WO2019124803A1

WO2019124803A1 - Composition comprising selaginella rossii warb. extract or fractions thereof for preventing or treating metabolic syndromes

Info

Publication number: WO2019124803A1
Application number: PCT/KR2018/014960
Authority: WO
Inventors: 정태숙; 박호용; 이화; 피아오런쯔; 이상우; 최상호; 리후린; 김은진
Original assignee: 한국생명공학연구원
Priority date: 2017-12-18
Filing date: 2018-11-29
Publication date: 2019-06-27
Also published as: KR102036302B1; CN111491645A; CN111491645B; KR20190073265A

Abstract

The present invention provides a composition for preventing, improving, or treating metabolic syndromes comprising Selaginella rossii Warb. extract, fractions thereof, or both as active ingredients. The composition of the present invention strongly inhibits diphenylpeptidase-4(DPP-4), induces increased secretion of insulin in pancreatic beta cells, promotes increased secretion of GLP-1, inhibits fat accumulation in adipocytes, effectively inhibits oxidation of low density lipoprotein(LDL), improves weight gain, improves hyperglycemia and glucose tolerance by high fat diet, lowers blood triglyceride levels, and shows liver protection efficacy. Thus, the present invention can be effectively used for preventing or treating metabolic syndromes as well as has excellent antioxidant activity and can be effectively used as an antioxidant composition.

Description

Composition for prevention or treatment of metabolic syndrome including Selaginella radish extract, fraction thereof

The present invention relates to a composition for preventing, ameliorating or treating metabolic syndrome containing Selaginella rossii Warb. Extract, fraction thereof, or all of them as an active ingredient.

Glucagon-like peptide-1 (GLP-1), an incretin secreted in human intestinal L cells, has receptors in many tissues of the human body. GLP-1 is known to have a strong effect on insulin action in postprandial blood glucose control in response to nutrients ingested into the small intestine (Diabetes Care, 19: 580-586, 1996). In addition, pancreatic tissue promotes insulin secretion and cell growth of beta (beta) cells, and suppresses the secretion of glucagon from alpha cells and regulates the body's blood sugar. Therefore, it is known that GLP-1 is associated with lowering of blood glucose, maintaining the sensitivity of pancreatic beta cells, and reduction of appetite, and GLP-1 receptor agonist is the only weight loss effect of diabetic drugs developed so far (Diabetologia 55: 1577-1596, 2012).

Dipeptidyl peptidase-4 (DPP-4; EC 3.4.14.5) belongs to a functionally serine protease (Barrett AJ et al., Arch. Biochem. Biophys., 318: 247-250, 1995) DPP-4 degrades GLP-1 in the small intestine to convert the active GLP-1 into an inactive GLP-1 (9-36) (Eur. J. Biochem., 214: 829-835, 1993). Thus, DPP-4 inhibitors have been used as highly potent agents for the treatment of type 2 diabetes and impaired glucose tolerance. In addition, since it is known that Type 1 diabetes (insulin-dependent diabetes), arthritis, obesity or osteoporosis is mediated by the activity of DPP-IV, drugs having an inhibitory action on DPP- It can play a very important role as a candidate drug for treatment.

Oxidation of low-density lipoprotein (LDL) due to oxidative stress generated in vitro and ex vivo produces fatty streaks, which are early lesions of atherosclerosis, leading to various complications including atherosclerosis. (Circulation, 91: 2488-2496, 1995, Arterioscler. Thromb. Vasc Biol., 17: 3338-3346, 1997).

The inhibition of GLP-1 (glucagon-like peptide-1) secretion, inhibition of DDP-4 expression, antioxidant activity, inhibition of lipid-lowering lipoprotein (LDL) These are very important factors.

Metabolic syndrome refers to a condition in which the risk factors of death such as diabetes, obesity, insulin resistance, fatty liver, hyperlipidemia, arteriosclerosis, or complications thereof coexist. The incidence of these metabolic syndromes is increasing rapidly in Korea, and it is known that the incidence of metabolic syndrome has increased to the level of advanced countries such as the United States and Western Europe or more.

(T-CHL) and low-density lipoprotein cholesterol (LDL-C) are known to be the major factors associated with gastric metabolic syndrome as blood lipid components are identified as a risk factor for arteriosclerosis. In addition, common symptoms of metabolic syndrome are associated with obesity, which is associated with hypertension, hyperlipidemia, and cardiovascular disease.

Metabolic syndrome has not been developed yet, and it is attempting to treat metabolic syndrome using drugs for the treatment of diabetes, hyperlipidemia and hypertension. Metformin, TZD (thiazolidinediones) drugs, glucosidase inhibitors and dipeptidyl peptidase (DDP) -IV inhibitors, which are currently used as diabetic drugs, are expected to be used as medicines for the treatment of metabolic syndrome In addition, blood pressure treatment and hyperlipemia treatment are attracting attention. However, there is a limit to improving metabolic syndrome with these drugs.

The factors associated with the cause and treatment of metabolic syndrome include exercise, dietary habits, weight, blood glucose, triglyceride, cholesterol, insulin resistance, adiponectin, leptin, AMP-activated protein kinase (AMPK) , Sex hormones such as estrogen, genetic factors, and in vivo concentrations of malonyl-CoA.

Therefore, for the effective management or treatment of metabolic syndrome with complex symptoms, it is ideal to develop a material capable of simultaneously treating hypoglycemia and hypertension simultaneously with the hypoglycemic effect for maintenance of normal blood sugar. However, There is a lack of development.

Selaginella rossii Warb. Is a plant of the order Selaginellaceae and is referred to as a guerrilla or a pit. Selaginella Rossi is a morphologically characterized stem with irregular branching, irregular branching, no stalks attached to the sporangium, and sawtooth on the lower side of the leaf. It has different morphological characteristics I have. No studies have been reported on the efficacy and functionality of the Selaginella radish extract, its fractions, or both.

The present inventors have confirmed the prevention, improvement and therapeutic effect of the metabolic syndrome using Selaginella rossii extract, fractions thereof, or all of them, in order to solve the problems of the above prior arts. As a result, the Selaginella rossii extract, its fractions, or all thereof, significantly inhibited DPP-4 activity, induced an increase in the secretion of insulin in pancreatic beta cells, and secreted GLP-1 in secretory L cells The inventors have confirmed that the expression of the related genes is controlled to promote the secretion of GLP-1, the lipid accumulation is inhibited in 3T3-L1 adipocytes, and the oxidation of LDL is effectively inhibited.

It is an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of metabolic syndrome containing Selaginella rossii extract, a fraction thereof, or all of them as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or ameliorating a metabolic syndrome containing Selaginella rossii extract, a fraction thereof, or all of them as an active ingredient.

Another object of the present invention is to provide an antioxidative composition containing Selaginella rossii extract, a fraction thereof, or all of them as an active ingredient.

An aspect of the present invention provides a pharmaceutical composition for preventing or treating a metabolic syndrome comprising Selaginella rossii extract, a fraction thereof, or both of them as an active ingredient.

According to one embodiment of the present invention, the metabolic syndrome may be selected from diabetes, obesity, fatty liver, hyperlipidemia, atherosclerosis, and complications thereof.

According to one embodiment of the present invention, the Selaginella rossii extract may be water, a lower C ₁ -C ₄ alcohol, ethyl acetate or a mixed solvent thereof.

According to one embodiment of the present invention, the Selaginella rossii extract may be any one selected from the group consisting of an ethanol extract, an aqueous ethanol solution, a methanol extract, an aqueous methanol solution and an ethyl acetate extract.

According to one embodiment of the present invention, the fraction may be ethyl acetate or a butanol fraction.

Another aspect of the present invention provides a food composition for preventing or ameliorating a metabolic syndrome comprising Selaginella rossii extract, a fraction thereof, or both.

According to one embodiment of the present invention, the Selaginella rossii extract may be water, C ₁ -C ₄ lower alcohol, ethyl acetate, or a mixed solvent thereof.

Another aspect of the present invention provides a pharmaceutical composition for antioxidant comprising Selaginella rossii extract, a fraction thereof, or both of them as an active ingredient.

The Selaginella rossii extract of the present invention, its fractions or all thereof strongly inhibits diphenylpeptidase-4 (DPP-4) activity, induces increased secretion of insulin in pancreatic beta cells, and inhibits GLP- 1, inhibits fat accumulation in adipocytes, effectively inhibits the oxidation of low density lipoprotein (LDL), improves weight gain, hyperglycemia and glucose tolerance by high fat diet, and increases serum triglyceride levels To be used for prevention or treatment of metabolic syndrome as well as being excellent in antioxidative activity and thus can be usefully used as an antioxidant composition.

FIG. 1 shows the results of confirming an increase in the amount of insulin secretion according to the treatment with Selaginella lucia ethanol extract or ethyl acetate fraction in pancreatic beta cells induced by high glucose (30 mM).

FIG. 2 shows the results of confirming an increase in the amount of GLP-1 secreted by treatment of Selaginella lucia ethanol extract or ethyl acetate fraction in visceral L cells.

FIG. 3 shows the results of confirming the increase of expression of proglucagon, PCSK1 / 3, GPR119 and PPARβ / δ, which are genes involved in the synthesis of GLP-1 by treatment of Selaginella lucia ethanol extract or ethyl acetate fraction in visceral L cells.

FIG. 4 is a graph showing the effect of PLN2 on the lipolysis process by the metabolic clock genes ARNTL, PER2, NR1D1 and GLP-1, which regulate the secretion of GLP-1 by treatment with Selaginella lucia ethanol extract or ethyl acetate fraction in visceral L cells Of the cells.

FIG. 5 shows a microscopic photograph in which fat accumulation was inhibited by treatment of Selaginella radish ethanol extract or ethyl acetate fraction in 3T3-L1 differentiated adipocytes.

FIG. 6 shows the result of confirming inhibition of fat accumulation by treatment of Selaginella lucia ethanol extract or ethyl acetate fraction in 3T3-L1 differentiated adipocytes.

FIG. 7 is a graph showing the inhibition of weight gain by the administration of Selaginella radicillium ethanol extract or ethyl acetate extract in a mouse model in which a high fat diet is weighted.

FIG. 8 is a graph showing blood glucose lowering by administration of Selaginella lucia ethanol extract or ethyl acetate extract in a model in a mouse model in which hyperglycemia was induced by high fat diet.

FIG. 9 shows that the glucose tolerance by the glucose administration in the mouse model induced by the high fat diet method is significantly improved in the Selaginella radish ethanol extract group or the ethyl acetate extract group.

FIG. 10 shows the result that the blood glucose level curve of the mouse model in which the high fat diet induces glucose tolerance is improved by the administration of Selaginella radish ethanol extract or ethyl acetate extract.

FIG. 11 is a graph showing changes in insulin concentration in blood before and after glucose administration in a mouse model in which high glucose tolerance induces glucose tolerance.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating a metabolic syndrome comprising Selaginella rossii extract, fraction thereof, or all of them as an active ingredient.

In the present invention, Selaginella rossii can be used without limitation such as stems, leaves, roots, spores and the like. Selaginella rossii is widely distributed throughout Korea, northern China, Russia, and South Korea, so it is easy to secure raw materials at low cost and can be purchased or collected directly.

In the present invention, the extraction method such as hot water extraction, immersion extraction, reflux cooling extraction and ultrasonic extraction can be used. The number of times of extraction is preferably 1 to 5 times. The extraction solvent may be a solvent selected from water, an alcohol or a mixture thereof, preferably water, a C ₁ to C ₄ lower alcohol (e.g., methanol, ethanol, propanol, isopropanol, butanol, etc.), ethyl acetate, But is not limited thereto.

The amount of the extraction solvent is 1 to 15 times the weight of Selaginella rossii . According to one embodiment of the present invention, in the case of Selaginella rossii aqueous solution extract of ethanol, it is extracted at room temperature for 24 to 72 hours, preferably for about 48 hours. According to another embodiment of the present invention, in the case of Selaginella rossii aqueous methanol solution extract, it is extracted at room temperature for 24 to 72 hours, preferably about 48 hours.

The Selaginella rossii extract according to the present invention may be any one selected from the group consisting of an ethanol extract, an aqueous ethanol solution, a methanol extract, an aqueous methanol solution and an ethyl acetate extract.

The present invention also provides a Selaginella rossii fraction obtained by further isolating the Selaginella rossii extract. Fractionation of the Selaginella rossii extract is carried out by a separation method known in the art. Preferably, the extract of Selaginella rossii is suspended in a low-alcohol such as methanol, ethanol or propanol and then extracted with a solvent such as hexane, chloroform, ethyl acetate, butanol or water to obtain a fraction have. According to an embodiment of the present invention, an aqueous solution of an aqueous ethanol solution of Selaginella rossii is suspended in methanol, the hexane fraction layer is separated by adding hexane, the hexane is separated, and the remaining water layer is washed with chloroform, ethyl acetate, Are sequentially added to prepare each fraction.

In the present invention, the fraction may preferably be ethyl acetate or a butanol fraction of Selaginella rossii .

The metabolic syndrome can be any one selected from diabetes (e.g., type 1, type 2 diabetes), obesity, fatty liver, hyperlipidemia, arteriosclerosis, and complications thereof. Such complications may include, for example, coronary artery disease, angina pectoris, carotid artery disease, stroke, cerebral arterial sclerosis, hypercholesterolemia, cholesterol stone, hypertriglyceridemia, hypertension, cataract, kidney disease and the like.

The Selaginella rossii extract or its fraction according to the present invention significantly inhibits DPP-4 activity, induces an increase in insulin secretion in pancreatic beta cells, and inhibits GLP-1 synthesis and secretion-related genes 1 is effective in preventing or treating metabolic syndrome by controlling the expression of GLP-1, promoting the secretion of GLP-1, inhibiting lipid accumulation in 3T3-L1 adipocytes and effectively inhibiting LDL oxidation.

To include a cellar not Nella Rossi (Selaginella rossii) extract or a fraction of from 0.1 to 95% by weight relative to the total weight of the pharmaceutical composition containing as an active ingredient Cellar not Nella Rossi (Selaginella rossii) extracts or fractions thereof thereof of the present invention But is not limited thereto.

The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier and may be in the form of powders, granules, tablets, capsules, suspensions, emulsions, oral preparations such as syrups and aerosols, external preparations, Can be formulated in the form of sterile injectable solutions.

Such pharmaceutically acceptable carriers may be those conventionally used in the art such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, But are not limited to, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the pharmaceutical composition of the present invention includes diluents or excipients such as fillers, extenders, binders, humectants, disintegrants, surfactants, and other pharmaceutically acceptable additives.

When the pharmaceutical composition of the present invention is formulated into a solid preparation for oral use, it includes tablets, pills, powders, granules, capsules and the like. Such a solid preparation may contain at least one excipient such as starch, calcium carbonate, Sucrose or lactose, gelatin, and the like, including, but not limited to, lubricants such as magnesium stearate, talc, and the like.

When the pharmaceutical composition of the present invention is formulated orally for oral use, it includes suspensions, solutions, emulsions, syrups and the like, and includes, but is not limited to, diluents such as water and liquid paraffin, wetting agents, sweeteners, fragrances and preservatives.

When the pharmaceutical composition of the present invention is formulated for parenteral use, it may contain a sterilized aqueous solution, a non-aqueous solvent, a suspending agent, an emulsion, a lyophilized preparation and a suppository. Examples of the non-aqueous solvent include propylene glycol, polyethylene glycol, Vegetable oils such as oils, injectable esters such as ethyl oleate, and the like. Examples of suppositories include, but are not limited to, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The dosage of the Selaginella rossii extract or its fraction contained in the pharmaceutical composition of the present invention varies depending on the condition and body weight of the patient, the age, the degree of the disease, the drug form, the administration route and the period, Can be appropriately selected. For example, the Selaginella rossii extract or its fractions may be administered at a dose of 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg per day, Or may be administered in divided doses.

The pharmaceutical composition of the present invention may be administered to mammals such as rats, mice, livestock, humans, and the like by various routes, for example, oral, intraperitoneal or intravenous, muscular, subcutaneous, intrauterine, .

In order to achieve the above object, the present invention also provides a food composition for preventing or ameliorating a metabolic syndrome comprising Selaginella rossii extract, a fraction thereof, or all of them as an active ingredient.

The food composition of the present invention can be used as a health functional food. The term "functional food" as used herein means a food produced or processed by using raw materials or ingredients having functionality useful to the human body according to the Act on Health Functional Foods, and "functional" refers to the structure and functions of the human body Means taking nutrients for the purpose of obtaining a beneficial effect for health use such as controlling nutrients or physiological action.

The food composition of the present invention may contain conventional food additives, and the suitability of the term "food additives" as referred to above is to be determined by the Food and Drug Administration according to the General Rules and General Test Methods approved by the Food and Drug Administration It shall be judged according to standards and standards for items.

Examples of the substances found in the above-mentioned "food additives" include natural compounds such as ketones, chemical compounds such as glycine, potassium citrate, nicotinic acid and cinnamic acid, coloring pigments, licorice extracts, crystalline cellulose, high- L-glutamic acid sodium preparations, noodle-added alkalis, preservative preparations, tar pigment preparations and the like.

The food composition of the present invention may contain 0.01 to 95% by weight, preferably 1 to 80% by weight, of the Selaginella rossii extract, its fractions or all of them, based on the total weight of the composition. The Selaginella rossii extract, fractions thereof or all of them contained in the food composition of the present invention can be obtained in the same manner as the extraction method mentioned in the production of the above pharmaceutical composition.

In addition, the food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, and circles for the purpose of preventing and / or improving the metabolic syndrome.

For example, the health functional food in the form of tablets may be prepared by granulating a mixture of Selaginella rossii extract, its fractions or both, excipients, binders, disintegrants, and other additives in a conventional manner , A lubricant, and the like may be put in a compression molding, or the mixture may be directly compression molded. The health functional food of the tablet form may contain a mating agent and the like if necessary, and may be sieved to a suitable skin care agent if necessary.

The hard capsule in a capsule form of health functional food may be prepared by mixing a conventional hard capsule with a mixture of Selaginella rossii extract, a fraction thereof, or all of them, and additives such as excipients or the like, And the soft capsule can be prepared by filling a capsule base such as gelatin with a mixture of Selaginella rossii extract, fraction thereof, or all of them, and additives such as excipients. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a coloring agent, a preservative and the like, if necessary.

The ring-shaped health functional food can be prepared by molding Selaginella rossii extract, its fractions, or a mixture of all of these, excipients, binders, disintegrants, etc., by an appropriate method, and if necessary, It may also be converted into starch, talc or a suitable substance.

The granular health functional food may be prepared by granulating a mixture of Selaginella rossii extract, fractions thereof, all of them, excipients, binders, disintegrants and the like by a suitable method, and if necessary, And the like. In the granular form of health functional foods, when the next granularity test was carried out using the No. 12 (1680 μm), No. 14 (1410 μm) and No. 45 (350 μm) sieve, the total amount of the 12- 5.0% or less and that passing through the 45-well body may be 15.0% or less of the total amount.

The definitions of the above excipients, binders, disintegrants, lubricants, mating agents, flavoring agents, and the like are described in documents known in the art and include the same or similar functions (Korean Pharmacopoeia, College of Pharmacy, 5th ed., P. 33-48, 1989).

There is no particular limitation on the kind of the food. Examples of foods to which the extract of the present invention can be added include beverages, gums, vitamin complexes, and drinks, and include all health functional foods in a conventional sense.

In order to achieve the above object, the present invention also provides an antioxidant composition comprising Selaginella rossii extract, a fraction thereof, or all of them.

The term "antioxidant" refers to a function to inhibit, reduce or control the generation or reaction of hydroxyl radicals generated from the hydrogen peroxide or hydrogen peroxide generated from the free radicals, the free radicals generated in the body in a narrow range, The broad range refers to the action of inhibiting, reducing or controlling the generation of an oxidation reaction occurring in the natural world. For purposes of the present invention, the antioxidant is understood as a narrow range of antioxidants and can be understood as an action that inhibits, reduces or controls the production or reaction of free radicals or hydrogen peroxide, which occurs mainly at the cellular level, but is not particularly limited thereto Do not.

The Selaginella rossii extract, fractions thereof or all of them according to the present invention can increase the activity of antioxidant enzymes or increase the protein expression of antioxidant enzymes. In particular, it has an excellent effect in terms of effectively suppressing oxidation of LDL. The antioxidant composition can be used in pharmaceutical compositions, food compositions, cosmetic compositions, and the like.

The present invention provides a method of treating a metabolic syndrome comprising administering to a subject a Selaginella rossii extract, a fraction thereof, or both.

The term " Selaginella rossii extract, fraction thereof or all of them ","metabolic syndrome ",and" administration "and the like are the same as described above in the present invention.

The subject refers to an animal and can typically be a mammal capable of exhibiting beneficial effects with the Selaginella rossii extract of the present invention, fractions thereof, or both. A preferred example of such a subject may include primates such as humans. Such subjects may also include all subjects with or at risk of having symptoms of the metabolic syndrome.

The present invention also provides the use of said Selaginella rossii extract, fractions thereof, or both, in the manufacture of a medicament for the treatment of metabolic syndrome.

The present invention also provides a composition comprising said Selaginella rossii extract, fractions thereof, or both, for use in the treatment of metabolic syndrome.

The present invention also provides said Selaginella rossii extract, fractions thereof, or all of these for the treatment of metabolic syndrome.

Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described in detail below. The present invention may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. Is provided to fully convey the scope of the invention to those skilled in the art, and the invention is only defined by the scope of the claims.

실시예 1. 셀라지넬라 로씨 추출물의 제조Example 1. Preparation of Selaginella radish extract

Selaginella rossii Warb. (Origin: China, Yanbian) and dried at room temperature. The dried material was cut to a suitable size and pulverized using a blender mixer to obtain a pulverized material.

100 mL each of 70%, 95% (v / v) methanol, 50%, 70% and 95% (v / v) ethanol and ethyl acetate were added to 10 g of Sella jinelrolo crushed product, , And only the solvent-soluble portion was recovered using a filter paper (Whatman, No. 2). The extract was concentrated under reduced pressure to obtain an aqueous solution of Selaginella romcum methanol aqueous solution, an aqueous solution of ethanol solution and an ethyl acetate extract.

실시예 2. 셀라지넬라 로씨 분획물의 제조Example 2. Preparation of Selaginella radix Fractions

The 95% ethanol extract of Selaginella rosin in Example 1 was suspended in 10% methanol, and the same amount of n-hexane was added thereto. After shaking, the mixture was allowed to stand to separate into an upper layer composed of hexane and an aqueous layer below The fractionation process for separating only the upper layer was repeated three times to prepare hexane fractions. The chloroform fraction, the ethyl acetate fraction, the butanol fraction and the water fraction were successively added to the water layer in the same manner, and chloroform, ethyl acetate and butanol were sequentially added to the aqueous layer in succession after shaking, and the mixture was left to concentrate under reduced pressure to obtain ethyl Acetate fraction and 190 mg of the butanol fraction.

실시예 3. 셀라지넬라 로씨 추출물 및 이의 분획물의 DPP-4 저해 효과Example 3. DPP-4 inhibitory effect of Selaginella radish extract and its fractions

In order to evaluate the DPP-4 inhibitory activity of the Selaginella extract and the fractions thereof in Examples 1 and 2, 50 mM TrisHCl buffer (pH 7.5), human recombinant DPP-4 (ENZ375, Prospec), H- DPP-4 inhibitory activity was measured using -Pro-7-amino-4-rifluoromethylcoumarin (AFC) (24126, AnaSpec). 2 μl of sample, 78 μl of 50 mM Tris-HCl buffer and 10 μl of 1 μg / ml DPP-4 were added to a 96-well plate and reacted for 10 minutes at room temperature. 10 μl of 0.4 mM H-Ala-Pro-AFC substrate was added to each well and reacted at room temperature for 1 hour. Then, DPP-4 was added to each well using a fluorometer (Victor 2, Perkin Elmer, excitation 355 nm, And the fluorescence value of AFC degraded from the dipeptide was measured to calculate DPP-4 activity. DMSO was used as a control group and sitagliptin (Sigma), a DPP-4 inhibitor, was used as a positive control.

구분division	시료농도(㎍/㎖)Sample concentration (/ / ml)	DPP-4 저해활성(%)DPP-4 inhibitory activity (%)	IC₅₀(㎍/㎖)IC ₅₀ ([mu] g / ml)
셀라지넬라 로씨 95% 메탄올추출물95% Methanol Extract of Selaginella Rossi	5050	81.1±0.281.1 ± 0.2	18.018.0
셀라지넬라 로씨 70% 에탄올추출물70% ethanol extract of Selaginella Rossi	5050	79.7±0.479.7 ± 0.4	18.218.2
셀라지넬라 로씨 95% 에탄올추출물95% ethanol extract of Selaginella Rossi	5050	75.2±1.875.2 ± 1.8	18.818.8
셀라지넬라 로씨 에틸아세테이트추출물Selaginella rosin ethyl acetate extract	5050	94.5±1.094.5 ± 1.0	7.97.9
셀라지넬라 로씨 에틸아세테이트 분획Selaginella rocis ethyl acetate fraction	1010	91.5±1.191.5 ± 1.1	4.64.6

As shown in Table 1, the 95% methanol extract, 70%, 95% ethanol extract, ethyl acetate extract and ethyl acetate fraction of Selaginella radix according to the present invention showed very high DPP-4 inhibitory activity. The IC ₅₀ concentrations of the 95% methanol extract, 70%, 95% ethanol extract and ethyl acetate extract were 18.0, 18.2, 18.8 and 7.9 ㎍ / ml, respectively. Especially, the IC ₅₀ concentration of the ethyl acetate fraction was 4.6 μg / ml High DPP-4 inhibitory activity. From these results, the excellent effect of the Selaginella radish extract and its fractions was confirmed.

실시예 4. 셀라지넬라 추출물 및 분획물의 인슐린 분비 촉진 활성 Example 4. Insulin secretion promoting activity of Selaginella extract and fractions

(1) 세포배양(1) Cell culture

The mouse pancreatic β cell line MIN6 cells were cultured in Dulbecco's Modified Eagle's medium (DMEM, Hyclone) containing 15% fetal bovine serum (FBS, Gibco), 100 units / ml penicillin and 100 μg / ml streptomycin ℃ incubated in a humid 5% CO ₂ incubator.

(2) MIN6 베타세포에서 인슐린 분비능 측정(2) Measurement of insulin secretion ability in MIN6 beta cells

Cells were plated at a rate of 1 × 10 ⁵ per well on a 24-well plate and cultured in a humidified 5% CO ₂ incubator at 37 ° C. After 48 hours, the cells were first replaced with DMEM medium containing no glucose and left for 60 minutes. Then, the Selaginella radish extract and fraction samples according to the present invention were added to a DMEM medium containing high glucose (30 mM) And reacted for 30 minutes. Control groups were used without sample addition under the same conditions, and the insulin secreted into the medium was measured using an ELISA insulin kit (Alpco diagnostics).

As shown in FIG. 1, the ethanol extract of Selaginella radix according to the present invention was found to induce 55.8% insulin secretion increase at a concentration of 50 μg / ml compared to the control. It was also confirmed that treatment of the ethyl acetate fraction (50 μg / ml) induced 92.7% increase in insulin secretion (approximately 1.7 times of the extract) under the same conditions as the control group. From these results, the excellent effect of the Selaginella radish extract and its fractions was confirmed.

실시예 5. 셀라지넬라 추출물 및 분획물의 GLP-1 분비 촉진 활성Example 5 GLP-1 secretion promoting activity of Selaginella extract and fractions

(1) 세포배양 (1) Cell culture

NCI-H716 cells, a human intestinal L cell line, were cultured in RPMI 1640 medium containing 10 mM hydroxyethyl piperazine ethane sulfonic acid (HEPES, Hyclone), 100 units / ml penicillin and 100 μg / ml streptomycin G) in a 5% CO ₂ incubator at 37 ° C in a humidified atmosphere.

(2) NCI-H716세포에서 GLP-1 분비능 측정(2) Measurement of GLP-1 secretion ability in NCI-H716 cells

Cells were plated on a 24-well plate at 5 × 10 ⁵ cells per well and cultured in a humidified 5% CO ₂ incubator at 37 ° C. After 48 hours, the cells were replaced with Krebs-Ringer Buffer (KRB) containing no glucose and allowed to stand for 60 minutes. Then, KRG was treated with Selaginella radish extract and fraction samples according to the present invention at a constant concentration and reacted for 60 minutes . In the control group, GLP-1 secreted from the buffer was used in the absence of the sample, and the GLP-1 enzyme-linked immunosorbent assay (ELISA) kit (Millipore) was used.

As shown in FIG. 2, the extract of Selaginella radish (50 μg / ml) according to the present invention increased the secretion of GLP-1 in NCI-H716 L cells by 37.9% as compared with the control. It was also confirmed that treatment of the ethyl acetate fraction (50 μg / ml) induces an excellent GLP-1 secretion increase of 114.4% (about 3 times of the extract) compared with the control group under the same conditions. From these results, the excellent effect of the Selaginella radish extract and its fractions was confirmed.

(3) NCI-H716 세포에서 GLP-1관련 유전자 발현 측정(3) Measurement of GLP-1-related gene expression in NCI-H716 cells

Total RNA was isolated using a TRI reagent (Ambion) in a cell group treated with a Selaginella radish sample according to the present invention for 24 hours, and then cDNA was synthesized using a High-capacity cDNA Reverse Transcription kit (Applied Biosystems) Respectively. Real-Time PCR system (Applied Biosystems) using SYBR Green Master (Roche) using the characteristics of SYBR Green intercalated into double strand deoxyribonucleic acid (dsDNA) with synthesized oligos to amplify each gene , Foster City, CA). The results were expressed quantitatively by the expression of GAPDH. The primers used were confirmed to form a single amplicon of about 150 to 200 bp in the PCR amplification process, and their nucleotide sequences are shown in Table 2 below.

유전자 명칭Gene name	센스 (sense)Sense	안티-센스 (anti-sense)Anti-sense
ActinActin	GGCACCACACCTTCTACAAT(서열번호 1)GGCACCACACCTTCTACAAT (SEQ ID NO: 1)	GCCTGGATAGCAACGTACAT(서열번호 2)GCCTGGATAGCAACGTACAT (SEQ ID NO: 2)
ARNTLARNTL	GAGCGGCTCATAGATGCAAAA(서열번호 3)GAGCGGCTCATAGATGCAAAA (SEQ ID NO: 3)	GTCGTGCTCCAGAACATAATCG(서열번호 4)GTCGTGCTCCAGAACATAATCG (SEQ ID NO: 4)
GPR119GPR119	CCATGGCTGGAGGTTATCGAT(서열번호 5)CCATGGCTGGAGGTTATCGAT (SEQ ID NO: 5)	AGACACAGTACGGAGAGCTTTGAA(서열번호 6)AGACACAGTACGGAGAGCTTTGAA (SEQ ID NO: 6)
NR1D1NR1D1	CGGAGCATCCAGCAGAACAT(서열번호 7)CGGAGCATCCAGCAGAACAT (SEQ ID NO: 7)	GCGATTGATGCGGACGAT(서열번호 8)GCGATTGATGCGGACGAT (SEQ ID NO: 8)
PCSK1/3PCSK1 / 3	GAGTGGGTCCTAGAGATTGAAAACA(서열번호 9)GAGTGGGTCCTAGAGATTGAAAACA (SEQ ID NO: 9)	GCCATAGAGTACGAGGGTGAACTT(서열번호 10) GCCATAGAGTACGAGGGTGAACTT (SEQ ID NO: 10)
PER2PER2	AGCGTTACCTCTGAGCACATTG(서열번호 11)AGCGTTACCTCTGAGCACATTG (SEQ ID NO: 11)	CATCGCTGAAGGCATCTCTTT(서열번호 12)CATCGCTGAAGGCATCTCTTT (SEQ ID NO: 12)
PLIN2PLIN2	CCTCATGTCCTCAGCCTATCTCA(서열번호 13)CCTCATGTCCTCAGCCTATCTCA (SEQ ID NO: 13)	ACCGTTCTCTGCCATCTCACA(서열번호 14)ACCGTTCTCTGCCATCTCACA (SEQ ID NO: 14)
proglucagonproglucagon	TGCTGATGGTTCTTTCTCTGATG(서열번호 15)TGCTGATGGTTCTTTCTCTGATG (SEQ ID NO: 15)	TCCCTGGCGGCAAGATTA(서열번호 16)TCCCTGGCGGCAAGATTA (SEQ ID NO: 16)
PPARβ/δPPAR? /?	ATTCAGAAGAAGAACCGCAACAA(서열번호 17)ATTCAGAAGAAGAACCGCAACAA (SEQ ID NO: 17)	CCGGCATCCGACCAAAA(서열번호 18)CCGGCATCCGACCAAAA (SEQ ID NO: 18)

As shown in FIG. 3, the proteolytic cleavage of propylen convertase subtilisin / kexin type in the production of proglucagon and GLP-1, which are precursors of GLP-1, by the treatment of Selaginella radish ethanol extract and ethyl acetate fraction according to the present invention 1/3 (PCSK1 / 3) expression was significantly increased compared with the control group. In addition, GLP-1 production is regulated by interfering with G-protein-coupled receptor 119 (GPR119) and β-catenin / TCF-4 pathway mediating GLP-1 secretion as a lipid receptor in food and expressing proglucagon Expression of peroxisome proliferator-activated receptor beta or delta (PPARβ / δ) (Gastroenterology. 2011; 140: 1564-1574) was significantly increased by treatment with Selaginella radish extract and fraction.

As shown in FIG. 4, the aryl hydrocarbon receptor nuclear translocator-like protein (ARNTL) gene and its sub-genes, period circadian clock 2 (PER2) and nuclear receptor subfamily 1 group D member 1 (NR1D1) was significantly increased by treatment with Selaginella radish extract or fraction according to the present invention and the expression of perilipin 2 (PLIN2), which is increased in the lipolysis process by GLP-1 Expression was also significantly increased by treatment with the Selaginella radish extract or fraction according to the present invention.

From this, it can be seen that the excellent induction activity of GLP-1 secretion of Selaginella radish extract and its fractions according to the present invention is enhanced by the proglucagon, PCKS1 / 3, GPR119, PPAR? /?, PER2 , ARNTL, NR1D1, and PLIN2, and the excellent effects of the Selaginella radish extract and its fractions were confirmed.

실시예 6. 셀라지넬라 추출물 및 분획물의 지방축적 저해 활성Example 6. Fat accumulation inhibitory activity of Selaginella extract and fractions

(1) 세포배양(1) Cell culture

3T3-L1 cells were cultured in DMEM (Hyclone) containing 10% calf serum (Gibco), 2 mM L-glutamin, 100 units / ml penicillin and 100 μg / ml streptomycin. ℃ incubated in a humid 5% CO ₂ incubator.

(2) 3T3-L1세포에서 지방축적 저해능 측정(2) Measurement of fat accumulation in 3T3-L1 cells

2 × 10 ⁴ cells per well are added to a 48-well plate and cultured in a humidified 5% CO ₂ incubator at 37 ° C. After incubation for 2 days, the cells were incubated in DMEM medium supplemented with FBS (Hyclone), 0.25 μM dexamethasone (DEX), 5 μg / ml insulin, 0.5 mM 1-methyl-3-isobutylxanthine IBMX) was added to promote differentiation into adipocytes for 2 days. Then, insulin alone was added except for IBMX and DEX, and the medium was further cultured at 8 days to 10 days to allow accumulation of fat while changing the medium at two days intervals with the above conditions. After that, staining with Oil red O was performed and microscopic observation of the triglyceride produced in the cells was made. The following cells were extracted with 100 μl of isopropanol and the absorbance at 490 nm was measured using Microplate Reader (Bio-red) to quantify the degree of fat accumulation.

As shown in FIG. 5 and FIG. 6, the extract of Selaginella radish (80 μg / ml) according to the present invention showed an effect of inhibiting fat accumulation in differentiated adipocytes. Especially, ethyl acetate fraction (20, 40 μg / ㎖) showed significant fat accumulation inhibitory effect of 44.8% and 100.0% in differentiated adipocytes, respectively. Thus, it was confirmed that the extract of Selaginella radish according to the present invention and the fraction thereof can exhibit excellent anti-obesity activity.

실시예 7. 셀라지넬라 추출물 및 분획물의 LDL 항산화 활성Example 7. LDL antioxidant activity of Selaginella extract and fractions

In order to confirm the LDL oxidation inhibitory activity of the Selaginella radish extract and fractions according to the present invention, LDL was isolated from human plasma using an ultracentrifuge, and the oxidation of LDL was induced using Cu ²⁺ , (1994) Methods in Enzymology Vol. 234, Oxygen radicals in biological systems Part D (TBARS) was used to measure dialdehyde, an oxidation product of unsaturated fatty acids (Packer, L. Ed. 14: 2719-2723, 2004), and the positive control group was pro-amylglycerol (Sigma Chemical Co., San Diego, Calif.), And the amount of malondialdehyde produced was quantified using a standard curve (Jeong TS et al., Bioorg. Med. Chem. Probucol was used.

The results are shown in Table 3 below.

구분division	시료농도(㎍/㎖)Sample concentration (/ / ml)	LDL 산화 저해활성(%)LDL oxidation inhibitory activity (%)
셀레지넬라-70% 메탄올추출물Celeginella-70% methanol extract	2020	65.5±2.565.5 ± 2.5
셀레지넬라-95% 메탄올추출물Celeginella -95% methanol extract	2020	69.4±0.569.4 ± 0.5
셀레지넬라-70% 에탄올추출물Celeginella -70% ethanol extract	2020	65.6±0.565.6 ± 0.5
셀레지넬라-95% 에탄올추출물Celeginella -95% ethanol extract	2020	69.9±0.569.9 ± 0.5
셀레지넬라-에틸아세테이트추출물Celeginella-ethyl acetate extract	2020	73.3±0.373.3 ± 0.3
셀레지넬라-에틸아세테이트 분획Celeginella-ethyl acetate fraction	1010	79.5±0.379.5 ± 0.3
셀레지넬라-부탄올 분획Celeginella-butanol fraction	1010	72.0±1.172.0 ± 1.1

As shown in Table 3, the present invention exhibited excellent LDL antioxidative activity, and the extracts of 95% ethanol and ethyl acetate showed 69.9% and 73.3% at 20 μg / ml, respectively, , And the ethyl acetate fraction and the butanol fraction showed excellent LDL oxidation inhibitory activity of 79.5% and 72.0% at the concentration of 10 μg / ml, respectively. From these results, the excellent effect of the Selaginella radish extract and its fractions was confirmed.

실시예 8. 셀라지넬라 추출물의 in vivo 동물모델에서의 대사증후군 예방 효능Example 8. Prevention of metabolic syndrome in an in vivo animal model of Selajinella extract

In order to examine the effect of the Sella jinelrosei extract according to the present invention on the metabolic syndrome, especially diabetes, type 2 diabetes, obesity, fatty liver and hyperlipemia, the following experiment was conducted.

(1) 동물의 사육(1) Breeding of animals

Male C57BL / 6J mice were purchased from Life Mouse Center, Korea Research Institute of Bioscience and Biotechnology. The experimental animals were freely fed with the basic diet (10 kcal% fat, D12450B) and water for 3 weeks, and then they were adapted to the laboratory environment. The experimental groups were classified as follows:

(1) Negative control group receiving the basal diet (10 kcal% fat, D12450B);

② Control group that consumes high fat diet (60 kcal% fat, D12492);

(3) Method of high-fat diet Test group of oral administration of Selaginella radish ethanol extract of the present invention (100 mg / kg · day) to oral administration;

(4) High fat diet Test group of oral administration of Selaginelrocyse ethyl acetate extract (50 mg / kg · day) of the present invention to the test group.

The experimental group was tested for 10 weeks to observe antidiabetic and anti-obesity effects on body weight, blood glucose and glucose tolerance.

The environment of the animal breeding room was kept constant at constant temperature (22 ± 2 ° C), humidity (50 ± 5%) and light period (lighted 07:00 ~ 19:00) at 12 hour intervals and 5 animals , And diets and drinking water were freely ingested. Dietary intake and body weight were measured and recorded at regular intervals every week. Twelve-hour fasting followed by blood sampling was performed using Accu-check active test strips (Roche). The animals were fasted for 12 hours before sacrifice, and capillary tubes were used to collect blood from hepatocytes and heparin was used to prevent the coagulation. For blood biochemical tests, 800 g, Plasma was separated by centrifugation at 4 ° C for 15 minutes and stored at -70 ° C for analysis. The organ tissues (pancreas, liver and adipose tissue) of each experimental animal were immediately removed after blood collection and weighed.

(2) 동물실험 결과의 통계처리 및 유효성 평가(2) Statistical analysis and validation of animal test results

The results were expressed as means ± standard deviation. The differences between the groups were analyzed by one-way ANOVA followed by Turkey's post hoc test (JMP ^® software, SAS Institute Inc., USA) And less than 5% ( P <0.05). That is, a, b, c indicated by superscripts indicate statistical significance between the other groups.

(3) 체중 및 장기 무게 변화 측정(3) Measurement of weight and organ weight change

As shown in FIG. 7, the body weight of each experimental animal of Example 8-1 was measured by weight change at intervals of one week. As a result, the body weight of the control group consuming the high fat diet was significantly Body weight was increased, whereas the body weight of the test group consumed Selaginella rosini ethanol extract and acetate extract with high fat diet decreased from 3 weeks in the control group and decreased by 4.1% and 12.9% in the 10th week, respectively.

구분division	간 무게 (g)Liver weight (g)	췌장 무게 (g)Pancreas weight (g)	지방조직 무게 (g)Fat tissue weight (g)
음성대조군Negative control group	0.83 ± 0.05^c 0.83 0.05 ^c	0.13 ± 0.01^b 0.13 0.01 ^b	1.22 ± 0.17^b 1.22 ± 0.17 ^b
대조군Control group	1.24 ± 0.13^a 1.24 ± 0.13 ^a	0.18 ± 0.01^a 0.18 + 0.01 ^a	5.33 ± 0.31^a 5.33 + - 0.31 ^a
에탄올 추출물군Ethanol extract group	1.16 ± 0.08^ab 1.16 ± 0.08 ^ab	0.16 ± 0.02^ab 0.16 ± 0.02 ^ab	5.10 ± 0.46^a 5.10 ± 0.46 ^a
에틸아세테이트 추출물군Ethyl acetate extract group	0.98 ± 0.06^bc 0.98 ± 0.06 ^bc	0.15 ± 0.01^ab 0.15 + 0.01 ^ab	4.62 ± 0.39^ab 4.62 ± 0.39 ^ab

a, b, c: Superscripts indicate a statistical significance ( P <0.05) between the different groups a, b, and c.

In addition, as shown in Table 4, liver weight of the control group was 0.83 g, liver weight of the control group was 1.24 g, and hepatic weights of the ethanol extract group and the ethyl acetate extract group were 1.16 g and 0.98 g The increase in liver weight was inhibited by the ingestion of Selaginella radish extract.

After 10 weeks, the pancreas weight of the control group was 0.13 g, the pancreas weight of the control group was increased to 0.18 g, while the pancreas weights of the ethanol extract group and the ethyl acetate extract group were 0.16 g and 0.15 g, respectively, Respectively.

After 10 weeks, the weight of the adipose tissue of the test group was determined to be 1.22 g in the negative control group, 5.33 g in the control group , Whereas the weight of fat in the ethanol extract and ethyl acetate extract groups was 5.10 g and 4.62 g, respectively.

(4) 혈당 변화 분석(4) Analysis of blood sugar change

As shown in FIG. 8, the fasting blood glucose level of the control group consuming the high fat diet showed a significant increase in blood glucose level compared to the negative control group at the 6th week, whereas the administration of Selaginella radish extract inhibited the increase of blood glucose, The fasted glucose level at 10th week in the acetate extract group was 26.8% lower than that of the control group.

As a result of the glucose tolerance test at the 8th week of the experiment, as shown in FIG. 9, the blood glucose level at 60, 90 and 120 minutes of Selaginella radish extract was significantly reduced as compared with the control group. The area under the curve (AUC) of FIG. 10 was also lower than that of the control group. As shown in FIG. 11, the insulin concentration in the control group was significantly increased compared to the negative control group before the glucose administration and 30 minutes after the glucose administration, whereas the insulin concentration in the ethanol extract group was decreased compared to the negative control group. The insulin concentration in the extract group was significantly decreased. This indicates that the sensitivity of insulin secretion by glucose administration is increased. From the above results, the excellent blood glucose control effect of Selaginella radish extract was confirmed in an in vivo animal experiment.

(5) 혈액 생화학적 지표 분석(5) Analysis of blood biochemical indicators

After the 10th abortion of Example 8-1, blood glucose was measured from each animal and blood glucose was measured and the HbA1c, insulin and insulin resistance index (HOMA-IR index) were measured on the separated plasma, Total cholesterol (TC) and triglyceride levels were measured, and AST and ALT, which are indicators of liver function, were measured.

The glycated hemoglobin was measured using an Eisai's glycosylated hemoglobin cartridge [Infopia], and the insulin concentration was measured using an Insulin ELISA kit (Alpco diagnostics), and the insulin resistance index was calculated according to the reference (Biochem. Biophys. Res. Commun. Insulin concentration (ng / mL) x 24.8 x glucose concentration (mg / dL) divided by the calculation formula according to the following formula (341: 507-514, 2006) The total cholesterol, triglyceride, and AST and ALT levels, which are indicators of lipid composition, were determined by using the individual measurement kit purchased from Asan Pharmaceuticals. The results are shown in Table 5 below.

혈액 생화학 지표Blood biochemistry index	음성대조군Negative control group	대조군Control group	에탄올추출물군Ethanol extract group	에틸아세테이트추출물군Ethyl acetate extract group
공복혈당 (mg/dL)Fasting blood glucose (mg / dL)	84.1 ± 3.8^c 84.1 ± 3.8 ^c	182.3 ± 16.1^a 182.3 ± 16.1 ^a	166.3 ± 18.1^ab 166.3 ± 18.1 ^ab	133.5 ± 7.7^b 133.5 ± 7.7 ^b
당화혈색소 (%)Glycated hemoglobin (%)	5.1 ± 0.1^b 5.1 ± 0.1 ^b	7.5 ± 0.6^a 7.5 ± 0.6 ^a	6.6 ± 0.3^a 6.6 ± 0.3 ^a	6.4 ± 0.3^a 6.4 ± 0.3 ^a
인슐린 (ng/mL)Insulin (ng / mL)	0.46 ± 0.08^b 0.46 ± 0.08 ^b	2.15 ± 0.57^a 2.15 ± 0.57 ^a	2.09 ± 0.38^a 2.09 + 0.38 ^a	1.05 ± 0.18^b 1.05 + 0.18 ^b
인슐린저항성 지수Insulin resistance index	2.4 ± 0.4^c 2.4 ± 0.4 ^c	27.8 ± 8.8^a 27.8 ± 8.8 ^a	22.6 ± 5.5^ab 22.6 ± 5.5 ^ab	9.1 ± 1.9^bc 9.1 ± 1.9 ^bc
총콜레스테롤 (mg/dL)Total cholesterol (mg / dL)	110.0 ± 6.3^b 110.0 ± 6.3 ^b	192.4 ± 4.2^a 192.4 + 4.2 ^a	199.6 ± 10.7^a 199.6 ± 10.7 ^a	188.3 ± 3.4^a 188.3 ± 3.4 ^a
중성지방 (mg/dL)Triglyceride (mg / dL)	122.4 ± 7.9^b 122.4 ± 7.9 ^b	159.2 ± 12.2^a 159.2 ± 12.2 ^a	132.7 ± 9.3^ab 132.7 ± 9.3 ^ab	130.7 ± 3.3^ab 130.7 ± 3.3 ^ab
AST (IU/L)AST (IU / L)	31.7 ± 2.1^ab 31.7 ± 2.1 ^ab	38.2 ± 4.3^a 38.2 ± 4.3 ^a	32.6 ± 2.2^ab 32.6 ± 2.2 ^ab	28.3 ± 0.9^b 28.3 ± 0.9 ^b
ALT (IU/L)ALT (IU / L)	16.6 ± 1.6^b 16.6 ± 1.6 ^b	23.7 ± 1.8^a 23.7 ± 1.8 ^a	23.9 ± 2.7^a 23.9 ± 2.7 ^a	16.1 ± 1.9^b 16.1 ± 1.9 ^b

As shown in Table 5, the control group showed significantly higher fasting glucose, glycated hemoglobin, insulin, insulin resistance index, total cholesterol, and triglyceride compared to the negative control group, while the ethanol extract of Selaginella los and ethyl acetate The administration of the extract decreased the hyperglycemia induced by high fat diet. In addition to glucose concentration, glycated hemoglobin of ethanol extract group and ethyl acetate extract group were decreased by 12.0% and 14.7%, respectively, and insulin concentration was decreased by 51.1% in the ethyl acetate extract group compared to the control group. Insulin resistance index was significantly decreased by 21.3% and 67.3% in the ethanol extract and ethyl acetate extract groups, respectively. Serum triglyceride levels were decreased by 16.7% and 17.9% in the ethanol extract and ethyl acetate extract groups, respectively, compared with the control group. In addition, AST and ALT concentrations in the liver were lower than 40 IU / L in all groups, but they were slightly increased in the control group compared to the negative control group. On the other hand, AST and ALT in the ethyl acetate extract group were significantly decreased compared to the control group. From the above results, it was confirmed in the in vivo animal experiment that lipid lowering effect and hepatoprotective effect in addition to the blood glucose controlling effect of Selaginella radish extract were confirmed.

<제제예 1> 정제의 제조&Lt; Formulation Example 1 > Preparation of tablets

The Selaginella rossii extract prepared in Example 1 or 2 and / or the fraction thereof were uniformly mixed with crystalline cellulose, starch and the like, and then granulated together and mixed with magnesium stearate, sucrose fatty acid ester or the like And pressed to produce tablets. Table 6 shows the constituents used in the tablet and the amount thereof used.

245 mg of Selaginella rossii and / or fractions of Example 1 or 2

Crystalline cellulose (KP) 225 mg

Lactose (KP) 12.5 mg

Starch (KP) 12.5 mg

Magnesium stearate (KP) 10 mg

Sucrose fatty acid ester (KP) 5 mg

<제제예 2> 캡슐의 제조&Lt; Formulation Example 2 > Preparation of capsules

The Selaginella rossii extract and / or its fractions prepared according to Example 1 or 2 were uniformly mixed with shell calcium, crystalline cellulose and the like, and then filled in gelatin capsules to prepare capsules.

Table 7 shows the constituents used in the manufacture of capsules and their amounts used.

250 mg of Selaginella rossii and / or fractions of Example 1 or 2

Shell calcium (KP) 125 mg

Crystalline cellulose (KP) 65 mg

<제제예 3> 액제의 제조&Lt; Formulation Example 3 > Preparation of solution

0.15% by weight of Selaginella rossii extract prepared according to Example 1 or 2 and / or its fractions, 10% by weight of liquid fructose, 2% by weight of honey, 2% by weight of apple juice concentrate (60bx) 0.5% by weight of guarana extract powder, 0.5% by weight of citric acid, 0.1% by weight of sodium citrate and 0.1% by weight of taurine, and then purified water was added thereto to prepare a liquid preparation.

<제제예 4> 건강 음료의 제조&Lt; Formulation Example 4 > Preparation of health drink

The Selaginella rossii extract and / or its fractions prepared according to Example 1 or 2 were uniformly mixed with citric acid, oligosaccharide, moss concentrate, plum concentrate, taurine, etc., and purified water was added thereto for about 1 hour After stirring and heating at 85 ° C, the resulting solution was filtered and sterilized in a sterilized container, sealed sterilized, and stored in a refrigerator to prepare a beverage.

Table 8 shows the constituents used in the manufacture of health beverages and their amounts used.

1000 mg of Selaginella rossii and / or fractions of Example 1 or 2

Citric acid 1000mg

Oligosaccharide 100 g

Concentrated fruit juice 2g

Plum concentrate 2g

Taurine 1g

Purified water 900 ml

Claims

A pharmaceutical composition for preventing or treating metabolic syndrome comprising Selaginella rossii extract, fraction thereof, or all of them as an active ingredient.
The pharmaceutical composition according to claim 1, wherein the metabolic syndrome is selected from diabetes, obesity, fatty liver, hyperlipidemia, arteriosclerosis, and complications thereof.
The pharmaceutical composition according to claim 1, wherein the extract of Selaginella rossii is water, a low C 1 -C 4 alcohol, ethyl acetate or a mixed solvent thereof.
The method according to claim 3, wherein the Selaginella rossii extract is an extract of any one selected from the group consisting of ethanol extract, aqueous ethanol extract, methanol extract, methanol aqueous extract and ethyl acetate extract, for the prevention or treatment of metabolic syndrome A pharmaceutical composition.
The pharmaceutical composition according to claim 1, wherein said fraction is ethyl acetate or a butanol fraction, for the prophylaxis or treatment of metabolic syndrome.
A food composition for preventing or ameliorating a metabolic syndrome comprising Selaginella rossii extract, fraction thereof or all of them.
The food composition according to claim 6, wherein the metabolic syndrome is selected from diabetes, obesity, fatty liver, hyperlipidemia, arteriosclerosis and complications thereof.
The food composition according to claim 6, wherein the Selaginella rossii extract is water, a C 1 -C 4 lower alcohol, ethyl acetate or a mixed solvent thereof.
9. The method according to claim 8, wherein the Selaginella rossii extract is selected from the group consisting of ethanol extract, ethanol aqueous solution extract, methanol extract, methanol aqueous solution extract and ethyl acetate extract, a food for preventing or improving metabolic syndrome Composition.
7. The food composition according to claim 6, wherein said fraction is ethyl acetate or butanol fraction, for preventing or improving metabolic syndrome.
A pharmaceutical composition for antioxidant comprising an extract of Selaginella rossii , a fraction thereof, or all of them as an active ingredient.