KR20210014610A - COMPOSITION COMPRISING EXTRACT OF POLYGONUM CUSPIDATUM SIEB. et ZUCC. AND CINNAMOMUM CASSIA BLUME FOR PREVENTING, IMPROVING OR TREATING OF COGNITIVE DYSFUCCTION - Google Patents

Abstract

The present invention relates to a composition for preventing, alleviating or treating cognitive impairment containing extracts of Reynoutria japonica and Cinnamomum cassia. More specifically, the present invention provides: a pharmaceutical composition for preventing or treating cognitive impairment which effectively inhibits neuroinflammation, significantly reduces the level of MCP-1, a blood biomarker that affects cognitive functions, inhibits systemic inflammation, and thus improves cognitive function, learning ability or memory decreased by anticholinergic drugs; a health functional food composition for improving learning ability or memory; and/or a composition for alleviating decline of cognitive functions.

Description

A composition for the prevention, improvement or treatment of cognitive dysfunction, comprising the extract of jangeun and geunsim {COMPOSITION COMPRISING EXTRACT OF POLYGONUM CUSPIDATUM SIEB. et ZUCC. AND CINNAMOMUM CASSIA BLUME FOR PREVENTING, IMPROVING OR TREATING OF COGNITIVE DYSFUCCTION}

The present invention relates to a composition for the prevention, improvement, or treatment of cognitive dysfunction, including the extracts of piriformis and ginseng, more specifically, MCP-1, a blood biomarker that effectively inhibits neuroinflammation and affects cognitive function A pharmaceutical composition for the prevention or treatment of cognitive dysfunction that significantly reduces the level of, suppresses systemic inflammation, and improves cognitive function, learning ability, or memory decreased by anticholinergic drugs, prevention or improvement of cognitive dysfunction It provides a functional health food composition, a functional health food composition for improving learning ability or memory and/or a composition for improving cognitive function decline.

Cognition refers to the whole process of thinking, speaking, remembering, judging and executing with the brain in human life. Therefore,'cognitive function' includes attention, perception, memory, language ability, and executive ability, and'cognitive function disorder' is the most prominent phenomenon among aging phenomena in the brain, characterized by a decrease in learning and memory ability, and a decrease in judgment ability. It is a physiological phenomenon that gets erased. In particular, these cognitive dysfunctions can appear in a variety of ways. Among them, dementia significantly interferes with interpersonal relationships, occupational functions, and daily life functions due to a decrease in cognitive functions such as memory, language abilities, visual perception and spatio-temporal composition abilities, and executive functions. It is diagnosed as a complex disease that causes this.

In Korea, with the rapid aging, the number of dementia patients is increasing steadily by 25% every year to 8.4% of the elderly population, and in this situation, the economic burden and social problems of dementia treatment are emerging as the biggest health problem. Alzheimer's dementia accounts for the majority of senile dementia. Alzheimer's dementia is commonly called Alzheimer's disease (AD), and it can be said to be a disease that slowly dies without any treatment efforts. Accordingly, there is a growing need for the development of preventive and therapeutic treatments for memory loss and AD caused by aging, and improvement of usual eating habits or cognitive improvement through the development of health functional foods contributes to the improvement of the quality of life of both AD patients and their families. It is predicted to be able to solve social and economic problems.

The cause of AD has not been accurately identified, but among the neuropathological characteristics of AD, neuronal cell death due to inflammatory reactions including oxidative stress caused by Aβ deposited on the brain parenchyma and cerebrovascular wall is the most important in the pathogenesis of AD. It is known to play a role, and β and γ-secretase are largely involved in the production of Aβ, and studies on β and γ-secretase activity inhibitors that can reduce the production of Aβ are drawing attention. Therefore, for the prevention and treatment of AD, studies related to the prevention and treatment of AD are being conducted through the identification of various targets and mechanisms of action, and recently, studies on the development of functional materials for removing Aβ are being made most actively.

AD treatments developed to date mainly target neurotransmitter processes to relieve symptoms, and the most advanced currently is a choline-based drug, which prevents the decomposition of acetylcholine, a neurotransmitter, in the brain. Acetylcholinesterase inhibitors (Acricept, Reminyl, Exelon) that increase the amount of choline are attracting attention. Among the drugs using this mechanism, tacrine (product name Cognex Capsule) and donepezil (product name Aricept), which are marketed in Korea after approval by the US FDA, are representative drugs. However, most of the AD treatments including these drugs have reported serious side effects.Tacrine has symptoms such as hepatotoxicity, insomnia, gastrointestinal disorders, confusion, anorexia, and nervousness. It is known that disorders of the mental and nervous system such as nightmares and vivid dreams, and disorders of the digestive system such as diarrhea, nausea, vomiting, etc. In addition, these drugs may be effective in temporarily alleviating the symptoms of AD, but a treatment and treatment that can fundamentally treat AD have not been developed until now.

On the other hand, polygonum cuspidatum Sieb. et Zucc. = Reynoutria japonica Hou.), a perennial herbaceous plant belonging to the Mardiaceae family, refers to the roots or rhizomes of plants of the genus and related plants. , Banjang, Santongsoon, Banjanggeun, Bad answer, Mountain, Bangeun, Woonghwangyeon, Land Yu. Hojanggeun is distributed in Korea, Japan, Taiwan, and China, and in Korea, it grows in valleys across the country. The rhizome is more than 1m high, and the rhizome extends sideways from the basement, is woody, yellowish brown, and has a clear node. The stem grows straight and is hollow in a circular shape. There are no hairs on the surface and there are many red or purple spots. These roots, rhizomes and leaves have been used as medicinal materials from ancient times. Hojanggeun is known as palliative, diuretic, tonggyeong, and antitussive tablets, and has antibacterial and antiviral pharmacological effects.

Cinnamomum cassia Blume, an evergreen tree belonging to the camphor family, is the stem bark of broilers or other similar plants, with the perilla and primary cortex removed. It is a long plank-shaped or cylindrical shape, and the length is 10-20cm, and the thickness is uneven. Both the outer and inner sides are reddish brown, and the quality is well broken. The bent side is reddish brown and rich in oil. It has a unique aroma and tastes spicy and sweet. The pharmacological action of Gyesim is a cardiovascular agent that promotes blood circulation and is known to be good for heart breakdown, excitement, dry stomach suit, warmth health, whole meridians, positive position, body temperature control, improvement of weak constitution, and gustular wind.

Under this background, the present inventors confirmed that the complex extract of Hojanggeun and Gyesim showed a synergistic effect in improving cognitive dysfunction significantly better than each single extract, and completed the present invention.

Republic of Korea Patent Publication No. 10-2019-0047359

It is an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of cognitive dysfunction comprising the extract of janggeun and geunsim.

Another object of the present invention is to provide a health functional food composition for the prevention or improvement of cognitive dysfunction comprising the extract of janggeun and geunsim.

Another object of the present invention is to provide a health functional food composition for enhancing learning ability or memory, comprising the extract of Hojanggeun and Gyesim.

Another object of the present invention is to provide a composition for improving cognitive function lowering, including the extract of Hojanggeun and Gyesim.

In order to solve the above problems, the present invention provides a pharmaceutical composition for the prevention or treatment of cognitive dysfunction comprising the extract of janggeun and geunsim.

In addition, the present invention provides a health functional food composition for the prevention or improvement of cognitive dysfunction comprising the extract of janggeun and geunsim.

In addition, the present invention provides a health functional food composition for improving learning ability or memory, including the extract of janggeun and geunsim.

In addition, the present invention provides a composition for improving cognitive function lowering, including the extract of janggeun and geunsim.

According to a preferred embodiment of the present invention, the extracts of jangeun and ginseng can be extracted using water, C1 to C4 lower alcohols, or a mixture thereof as a solvent.

According to another preferred embodiment of the present invention, the extract of jangjanggeun and ginseng root may be mixed in a weight ratio of greater than 1:0.5 to less than 1:2.

According to another preferred embodiment of the present invention, the cognitive dysfunction is dementia, Alzheimer's disease, Huntington's disease, vascular dementia, ischemic stroke, traumatic brain injury, forgetfulness, Parkinson's disease, Pick disease, Creutzfeldt disease (Creutzfeldt). -Jakob disease), and mild cognitive dysfunction may be any one or more selected from the group consisting of.

According to another preferred embodiment of the present invention, the cognitive decline may be any one or more selected from the group consisting of lethargy, attention loss, depression, hearing loss, painlessness, inactivity and discrimination.

According to another preferred embodiment of the present invention, the composition for improving cognitive decline may be a pharmaceutical composition or a food composition.

The composition comprising the complex extracts of Hojanggeun and Gyesim of the present invention effectively inhibits neuroinflammation, significantly reduces the level of MCP-1, a blood biomarker that affects cognitive function, and significantly inhibits systemic inflammation. And, it was found to enhance cognitive function, learning ability and/or memory in an animal model of dementia induced by scopolamine. Therefore, pharmaceutical and food composition compositions for improving memory and learning ability of candidates or office workers who require high-level brain activity, as well as pharmaceutical and food compositions for improving cognitive decline, preventing, improving or treating cognitive dysfunction or neuroinflammation And it can be variously applied to food compositions.

1 shows the effect of reducing neuroinflammation in BV2 cells in which the inflammatory response was induced by LPS, respectively, by treatment with a single extract of janggeun root, a single extract of gypsy, and a 1:1 complex extract of jangchim and gychim through IL-10 gene expression analysis. It is a graph.
FIG. 2 is a graph confirming the effect of reducing neuroinflammation according to the weight ratio of a mixture of gaujanggeun and gypsy in BV2 cells in which an inflammatory response was induced through IL-10 gene expression analysis.
3 is a gene expression of various inflammatory factors (IL-1β, IL-10, and iNOS) according to the treatment of 1:1 and 2:1 complex extracts of Gaujanggeun and Gisim in BV2 cells in which the inflammatory response is induced. This is a graph confirmed through analysis.
Figure 4 is a graph showing the effect of reducing the level of MCP-1 in the blood according to the administration of a complex extract of geunjanggeun and geunsim.
5 is a graph showing the effect of reducing the level of TNF-α in the blood according to administration of a complex extract of Hojanggeun and Gyesim.
6 is a graph showing the effect of reducing IL-6 levels in blood according to administration of a complex extract of Hojanggeun and Gisim.
7 is a graph showing the results of measuring the effect of improving cognitive and short-term memory according to the administration of a complex extract of Gaujanggeun and Gyesim by a Y-maze cross-behavior (Spontaneous alternation) experiment.
Figure 8 is a graph confirming the change in the number of movements to the entire arm (arm) according to the administration of the complex extract of geunjanggeun and geunsim in the Y-type maze experiment.
9 is a graph showing the results of measuring the learning and long-term memory improvement effect according to the administration of a complex extract of jangeun and geunsim by a passive avoidance experiment.

As described above, the existing drugs used for the treatment of cognitive dysfunction, especially AD, are only effective in temporarily alleviating AD symptoms, but have fundamental limitations in treating AD, and various side effects caused by these drugs have been reported. However, there is still a need to develop a therapeutic agent that is effective in improving cognitive dysfunction or memory and is safe for the human body without side effects. Under this background, the present inventors confirmed that the complex extracts of Hojanggeun and Kyesim show a synergistic effect on improving cognitive dysfunction significantly better than each single extract, and the prevention of cognitive dysfunction by using the complex extract of Hojanggeun and Kyesim , By providing a composition for improvement or treatment, a solution to the above-described problem was sought. The composition comprising the complex extracts of Hojanggeun and Gyesim of the present invention effectively inhibits neuroinflammation, significantly reduces the level of MCP-1, a blood biomarker that affects cognitive function, and significantly inhibits systemic inflammation. And, it was found to enhance cognitive function, learning ability and/or memory in an animal model of dementia induced by scopolamine. Therefore, not only pharmaceutical and food compositions for improving memory and learning ability of test takers or office workers who require high-level brain activity, but also pharmaceutical and food compositions for improving cognitive decline, preventing, improving or treating cognitive dysfunction or neuroinflammation It can be applied in various ways to food compositions.

Hereinafter, the present invention will be described in more detail.

All technical terms used in the present invention, unless otherwise defined, are used in the same sense as those of ordinary skill in the art generally understand in the related field of the present invention. In addition, although preferred methods or samples are described in the present specification, those similar or equivalent are included in the scope of the present invention.

The present invention provides a pharmaceutical composition for the prevention or treatment of cognitive dysfunction comprising the extract of janggeun and geunsim.

In addition, the present invention provides a health functional food composition for the prevention or improvement of cognitive dysfunction comprising the extract of janggeun and geunsim.

In addition, the present invention provides a health functional food composition for improving learning ability or memory, including the extract of janggeun and geunsim.

In addition, the present invention provides a composition for improving cognitive function lowering, including the extract of janggeun and geunsim.

In the composition of the present invention, the hojanggeun and chicken syrup may be purchased and used commercially, or may be directly collected or cultivated in nature. As long as the extract having the effect of preventing, improving, or treating cognitive dysfunction can be obtained, the root, for example, the root, the upper part, the stem, the leaf, the flower, the trunk of the fruit, the fruit It can be extracted from the skin as well as plant tissue culture.

The composition of the present invention may be prepared in the form of extracting by mixing a single extract of jangjanggeun and chicken shim respectively at a specific weight ratio, or mixing a jangchim and chicken shim at a specific weight ratio, and mixing mentioned in the present invention The weight ratio refers to both the mixed weight ratio of each single extract and the mixed weight ratio of the raw material before the extract is prepared.

Gaujanggeun and chicken core can be used after washing and drying to remove foreign substances, and pulverized to increase extraction efficiency. The method of preparing the complex extract of the root janggeun and gyesim may use conventional extraction methods in the art such as immersion extraction, static extraction, ultrasonic extraction, filtration, hot water extraction, and reflux extraction. The extraction solvent may be used without limitation as long as it is a conventional extraction solvent in the art, preferably water, C1 ~ C4 alcohol, or a mixed solvent thereof, more preferably water, methanol or ethanol, and most Preferably, it may be ethanol. In addition, the extraction solvent can be extracted by adding 1 to 20 times the weight of the ginseng root and chicken core.

In addition, the extraction time may be 0.5 to 48 hours, more preferably 1 to 36 hours, but is not limited thereto, and the number of extractions may be repeated once to 10 times.

If necessary, it may be prepared as a powder through additional steps such as filtration, concentration, and freeze drying according to a method known in the art. The concentration may be concentrated under reduced pressure, and the concentration under reduced pressure may be performed using a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto. In addition, the drying is preferably vacuum drying, vacuum drying, boiling drying, spray drying, or freeze drying, but is not limited thereto.

In the present invention, the term "extract" refers to a liquid component obtained by immersing a target substance in various solvents and then extracting at room temperature, low temperature, or warm state for a certain period of time, and removing the solvent from the liquid component. It means the result of obtained solid content etc. In addition, in addition to the resulting product, it can be comprehensively interpreted as including all of the diluted solution of the resultant, the concentrate thereof, the preparation thereof, and the purified product.

In the composition of the present invention, the extract of jangchim root and ginseng extract may be mixed in an optimal weight ratio to induce the most excellent synergistic effect, for example, a weight ratio of greater than 1:0.5 to less than 1:2, most preferably 1 It can be mixed in a :1 weight ratio. In the case of mixing the extracts by weight outside of the above range, the combined synergistic effect is reduced and thus the optimal activity cannot be exhibited. Therefore, it is preferable to mix the extracts between the roots and branches in the weight ratio.

1 to 3, in BV2 cells in which an inflammatory response was induced by LPS, a 1:1 complex extract of astrocytes and ginseng roots effectively reduced gene expression of all inflammatory factors, and 1:2 or 2:1 (i.e. , 0.5:1) The inhibitory effect was remarkably excellent compared to the composite extract. As can be seen from the results of Figs. 1 and 2, the single extract of janggeun root and the single extract of gyesim inhibited IL-10 gene expression at similar levels, respectively, but the 1:2 complex extract of jangchim and gyesim is 2:1 complex extract Compared to, the effect of inhibiting IL-10 gene expression was superior, and it was found that the effect was different from the expected effect according to the results confirmed in a single extract.

Through various experimental results, it was confirmed that there is no tendency for the neuroinflammation inhibitory effect to increase as the mixing weight ratio of the Hojanggeun extract in the complex extract increases, or conversely, as the mixture weight ratio of the ginseng extract increases. It was confirmed that the synergistic effect on the inhibition of neuroinflammation was specifically shown.

Therefore, in order for the complex extract to exhibit the maximum effect, it is preferable that one single extract is not mixed in a weight exceeding 2 times that of the other single extract. It is most preferably mixed.

In the present invention, "cognitive dysfunction" refers to mental and behavioral disorders and endocrine disorders, metabolic and nutritional disorders, and memory declines due to drugs, etc. due to brain diseases, brain injury, addiction, etc. Includes memory impairment.

Cognitive disorders in the present invention include dementia, Alzheimer's, Huntington's disease, vascular dementia, ischemic stroke, traumatic brain injury, forgetfulness, Parkinson's disease, Pick disease, Creutzfeldt-Jakob disease, and mild cognitive function. It may be any one or more selected from among the disorders, but is not limited thereto.

In the present invention, the mild cognitive dysfunction is defined as a pre-dementia clinical stage in which memory and cognitive functions are significantly lowered compared to age and educational level, but does not cause any disturbance in life.

In the present invention, the cognitive dysfunction includes symptoms of brain function abnormalities such as memory loss and dementia, which are caused by estrogen reduction in menopausal women.

Cognitive dysfunction in menopausal women is known to be due to a decrease in estrogen causing abnormalities in brain functions such as memory and cognitive function (Weber MT, Maki PM, McDermott MP. Cognition and mood in perimenopause: a systematic review and meta- analysis.The Journal of Steroid Biochemistry and Molecular Biology. 2014;142:90-8). Estrogen acts on the hypothalamus that regulates the autonomic nervous system, the limbic system that regulates memory and cognitive functions, and the cerebral cortex that controls high-level mental functions to control emotions, moods, memory, and cognition. It is known to regulate (Henderson VW. Cognitive changes after menopause: influence of estrogen. Clinical Obstetrics and Gynecology. 2008;51(3):618). In particular, estrogen is associated with neurodegeneration of the hippocampus, which is the center of memory and cognitive function, and causes cognitive impairment. The hippocampus stores short-term memory and transmits information to the cerebral cortex, limbic system, and hypothalamus in order to convert to long-term memory.The decrease in estrogen due to menopause deteriorates language memory, learning ability, and fine movement skills. Has been reported (Grady CL. Functional brain imaging and age-related changes in cognition. Biological Psychology. 2000;54(1-3):259-81).

Meanwhile, in 2010, biomarkers in the blood involved in the regulation of memory and cognitive function were discovered and reported (Villeda SA et al. The aging systemic milieu negatively regulates neurogenesis and cognitive function. Nature. 2011;477(7362)) :90-4). In this study, biomarkers that affect cognitive function were identified and verified by comparing blood markers in the blood of elderly mice and the blood of young mice with parabiosis. Of the six blood markers found here, MCP-1 was reported to be associated with menopause in 2013 (im WK et al. Monocyte Chemoattractant Protein-1 Deficiency Attenuates Oxidative Stress and Protects against Ovariectomy-Induced Chronic Inflammation in Mice.PLoS One. 2013;8(8):e72108). MCP-1 is a type of cytokine secreted by monocytes, macrophages, and dendritic cells, and plays a role in bringing monocytes, memory T cells, and dendritic cells to the site of inflammation. Because it mediates the inflammatory response, the mechanism related to inflammation is mainly known, but a new function as a blood factor regulating cognitive function was reported in 2010, and it has established itself as a marker for cognitive function in blood. According to reports that MCP-1 is increased in the blood of menopausal animal models of OVX (OVX) animals and that memory and cognitive declines are caused by OVX (Kim WK et al. Monocyte Chemoattractant Protein-1 Deficiency Attenuates Oxidative Stress and Protects against Ovariectomy-Induced Chronic Inflammation in Mice.PLoS One. 2013;8(8):e72108; Su J et al. The effect of ovariectomy on learning and memory and relationship to changes in brain volume and neuronal density.The International Journal of neuroscience. 2012;122(10):549-59), it can be seen that there is a possibility that the level of MCP-1 in the blood increased by OVX and the decline in memory and cognitive function are largely related.

In the present invention, the term "neuroinflammation" refers to inflammation occurring in the brain, and is an important factor causing cognitive disorder-related diseases. It is known that excessive activation of inflammatory cells in the brain leads to increased secretion of inflammatory cytokines, and cognitive impairment is caused by damage to brain cells by overactivation of this brain inflammatory response.

In the present invention, the term "cognitive function decline" may be any one or more selected from the group consisting of lethargy, memory loss, forgetfulness, cognitive decline, learning disability, attention loss, depression, hearing loss, painlessness, inactivity and discrimination. have.

As shown in Fig. 4, the complex extract of Hojanggeun and Gyesim significantly reduces the level of MCP-1, a blood biomarker that affects cognitive function, and as shown in Figs. 5 and 6, TNF-α and IL in the blood By reducing the level of -6, systemic inflammation is significantly suppressed, and as shown in Figs. 7 to 9, it shows the effect of improving cognitive function, learning ability, or memory, which is lowered by anticholinergic drugs. It can be used as a therapeutic agent or food for prevention, improvement or treatment and/or improvement of learning ability or memory, improvement of cognitive decline.

In the composition of the present invention, the term "prevention" means any action that inhibits or delays the onset of a disease or condition. In the present invention, it means to delay the onset of or suppress the onset of cognitive dysfunction.

In the composition of the present invention, the term "improvement" refers to any action that improves or beneficially changes a disease or condition, and in the present invention, improves symptoms of cognitive dysfunction or improves cognitive function, learning ability, or memory. It means letting go.

In the composition of the present invention, the term "treatment" refers to any action that delays, stops, or reverses the progression of a disease or condition, and in the present invention, cognitive dysfunction or symptoms of cognitive function, learning ability, or memory decline It means to alleviate, alleviate or eliminate, or reverse.

The term "synergy effect" refers to the effect that occurs when each component is administered in combination (combination) is greater than the sum of the effects that occur when administered alone as a single component [Chou and Talalay, Adv. Enzyme. Regul., 22:27-55, 1984]. The complex extract of Hojanggeun and Gyesim of the present invention increases the effect of preventing, improving or treating cognitive dysfunction than each single extract, and also increases the effect of enhancing cognitive function, learning ability or memory.

The term “administered in combination” means that an extract or ingredient is administered together to a patient. That each extract or component is administered together means that each component can be administered at the same time or in any order or sequentially at different times in order to obtain the desired therapeutic effect.

The term “patient” refers to any single individual in need of treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, insects, and the like. In addition, any subject who participated in a clinical study trial showing no clinical manifestation of any disease, or a subject who participated in an epidemiological study or a subject used as a control group is included.

The composition for improving cognitive function reduction of the present invention may be used as a pharmaceutical and/or food composition.

The pharmaceutical composition of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally, and parenteral administration methods are not limited thereto, but intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal , Intranasal, intestinal, topical, sublingual or rectal administration.

The pharmaceutical composition of the present invention can be formulated as a formulation for oral administration or parenteral administration according to the route of administration as described above. When formulated, one or more buffers (e.g., saline or PBS), carbohydrates (e.g., glucose, mannose, sucrose, or dextran, etc.), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA) Or glutathione), fillers, extenders, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrants or surfactants, diluents or excipients.

Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions or capsules, and the like, and such solid preparations are at least one excipient in the pharmaceutical composition of the present invention, for example , Starch (including corn starch, wheat starch, rice starch, potato starch, etc.), Calcium carbonate, Sucrose, Lactose, Dextrose, Sorbitol, Mannitol, Xylitol, Erythritol Maltitol, Cellulose , Methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose or gelatin may be mixed and prepared. For example, tablets or dragees can be obtained by blending the active ingredient with a solid excipient, pulverizing it, adding a suitable auxiliary, and processing into a granule mixture.

In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, or syrups, but may include various excipients, such as wetting agents, sweetening agents, fragrances, or preservatives, in addition to water or liquid paraffin, which are simple diluents commonly used. .

In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrant, and an anti-coagulant, a lubricant, a wetting agent, a fragrance, an emulsifier and a preservative may be additionally included. .

When administered parenterally, the pharmaceutical composition of the present invention may be formulated according to a method known in the art in the form of an injection, a transdermal administration, and a nasal inhalation agent together with a suitable parenteral carrier. In the case of such injections, they must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, water, ethanol, polyol (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), a mixture thereof and/or a solvent or dispersion medium containing vegetable oil. I can. More preferably, suitable carriers include isotonic solutions such as Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose. Etc. can be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid, thimerosal, and the like may be additionally included. In addition, the injection may further include an isotonic agent such as sugar or sodium chloride in most cases.

In the case of transdermal administration, ointments, creams, lotions, gels, external solutions, pasta, liniment, and air rolls are included. In the above,'transdermal administration' means that the active ingredient in an effective amount contained in the pharmaceutical composition is delivered into the skin by topically administering the pharmaceutical composition to the skin.

In the case of inhalation dosages, the compounds used according to the invention can be prepared using a suitable propellant, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas, pressurized pack or It can be conveniently delivered from a nebulizer in the form of an aerosol spray. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges for use in an inhaler or insufflator can be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a formula generally known for all pharmaceutical chemistry.

The pharmaceutical composition of the present invention may provide a desirable effect of preventing, improving or treating cognitive impairment and/or enhancing learning ability or memory when it contains the complex extract of Hojanggeun and Gisim in an effective amount. As used herein, the term "effective amount" refers to an amount that exhibits a higher response compared to the negative control group, and preferably refers to an amount sufficient to prevent, ameliorate or treat cognitive dysfunction. In the pharmaceutical composition of the present invention, the complex extract of Hojanggeun and Gyesim may be contained in 0.01 to 99.9%, and the remaining amount may be occupied by a pharmaceutically acceptable carrier. The effective amount of the complex extract of Hojanggeun and Gyesim contained in the pharmaceutical composition of the present invention will vary depending on the form in which the composition is commercialized.

The total effective amount of the pharmaceutical composition of the present invention may be administered to a patient in a single dose, and may be administered by a fractionated treatment protocol that is administered for a long time in multiple doses. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease. For example, it may be administered in divided doses from 1 to several times so as to be administered in an amount of preferably 0.001 to 100 mg, more preferably 0.01 to 10 mg per 1 kg of body weight per day, based on the complex extract of Hojanggeun and Gyesim. However, the dosage of the complex extract of Geunjanggeun and Gyesim is not only the administration route and the number of treatments of the pharmaceutical composition, but also the patient's age, weight, health condition, sex, disease severity, diet and excretion rate. Since the effective dose is to be determined, considering these points, those of ordinary skill in the art can use the complex extract of Giliworm root and Pyramid to prevent, treat or improve cognitive dysfunction, and/or improve learning ability or memory. It will be possible to determine an appropriate effective dosage according to the specific application for this. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, route of administration, and method of administration as long as it exhibits the effects of the present invention.

The pharmaceutical composition for preventing or treating cognitive dysfunction of the present invention may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, or methods using a biological response modifier.

The pharmaceutical composition for preventing or treating cognitive dysfunction of the present invention may also be a quasi-drug composition comprising a complex extract of Hojanggeun and Gyesim.

When the composition of the present invention is used as a quasi-drug composition, the complex extract of Hojanggeun and Gyesim may be added as it is or may be appropriately used in accordance with a conventional method with other quasi-drug components. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).

The contents of the pharmaceutical composition and health functional food composition of the present invention may be applied mutatis mutandis to the quasi-drug composition and the quasi-drug of the present invention.

In the present invention, the term "health functional food" includes both the meaning of "functional food" and "health food".

In the present invention, the term "functional food" is the same term as food for special health use (FoSHU), and has a medical and medical effect processed so that the bioregulatory function is effectively displayed in addition to nutritional supply. Means high food.

In the present invention, the term "health food" refers to a food having an active health maintenance or enhancing effect compared to general food, and a health supplement food refers to a food for health supplement purposes. In some cases, the terms functional food, health food, and health supplement food are used interchangeably. The food may be prepared in various forms such as tablets, capsules, powders, granules, liquids, pills, etc. to obtain useful effects for improving cognitive function disorders or enhancing cognitive function, learning ability, or memory.

As a specific example of such a functional food, it is possible to manufacture a processed food with good storage properties while making use of the characteristics of agricultural products, livestock products, or aquatic products using the composition.

The health functional food composition of the present invention may also be prepared in the form of nutritional supplements, food additives, feed, etc., and target animals including humans or livestock.

Food compositions of this type can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruit, canned food, jam, marmalade, etc.), fish, meat and processed foods thereof (e.g. ham, sausage) Corn beef), bread and noodles (e.g. udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, sweets, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine , Vegetable protein, retort food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.), etc. can be prepared by adding a complex extract of chojanggeun and chicken heart.

In addition, as a nutritional supplement, it is not limited thereto, but may be prepared by adding a complex extract of Hojanggeun and Gyesim to capsules, tablets, and pills.

In addition, the health functional food is not limited thereto, for example, liquefied, granulated, encapsulated, and powdered so that the complex extracts of Hojanggeun and Gyesim are prepared in the form of tea, juice, and drink so that they can be consumed (healthy beverage). It can be consumed in a form. In addition, in order to use the complex extract of Hojanggeun and Gyesim in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate. In addition, it can be prepared in the form of a composition by mixing the complex extract of the above-mentioned hojanggeun and gypsy with a known active ingredient known to be effective in preventing or improving cognitive dysfunction or enhancing cognitive function, learning ability, or memory. have.

When the food composition of the present invention is used as a health drink composition, the health drink composition may contain various flavoring agents or natural carbohydrates as an additional component, like a normal drink. The natural carbohydrates described above include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Polysaccharides such as dextrin and cyclodextrin; It may be a sugar alcohol such as xylitol, sorbitol, and erythritol. Sweeteners include natural sweeteners such as taumatin and stevia extract; Synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

The complex extract of Hojanggeun and Gyesim may be contained as an active ingredient in a food composition for preventing or improving cognitive dysfunction or a food composition for improving cognitive function, learning ability, or memory, the amount of which obtains the above preventing, improving or enhancing effect. In an effective amount, for example, it is preferably 0.01 to 100% by weight based on the total weight of the total composition, but is not particularly limited thereto. The food composition of the present invention is mixed with other active ingredients known to be effective in preventing or improving cognitive dysfunction or enhancing cognitive function, learning ability, or memory, together with a complex extract of Hojanggeun and Kyesim Can be manufactured.

In addition to the above, the health functional food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives , Glycerin, alcohol, or a carbonating agent. In addition, the health food of the present invention may contain flesh for the manufacture of natural fruit juice, fruit juice beverage, or vegetable beverage. These ingredients may be used independently or in combination. The ratio of these additives is not very important, but it is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described in more detail through examples. However, since the present invention can be modified in various ways and has various forms, specific examples and descriptions described below are only to aid understanding of the present invention, and limit the present invention to a specific disclosure form. I am not trying to do it. It is to be understood that the scope of the present invention includes all changes, equivalents, and substitutes included in the spirit and scope of the present invention.

[Production Example 1]

Manufacture of single extract of chojanggeun and ginseng

1-1. Preparation of Hojanggeun Extract

10 L of 70% ethanol was added to 100 g of hojanggeun purchased from Human Herb Co., Ltd. (http://www.humanherb.co.kr/), and the extract was obtained at room temperature after immersing for 24 hours at 60°C. Again, 10ℓ of 70% ethanol was added and the extraction process was repeated twice more to collect the extract.

1-2. Preparation of seaweed extract

10ℓ of 70% ethanol was added to 100g of Gyesim purchased from Human Herb Co., Ltd. (http://www.humanherb.co.kr/), and the extract was obtained at room temperature after immersion at 60°C for 24 hours. Again, 10ℓ of 70% ethanol was added and the extraction process was repeated twice more to collect the extract.

[Production Example 2]

Manufacture of complex extracts of Hojanggeun and Gyesim

A composite extract obtained by mixing the Hojanggeun extract and the ginseng extract prepared in Preparation Example 1 in the weight ratio shown in Table 1, respectively.

Hojanggeun: Mixed weight ratio of chicken core Manufacturing Example 2-1 1:1 Manufacturing Example 2-2 1:2 Preparation Example 2-3 2:1

[Preparation Example 1]

Preparation of cell lines and experimental materials

DMEM medium and FBS were purchased from Hyclone, and gentamicin was purchased from Lonza to cultivate the microglia cell line, BV2 cells (sold in the laboratory of Kyung-ho Seok, Kyungpook National University). To induce the inflammatory reaction, LPS (Lipopolysaccharide) was purchased from Sigma-Aldrich and used.

For RNA extraction, MACHEREY-NAGEL's NucleoZOL was purchased, and Bio-Rad's iScript cDNA synthesis kit and iQ SYBR Green Supermix product were purchased for cDNA synthesis and real-time PCR analysis.

Primers for real-time PCR were synthesized and used by Bioneer with the nucleotide sequence shown in Table 2.

Gene name Forward primer
(5'→3') order
number Reverse primer
(5'→3') order
number IL-10 GCCCTTTGCTATGGTGTC One TCTCCCTGGTTTCTCTTCC 2 IL-1β CTCAACTGTGAAATGCCACC 3 CTTCATCTTTTGGGGTCCGT 4 iNOS GTTCTCAGCCCAACAATACAAGA 5 GTGGACGGGTCGATGTCAC 6 Gadph CAGTATGACTCCACCCACGG 7 ATGGGCTTCCCGTTGATGAC 8

Confirmation of the effect of reducing neuroinflammation by administering the complex extract of Hojanggeun and Kyesim

One of the factors affecting memory and cognitive abilities is brain damage caused by neuroinflammation. There are several causes of inflammation in the nerve tissue, such as traumatic brain injury, infection, and autoimmune diseases, but most neuroinflammation is accompanied by activation of microglia and astrocytes. These activated cells produce inflammatory factors such as cytokines and chemokines, which promote necrosis of nerve cells.By controlling this phenomenon, brain damage caused by activated neuroinflammation can be reduced and smooth brain function can be maintained (Health Functional food functional evaluation guide, Korea Food and Drug Administration, 2019; Wang WY, Tan MS, Yu JT, Tan L.. Role of pro-inflammatory cytokines released from microglia in Alzheimer's disease. Ann Transl Med. 2015 Jun;3(10) :136).

BV2 cells are mouse microglia cell lines that act as immune cells such as macrophages in the central nervous system. When BV2 cells are treated with LPS, a bacterial-derived toxin, receptors in the BV2 cell membrane react to induce inflammatory signaling. Using these properties, neuroinflammation can be realized in BV2 cells in vitro , and the method of treating the drug and verifying the effect of reducing neuroinflammation is relatively easy and widely used (Hye Yeon Nam, et. al. Ibrutinib suppresses LPS-induced neuroinflammatory responses in BV2 microglial cells and wild-type mice.J Neuroinflammation. 2018; 15: 271.Published online 2018 Sep 19).

Accordingly, in the present example, the effect of reducing neuroinflammation of the complex extract of Giliworm root and Gypsy core was confirmed using BV2 cells in which the inflammatory reaction was induced, which is a microglia cell line.

1-1. Culture of microglia cell line BV2 cells

BV2 cells were cultured at 37° C. and 5% CO ₂ using DMEM medium containing 5% FBS and 10 μg/ml gentamicin, and subcultured every 2 days. In order to induce an inflammatory response, 2×10 ⁵ cells were placed in a 6-well plate and cultured for 24 hours before use.

1-2. Induction of inflammatory response of BV2 cells and treatment of 1:1 complex extracts of Hojanggeun and Kyesim

Put the cells in a 6-well plate so that 2x10 ⁵ cells can enter and incubate for 24 hours, then 20 µg/ml each of the single, single, and 1:1 complex extracts of Hojanggeun with 100ng/ml LPS in serum-free medium After treatment at the concentration (final DMSO concentration is 0.1%), incubate for 4 hours at 37°C and 5% CO ₂ .

1-3. RNA extraction and IL-10 gene expression analysis

After removing the medium and washing with PBS once, the cells were immediately melted using NucleoZOL, and RNA was extracted according to the manufacturer's Total RNA isolation protocol. 1 μg of RNA was synthesized by reverse transcription polymerase chain reaction using iScript cDNA synthesis kit. The synthesized cDNA was analyzed by performing real-time PCR with iQ SYBR Green Supermix using the primer set of the IL-10 gene, an inflammatory cytokine in Table 2.

As a result of the experiment, as shown in FIG. 1, the expression of the inflammatory cytokine IL-10 gene increased by LPS was decreased by a single extract of Hojanggeun root and a gypsysimus, respectively. Confirmed. Through this, it was found that the 1:1 complex extract is more effective in inhibiting neuroinflammation than the single extract of Hojanggeun and Gyesim.

Confirmation of the effect of reducing neuroinflammation according to the weight ratio of gaujanggeun and geunsim

2-1. IL-10 gene expression analysis

In the same manner as in Example 1, the length ratio of 1: 1 (Production Example 2-1), 1:2 (Production Example 2-2) and 2:1 (Production Example 2-3) was mixed The effect of reducing neuroinflammation of the complex extract was confirmed.

As a result of the experiment, as shown in FIG. 2, the complex extract having a mixture weight ratio of chojanggeun: chicken core significantly increased the expression of the IL-10 gene by LPS than the 1:2 or 2:1 complex extract. It was confirmed that it suppressed and showed a significant difference. Through this, it was confirmed that the ratio of the complex extract of G. japonica root and Gyesim complex showing anti-inflammatory effect on neuroinflammation was most appropriate.

2-2. Analysis of gene expression of various inflammatory factors (IL-1β, IL-10, iNOS)

In order to confirm the effect of reducing neuroinflammation according to the mixing weight ratio through more various inflammatory factors, the expression of IL-1β and iNOS genes was further analyzed. The experimental method was carried out in the same manner as in Example 2-1, and the synthesized cDNA was analyzed by real-time PCR with iQ SYBR Green Supermix using the primer set of the inflammatory cytokines IL-1β and iNOS gene of Table 2. Each gene expression value including the IL-10 gene of Example 2-1 was corrected by dividing it by the gapdh expression value, which is a housekeeping gene.

As a result of the experiment, as shown in FIG. 3, it was confirmed that the 1:1 complex extract significantly suppressed the expression of neuroinflammation-related genes induced by LPS compared to the 2:1 complex extract, while the inhibitory effect was remarkable.

The result that the 1:1 complex extract effectively inhibits the neuro-inflammatory response of microglia induced by LPS is sufficient evidence that the 1:1 complex extract can prevent or inhibit brain damage caused by the inflammatory response. Through these results, it can be interpreted that the 1:1 complex extract can help maintain healthy brain function and improve brain activity.

Based on the above results, in the following examples, experiments were conducted with a 1:1 complex extract having the best effect.

The statistical significance of the experimental results of Examples 1 and 2 was analyzed by the one-way ANOVA statistical method, and the comparison with the control group treated with LPS was analyzed by Dunnett's post-test. *p<0.05, **p<0.01.

[Preparation Example 2]

Preparation of experimental animals and materials

7-week-old SD female rats were purchased and acclimated for 1 week under constant temperature (23±1℃) and humidity (50%±5), and then bilateral ovariectomy under anesthesia to create a model that mimics human menopause. (OVX) was implemented.

In the control group (sham), the ovary was left intact and only simulated surgery was performed, followed by a recovery period of 7 days. The ovariectomy group is divided into a simulated surgery group (Sham), an ovarian resection group (OVX)), a β-estradiol administration group (E2), and a 1:1 complex extract administration group (HG) of eosinophilia and ginseng extract. Was orally administered for 4 weeks at a concentration of 200mg per kg of rat body weight.

During the test period, solid feed and water were freely ingested, and the breeding environment was automatically maintained in a light-dark cycle at a temperature of 23±0.5℃, a relative humidity of 50±5%, and a 12-hour interval. After the end of the experiment period, they were fasted for 12 hours, the weight before sacrifice was measured, and an anesthetic in which lumpun and zoletin were mixed in a ratio of 2:3 was used for anesthesia of the experimental animals. After blood was collected from the experimental animals, it was centrifuged (1,000g, 15min, 4℃), and stored in an ultra-low temperature freezer at -80℃ before analysis.

R&D Systems' Rat MCP-1 ELISA kit (DY3144-05) was purchased to measure blood MCP-1, and R&D Systems' Rat Magnetic Luminex Assay (multiplex) was used to measure TNF-α and IL-6.

Confirmation of the level of markers for controlling cognitive function in the blood according to administration of complex extracts of Hojanggeun and Kyesim

Blood dispensed in small portions in Preparation Example 2 and stored at -80°C is slowly dissolved at 4°C, and diluted to 1/4 concentration using the dilution buffer of an ELISA kit. Conduct an ELISA experiment according to the protocol provided by the kit and measure the absorbance at 450 nm and 540 nm. At this time, the absorbance value of 450 nm is divided by the absorbance value of 540 nm, which is a correction factor, and the concentration is calculated by substituting it into the standard curve trend line calculation formula.

As a result of the experiment, as shown in FIG. 4, it was confirmed that the MCP-1 in the blood increased by OVX was significantly reduced by administration of a 1:1 complex extract of gastrointestinal muscle and gypsy. In the positive control group treated with estradiol, a significant decrease in MCP-1 in blood was observed.

Through the results as described above, it can be confirmed that the complex extract of Hojanggeun and Gyesim can be used to improve cognitive dysfunction in the menopausal model by controlling the level of MCP-1, a marker related to cognitive ability in blood.

Efficacy of reducing systemic inflammation by administration of complex extracts of Geunjanggeun and Gisim

In Preparation Example 2, blood was dispensed in small portions and stored at -80°C, slowly dissolve at 4°C, and diluted to 1/2 concentration using the dilution buffer of the Magnetic luminex multiplex assay kit. Conduct an ELISA experiment according to the protocol provided by the kit and analyze using the Luminex 200 System.

As a result of the experiment, as shown in Figs. 5 and 6, it was confirmed that the levels of TNF-α and IL-6 in the blood were significantly reduced in the 1:1 complex extract administration group of jangchim muscle and chicken heart compared to the OVX group. Due to this result of the reduction of TNF-α and IL-6, which are representative inflammation markers, in the blood, it can be judged that the complex extract of Hojanggeun and Gisim can effectively reduce the systemic inflammation that increases in the menopausal model. It can be seen that it can have a positive effect on the improvement of cognitive function.

[Preparation Example 3]

Preparation of experimental animals and materials

In order to verify the cognitive improvement function, 60 ICR mice of 5 weeks old were purchased from Coretech Co., Ltd., and the feed was purchased from Purina's rat feed.

Donepezil, ascorbic acid and scopolamine were purchased from Sigma, and PBS (Phosphate buffered saline) was purchased from Hyclone.

Breeding of experimental animals and oral administration of experimental substances

ICR mice were reared to have free access to feed and water under constant temperature (23±1℃) and humidity (50±5%) after wearing. After adapting to the breeding environment for 1 week and measuring the weight, it was divided into six groups as shown in Table 3. After the adaptation period, donepezil 5 mg/kg in the positive control group, and 1:1 complex extracts of Hojanggeun and Kyesim in the experimental groups 1, 2 and 3 at concentrations of 50 mg/kg, 100 mg/kg, and 200 mg/kg, respectively, The same amount of distilled water was orally administered to the control group 1 and the control group 2 in the same manner. Administration was performed once a day for a total of 8 weeks.

group Control 1
(Vehicle) Control 2
(Scopolamine) Positive control
(Donepezil) Experimental group 1
(HG 50mg/kg) Experimental group 2
(HG 100mg/kg) Experimental group 3
(HG 200mg/kg) Oral administration Distilled water (DW) Distilled water (DW) Donepezil 5mg/kg Complex extract 50mg/kg complex
100mg/kg extract complex
200mg/kg extract i.p. injection PBS Scopolamine 1mg/kg Mari number 10 10 10 10 10 10

Establishment of dementia induction animal model using scopolamine

Several dementia model animals have been used to measure cognitive, learning and memory abilities. Among them, the mouse model for inducing dementia by anticholinergic drugs such as Scopolamine is a model that is widely used because of its short dementia induction period and easy experimental method (Preston GC et al., (1988). The scopolamine model of dementia: determination of central cholinomimetic effects of physostigmine on cognition and biochemical markers in man.J Psychopharmacol. 2(2), 67-79; Jinghua Wang et al. (2014). Effects of Fructus Akebiae on learning and memory impairment in a scopolamine -induced animal model of dementia. 8(2), 671-675).

In this example, scopolamine at a concentration of 1 mg/kg 30 minutes before the behavioral test for measuring learning and memory ability was injected by intraperitoneal injection (i.p. injection) to induce dementia in experimental animals. Control 1 was injected with the same amount of phosphate buffered saline (PBS) as a vehicle.

Measurement of spatial perception and short-term memory ability using Y-maze

Experimental substances were administered orally 1 hour before the behavioral experiment, and scopolamine was injected intraperitoneally 30 minutes later. After 30 minutes, place the mouse at the end of one arm of the Y-maze and record the movement for 8 minutes. One point (actual alternation) was given for entering three different arms one after another, and no score was given if not consecutively entered. The value of spontaneous alternation was expressed by dividing the above measured score by the number subtracting 2 from the total number of entries into the entire arm and converting it into probability. Statistical significance was analyzed using the One-way ANOVA statistical method and the Dunnett's post-hoc test. ###p<0.001, *p<0.05

As a result of the experiment, as shown in FIG. 7, spatial perception and short-term memory capacity decreased due to dementia induction by scopolamine was significantly recovered by administration of 100 mg/kg and 200 mg/kg concentrations of complex extracts of elongated roots and ginsengshim. I was able to confirm it. In addition, the movement for 8 minutes in the Y-shaped maze decreased in the experimental group administered with 50 mg/kg of the complex extract of Hojanggeun and Gyesim, but significantly decreased in the experimental groups of 100 and 200 mg/kg concentrations, respectively. Did not appear. This is because experimental groups 1 and 2, which administered the complex extracts of G. japonica and gypsysimus at 100 and 200 mg/kg, respectively, entered the arm of the Y-type maze at the same number of times as the control group 2. It can be seen that the complex extracts of long roots and ginseng roots improved spatial perception and short-term memory capacity by recovering dementia induced by scopolamine.

Measurement of learning and long-term memory ability using passive avoidance

The passive avoidance test apparatus consists of two zones, a light chamber and a dark chamber, and the floor is made of wire mesh. On the first day (Training day), the mice were placed in a bright chamber and allowed to acclimate for 20 seconds, and then the door to the dark chamber was opened. When the mouse completely entered the dark chamber, the door was closed and an electric shock of 0.3mA and 3 seconds was applied. The time to enter the dark chamber was recorded and the mice returned to the cage. 24 hours later, the next day (Aquisition day), the test substances were administered orally 1 hour before the behavioral experiment, and scopolamine was injected intraperitoneally 30 minutes later. After 30 minutes, the mice were placed in a bright chamber in the same manner as on the first day, and the time until entering the dark chamber was recorded. The maximum measurement time was set to 300 seconds.

As a result of the experiment, it can be seen that the learning and long-term memory ability decreased due to dementia induction by scopolamine was increased in the positive control group (Donepezil) and the experimental groups administered with the complex extracts of scopolamine there was. In particular, Experimental Group 3, administered with 200 mg/kg of the complex extract of Hojanggeun and Gyesim, showed similar learning and memory abilities to Control 1, which did not induce dementia. Through this, it can be seen that the complex extract of Hojanggeun and Gyesim can suppress dementia induction and improve cognitive, learning, and memory abilities.

SEQUENCE LISTING <110> NovMetaPharma Co., Ltd. <120> COMPOSITION COMPRISING EXTRACT OF POLYGONUM CUSPIDATUM SIEB. et ZUCC. AND CINNAMOMUM CASSIA BLUME FOR PREVENTING, IMPROVING OR TREATING OF COGNITIVE DYSFUCCTION <130> 1067452 <150> KR 10-2019-0092747 <151> 2019-07-30 <160> 8 <170> PatentIn version 3.2 <210> 1 <211> 18 <212> DNA <213> Artificial <220> <223> IL-10 forward primer <400> 1 gccctttgct atggtgtc 18 <210> 2 <211> 19 <212> DNA <213> Artificial <220> <223> IL-10 reverse primer <400> 2 tctccctggt ttctcttcc 19 <210> 3 <211> 20 <212> DNA <213> Artificial <220> <223> IL-1β <400> 3 ctcaactgtg aaatgccacc 20 <210> 4 <211> 20 <212> DNA <213> Artificial <220> <223> IL-1β reverse primer <400> 4 cttcatcttt tggggtccgt 20 <210> 5 <211> 23 <212> DNA <213> Artificial <220> <223> iNOS forward primer <400> 5 gttctcagcc caacaataca aga 23 <210> 6 <211> 19 <212> DNA <213> Artificial <220> <223> iNOS reverse primer <400> 6 gtggacgggt cgatgtcac 19 <210> 7 <211> 20 <212> DNA <213> Artificial <220> <223> Gadph forward primer <400> 7 cagtatgact ccacccacgg 20 <210> 8 <211> 20 <212> DNA <213> Artificial <220> <223> Gadph reverse primer <400> 8 atgggcttcc cgttgatgac 20

Claims (13)

A pharmaceutical composition for the prevention or treatment of cognitive dysfunction, comprising the extract of jangeun and geunsim. The pharmaceutical composition for preventing or treating cognitive dysfunction according to claim 1, wherein the extracts of Hojanggeun and Gyesim are extracted using water, C1 to C4 lower alcohol or a mixture thereof as a solvent. The pharmaceutical composition for preventing or treating cognitive dysfunction according to claim 1, wherein the extracts of Hojanggeun and Gyesim are mixed in a weight ratio of greater than 1:0.5 and less than 1:2. The method of claim 1, wherein the cognitive dysfunction is dementia, Alzheimer's disease, Huntington's disease, vascular dementia, ischemic stroke, traumatic brain injury, forgetfulness, Parkinson's disease, Pick disease, Creutzfeldt-Jakob disease, and A pharmaceutical composition for preventing or treating cognitive dysfunction, characterized in that at least one selected from the group consisting of mild cognitive dysfunction. Health functional food composition for the prevention or improvement of cognitive dysfunction, comprising the extract of janggeun and geunsim as active ingredients. The health functional food composition for preventing or improving cognitive dysfunction according to claim 5, wherein the Hojanggeun and Ginseng extract is extracted using water, C1 to C4 lower alcohol or a mixture thereof as a solvent. The health functional food composition for preventing or improving cognitive dysfunction according to claim 5, wherein the chojanggeun and ginseng extract are mixed in a weight ratio of greater than 1:0.5 to less than 1:2. The method of claim 5, wherein the cognitive impairment is dementia, Alzheimer's disease, Huntington's disease, vascular dementia, ischemic stroke, traumatic brain injury, forgetfulness, Parkinson's disease, Pick disease, Creutzfeldt-Jakob disease, and Health functional food composition for preventing or improving cognitive dysfunction, characterized in that at least one selected from the group consisting of mild cognitive dysfunction. Health functional food composition for improving learning ability or memory, including the extract of janggeun and geunsim. A composition for improving cognitive function lowering, including the extract of jangeun and geunsim. The composition for improving cognitive function according to claim 10, wherein the cognitive decline is at least one selected from the group consisting of lethargy, decreased attention, depression, decreased hearing, painlessness, sweatlessness, and decreased discernment. The composition of claim 10, wherein the composition is a pharmaceutical composition. The composition of claim 10, wherein the composition is a food composition.

Images