800,000 SNPs We found 200 SNP sites (20 SNP sites / chromosome) per chromosome through this information. Sequence information was obtained using the selected SNP site using the MaizeGDB website (http://www.maizegdb.org/).

After that, 200 primers were prepared by using 3 'end-inconsistent primer production method published by Professor Lee Seok-ha of Seoul National University using the principle that the PCR product is not generated due to inconsistency of the forward primer 3' al., 2005. Theor. AppL. Genet. 110: 1003-1010) (see Figure 1).

Specifically, if the second nucleotide sequence at the 3 'end of the SNP site is inconsistent to generate a PCR product in the presence of the SNP site and a SNP site is not present in the SNP site, the presence or absence of the SNP site , And it was tried to discriminate the cultivars easily. The Primer3 program was used and the PCR product was constructed to be generated at 200 ~ 500bp.

2-3: Specific reaction primer selection

In order to select a primer combination that specifically reacts with a variety of potato varieties among the combination of 200 primer sets inconsistent with the second base at the 3 'end of the forward primer prepared in Example 2-2, After cultivating DNA of 50 cultivars including cultivars and imported varieties, primer combinations which were not amplified or amplified by a single band were firstly selected. The first selection process is shown in Fig.

Thereafter, in the case of the mating of the manganese varieties and the manganese varieties, in the case of the primers which do not correspond to the amplification reaction, the manganese manganese was secondarily removed and the primers which can be specifically selected for the manganese varieties were selected (see Fig. 3).

As a result, 20 primers per chromosome were amplified by PCR using the primers prepared in Example 2-2, and 16 primers with clear amplification patterns were selected and used for analysis (see FIG. 4).

The composition of the solution in the PCR amplification was 20 μl in total, and 20 ng of the strong alkoxylated DNA of Example 2-1, 0.3 M of the primer prepared in Example 1-2 and 2 × Polymerase (manufactured by Promega) were used.

The PCR reaction was carried out at 95 ° C for 5 minutes, denatured at 95 ° C for 1 minute, annealed at 45 ° C to 65 ° C for 1 minute, and extended at 72 ° C for 2 minutes. This process was repeated 29 cycles. For 10 min and the PCR amplification was terminated at 4 ° C. Then, 18 μl of the amplified PCR product was loaded on 1% agarose gel and electrophoresed at 100 V (volts) for 40 minutes. After electrophoresis, EtBr (Ethidium bromide ), And the band was confirmed using UV.

As can be seen in Figure 2, only the primer combinations that specifically reacted to the SNP site were selected, except for primer combinations that resulted in unexpected PCR bands.

Then, in order to remove the primer combination in which the primer combination is inconsistent between the offspring and the cultivars, the DNA of the hard DNA sample and the duplicate DNA was extracted in the same manner as in the method of Example 2-1,

The specific assay method is to use the DNA extracted from 2015 as the DNA of F1, F1 (KS140), and KS141 (the sample is requested to be distributed to the National Institute of Food Science, Rural Development Administration , And the varieties used were the strong dioxin DNA obtained in Example 2-1. In addition, the DNA extraction method was performed in the same manner as in Example 2-1, and the PCR amplification method was performed as described above, and the results are shown in FIG.

As can be seen in FIG. 3, primer combinations that were not generated in the varieties but not in the PCR bands were excluded from the selection because they were not suitable as a primer combination capable of discriminating the varieties. Two selected primer sets are described in Table 1 below.

Primer name order
number Forward sequence order
number Reverse sequence Tm
(° C) Product Size (bp) Location of chromosome IBM 911 One TTGGTACTTGGTATCACAATGTTA 2 GCATTGTGTCCAGTGTTCTC 50 227 4 IBM 1798 3 GGCTGACTGTTCTATGGAACTT 4 AGCTGCGCACACTATCAAGA 52 345 9

As shown in Table 1, the primers of the present invention selected one primer on chromosome 4 and one primer on chromosome 9. The selected primer combination had an annealing temperature of 50-52 ° C.

In order to determine whether the combination of the two primers of the present invention is capable of specifically picking up the strong corn among the fifty corn cultivars for feed, the corn cultivar shown in Fig. 5 was subjected to PCR analysis using the two primer sets.

As a result, as shown in Fig. 6, bands were formed when the PCR was performed with the IBM911 primer set only in the rivers, and no band was formed when PCR was performed with the IBM1798 primer set.

In summary, the PCR amplification product using the IBM 911 primer set should be identified at 227 bp, and at the same time the PCT amplification product using the IBM 1798 primer set should be identified as a band at 345 bp.

As can be seen from the above examples, it was found that the primer set of the present invention can effectively discriminate the Kang Dahok varieties from various varieties, protect the Kang Daok varieties and effectively test the purity of F1 seeds. Further, the present invention provides a method of distinguishing a steel sheet by using the above-described primer set for discriminating steel sheets.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for Kangdaok identification and method for          identification <130> 1042416 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IBM 911 Forward sequence <400> 1 ttggtacttg gtatcacaat gtta 24 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IBM 911 Reverse sequence <400> 2 gcattgtgtc cagtgttctc 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IBM 1798 Forward sequence <400> 3 ggctgactgt tctatggaac tt 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IBM 1798 Reverse sequence <400> 4 agctgcgcac actatcaaga 20

Claims (6)

(a) a primer set of a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2; And
(b) a primer set of a forward primer represented by SEQ ID NO: 3 and a reverse primer set forth in SEQ ID NO: 4.
2. The method according to claim 1, wherein the primer set of (a) is complementary to the nucleotide sequence of chromosome 4 of the maize B73 standard genome,
Wherein the primer set of (b) is complementary to the nucleotide sequence of chromosome 9 of the maize B73 standard genome.
(i) isolating genomic DNA from maize;
(ii) isolating the genomic DNA isolated in step (i)
(a) a primer set of a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2; And
(b) amplifying the target sequence by performing amplification reaction using the forward primer represented by SEQ ID NO: 3 and the primer set of the reverse primer represented by SEQ ID NO: 4; And
(iii) identifying the amplified product in step (ii);
Wherein the method comprises the steps of:
[3] The method of claim 3, wherein step (iii) comprises detecting a product having a size of 227 bp among amplified products using a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2; A primer set of SEQ. ID. NO. 3 and a primer set of a reverse primer set forth in SEQ. ID. NO. 4 to determine that a product having a size of 345 bp is not detected in the amplified product.
[4] The method of claim 3, wherein the amplification reaction comprises annealing at a temperature of 44 to 58 [deg.] C.
4. The method according to claim 3, wherein the primer set in step ii) is complementary to the nucleotide sequence of chromosome 4 of the corn B73 standard genome, the primer set of b) is a corn B73 standard genome, Which is complementary to the nucleotide sequence of chromosome 9 of SEQ ID NO:

Images