KR20210036803A - Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii - Google Patents

Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii Download PDF

Info

Publication number
KR20210036803A
KR20210036803A KR1020200105022A KR20200105022A KR20210036803A KR 20210036803 A KR20210036803 A KR 20210036803A KR 1020200105022 A KR1020200105022 A KR 1020200105022A KR 20200105022 A KR20200105022 A KR 20200105022A KR 20210036803 A KR20210036803 A KR 20210036803A
Authority
KR
South Korea
Prior art keywords
extract
mmp
cosmetic composition
skin
skin aging
Prior art date
Application number
KR1020200105022A
Other languages
Korean (ko)
Other versions
KR102335262B1 (en
Inventor
정태숙
박호용
이화
이호림
박인철
김수용
이상우
최상호
이창영
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of KR20210036803A publication Critical patent/KR20210036803A/en
Application granted granted Critical
Publication of KR102335262B1 publication Critical patent/KR102335262B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/40Chemical, physico-chemical or functional or structural properties of particular ingredients
    • A61K2800/52Stabilizers
    • A61K2800/522Antioxidants; Radical scavengers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/74Biological properties of particular ingredients
    • A61K2800/78Enzyme modulators, e.g. Enzyme agonists
    • A61K2800/782Enzyme inhibitors; Enzyme antagonists

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Dermatology (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Cosmetics (AREA)

Abstract

The present invention relates to a cosmetic composition for preventing skin aging and reducing skin wrinkles, comprising a Selaginella rossii extract, wherein the composition exhibits an excellent antioxidant effect and a collagenase overexpression suppressing effect, thereby being capable of being usefully employed for the use of preventing skin aging and reducing skin wrinkles.

Description

셀라지넬라 로씨 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물{Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii }Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii}

본 발명은 셀라지넬라 로씨 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물에 관한 것이다.The present invention relates to a cosmetic composition for preventing skin aging and improving skin wrinkles, comprising a celaginella rosi extract.

사람의 피부노화를 일으키는 원인으로는 내적인 노화(intrinsic aging)와 광노화(photo-aging) 두가지로 구분되며, 그 중 광노화는 주로 자외선에 의한 피부노화를 의미한다.The causes of human skin aging are classified into two types, intrinsic aging and photo-aging, of which photoaging mainly refers to skin aging caused by ultraviolet rays.

일반적으로 자외선은 그 파장에 따라 자외선 A(UVA, 320-400nm), 자외선 B(UVB, 280-320nm) 및 자외선 C(UVC, 190-280nm) 등 세 가지로 구분된다. 태양광으로부터 지표에 도달하는 자외선 중 자외선 C는 대기권의 상층부에 있는 오존층에서 흡수, 산란되어 여과되므로 자연적 광화학 반응에 별다른 영향을 미치지 않는다. 자외선 A는 일차적으로는 태양으로부터 방출되나 인공 램프 등에 의해서도 방출되며 피부의 표피와 진피층에 깊숙하게 투과한다. 한편, 자외선 B는 자외선 A 보다 파장이 짧아서 피부 깊숙이 침투하지는 못한다고 알려져 있으나, 자외선 A 보다 훨씬 강한 에너지를 가지고 있어서 피부 표면에 예리한 홍반을 발생시키는 한편 피부의 광노화를 촉진시키는 파장으로 알려져 있다.In general, ultraviolet rays are classified into three types: ultraviolet A (UVA, 320-400nm), ultraviolet B (UVB, 280-320nm), and ultraviolet C (UVC, 190-280nm) according to their wavelength. Of the ultraviolet rays reaching the surface from sunlight, ultraviolet C is absorbed, scattered and filtered in the ozone layer in the upper part of the atmosphere, so it does not significantly affect the natural photochemical reaction. Ultraviolet A is primarily emitted from the sun, but is also emitted by artificial lamps, and penetrates deeply into the epidermis and dermis of the skin. On the other hand, UV B is known to have a shorter wavelength than UV A and cannot penetrate deep into the skin, but it has much stronger energy than UV A, so it is known as a wavelength that causes sharp erythema on the skin surface and promotes photoaging of the skin.

콜라겐은 피부의 섬유아세포에서 생성되는 주요 기질 단백질로서 세포외 간질에 존재하고, 생체 단백질 총중량의 30%를 차지하는 중요한 단백질로 견고한 3중 나선구조를 가지고 있다. 주된 기능으로는 피부의 기계적 견고성, 결합조직의 저항력과 조직의 결합력, 세포접착의 지탱, 세포분할과 분화의 유도 등이 알려져 있다. 콜라겐은 피부노화의 외적인 원인이 되는 자외선 노출에 의해서도 파괴되며, 자외선에 의한 변화는 자외선에 노출된 시간의 축적에 비례하는 것으로 알려져 있다. 자외선은 피부 진피층에서 탄력섬유성 물질을 축적시키고 교원 섬유를 변성시켜 피부에 주름이 생기게 만들고 탄력성을 저하시킨다.Collagen is a major matrix protein produced in fibroblasts of the skin, and is present in the extracellular interstitial, and is an important protein that accounts for 30% of the total weight of a living body protein. The main functions are known as the mechanical firmness of the skin, the resistance of connective tissue and the binding force of the tissue, support of cell adhesion, and induction of cell division and differentiation. Collagen is also destroyed by exposure to ultraviolet rays, which is an external cause of skin aging, and it is known that changes due to ultraviolet rays are proportional to the accumulation of time exposed to ultraviolet rays. Ultraviolet rays accumulate elastic fibrous substances in the dermal layer of the skin and denature collagen fibers, causing wrinkles and lowering elasticity.

자외선에 의한 피부노화과정에서 MMPs(Matrix Metalloproteinases)는 핵심적인 역할을 한다. 자외선 조사에 의해 MMP의 발현이 유도되는데, MMP는 피부조직의 콜라겐을 비롯한 교원섬유들의 분해를 야기하여 주름 생성을 비롯한 피부노화를 초래한다. 그 중, MMP-1은 인체 분포된 콜라겐 중 90%이상을 차지하는 type Ⅰ 콜라겐을 비롯한 type Ⅱ, Ⅲ 콜라겐을 분해하는 효소로, 피부노화 및 주름 개선의 표적으로 잘 알려져 있다. MMP-2 또한 기저막(basement membrane)을 형성하는 type Ⅳ 콜라겐을 분해하는 효소로, 피부노화 개선의 표적으로 연구되고 있다(Int J Mol Sci. 2016; 17, 868). MMP-2와 MMP-9은 MMP-1에 의해 분해된 콜라겐 조각들을 더 잘게 분해하여 피부노화에 주요한 역할을 한다 (J Appl Biol Chem. 2018; 61, 9-15).MMPs (Matrix Metalloproteinases) play a key role in the skin aging process caused by UV rays. The expression of MMP is induced by UV irradiation, which causes the decomposition of collagen and collagen fibers in the skin tissue, resulting in skin aging including wrinkle formation. Among them, MMP-1 is an enzyme that decomposes type II and III collagen, including type I collagen, which accounts for more than 90% of the collagen distributed in the human body, and is well known as a target for skin aging and wrinkle improvement. MMP-2 is also an enzyme that degrades type IV collagen that forms a basement membrane, and has been studied as a target for improving skin aging ( Int J Mol Sci. 2016; 17, 868). MMP-2 and MMP-9 play a major role in skin aging by further decomposing collagen fragments degraded by MMP-1 ( J Appl Biol Chem . 2018; 61, 9-15).

또한, 피부노화에는 MMPs뿐만 아니라, 신체의 대사 과정 중에 발생하는 자유라디칼, 과산화수소 또는 과산화물의 생성, 및 생체 내 항산화 방어기전의 파괴에 따른 세포 및 조직 구성물질의 산화 등이 관여하며, 이와 같은 요소에 의해 피부세포 및 조직에 손상이 발생하여 피부의 노화가 가속화된다. In addition, skin aging involves not only MMPs, but also the production of free radicals, hydrogen peroxide or peroxides generated during the metabolic process of the body, and oxidation of cellular and tissue components due to the destruction of antioxidant defense mechanisms in the body. This causes damage to skin cells and tissues, accelerating skin aging.

이에, 본 발명자들은 피부 노화 방지 및 피부 주름 개선용 소재를 발굴하기 위한 연구를 수행하여 본 발명을 완성하였다.Accordingly, the present inventors completed the present invention by conducting research to discover a material for preventing skin aging and improving skin wrinkles.

대한민국 특허공개 제10-2007-0045157호Korean Patent Publication No. 10-2007-0045157

본 발명의 하나의 목적은 셀라지넬라 로씨(Selaginella rossii) 추출물울 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물을 제공하는 것이다.One object of the present invention is to provide a cosmetic composition for preventing skin aging and improving skin wrinkles, including Selaginella rossii extract.

일 양상은 셀라지넬라 로씨(Selaginella rossii) 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물을 제공한다.One aspect provides a cosmetic composition for preventing skin aging and improving skin wrinkles, including Selaginella rossii extract.

상기 셀레지넬라 로씨는 줄기, 잎, 뿌리, 꽃, 종자, 또는 식물 전체를 사용할 수 있다. 상기 셀레지넬라 로씨는 국내 전역, 중국 북부, 러시아 등에 분포하고 있어 원료 확보가 용이하며, 구입하거나 직접 채취한 것을 사용할 수 있다. The selesinella rosehip may be used as a stem, leaf, root, flower, seed, or whole plant. The Selesinella Rossi is distributed throughout Korea, northern China, Russia, etc., so it is easy to secure raw materials, and it is possible to purchase or use directly collected ones.

상기 셀라지넬라 로씨 추출물은 하기와 같이 수득될 수 있다. 셀라지넬라 로씨를 물로 세척하여 이물질을 제거한 후 그늘에서 건조하고, 건조된 셀라지넬라 로씨에 적당한 양의 용매를 첨가하여 완전히 침지되도록 한다. 이 때, 건조된 셀라지넬라 로씨는 건조된 상태 그대로 사용하거나 분쇄하여 분말 형태로 사용할 수 있다. 셀라지넬라 로씨는 통상의 추출용매를 이용하여 추출할 수 있으며, 예를 들면, (a) 탄소수 1~4의 무수 또는 함수 저급 알코올(예: 메탄올, 에탄올, 프로판올, 부탄올, 노말-프로판올, 이소-프로판올 및 노말-부탄올 등), (b) 상기 저급 알코올과 물과의 혼합용매, (c) 아세톤, (d) 에틸아세테이트, (e) 클로로포름, (f) 1,3-부틸렌글리콜, (g) 헥산, (h) 디에틸에테르, (i) 부틸아세테이트 (j) 클로로포름-메탄올 또는 (k) 증류수를 이용하여 추출할 수 있다. 구체적으로, 상기 추출용매는 에탄올 및 물이 70:30 내지 95:5의 부피비로 혼합된 에탄올 수용액(70%, 95%(v/v) 에탄올), 또는 에틸아세테이트로 추출할 수 있다. The Celagenella Rossi extract can be obtained as follows. After washing the Celagenella Rossi with water to remove foreign substances, dry it in the shade, and add an appropriate amount of solvent to the dried Celagenella Rossi so that it is completely immersed. In this case, the dried Celagenella Rossi may be used as it is dried or may be pulverized and used in a powder form. Cellagenella Rossi can be extracted using a conventional extraction solvent, for example, (a) anhydrous or hydrated lower alcohol having 1 to 4 carbon atoms (e.g., methanol, ethanol, propanol, butanol, normal-propanol, iso -Propanol and normal-butanol), (b) a mixed solvent of the lower alcohol and water, (c) acetone, (d) ethyl acetate, (e) chloroform, (f) 1,3-butylene glycol, ( g) hexane, (h) diethyl ether, (i) butyl acetate (j) chloroform-methanol, or (k) distilled water. Specifically, the extraction solvent may be extracted with an aqueous ethanol solution (70%, 95% (v/v) ethanol) in which ethanol and water are mixed in a volume ratio of 70:30 to 95:5, or ethyl acetate.

일 구체예에 따르면, 상기 추출물은 에탄올 추출물 또는 에틸아세테이트 추출물일 수 있다. 일 실시예에 따르면 셀라지넬라 로씨의 에탄올 추출물은 항산화 효과가 우수하며, 셀라지넬라 로씨의 에틸아세테이트 추출물은 MMP 발현 억제 및 콜라겐 합성 효소 발현 증가 효과가 우수하므로 피부 노화 방지 및 피부 주름 개선에 이용될 수 있다. 또한 일 실시예에 따르면, 셀라지넬라 로씨 추출물은 동속이종의 다른 셀라지넬라속 식물보다 MMP 발현 억제 효과가 우수함이 확인되었다. According to one embodiment, the extract may be an ethanol extract or an ethyl acetate extract. According to an embodiment, the ethanol extract of Cellagenella Rossi has excellent antioxidant effect, and the ethylacetate extract of Cellagenella Rossi has excellent effect of inhibiting MMP expression and increasing the expression of collagen synthase, so it is used to prevent skin aging and improve skin wrinkles. Can be. In addition, according to an embodiment, it was confirmed that the extract of Celazinella rosi has a superior effect of inhibiting MMP expression than other Celazinella genus plants of the same genus.

상기 추출 용매의 양은 셀라지넬라 로씨 중량의 1 내지 30배일 수 있으나 특별히 한정되는 것은 아니다. The amount of the extraction solvent may be 1 to 30 times the weight of Celazinella Rossi, but is not particularly limited.

상기 추출은 열수 추출, 상온 침지 추출, 환류 냉각 추출, 또는 초음파 추출 방법을 사용할 수 있다. 추출 횟수는 1 내지 5회일 수 있다. 추출시간은 실온에서 추출하는 경우 2 내지 72시간, 24 내지 72시간, 또는 48시간일 수 있으나 특별히 한정되는 것은 아니다. The extraction may be hot water extraction, room temperature immersion extraction, reflux cooling extraction, or ultrasonic extraction. The number of extractions may be 1 to 5 times. The extraction time may be 2 to 72 hours, 24 to 72 hours, or 48 hours when extracted at room temperature, but is not particularly limited.

상기 화장료 조성물은 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속 이온 봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분과 같은 화장품 분야에서 통상적으로 사용되는 보조제를 더 포함할 수 있다.The cosmetic composition may further include fatty substances, organic solvents, solubilizers, thickening and gelling agents, softening agents, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic Cosmetics such as emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic actives, lipid vesicles or any other ingredients commonly used in cosmetics It may further include adjuvants commonly used in the field.

상기 화장료 조성물은 그 제형의 제제화에 필요하고 적절한 각종 기제 및/또는 첨가물을 포함할 수 있으며, 그 효과를 떨어트리지 않는 범위 내에서 비이온 계면활성제, 실리콘 폴리머, 체질안료, 향료, 방부제, 살균제, 산화 안정화제, 유기 용매, 이온성 또는 비이온성 증점제, 유연화제, 산화방지제, 자유 라디칼 파괴제, 불투명화제, 안정화제, 에몰리언트(emollient), 실리콘, α-히드록시산, 소포제, 보습제, 비타민, 곤충 기피제, 향료, 보존제, 계면활성제, 소염제, 물질 P 길항제, 충전제, 중합체, 추진제, 염기성화 또는 산성화제, 또는 착색제 등 공지의 화합물을 더 포함하여 제조될 수 있다.The cosmetic composition may contain various bases and/or additives necessary and appropriate for the formulation of the formulation, and within a range that does not deteriorate the effect, nonionic surfactants, silicone polymers, extender pigments, fragrances, preservatives, disinfectants, Oxidation stabilizers, organic solvents, ionic or nonionic thickeners, softening agents, antioxidants, free radical destroying agents, opacifying agents, stabilizers, emollients, silicones, α-hydroxy acids, antifoaming agents, moisturizing agents, vitamins, Insect repellents, flavors, preservatives, surfactants, anti-inflammatory agents, substance P antagonists, fillers, polymers, propellants, basification or acidifying agents, or colorants, and other known compounds may be further included.

일 구체예에 따르면, 상기 피부 노화 및 상기 피부 주름은 피부의 자외선 노출에 의해 발생하는 것일 수 있다.According to one embodiment, the skin aging and the skin wrinkles may be caused by exposure to ultraviolet rays of the skin.

일 구체예에 따르면, 상기 셀라지넬라 로씨 추출물은 자외선에 의해 증가된 MMP-1, MMP-2, 및 MMP-9의 발현을 억제함으로써 피부 노화 방지 및 피부 주름 개선 효과를 나타내는 것일 수 있다. According to one embodiment, the celaginella rosi extract may exhibit an effect of preventing skin aging and improving skin wrinkles by inhibiting the expression of MMP-1, MMP-2, and MMP-9 increased by ultraviolet rays.

일 구체예에 따르면, 상기 셀레지넬라 로씨 추출물은 자외선에 의해 감소된 COL1A1과 COL1A2의 발현을 증가시킴으로써 피부 노화 방지 및 피부 주름 개선 효과를 나타내는 것일 수 있다. According to one embodiment, the selesinella rosi extract may exhibit an effect of preventing skin aging and improving skin wrinkles by increasing the expression of COL1A1 and COL1A2 reduced by ultraviolet rays.

일 실시예에 따르면, 상기 셀라지넬라 로씨 추출물은 현저한 DPPH 라디칼 소거 활성을 나타내고, 인간 피부세포에서 자외선에 의해 유도된 MMP-1, MMP-2및 MMP-9의 과발현을 억제하거나, 자외선에 의해 유도된 COLA1 및 COLA2의 발현 감소를 증가시키는 활성을 나타내므로, 자외선 등에 의해 손상되는 피부 콜라겐 등의 단백질 분해를 억제함으로써 피부노화를 효과적으로 개선할 수 있다. According to an embodiment, the celaginella rosi extract exhibits remarkable DPPH radical scavenging activity, inhibits overexpression of MMP-1, MMP-2, and MMP-9 induced by ultraviolet rays in human skin cells, or by ultraviolet rays. Since it exhibits an activity of increasing the decrease in the expression of induced COLA1 and COLA2, it is possible to effectively improve skin aging by inhibiting the degradation of proteins such as skin collagen damaged by ultraviolet rays or the like.

일 구체예에 따르면, 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이로 이루어진 군에서 선택되는 어느 하나의 제형일 수 있다.According to one embodiment, the cosmetic composition is composed of a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray. It may be any one formulation selected from the group.

예를 들어, 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연화장수, 영양화장수, 로션, 바디 로션, 영양 크림, 마사지 크림, 모이스처 크림, 핸드크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 젤, 패치, 수중유(oil-in-water, O/W)형, 유중수(water-in-oil, W/O)형 등의 기초 화장료, 립스틱, 메이크업베이스 또는 파운데이션 등의 색조 화장료, 헤어토닉, 젤 또는 무스 등의 정발제(hair fixatives), 양모제 또는 염모제 등의 모발용 화장료 조성물로 제형화될 수 있다.For example, the cosmetic composition is formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray. May be, but is not limited thereto. More specifically, softening lotion, nourishing lotion, lotion, body lotion, nourishing cream, massage cream, moisture cream, hand cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, gel, patch, oil-in-water Basic cosmetics such as (oil-in-water, O/W) type and water-in-oil (W/O) type, color cosmetics such as lipstick, makeup base or foundation, hair tonic, gel or mousse, etc. It may be formulated as a cosmetic composition for hair such as hair fixatives, wool or hair dye.

상기 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로써, 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 사용될 수 있다.When the formulation of the cosmetic composition is a paste, cream or gel, as a carrier component, animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide, etc. Can be used.

상기 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 사용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸에테르와 같은 추진체를 포함할 수 있다.When the formulation of the cosmetic composition is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane / May contain propellants such as butane or dimethyl ether.

상기 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 사용될 수 있다. 예를 들어, 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌글리콜 또는 소르비탄의 지방산 에스테르가 사용될 수 있다.When the formulation of the cosmetic composition is a solution or emulsion, a solvent, a solubilizing agent or an emulsifying agent may be used as a carrier component. For example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan may be used. .

상기 화장료 조성물의 제형이 현탁액인 경우에는 담체 성분으로써, 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 사용될 수 있다.When the formulation of the cosmetic composition is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracant, and the like can be used.

상기 화장료 조성물의 제형이 계면활성제 함유 클렌징인 경우에는 담체 성분으로써, 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 사용될 수 있다.When the formulation of the cosmetic composition is a surfactant-containing cleansing, as a carrier component, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid Amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

상기 화장료 조성물의 제형이 비누, 계면활성제 함유 클렌징 또는 계면활성제 비함유 클렌징 제형일 경우, 피부에 도포한 후 닦아내거나 떼거나 물로 씻어낼 수 있다. 상기 비누는 예를 들어, 액상비누, 가루비누, 고형비누 및 오일비누일 수 있고, 계면활성제 함유 클린징 제형은 클렌징폼, 클렌징 워터, 클렌징 수건 및 클렌징 팩일 수 있으며, 계면활성제 비함유 클렌징 제형은 클렌징크림, 클렌징 로션, 클렌징 워터 및 클렌징 겔일 수 있으나, 이에 한정되는 것은 아니다.If the formulation of the cosmetic composition is a soap, a cleansing formulation containing a surfactant, or a cleansing formulation containing no surfactant, it may be applied to the skin and then wiped off, removed, or washed off with water. The soap may be, for example, liquid soap, powder soap, solid soap and oil soap, and the cleansing formulation containing surfactant may be a cleansing foam, cleansing water, cleansing towel and cleansing pack, and the cleansing formulation containing no surfactant is cleansing. It may be a cream, a cleansing lotion, a cleansing water, and a cleansing gel, but is not limited thereto.

셀라지넬라 로씨 추출물 또는 이의 분획물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물에 따르면, 우수한 항산화 효과 및 콜라겐 분해 효소의 과발현을 억제하는 효과를 나타내므로, 피부 노화 방지 및 피부 주름 개선 용도로 유용하게 활용될 수 있다.According to the cosmetic composition for preventing skin aging and improving skin wrinkles comprising an extract or a fraction thereof, it has an excellent antioxidant effect and an effect of inhibiting overexpression of collagen-degrading enzyme, so it is used for preventing skin aging and improving skin wrinkles. It can be usefully used.

도 1은 CCD-986sk 피부세포에서 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 따른 세포독성을 확인한 결과를 나타낸 그래프이다.
도 2는 자외선 조사한 CCD-986sk세포에서 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 따른 MMP-1의 과발현을 억제한 결과를 나타낸 그래프이다.
도 3은 자외선 조사한 CCD-986sk세포에서 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 따른 MMP-2 과발현의 억제를 확인한 결과를 나타낸 그래프이다.
도 4는 자외선 조사한 CCD-986sk세포에서 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 따른 MMP-9 과발현의 억제를 확인한 결과를 나타낸 그래프이다.
도 5는 자외선 조사한 CCD-986sk세포에서 감소된 COL1A1의 발현이 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 의해 다시 회복되는 결과를 나타낸 그래프이다.
도 6은 자외선 조사한 CCD-986sk세포에서 감소된 COL1A2의 발현이 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 의해 다시 회복되는 결과를 나타낸 그래프이다.
도 7은 셀라지넬라 로씨 및 이와 동속이종 식물 추출물의 MMP-1 발현 억제 효과를 비교한 결과를 나타낸 것이다. 도 7에서, #은 UV를 처리하지 않은 대조군과 비교할 때 P<0.01이며, *은 UV만 처리한 대조군과 비교할 때 P<0.05이며, **은 UV만 처리한 대조군과 비교할 때 P<0.01이다.
1 is a graph showing the results of confirming the cytotoxicity according to the treatment of an ethanol extract or ethyl acetate extract of Cellagenella Rossi in CCD-986sk skin cells.
FIG. 2 is a graph showing the results of suppressing the overexpression of MMP-1 according to treatment with an ethanol extract or ethyl acetate extract of Celagenella Rossi in CCD-986sk cells irradiated with ultraviolet rays.
3 is a graph showing the results of confirming the inhibition of MMP-2 overexpression according to treatment with an ethanol extract or ethyl acetate extract of Celazinella Rossi in CCD-986sk cells irradiated with ultraviolet rays.
4 is a graph showing the results of confirming the inhibition of MMP-9 overexpression according to the treatment of an ethanol extract or ethyl acetate extract of Celagenella Rossi in CCD-986sk cells irradiated with ultraviolet rays.
FIG. 5 is a graph showing the result that the expression of COL1A1 reduced in UV-irradiated CCD-986sk cells is recovered again by treatment with an ethanol extract of celaginella rosi or an ethyl acetate extract.
Figure 6 is a graph showing the result that the expression of COL1A2 reduced in the UV-irradiated CCD-986sk cells is recovered again by treatment with an ethanol extract of celaginella rosi or an ethyl acetate extract.
Figure 7 shows the results of comparing the MMP-1 expression inhibitory effect of Celajinella Rossi and the same genus plant extract. In FIG. 7, # denotes P<0.01 when compared to the control group not treated with UV, * denotes P<0.05 when compared with the control group treated with only UV, ** denotes P<0.01 when compared with the control group treated with only UV. .

이하 본 발명을 하나 이상의 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through one or more examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

실시예 1. 셀라지넬라 로씨 추출물의 제조Example 1. Preparation of Celazinella Rossi Extract

셀라지넬라 로씨(Selaginella rossii) 지상부 전체를 채취(원산지: 중국, 연변)하여 상온에서 건조하였다. 건조물은 적당한 크기로 절단하여 블렌더(blender mixer)를 이용하여 분쇄하여 준비하였다. Selaginella rossii (Selaginella rossii) The whole above-ground part was collected (origin: Yanbian, China) and dried at room temperature. The dried product was prepared by cutting into an appropriate size and grinding using a blender.

셀라지넬라 로씨 분쇄물 10g 당 70%(v/v) 에탄올 수용액, 95%(v/v) 에탄올 수용액, 또는 에틸아세테이트를 각각 100㎖씩 가하고 교반하면서 48시간 동안 실온에서 추출한 후, 여과지(Whatman, No. 2)를 사용하여 용매 가용부만을 회수하였다. 추출액은 감압 하에서 농축하여 셀라지넬라 로씨의 70% 에탄올 추출물, 95% 에탄올 추출물, 및 에틸아세테이트 추출물을 수득하였다. After adding 100 ml each of 70% (v/v) ethanol aqueous solution, 95% (v/v) ethanol aqueous solution, or ethyl acetate per 10 g of Celazinella Rossi pulverized product, and extracting at room temperature for 48 hours while stirring, filter paper (Whatman , No. 2) was used to recover only the soluble part of the solvent. The extract was concentrated under reduced pressure to obtain a 70% ethanol extract, 95% ethanol extract, and ethyl acetate extract of Celazinella Rossi.

실시예 2. 셀라지넬라 로씨 추출물의 DPPH 소거 활성 확인Example 2. Confirmation of DPPH scavenging activity of Celazinella Rossi extract

실시예 1의 셀라지넬라 로씨 추출물의 항산화 활성을 확인하기 위하여, 셀라지넬라 로씨 추출물의 DPPH 소거 활성을 평가하였다. In order to confirm the antioxidant activity of the extract of Celazinella Rossi of Example 1, the DPPH scavenging activity of Celazinella Rossi extract was evaluated.

구체적으로, 2,2-diphenyl-2-picrylhydrazyl(DPPH, sigma, USA)를 0.15mM이 되도록 메탄올에 용해하여 DPPH 용액을 제조하였다. 96 웰 플레이트에 메탄올로 희석된 시료 10㎕ 및 DPPH 용액을 함께 첨가한 후, 실온에서 40분간 반응시켰다. 반응액은 Microplate reader 680(Bio Rad Co., USA)을 이용하여 517nm에서 흡광도를 측정하여 DPPH 라디칼 소거능을 계산하였다. Specifically, 2,2-diphenyl-2-picrylhydrazyl (DPPH, sigma, USA) was dissolved in methanol to 0.15 mM to prepare a DPPH solution. After adding 10 µl of a sample diluted with methanol and a DPPH solution to a 96-well plate, the mixture was reacted at room temperature for 40 minutes. The reaction solution was measured for absorbance at 517 nm using Microplate reader 680 (Bio Rad Co., USA) to calculate DPPH radical scavenging ability.

그 결과, 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물, 및 에틸아세테이트 추출물은 우수한 DPPH 자유 라디칼 소거능을 나타내는 것으로 확인되었다(표 1).As a result, it was confirmed that the 70% ethanol extract, 95% ethanol extract, and ethyl acetate extract of Celazinella Rossi exhibit excellent DPPH free radical scavenging ability (Table 1).

구분division 시료농도
(㎍/㎖)
Sample concentration
(㎍/mL)
DPPH 라디칼 소거능
(%)
DPPH radical scavenging activity
(%)
셀라지넬라 로씨 70% 에탄올 추출물Cellagenella Rossi 70% ethanol extract 200200 53.2 ± 0.853.2 ± 0.8 셀라지넬라 로씨 95% 에탄올 추출물Cellagenella Rossi 95% ethanol extract 200200 67.6 ± 1.167.6 ± 1.1 셀라지넬라 로씨 에틸아세테이트 추출물Cellagenella Rossi Ethyl Acetate Extract 200200 13.7 ± 0.213.7 ± 0.2

이와 같은 결과를 통하여, 셀라지넬라 로씨 추출물은 우수한 항산화 활성에 따른 피부 노화 방지 용도로 사용될 수 있음을 확인하였다.Through these results, it was confirmed that the celaginella rosi extract can be used for skin aging prevention according to its excellent antioxidant activity.

실시예 3. 셀라지넬라 로씨 추출물의 MMP 과발현 억제 효과 확인Example 3. Confirmation of MMP overexpression inhibitory effect of Celazinella rosi extract

3-1. 세포 배양3-1. Cell culture

인간 정상 피부 세포인 CCD-986sk 섬유아세포(한국세포주은행, 대한민국)는 10% FBS(fetal bovine serum)(Atlas), 100units/㎖ 페니실신(penicillin) 및 100㎍/㎖ 스트렙토마이신(streptomycin)이 함유된 IMDM(Iscove's Modified Dulbecco's Medium)(Welgene) 배지를 이용하여 37℃의 습윤한 5% CO2 배양기에서 배양하였다.CCD-986sk fibroblasts (Korea Cell Line Bank, Korea), which are normal human skin cells, contain 10% FBS (fetal bovine serum) (Atlas), 100 units/ml penicillin and 100µg/ml streptomycin. Using the IMDM (Iscove's Modified Dulbecco's Medium) (Welgene) medium was cultured in a humidified 5% CO 2 incubator at 37°C.

3-2. 세포독성 평가3-2. Cytotoxicity assessment

셀라지넬라 로씨 추출물이 세포 독성을 나타내는지 확인하기 위하여, 실시예 3-1의 세포에 대한 셀라지넬라 로씨 추출물의 세포독성 여부를 평가하였다.In order to confirm whether the Celajinella Rossi extract exhibits cytotoxicity, the cytotoxicity of the Celajinella Rossi extract against the cells of Example 3-1 was evaluated.

구체적으로, 96-웰 플레이트에 실시예 3-1의 세포를 웰당 5×103 세포/100㎕씩 넣고, 37℃의 습윤한 5% CO2 배양기에서 배양하였다. 24시간 후, 실시예 1의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물 및 에틸아세테이트 추출물을 각각 최종 농도 100㎍/㎖로 IMDM 배지 100㎕와 함께 처리하였다. 24시간 배양한 뒤, 각 웰에서 배지를 100㎕씩 제거한 후, Cyto XTM(LPS solution, 대한민국)을 10㎕씩 첨가하여 60분 동안 반응 시킨 다음 마이크로플레이트 판독기(Microplate Reader)를 사용하여 450nm에서 흡광도를 측정하였다. Specifically, the cells of Example 3-1 were placed in a 96-well plate at 5×10 3 cells/100 μl per well, and cultured in a humidified 5% CO 2 incubator at 37°C. After 24 hours, the 70% ethanol extract, 95% ethanol extract, and ethyl acetate extract of Example 1 were treated with 100 µl of IMDM medium at a final concentration of 100 µg/ml, respectively. After incubation for 24 hours, 100 μl of the medium was removed from each well, 10 μl of Cyto X TM (LPS solution, Korea) was added each to react for 60 minutes, and then at 450 nm using a microplate reader. The absorbance was measured.

그 결과, 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물 및 에틸아세테이트 추출물은 모두 50㎍/㎖의 농도까지 세포독성을 나타내지 않는 것으로 확인되었다(도 1).As a result, it was confirmed that the 70% ethanol extract, 95% ethanol extract, and ethyl acetate extract did not exhibit cytotoxicity up to a concentration of 50 μg/ml (FIG. 1).

3-3. CCD-986sk 세포에서 MMP-1 생성량 감소 확인3-3. Confirmation of reduction in MMP-1 production in CCD-986sk cells

MMP(matrix metalloproteinase)-1은 type Ⅰ, Ⅱ, Ⅲ 콜라겐을 분해하여 피부 노화 및 주름 생성을 야기하는 효소이다. MMP (matrix metalloproteinase)-1 is an enzyme that causes skin aging and wrinkle formation by decomposing type Ⅰ, Ⅱ, and Ⅲ collagen.

CCD-986sk 세포에서 자외선 처리에 따른 MMP-1의 생성이 셀라지넬라 로씨 추출물의 처리에 의해 억제되는지 여부를 확인하기 위하여, 실시예 3-1의 세포에 자외선 및 셀라지넬라 로씨 추출물을 처리하여 MMP-1의 농도 변화를 측정하였다.In order to confirm whether the generation of MMP-1 due to UV treatment in CCD-986sk cells was inhibited by treatment with Celazinella Rossi extract, the cells of Example 3-1 were treated with UV rays and Celazinella Rossi extract. The change in the concentration of MMP-1 was measured.

구체적으로, 6 웰 플레이트에 실시예 3-1의 세포를 웰당 1.5×105개씩 넣고 37℃의 습윤한 5% CO2 배양기에서 배양하였다. 24시간 후, 자외선 B(UVB) 40mJ/cm2 로 처리한 세포에 실시예 1의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물 또는 에틸아세테이트 추출물을 각각 최종 농도 20 또는 50㎍/㎖로 첨가한 IMDM 배지로 24시간 동안 배양하였다. 배양 후, 각 웰의 상층액에서, MMP-1 ELISA 키트(Abcam사)를 사용하여 합성된 MMP-1의 농도를 측정하였다.Specifically, the cells of Example 3-1 were placed in a 6-well plate at 1.5×10 5 cells per well, and cultured in a humidified 5% CO 2 incubator at 37°C. After 24 hours, cells treated with ultraviolet B (UVB) 40mJ/cm 2 were treated with 70% ethanol extract, 95% ethanol extract, or ethyl acetate extract of Example 1 at a final concentration of 20 or 50 μg/ml, respectively. Incubated for 24 hours with the added IMDM medium. After incubation, in the supernatant of each well, the concentration of the synthesized MMP-1 was measured using an MMP-1 ELISA kit (Abcam).

그 결과, 50㎍/㎖ 농도의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물을 처리한 실험군은 대조군 대비 MMP-1의 생성이 각각 57.1%, 84.7%씩 감소된 것으로 확인되었다. 또한, 20㎍/㎖ 또는 50㎍/㎖ 농도의 에틸아세테이트 추출물을 처리한 실험군은 대조군 대비 MMP-1의 생성이 각각 86.2%, 99.5%씩 감소된 것으로 확인되었다(표 2).As a result, it was confirmed that the production of MMP-1 was reduced by 57.1% and 84.7%, respectively, in the experimental group treated with the 70% ethanol extract and 95% ethanol extract of Celazinella Rossi at a concentration of 50 μg/ml. In addition, it was confirmed that the production of MMP-1 was reduced by 86.2% and 99.5%, respectively, in the experimental group treated with the ethyl acetate extract at a concentration of 20 μg/ml or 50 μg/ml (Table 2).

구분division 시료농도
(㎍/㎖)
Sample concentration
(㎍/mL)
MMP-1 생성 억제율
(%)
MMP-1 production inhibition rate
(%)
셀라지넬라 로씨 70% 에탄올 추출물Cellagenella Rossi 70% ethanol extract 2020 5.0 ± 0.55.0 ± 0.5 5050 57.1 ± 3.857.1 ± 3.8 셀라지넬라 로씨 95% 에탄올 추출물Cellagenella Rossi 95% ethanol extract 2020 68.3 ± 1.468.3 ± 1.4 5050 84.7 ± 3.384.7 ± 3.3 셀라지넬라 로씨 에틸아세테이트 추출물Cellagenella Rossi Ethyl Acetate Extract 2020 86.2 ± 1.186.2 ± 1.1 5050 99.5 ± 1.199.5 ± 1.1

이와 같은 결과를 통하여, 셀라지넬라 로씨 추출물의 우수한 MMP-1 생성 억제 활성을 확인하였다.Through these results, it was confirmed that the excellent MMP-1 production inhibitory activity of the Celajinella rosi extract.

3-4. CCD-986sk 세포에서 MMPs및 Collagen 유전자의 발현 조절 활성 확인3-4. Confirmation of MMPs and Collagen Gene Expression Regulation Activity in CCD-986sk Cells

CCD-986sk 세포에서 자외선 처리에 따른 MMP-1, MMP-2, MMP-9, COL1A1, 및 COL1A2 유전자의 발현이 셀라지넬라 로씨 추출물의 처리에 의해 조절되는지 여부를 확인하였다.In CCD-986sk cells, it was confirmed whether the expression of MMP-1, MMP-2, MMP-9, COL1A1, and COL1A2 genes according to UV treatment was regulated by treatment with Celazinella rosi extract.

구체적으로, 실시예 3-3의 방법으로 자외선 처리한 세포에 셀라지넬라 로씨 시료를 24시간 처리한 실험군에서 TRI reagent(Ambion)를 이용하여 총 RNA를 분리한 다음, High-capacity cDNA Reverse Transcription kit(Applied Biosystems)를 사용하여 cDNA를 합성하였다. 각각의 유전자를 증폭시킬 수 있도록 합성된 올리고(oligo)와 함께 dsDNA(double strand deoxyribonucleic acid)에 끼어들어가는 SYBR Green의 특성을 이용한 SYBR Green Master(Roche)를 사용하여 7500-Real-Time PCR system(Applied Biosystems, Foster City, CA)에서 실시간으로 cDNA의 증폭과정을 확인하였다. 결과는 Actin의 발현으로 정량화하여 표시하였다. 사용된 프라이머들은 PCR 증폭과정에서 100 내지 200bp 정도의 단일 앰플리콘(single amplicon)을 형성함을 확인하였다. 사용한 염기서열은 하기 표 3과 같다.Specifically, total RNA was isolated using a TRI reagent (Ambion) from the experimental group in which the cellagenella rose sample was treated for 24 hours on the cells treated with ultraviolet rays by the method of Example 3-3, and then High-capacity cDNA Reverse Transcription kit (Applied Biosystems) was used to synthesize cDNA. A 7500-Real-Time PCR system (Applied) using SYBR Green Master (Roche) using the characteristics of SYBR Green that intervenes in dsDNA (double strand deoxyribonucleic acid) together with an oligo synthesized to amplify each gene. Biosystems, Foster City, CA) confirmed the amplification process of cDNA in real time. The results were quantified and displayed by the expression of Actin. It was confirmed that the primers used formed a single amplicon of about 100 to 200 bp during the PCR amplification process. The nucleotide sequence used is shown in Table 3 below.

프라이머primer 프라이머 염기서열(5'→3')Primer nucleotide sequence (5'→3') 서열번호Sequence number ActinActin forwardforward GGCACCACACCTTCTACAATGGCACCACACCTTCTACAAT 서열번호 1SEQ ID NO: 1 reversereverse GCCTGGATAGCAACGTACATGCCTGGATAGCAACGTACAT 서열번호 2SEQ ID NO: 2 MMP-1MMP-1 forwardforward AACACATCTGACCTACAGGATTGAAA AACACATCTGACCTACAGGATTGAAA 서열번호 3SEQ ID NO: 3 reversereverse CTTGGTGAATGTCAGAGGTGTGACTTGGTGAATGTCAGAGGTGTGA 서열번호 4SEQ ID NO: 4 MMP-2MMP-2 forwardforward ACTGGAGCAAAAACAAGAAGACATACACTGGAGCAAAAACAAGAAGACATAC 서열번호 5SEQ ID NO: 5 reversereverse TCCATTTTCTTCTTCACCTCATTGTCCATTTTCTTCTTCACCTCATTG 서열번호 6SEQ ID NO: 6 MMP-9MMP-9 forwardforward GCGCTGGGCTTAGATCATTCGCGCTGGGCTTAGATCATTC 서열번호 7SEQ ID NO: 7 reversereverse GTGCCGGATGCCATTCAGTGCCGGATGCCATTCA 서열번호 8SEQ ID NO: 8 COL1A1COL1A1 forwardforward TGGCCTCGGAGGAAACTTTTGGCCTCGGAGGAAACTTT 서열번호 9SEQ ID NO: 9 reversereverse GCTTCCCCATCATCTCCATTCGCTTCCCCATCATCTCCATTC 서열번호 10SEQ ID NO: 10 COL1A2COL1A2 forwardforward CGGTGGTGGTTATGACTTTGGTCGGTGGTGGTTATGACTTTGGT 서열번호 11SEQ ID NO: 11 reversereverse GAAGGGTCTCAATCTGGTTGTTGGAAGGGTCTCAATCTGGTTGTTG 서열번호 12SEQ ID NO: 12

그 결과, 20㎍/㎖ 또는 50㎍/㎖ 농도의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물 또는 에틸아세테이트 추출물 처리에 의하여 자외선 조사에 의해 과발현된 MMP-1의 발현이 유의적으로 억제된 것으로 확인되었다(도 2).As a result, the expression of overexpressed MMP-1 by UV irradiation was significantly suppressed by treatment with 70% ethanol extract, 95% ethanol extract, or ethyl acetate extract of Celazinella Rossi at a concentration of 20 μg/ml or 50 μg/ml. It was confirmed to be (Fig. 2).

이와 같은 결과를 통하여, 셀라지넬라 로씨 추출물의 투여에 의하여 type Ⅰ, Ⅱ, Ⅲ 콜라겐을 분해하는 MMP-1의 발현이 억제됨으로써, 피부 노화 방지 및 주름 생성 개선 효과를 확인하였다.Through these results, it was confirmed that the expression of MMP-1, which decomposes type I, II, and III collagen, was suppressed by administration of the extract of Celazinella Rossi, thereby preventing skin aging and improving wrinkles.

또한, MMP-1에 의해 1차로 분해된 콜라겐 조각들을 더 잘게 분해하는 MMP-2와 MMP-9의 발현을 확인한 결과, 20 또는 50 ㎍/㎖ 농도의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물, 또는 에틸아세테이트 추출물의 처리에 의하여 자외선 조사에 의해 과발현된 MMP-2와 MMP-9의 발현 역시 유의적으로 감소한 것으로 확인되었다(도 3, 도 4).In addition, as a result of confirming the expression of MMP-2 and MMP-9, which further decomposes collagen fragments firstly decomposed by MMP-1, a concentration of 20 or 50 μg/mL of Celagenella Rossi 70% ethanol extract, 95% It was confirmed that the expressions of MMP-2 and MMP-9 overexpressed by ultraviolet irradiation by treatment with ethanol extract or ethyl acetate extract were also significantly reduced (FIGS. 3 and 4).

그 외에, MMPs들의 타겟인 콜라겐의 발현을 조절하는 COL1A1과 COL1A2 유전자의 발현을 확인한 결과, 20 또는 50 ㎍/㎖ 농도의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물, 또는 에틸아세테이트 추출물의 처리에 의하여 자외선 조사에 의해 발현 저하된 COL1A1과 COL1A2 유전자의 발현이 유의적으로 증가한 것으로 확인되었다(도 5, 도 6).In addition, as a result of confirming the expression of the COL1A1 and COL1A2 genes that regulate the expression of collagen, which is a target of MMPs, a concentration of 20 or 50 µg/ml of Celazinella Rossi 70% ethanol extract, 95% ethanol extract, or ethyl acetate extract It was confirmed that the expression of COL1A1 and COL1A2 genes whose expression was reduced by UV irradiation by the treatment was significantly increased (FIGS. 5 and 6).

3-5. 셀라지넬라 로씨와 동속이종 식물의 MMP-1 발현 억제 효과 비교3-5. Comparison of Inhibitory Effects of Cellagenella Rossi and Xenogenes on MMP-1 Expression

셀라지넬라 로씨와 동속이종 식물인 셀라지넬라 타마리시나(S. tamariscina) 및 셀라지넬라 인볼벤스(S. involvens)의 추출물의 UV에 의해 유도된 MMP-1 발현 억제 효과를 확인하고, 이를 셀라지넬라 로씨 추출물의 효과와 비교하였다(하기 표 4 참조). 구체적인 실험방법은 상기 실시예 3-4와 동일하다. We confirmed the effect of inhibiting UV-induced MMP-1 expression of the extracts of S. tamariscina and S. involvens, which are allogeneic plants of C. It was compared with the effect of the celaginella rosi extract (see Table 4 below). The specific experimental method is the same as in Example 3-4.

학명Scientific name 채집 국가(지역)Collection country (region) 부위part 추출용매Extraction solvent SRSR S. rossiiS. rossii China (연변)China (Yanbian) Whole plantWhole plant 95% EtOH Ex.95% EtOH Ex. STST S. tamariscinaS. tamariscina China (연변)China (Yanbian) Whole plant Whole plant MeOH Ex.MeOH Ex. ST-LST-L S. tauntonianaS. tauntoniana 한국Korea Leaf Leaf MeOH Ex.MeOH Ex. ST-SST-S S. tamariscinaS. tamariscina 한국Korea Stem Stem MeOH Ex.MeOH Ex. SISI S. involvensS. involvens 한국Korea Whole plant Whole plant 95% EtOH Ex.95% EtOH Ex.

실험결과, 셀라지넬라 로씨 추출물(SR)은 셀라지넬라 타마리시나(ST, ST-L, ST-S) 추출물 및 셀라지넬로 인볼벤스(SI) 추출물보다 MMP-1 발현 억제 효과가 우수함을 확인하였다. (도 7 참조)As a result of the experiment, it was found that the Cellagenella Rossi Extract (SR) has a better effect of inhibiting MMP-1 expression than the Cellagenella tamaricina (ST, ST-L, ST-S) extract and the Cellagenello involence (SI) extract. Confirmed. (See Fig. 7)

이제까지 본 발명에 대하여 그 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.So far, the present invention has been looked at focusing on the examples. Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii <130> PN190293-P1 <150> KR 10-2019-0118790 <151> 2019-09-26 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin_forward <400> 1 ggcaccacac cttctacaat 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin_reverse <400> 2 gcctggatag caacgtacat 20 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MMP-1_forward <400> 3 aacacatctg acctacagga ttgaaa 26 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MMP-1_reverse <400> 4 cttggtgaat gtcagaggtg tga 23 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MMP-2_forward <400> 5 actggagcaa aaacaagaag acatac 26 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MMP-2_reverse <400> 6 tccattttct tcttcacctc attg 24 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-9 Forward primer <400> 7 gcgctgggct tagatcattc 20 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> MMP-9 Reverse primer <400> 8 gtgccggatg ccattca 17 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> COL1A1 Forward primer <400> 9 tggcctcgga ggaaacttt 19 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> COL1A1 Reverse primer <400> 10 gcttccccat catctccatt c 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> COL1A2 Forward primer <400> 11 cggtggtggt tatgactttg gt 22 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> COL1A2 Reverse primer <400> 12 gaagggtctc aatctggttg ttg 23 <110> Korea Research Institute of Bioscience and Biotechnology <120> Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii <130> PN190293-P1 <150> KR 10-2019-0118790 <151> 2019-09-26 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin_forward <400> 1 ggcaccacac cttctacaat 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin_reverse <400> 2 gcctggatag caacgtacat 20 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MMP-1_forward <400> 3 aacacatctg acctacagga ttgaaa 26 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MMP-1_reverse <400> 4 cttggtgaat gtcagaggtg tga 23 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MMP-2_forward <400> 5 actggagcaa aaacaagaag acatac 26 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MMP-2_reverse <400> 6 tccattttct tcttcacctc attg 24 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-9 Forward primer <400> 7 gcgctgggct tagatcattc 20 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> MMP-9 Reverse primer <400> 8 gtgccggatg ccattca 17 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> COL1A1 Forward primer <400> 9 tggcctcgga ggaaacttt 19 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> COL1A1 Reverse primer <400> 10 gcttccccat catctccatt c 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> COL1A2 Forward primer <400> 11 cggtggtggt tatgactttg gt 22 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> COL1A2 Reverse primer <400> 12 gaagggtctc aatctggttg ttg 23

Claims (6)

셀라지넬라 로씨(Selaginella rossii) 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물.Selaginella Rossi ( Selaginella rossii ) A cosmetic composition for preventing skin aging and improving skin wrinkles comprising an extract. 제 1 항에 있어서, 상기 추출물은 에탄올 추출물 또는 에틸아세테이트 추출물인 것인 화장료 조성물. The cosmetic composition according to claim 1, wherein the extract is an ethanol extract or an ethyl acetate extract. 제 1 항에 있어서, 상기 피부 노화 및 상기 피부 주름은 피부의 자외선 노출에 의해 발생하는 것인 화장료 조성물.The cosmetic composition according to claim 1, wherein the skin aging and the skin wrinkles are caused by exposure to ultraviolet rays of the skin. 제 1 항에 있어서, 상기 셀라지넬라 로씨 추출물은 자외선에 의해 증가된 MMP-1, MMP-2 및 MMP-9의 발현을 억제함으로써 피부 노화 방지 및 피부 주름 개선 효과를 나타내는 것인 화장료 조성물.The cosmetic composition according to claim 1, wherein the celaginella rosi extract inhibits the expression of MMP-1, MMP-2, and MMP-9 increased by ultraviolet rays, thereby preventing skin aging and improving skin wrinkles. 제 1 항에 있어서, 상기 셀라지넬라 로씨 추출물은 자외선에 의해 감소된 COL1A1과 COL1A2의 발현을 증가시킴으로써 피부 노화 방지 및 피부 주름 개선 효과를 나타내는 것인 화장료 조성물. The cosmetic composition according to claim 1, wherein the celaginella rosi extract increases the expression of COL1A1 and COL1A2 reduced by ultraviolet rays, thereby preventing skin aging and improving skin wrinkles. 제 1 항에 있어서, 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이로 이루어진 군에서 선택되는 어느 하나의 제형인 것인 화장료 조성물.
The method of claim 1, wherein the cosmetic composition is composed of a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray. A cosmetic composition that is any one formulation selected from the group.
KR1020200105022A 2019-09-26 2020-08-21 Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii KR102335262B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190118790 2019-09-26
KR20190118790 2019-09-26

Publications (2)

Publication Number Publication Date
KR20210036803A true KR20210036803A (en) 2021-04-05
KR102335262B1 KR102335262B1 (en) 2021-12-07

Family

ID=75166722

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200105022A KR102335262B1 (en) 2019-09-26 2020-08-21 Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii

Country Status (2)

Country Link
KR (1) KR102335262B1 (en)
WO (1) WO2021060714A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240054152A (en) 2022-10-18 2024-04-25 경북대학교 산학협력단 Cosmetic composition for improving skin condition comprising Selaginella martensii extract as an active ingredient

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050105616A (en) * 2004-04-30 2005-11-04 한불화장품주식회사 A composition of skin agent containing extract of saussurea spp and selaginella tamariscina
KR20070045157A (en) 2004-05-31 2007-05-02 쇼와 덴코 가부시키가이샤 Topical slimming preparation and a cosmetic containing a carnitine derivative
KR20080105730A (en) * 2007-06-01 2008-12-04 (주)아모레퍼시픽 Anti-wrinkle composition for external applications to the skin containing biflavonoid derivatives

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4880816B2 (en) * 2000-12-15 2012-02-22 株式会社ヤクルト本社 Skin anti-aging agent
CN102258442B (en) * 2011-07-15 2012-11-28 广州市娇兰化妆品有限公司 Compound traditional Chinese medicine extract and application thereof to whitening, moisturizing and anti-aging skin care product
WO2019124803A1 (en) * 2017-12-18 2019-06-27 한국생명공학연구원 Composition comprising selaginella rossii warb. extract or fractions thereof for preventing or treating metabolic syndromes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050105616A (en) * 2004-04-30 2005-11-04 한불화장품주식회사 A composition of skin agent containing extract of saussurea spp and selaginella tamariscina
KR20070045157A (en) 2004-05-31 2007-05-02 쇼와 덴코 가부시키가이샤 Topical slimming preparation and a cosmetic containing a carnitine derivative
KR20080105730A (en) * 2007-06-01 2008-12-04 (주)아모레퍼시픽 Anti-wrinkle composition for external applications to the skin containing biflavonoid derivatives

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240054152A (en) 2022-10-18 2024-04-25 경북대학교 산학협력단 Cosmetic composition for improving skin condition comprising Selaginella martensii extract as an active ingredient

Also Published As

Publication number Publication date
KR102335262B1 (en) 2021-12-07
WO2021060714A1 (en) 2021-04-01

Similar Documents

Publication Publication Date Title
KR101914157B1 (en) Cosmetic composition comprising camellia sinensis constituents
KR101040507B1 (en) Cosmetic composition for protecting skin against uv light and wrinkle improvement containing the extract of magnolia sieboldii flower extracts
KR101589002B1 (en) Cosmetic composition containing sargassum serratifolium extract for improving skin wrinkle
CN106821948B (en) Cosmetic composition containing Usnea fermented extract of Tremella mycelia as effective component
KR102251854B1 (en) Cosmetic composition for skin moisturizing and anti-wrinkle comprising Chamaecyparis obtusa leaf mixed extract as effective component
KR102335262B1 (en) Cosmetic composition for preventing skin aging and improving skin winkle comprising extracts of Selaginella rossii
KR20170055172A (en) Cosmetic Composition Comprising Extracts of Centipeda minima
KR20130138677A (en) Antiaging cosmetic composition
KR102508159B1 (en) Cosmetic Composition for Preventing Skin Aging and Improving Skin Winkle comprising Extract of Viburnum stellato-tomentosum
KR20080085432A (en) Whitening cosmetic composition comprising an extract of halocynthia sp. shell
KR101917711B1 (en) Cosmetic composition for improving skin wrinkle comprising fermented extract of sonchus oleraceus
KR101883307B1 (en) Cosmetic composition for improving skin wrinkle comprising extracts of hibiscus hamabo leaf as active ingredient
KR101445642B1 (en) Cosmetic composition comprising the extract of Lagerstroemia indica as active ingredient
KR102168533B1 (en) Cosmetic composition for whitening or improving the facial color containing herb extracts
KR102157395B1 (en) Cosmetic Composition including Rosa davurica Pall Callus Cultured in medicum containing mineral water
KR101176525B1 (en) Cosmetic Composition Comprising Acer tegmentosum Maxim as Active Ingredient
KR101825178B1 (en) Cosmetic composition comprising extract of dendropanax morbifera and d-asparatic acid with reinforced wrinkle elimanatin and whitening effect
KR101926179B1 (en) Cosmetic composition containing canavalia lineata extract for moisturizing and anti-wrinkle effects on the skin
CN111491615A (en) Cosmetic composition for improving skin wrinkles comprising fermented liquid of fruit of Sophora japonica or its extract as effective component and its preparation method
KR102062311B1 (en) Method for Producing Agaricus Blazei Extract, Extract and Cosmetic Composition Using the Same
KR102447998B1 (en) Cosmetic composition for improving skin wrinkle comprising extract of poncirus trifoliata fruit as active ingredient
KR102134150B1 (en) A composition comprising extract of Prasiola japonica for improving skin wrinkle caused by photoaging
KR102622691B1 (en) Cosmetic Composition For Prohibiting Skin Aging By Light Comprising Acer Tegmentosum And Fraction From Thereof As Active Ingredient
KR101479244B1 (en) Cosmetic composition comprising the extract of Lagerstroemia indica as active ingredient
KR101978335B1 (en) Fragrance composition comprising fermented product by yeast from flowers and manufacturing method thereof

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant