KR20200116324A - Composition for controlling bacterial spot disease of tomato comprising grape root extract and or its isolated compound as an active ingredient - Google Patents

Abstract

The present invention relates to a use of a grape root extract or a compound isolated therefrom for controlling a bacterial spot disease of tomato. Particularly, the present invention relates to a composition for controlling a bacterial spot disease of tomato comprising a grape root extract or a compound isolated therefrom (Isohopheaphenol or ampelopsin A) as an active ingredient, and a method for controlling a bacterial spot disease of tomato using the same. The grape root extract or the compound isolated therefrom, of the present invention, may selectively inhibit a type III secretion system of pathogens while not exhibiting antibacterial activity against a causative agent of the bacterial spot disease of tomato, and thus the composition of the present invention comprising the same as an active ingredient can be usefully applied as a non-sterile plant disease control agent. In particular, the composition of the present invention is a non-sterile plant disease control agent based on a natural material, and can solve a problem of the appearance of resistant plant pathogens caused by the use of conventional antibiotics, and thus has an advantage of reducing the antibiotic resistance problem and side effects to the environment by replacing organic synthetic sterilizers.

Description

Composition for controlling bacterial spot disease of tomato comprising grape root extract and or its isolated compound as an active ingredient, comprising grape root extract or a compound isolated therefrom

The present invention relates to a use of a grape root extract or a compound isolated therefrom for controlling tomato spot bacterial disease, and in detail, comprising a grape root extract or a compound isolated therefrom (isohopeaphenol or empelopsin A) as an active ingredient It relates to a composition for controlling tomato spot bacterial disease and a method for controlling tomato spot bacterial disease using the same.

Tomato spot bacterial disease is a representative tomato bacterial disease that occurs in tomato cultivation regions worldwide and damages tomato seeds, stems, and leaves.

Pseudomonas syringe causing tomato bacterial spot disease pv. Seeds or soil infected by tomato DC3000 ( Pseudomonas syringae pv. tomato DC3000) become an inoculum, causing symptoms on the leaves, stems, and fruits of tomato plants. In the early stages of infection, pathogens multiply outside the leaves or stems of plants to increase their density, and when they reach a certain density, they progress to the infection stage. In the infection stage, it invades the inside of the plant through the pores or wounds of the leaves, survives in the cell gap, and obtains moisture and nutrients that pathogens can multiply in large quantities.

Pseudomonas cold pv. Tomato DC3000 is one of the most studied model pathogens in revealing the invasion mechanism of pathogens in addition to the characteristics of causing bacterial spot disease in tomato plants. Pathogenic factors of bacterial pathogens include quorum sensing, generation of toxins, decomposition of plant cell walls using enzymes, and secretion of effector proteins through the Type III secretion system. The characteristics of these pathogenic factors will be described in detail as follows.

Pathogens proliferate at the infected site of plants and secrete a signal transducer between cells. When the signal transducer reaches a certain concentration, a specific gene is expressed. The gene contains pathogenic genes that produce toxins or cell wall degrading enzymes, and this series of processes is called quorum sensing. Therefore, when the pathogen density control system is suppressed, the expression of pathogenic genes is regulated, resulting in a plant disease control effect.

On the other hand, the type III secretion system is a mechanism that secretes a pathogenic protein called an effector protein into the cells of the host plant of the pathogen. It is mainly found in Gram-negative bacteria and is a secretory system possessed by pathogenic bacteria or some symbiotic bacteria. Effector proteins produced by bacteria move to host cells through needle-like secretion channels, and effector proteins inhibit the host cell's immune response and cause disease. Pseudomonas cold pv. Tomato DC3000 is a representative plant pathogen that is actively studied as a model organism to understand the mechanism of this type III secretion system. Both the hypersensitive response (HR) of DC3000 bacteria and the occurrence of disease in the host plant are due to the movement of effector proteins through the Type III secretion system. When the conditions for disease development are met, the expression of DC3000 bacteria's type III secretion system genes is activated. To describe this reaction in detail, two proteins, HrpR and HrpS, form a dimer to activate the promoter of the hrpL gene and produce the HrpL protein. HrpL protein, as an alternative sigma factor, plays a role in activating gene expression by attaching to promoter regions of genes in the lower type III secretion system. The hrpA gene, known as a subgene of the hrpL gene, is activated by HrpL sigma factor to synthesize a pathway through which the effector protein can move from the pathogen cell to the host cell. Avrpto protein, a representative effector protein, plays a role in inhibiting the immune response of host cells by binding with FLS2, a pattern recognition receptor of host cells, and AvrB1 protein is a host cell that resists attack by these effector proteins. Neutralizes the immune response.

The development of a plant disease control agent based on the above-described pathogenic factors is expected to play a role in solving the problem of emergence of resistant plant pathogens caused by the use of existing antibiotics. On the other hand, the development of plant disease control agents based on metabolites derived from natural products can provide an eco-friendly method for controlling plant diseases.

Therefore, when discovering type III secretion system inhibitors of plant pathogens through metabolites derived from natural products, it has the advantage of reducing antibiotic resistance problems and side effects to the environment by replacing organic synthetic fungicides.

Under this background, the present inventors have found that Pseudomonas syringe pv. Tomato DC3000 was selected as a candidate substance having the activity of inhibiting the type Ⅲ secretion system. In particular, grape root extract and a specific compound isolated therefrom did not show antibacterial activity against the pathogen, and the type Ⅲ secretion system was suppressed. The present invention was completed by confirming its usefulness as a non-sterile plant disease control agent because it has effective control activity against spot bacterial diseases.

Korean Patent Publication No. 10-2013-0101309

Accordingly, an object of the present invention is to provide a composition that can be usefully used as a non-sterile plant disease control agent by selectively inhibiting the type III secretion system without antibacterial activity.

Another object of the present invention is to provide a method capable of effectively controlling tomato spot bacterial diseases by using the composition for controlling non-sterile plant diseases.

In order to achieve the object of the present invention as described above,

The present invention provides a composition for controlling tomato spot bacterial disease comprising a grape root extract or a compound isolated therefrom as an active ingredient.

In one embodiment of the present invention, the extract may be a grape root methanol extract.

In one embodiment of the present invention, the compound may be isohopheaphenol or ampelopsin A.

In one embodiment of the present invention, the composition may contain one or more compounds consisting of isohopheaphenol, ampelopsin A, and stereoisomers thereof in a concentration of 1 to 100000 μM.

In one embodiment of the present invention, the composition may have a control effect by selectively inhibiting the type III secretion system that is not antibacterial activity against the causative agent of tomato spot bacterial disease.

In one embodiment of the present invention, the causative agent may be Pseudomonas syringae pv. tomato DC3000 ( Pseudomonas syringae pv. tomato DC3000).

In addition, the present invention provides a method for controlling tomato spot bacterial disease comprising the step of treating the composition to a plant or soil.

The grape root extract of the present invention or a compound isolated therefrom is capable of selectively inhibiting the type III secretion system of pathogens, not antibacterial activity against the causative agent of tomato spot bacterial disease, and the composition of the present invention comprising this as an active ingredient It can be usefully used as a non-sterile plant disease control agent. In particular, the composition of the present invention is a non-sterile plant disease control agent based on a natural material, and can solve the problem of the appearance of resistant plant pathogens caused by the use of existing antibiotics. There is an advantage in that it can reduce side effects for

1 is a graph showing the type III secretion system inhibitory activity of 16 candidate substances first selected from a total of 1030 plant metabolite extract libraries constructed in this laboratory.
2 is a block diagram showing a process of purifying isohopheaphenol and ampelopsin A in the grape root extract according to the present invention.
3 is a graph showing the molecular weight of isohopheaphenol isolated and purified from the grape root extract according to the present invention.
Figure 4 is a graph showing the molecular weight of ampelopsin A (ampelopsin A) isolated and purified from the grape root extract according to the present invention.
5A and 5B show ¹ H-NMR and ¹³ C-NMR spectra showing the results of structural analysis of Isohopheaphenol isolated and purified from the grape root extract according to the present invention.
6A and 6B show ¹ H-NMR and ¹³ C-NMR spectra showing the results of the structural analysis of ampelopsin A isolated and purified from the grape root extract according to the present invention.
7 is a photograph showing the antibacterial effect of the grape root extract according to the present invention (A: control, B: 10 μL of grape root extract buried treatment, C: 20 μL of grape root extract buried treatment, D: 40 μL of grape root extract Buried treatment, E: Grape root extract 80 μL applied treatment).
Figure 8 is a type III of Pseudomonas syringae pv. tomato DC3000 ( Pseudomonas syringae pv. tomato DC3000) by Isohopheaphenol and ampelopsin A isolated and purified from the grape root extract according to the present invention. This is a graph showing the results of real-time polymerase chain reaction comparing the expression levels of genes related to the secretion system (a: gene expression level when isohopeaphenol is treated, b: gene expression level when empelopsin-A is treated) .
9 is a photograph showing the results of the experiment of the control effect of the grape root extract of the present invention on tomato bacterial spot disease in a pot experiment under greenhouse conditions (A: healthy plants, B: infected plants, C: active fraction concentrate (0.125 g /mL), D: active fraction concentrate (0.25g/mL), E: active fraction concentrate (0.5g/mL))
FIG. 10 is a photograph showing the results of experimenting the control effect of Isohopheaphenol and ampelopsin A isolated and purified from the grape root extract of the present invention in a pot experiment under greenhouse conditions on tomato bacterial spot disease It is (A: healthy plants, B: infected plants, C: infected plants treated with isohopeaphenol, D: infected plants treated with empelopsin-A).

The present invention provides a composition for controlling tomato spot bacterial disease comprising a grape root extract or a compound isolated therefrom as an active ingredient.

The "grape root extract" of the present invention can be used obtained by directly extracting and separating from grape roots using a method known in the art for extraction and separation, and the'extract' as defined in the present invention uses an appropriate solvent. Thus, it is extracted from the grape root, for example, includes all of the crude extract of the grape root, a polar solvent-soluble extract, or a non-polar solvent-soluble extract.

Any suitable solvent for extracting the grape root extract of the present invention may be used as long as it is a pharmaceutically acceptable organic solvent, and water or an organic solvent may be used, but is not limited thereto, for example, purified water ( Water), methanol, ethanol, propanol, isopropanol, alcohol having 1 to 4 carbon atoms including butanol, acetone, ether, benzene ( Various solvents, such as benzene), chloroform, ethyl acetate, methylene chloride, hexane and cyclohexane, may be used alone or in combination. It is preferable to use methanol.

As the extraction method, any one of methods such as hot water extraction, cold precipitation extraction, reflux cooling extraction, solvent extraction, steam distillation method, ultrasonic extraction method, elution method, and compression method may be used. In addition, the desired extract may be further subjected to a conventional fractionation process, or may be purified using a conventional purification method. There is no limitation on the method for preparing the extract of the present invention, and any known method may be used.

For example, the grape root extract of the present invention can be prepared in a powder state by an additional process such as distillation under reduced pressure and freeze drying or spray drying of the primary extract extracted by the hot water extraction or solvent extraction method described above. In addition, the primary extract was added using various chromatography such as silica gel column chromatography, thin layer chromatography, high performance liquid chromatography, and ion exchange chromatography. It is also possible to obtain a fraction purified by.

Therefore, in the present invention, the grape root extract is a concept including all extracts, fractions, and purified products obtained in each step of extraction, fractionation, or purification, their dilutions, concentrates, or dried products.

In one embodiment of the present invention, the'grape root extract' is a methanol extract of grape root extracted with methanol from grape roots by Diaion HP-20 chromatography (H ₂ O-MeOH 100:0, 80:20, 60:40, 40:60, 20:80, 0:100%v/v, step gradient and 100% acetone) were performed to separate into a total of 7 fractions, and the active fractions (60% and 80% MeOH) were collected and concentrated under reduced pressure. After that, C18 reverse phase chromatography (H ₂ O-MeOH 100:0, 80:20, 60:40, 40:60, 20:80, 0:100 %v/v, step gradient) was performed to perform a total of 6 subsequent steps. Fractions may be separated, and 40% MeOH fractions of these fractions may be collected and concentrated under reduced pressure.

The grape root extract of the present invention prepared by the above method may be included in the composition at a concentration of 0.01 to 10 g/mL, but the value is not particularly limited.

On the other hand, the compound isolated from the grape root extract of the present invention may be Isohopheaphenol or ampelopsin A.

In the following examples of the present invention, the final purified products (Compounds 1 and 2) were separated from the grape root extract through an HPLC system using a C18 reverse phase column, and the finally separated Compounds 1 and 2 were Isohopheaphenol. Alternatively, it was confirmed through molecular weight and spectrum analysis that it was ampelopsin A.

The compound of the present invention may be included in the composition for controlling tomato spot bacterial disease in a concentration of 1 to 100000 μM, but the value is not particularly limited.

The composition of the present invention has a control effect by selectively inhibiting the type III secretion system, not antibacterial activity against the causative agent of tomato spot bacterial disease. That is, the grape root extract of the present invention or the compound isolated therefrom can selectively inhibit the type Ⅲ secretion system, not antibacterial activity against the causative agent of tomato spot bacterial disease, and the composition containing this as an active ingredient is a non-sterile plant It has a disease control effect.

Until the past, the development of antibiotics effective against various pathogenic bacteria was essential for the growth of bacteria and kills pathogenic bacteria by inhibiting the metabolic pathways commonly preserved in each bacteria or by inhibiting targets involved in the signaling system between cells and cells. Emphasis has been placed on the development of compounds that cause or inhibit. However, the antibiotics developed through this approach showed excellent efficacy in the early stage, but resistant strains easily appeared due to repeated use and abuse, and are emerging as many problems, and the need for development of new antibiotics is steadily increasing. to be.

The present invention was devised to solve the conventional problems as described above, as a factor causing pathogenicity of bacteria, targeting the type Ⅲ secretion system and selectively inhibiting it, so that it is non-sterile (does not show any effect on the growth of bacteria) plants It relates to a composition having a disease control effect.

Therefore, the composition of the present invention is expected to overcome the conventional antibiotic resistance problem as a non-sterile plant disease control agent, and has the advantage of being applicable to pathogenic bacteria that exhibit resistance to existing antibiotics.

In Example 4 below of the present invention, it was evaluated whether the grape root extract has antimicrobial activity against Pseudomonas syringae pv. tomato DC3000 ( Pseudomonas syringae pv. tomato DC3000), which is the causative agent of tomato spot bacterial disease. It was confirmed that there was no. On the other hand, in the following Example 5 of the present invention, a compound isolated from grape root extract (isohopeaphenol, Empelopsin-A) reduces the expression of genes related to the type III secretion system of Pseudomonas syringe fiV tomato DC3000. Confirmed. In addition, in Examples 6 and 7 of the present invention, it was confirmed that the grape root extract or a compound isolated therefrom (isohopeaphenol, empelopsin-A) had a control activity against Pseudomonas syringe fiV tomato DC3000.

Through the above experimental results, the grape root extract of the present invention or a compound isolated therefrom (isohopeaphenol, empelopsin-A) inhibits the type Ⅲ secretion system, not the growth inhibitory activity against the causative agent of tomato spot bacterial disease. Through, it was proved to have a plant disease control effect.

The composition of the present invention may be prepared by using a carrier usable as an agrochemical formulation in addition to the active ingredient (grape root extract or a compound isolated therefrom). As a carrier, any suitable carrier can be used as long as it is a commonly used pesticide formulation, but in particular, cryopreservatives skim milk, yeast extract, electrodeposition agent SOF70, Tween 20, surfactants TD20A, AS65D, etc. are used. It is desirable to do.

The active ingredient (grape root extract or a compound isolated therefrom) according to the present invention is preferably 0.001 to 10% by weight, and more preferably 0.003 to 2.0% by weight, based on 100% by weight of the total plant disease control agent composition. . The grape root extract or a compound isolated therefrom may be used as a powder or may be used as a liquid, and when used, it may be diluted 10 to 1000 times. However, the effective amount may be adjusted according to the degree of infection of the pathogen and environmental conditions. At this time, as the diluent, a commonly used one including purified water is used.

The present invention also provides a method for controlling tomato spot bacterial disease comprising the step of treating a plant or soil with a composition comprising the grape root extract of the present invention or a compound isolated therefrom as an active ingredient.

In one embodiment of the present invention, the composition may be treated with foliage on the above-ground part of the plant from 30 to 40 days after planting the crop or immediately before the invention.

The type of the plant is not particularly limited as long as it is a plant capable of infecting the causative agent of tomato spot bacterial disease, but it may be preferably a tomato.

Hereinafter, the present invention will be described in more detail through examples. These examples are for explaining the present invention more specifically, and the scope of the present invention is not limited to these examples.

<Example 1>

Pseudomonas cold pv. Selected as a candidate substance for inhibiting type Ⅲ secretion system of tomato DC3000

The present inventors from the plant metabolite extract library constructed in this laboratory, Pseudomonas syringe pv. A candidate substance having activity to inhibit the type III secretion system of tomato DC3000 was selected.

Among a total of 1030 plant metabolite extract libraries, Pseudomonas Syringe pv. In order to select a candidate group having the activity of inhibiting the type III secretion system of tomato DC3000, a screening for type III secretion system inhibitor established in this laboratory was performed. The screening is Pseudomonas Syringe pv. It is a system using the principle that the production of fluorescent protein is regulated by the expression of a type III secretion system-related gene of tomato DC3000, and follows the principle that the expression of fluorescent protein is inhibited by a substance having type III secretion system inhibitory activity. In other words, Pseudomonas Syringe pv. The promoter portion of the hrpA gene of the tomato DC3000 strain was inserted into a promoterless-GFP vector to create a vector in which the synthesis of fluorescent protein is regulated by the hrpA promoter. Pseudomonas Syringe pv. It was inserted into the tomato DC3000 strain to complete the reporter strain to be used for screening. The reporter strain selected the type III secretion system inhibitory activity candidate group in the plant metabolite library based on the principle that the hrpA promoter was activated, the fluorescent protein was produced, and the promoter was inhibited, the fluorescent protein expression was reduced. For reference, the hrpA gene is a type III secretion system-related gene that synthesizes a pathway through which effector proteins move from pathogens to plant cells.

As a result, as shown in Fig. 1, the grape root extract (KUNP 604), which has the best activity among 16 candidate libraries, was identified as a final candidate material to investigate the type III secretion system inhibitory activity and to verify the non-sterile plant disease control effect. Selected.

<Example 2>

Preparation of grape root extract (KUNP 604) of the present invention

Grape roots used in the experiment were grape roots collected from Jinju, Korea. Grape roots were washed with water 1-2 times, dried, and made into powder using a grinder. After immersion in 20 mL of 99.5% methanol per 1 g of grape root powder, extraction was performed at room temperature for 24 hours, and Whatman no. 2 It was filtered using filter paper and concentrated at 38°C using a vacuum concentrator. The grape root concentrate was recovered with 1 mL of 99.5% methanol and stored at 4°C before use.

<Example 3>

Isohopeaphenol and Empelopsin-A Separation and Purification from Grape Root Extract

The present inventors from the methanol extract of grape roots obtained through Example 2, Pseudomonas syringe pv. Isohopeaphenol and Empelopsin A, which are substances having an activity to inhibit the type III secretion system of tomato DC3000, were isolated and purified, and their structures were determined.

The methanol extract of grape roots obtained through Example 2 was Diaion HP-20 chromatography (H ₂ O-MeOH 100:0, 80:20, 60:40, 40:60, 20:80, 0:100% v/v, step gradient, and 100% acetone) were performed and separated into a total of 7 fractions. Among them, the active fractions (60% and 80% MeOH) were collected, concentrated under reduced pressure, and then C18 reverse phase chromatography (H ₂ O-MeOH 100:0, 80:20, 60:40, 40:60, 20:80, 0: 100%v/v, step gradient) was performed to separate a total of 6 subsequent fractions, 40% MeOH fractions of these fractions were collected and concentrated under reduced pressure, and finally, flow rate 2 mL min ^-1 , UV detector 254 nm, solvent 0.1 The final purified products (Compounds 1 and 2) were separated through an HPLC system using a C18 reverse phase column under preparative conditions using 10-80% methanol including% formic acid. The detailed separation process is shown in FIG. 2.

The structure of the compound was confirmed through molecular weight and spectrum analysis of the separated active substances, and it was confirmed that the compounds are'isohopeaphenol' and'empelopsin-A'.

<3-1> Compound 1

(1) Material properties: yellow amorphous powder

(2) Molecular formula: C ₅₆ H ₄₂ O ₁₂

(3) Mass spectrometry: ESI-HRMS m/z 905.2621 [MH] ^- (calculated 905.2598)

(4) Ultraviolet absorption spectrum (MeCN): λmax 230, 283 nm

(5) ¹ H nuclear magnetic resonance spectrum (500MHz, acetone-d ₆ ): 7.54 (2H, d, J = 8.4, H-2a,6a), 7.00 (2H, d, J = 8.4, H-3a,5a ), 5.65 (1H, d, J = 10.2, H-7a), 5.44 (1H, d, J = 10.2, H-8a), 6.39 (1H, d, J = 2.2, H-12a), 6.29 (1H , d, J = 1.6, H-14a), 6.39 (2H, d, J = 8.5, H-2b,6b), 6.33 (2H, d, J = 8.5, H-3b,5b), 5.16 (1H, brs, H-7b), 3.44 (1H, brs, H-8b), 5.84 (1H, d, J = 2.0, H-12b), 5.51 (1H, d, J = 2.0, H-14b)

(6) ¹³ C nuclear magnetic resonance spectrum (125MHz, acetone-d ₆ ): 133.8 (C-1a), 130.9 (C-2a,6a), 116.9 (C-3a,5a), 158.6 (C-4a), 93.7 (C-7a), 53.8 (C-8a), 140.8 (C-9a), 118.2 (C-10a), 158.6 (C-11a), 102.4 (C-12a), 156.8 (C-13a), 107.0 (C-14a), 137.6 (C-1b), 129.9 (C-2b,6b), 114.7 (C-3b,5b), 155.1 (C-4b), 43.7 (C-7b), 52.8 (C-8b ), 141.8 (C-9b), 117.0 (C-10b), 160.5 (C-11b), 95.3 (C-12b), 158.2 (C-13b), 109.6 (C-14b)

Results data are shown in detail in FIGS. 3 and 4, and it was confirmed that'Compound 1'of the present invention is'Isohopeaphenol' having the following chemical structural formula.

[Formula 1]

<3-1> Compound 2

(1) Material properties: yellow amorphous powder

(2) Molecular formula: C ₂₈ H ₂₂ O ₇

(3) Mass spectrometry: ESI-HRMS m/z 469.1278 [MH] ^- (calculated 469.1287)

(4) Ultraviolet absorption spectrum (MeCN): λmax 228, 281 nm

(5) ¹ H nuclear magnetic resonance spectrum (500MHz, acetone-d ₆ ): 7.10 (2H, d, J = 8.3, H-2a,6a), 6.76 (2H, d, J = 8.3, H-3a,5a ), 5.75 (1H, d, J = 11.4, H-7a), 4.14 (1H, d, J = 11.4, H-8a), 6.42 (1H, brs, H-12a), 6.22 (1H, brs, H -14a), 6.88 (2H, d, J = 8.2, H-2b,6b), 6.62 (2H, d, J = 8.3, H-3b,5b), 5.43 (1H, d, J = 4.4 H-7b ), 5.40 (1H, d, J = 4.4, H-8b), 6.15 (1H, d, J = 1.4, H-12b), 6.59 (1H, d, J = 1.4, H-14b)

(6) ¹³ C nuclear magnetic resonance spectrum (125MHz, acetone-d ₆ ): 132.7 (C-1a), 129.8 (C-2a,6a), 116.0 (C-3a,5a), 158.4 (C-4a), 88.6 (C-7a), 49.6 (C-8a), 143.1 (C-9a), 118.9 (C-10a), 157.2 (C-11a), 101.4 (C-12a), 160.2 (C-13a), 105.4 (C-14a), 130.9 (C-1b), 128.8 (C-2b,6b), 115.4 (C-3b,5b), 156.0 (C-4b), 43.8 (C-7b), 71.0 (C-8b ), 140.5 (C-9b), 118.3 (C-10b), 160.2 (C-11b), 97.1 (C-12b), 158.9 (C-13b), 110.4 (C-14b)

Results data are shown in detail in FIGS. 4 and 6, and it was confirmed that'Compound 2'of the present invention is'ampelopsin A'having the following chemical structural formula.

[Formula 2]

<Example 4>

Confirmation of antibacterial activity of grape root extract

In this experiment, Pseudomonas Syringe pv. The grape root extract, which has type III secretion system inhibitory activity of tomato DC3000, does not affect the growth of pathogens, and Pseudomonas syringe pv. To confirm that tomato DC3000 selectively regulates the type III secretion system, it was confirmed whether the grape root extract had antibacterial activity.

In Example 3, a paper disk containing the concentrate obtained by concentrating the active fraction of C18 chromatography under reduced pressure was applied to Pseudomonas Syringe pv. A suspension of tomato DC3000 (5×10 ⁴ CFU mL ^-1 ) is placed in the center of 20 μL plated King'B medium. The medium was cultured at 28° C. for 1 day, and then the antibacterial effect was evaluated by observing whether bacteria grow around the paper disk.

As a result, as shown in FIG. 7, it was confirmed that none of the paper disks buried with the concentrate from 10 μL to 80 μL formed a clear zone.Through these results, the grape root extract of the present invention did not have antibacterial activity. Pseudomonas syringe pv. It has been demonstrated to inhibit the pathogenicity of tomato DC3000.

<Example 5>

Pseudomonas syringe pv. of compounds derived from grape root extract (isohopeaphenol, eppelopsin-A). Effect of Tomato DC3000 on the Expression of Type III Secretion System Related Genes

In Example 4, it was confirmed that isohopeaphenol and empelopsin-A compound did not have an antibacterial effect. In this experiment, isohopeaphenol and empelopsin-A were pseudomonas syringe pv. PCR analysis was performed to confirm the effect on the expression level of genes related to the type III secretion system of tomato DC3000.

Type Ⅲ secretion system induction medium (50mM potassium phosphate buffer, 7.6mM (NH ₄ ) ₂ SO ₄ , 1.7mM MgCl ₂ , 1.7mM NaCl, 10mM fructose treated with 25 and 100 μM of isohopeaphenol and emphelopsin A, respectively) , pH 6.0) Pseudomonas syringe pv. Tomato DC3000 (This strain is a strain commonly used as a model system for the disease. It was distributed from a storage strain in the Plant Disease Molecular Biology Laboratory at Korea University in 2006) to induce the expression of genes related to the Type III secretion system at 18℃ for 3 hours. . Cells from which gene expression was induced were harvested, RNA was isolated, and cDNA was synthesized with the same amount of RNA (500 ng) to perform real-time polymerase chain reaction. Genes to check the expression level through real-time polymerase chain reaction were the type III secretion system-related genes hrpL, hrpA, and hopp1 genes, and gyrA and recA were used as internal control genes.

PCR conditions were 40 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds.

Primer sequence used for PCR amplification gene Primer sequence hrpL Forward CTCCAGTGCGTGTTTCTTGA Reverse GATGCCCCTCTACCTGATGA hrpA Forward GGTCGCATTTGCAGGATTA Reverse CTGAAGAGTGGCGTTGGAAG hopp1 Forward GCGGTACTGGAAGCAGTCTC Reverse TCAAGCTGTTGAGGCAAATG gyrA Forward CCTGCGTGAAGGCAAGTATT Reverse CAGCAGTTTTTCGTGTTCCA recA Forward CTTTGCAGATTTCCGGGTTA Reverse CGGCAAGGGTATCTACCTCA

As a result, as shown in FIG. 8, it can be seen that in the experimental group treated with isohopeaphenol and empelopsin- A with 100 μM, all of the hrpL, hrpA, and hopp1 genes decreased to a significant level when compared to the control group. In addition, the same results were obtained when comparing the expression levels of genes related to the type III secretion system by selecting gyrA as the internal control gene and comparing the expression levels by selecting recA .

Through the results as described above, isohopeaphenol and Empelopsin-A compound separated and purified from grape root extract were Pseudomonas Syringe pv. It was confirmed that tomato DC3000 can inhibit the type III secretion system.

<Example 6>

Control Effect of Grape Root Extracts on Tomato Bacterial Spots in Tomato Leaves in Greenhouse Conditions

In this experiment, in order to compare the control effect of grape root extract on bacterial spots of tomato leaves under greenhouse conditions, the active fraction (40% methanol fraction) of C18 chromatography of grape root extract was concentrated under reduced pressure and Pseudomonas syringe pv. Tomato leaves were inoculated with tomato DC3000 suspension. The degree of disease damage was evaluated in each treated and untreated groups, and the degree of spotting on tomato leaves was compared.

In detail, tomato seeds (product name: potted tomatoes), which are the disease-prone variety of bacterial spots, were placed in a 36-plastic pot containing high-pressure steam sterilized mixed soil (peat moss, perlite and vermiculite, 5:3:2, v/v/v). Sown. 10 ⁴ CFU mL ^-1 of Pseudomonas syringe pv. To the tomato DC3000 bacterial suspension, a concentrate obtained by concentrating the C18 chromatographic active fraction of grape root extract under reduced pressure was added at different concentrations (0.125g/mL, 0.25g/mL, 0.5g/mL), and a syringe was added to the tomato seedlings grown to the fourth leaf stage. And inoculated. The experiment was performed in 3 repetitions, and 24 hours after inoculation, wet room treatment was performed. Pseudomonas cold pv. 5-6 days after tomato DC3000 inoculation, the number and area of bacterial spots on the leaves of tomato seedlings were checked to evaluate the disease damage.

As a result, as shown in FIG. 9, it was confirmed that the number and area of bacterial spots in tomato leaves treated with the C18 chromatographic active fraction concentrate of grape root extract were significantly smaller than that of the control.

Through the above results, it was confirmed that the C18 chromatographic active fraction concentrate of the grape root extract of the present invention has a control effect on tomato bacterial spot disease.

<Example 7>

Control Effects of Isohopeaphenol and Empelopsin-A on Tomato Bacterial Spots in Tomato Leaves in Greenhouse Conditions

In this experiment, in order to compare the control effects of isohopeaphenol and empelopsin A on bacterial spots on tomato leaves under greenhouse conditions, Pseudomonas syringe pv. Tomato DC3000 suspension was inoculated on tomato leaves to evaluate the degree of disease damage in each treated and untreated group. Disease damage was compared by evaluating the degree of spots on tomato leaves.

Specifically, a 36-plastic pot containing a mixed soil (peat moss, perlite and vermiculite, 5:3:2, v/v/v) obtained by autoclaving tomato seeds (variety: potted tomato), which is a disease-prone cultivar, to bacterial spots. Sown in. 10 ⁴ CFU mL ^-1 of Pseudomonas syringe pv. Isohopeaphenol and empelopsin-A were added to the tomato DC3000 bacterial suspension by 100 μM each, and the tomato seedlings grown up to the 4th leaf stage were inoculated using a syringe. The experiment was performed in 3 repetitions, and 24 hours after inoculation, wet room treatment was performed. Pseudomonas cold pv. 5-6 days after tomato DC3000 inoculation, the number and area of bacterial spots on the leaves of tomato seedlings were checked to evaluate the disease damage.

As a result, as shown in FIG. 10, it was confirmed that the number and area of bacterial spots in tomato leaves treated with isohopeaphenol and empelopsin A were significantly smaller than that of the control.

Through the above results, it was confirmed that the isohopeaphenol and empelopsin-A compound isolated from the grape root extract of the present invention had a control effect on tomato bacterial spot disease.

So far, the present invention has been looked at around its preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

Claims (7)

A composition for controlling tomato spot bacterial disease comprising grape root extract or a compound isolated therefrom as an active ingredient. The method of claim 1,
The extract is a composition, characterized in that the methanol extract of grape roots. The method of claim 1,
The composition is characterized in that the compound is isohopheaphenol (Isohopheaphenol) or empelopsin A (ampelopsin A). The method of claim 3,
The composition is a composition comprising one or more compounds consisting of isohopheaphenol, ampelopsin A, and stereoisomers thereof in a concentration of 1 to 100000 μM. The method of claim 1,
The composition is a composition having a control effect by selectively inhibiting the type III secretion system that is not antimicrobial activity against the causative agent of tomato spot bacterial disease. The method of claim 5,
The causative agent is a composition of Pseudomonas syringae pv. tomato DC3000 ( Pseudomonas syringae pv. tomato DC3000). A method for controlling tomato spot bacterial disease comprising the step of treating a plant or soil with the composition of any one of claims 1 to 6.

Images