KR102604427B1 - Composition for controlling plant diseases comprising Trichoderma longibrachiatum strain and method to control plant diseases - Google Patents

Abstract

The present invention is Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) strain, a culture medium of the strain, a composition for controlling plant diseases comprising a culture filtrate of the strain or a fraction of the culture filtrate, and a method for controlling plant diseases using the composition.

Description

Composition for controlling plant diseases comprising Trichoderma longibrachiatum strain and method to control plant diseases using the same

The present invention is Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) strain, a culture medium of the strain, a composition for controlling plant diseases comprising a culture filtrate of the strain or a fraction of the culture filtrate, and a method for controlling plant diseases using the composition.

Plant pathogens cause serious damage to crops, reducing crop yield and compromising quality, threatening global food security. Synthetic fungicides are effective in controlling plant diseases, but misuse of the drugs has caused problems such as ecosystem disturbance, environmental pollution, toxicity to humans and livestock, and drug resistance. Accordingly, there is a need to develop new eco-friendly plant disease control methods to reduce or replace the use of chemical pesticides in future agricultural production, and to use natural materials such as plants, microorganisms, or their secondary metabolites to control plant diseases. are being studied.

Biocrop protection agent (biopesticide) is an eco-friendly plant disease control method used to control pathogens, pests, and weeds using microorganisms and natural substances derived from nature. Plant extracts or microorganisms are used as the main materials. In this regard, many research results have been reported showing that microorganisms and their secondary metabolites are effective in controlling plant diseases. For example, lipopeptides from Bacillus subtilis are effective against rice blast disease (causing agent: Magnaporthe ). It has been reported that it is effective in controlling Candida albicans and Cryptococcus neoforman in in vitro experiments . Cryptococcus neoformans ) and showed antibacterial activity against the basidiomycete Crinipellis Rhizomaticola ( Crinipellis ). Various studies have been reported on the control of plant diseases using microorganisms, such as the effectiveness of crinipellins, an antibiotic isolated from the culture medium of rhizomaticola , in controlling rice blast and pepper anthracnose. In addition, strobilurin or oudemansin, produced by various wood rot basidiomycetes, is the lead compound of QoI fungicide, which is the most widely sold in the global fungicide market.

Strains of the Trichoderma genus are fungi that live in the soil and rhizosphere and have an antagonistic effect on plant pathogens such as Fusarium, Pythium , Alternaria , and Phytophthora . It is actively used to control plant diseases. Representative strains of the Trichoderma genus used to control plant diseases are Trichoderma harzianum and Trichoderma viride. viride ), etc., and is used as a main ingredient in over 200 types of biocrop protection agents on the market around the world.

Biological control methods have a large degree of public acceptance and are positively recognized as a natural alternative to chemical pesticides with the advantages of reducing environmental pollution and increasing sustainability. Nevertheless, in the case of biological control agents, there is a problem that the control effect is low or it is not economical. Accordingly, the development of new biological control agents is still required.

Accordingly, in order to solve the problems of the prior art as described above, the present inventors isolated various microorganisms from the ocean and investigated their bactericidal activity, and found that the Trichoderma longibrachiatum SFC100166 strain exhibits excellent bactericidal activity. The present invention was completed by discovering and confirming the antibacterial activity of this strain against various plant pathogens.

Therefore, the problem to be solved by the present invention is to provide a novel Trichoderma longibrachiatum strain with bactericidal activity against plant pathogens, which can be used as a biocrop protection agent by controlling plant pathogens.

Another problem to be solved by the present invention is Trichoderma longibrachiatum strain, its culture medium; its culture filtrate; and a water-insoluble fraction of the culture filtrate; to provide a plant disease control composition or fertilizer composition containing at least one member selected from the group consisting of, and a plant disease control method using the same.

According to one aspect of the present invention, the present invention is Trichoderma longibrachiatum ( Trichoderma longibrachiatum ), which has bactericidal activity against plant pathogens. longibrachiatum ) strain SFC100166 (KACC 83038BP) is provided.

In the present invention, " Trichoderma " is a fungus that lives in the soil, ocean and rhizosphere. Microorganisms belonging to the genus Trichoderma include Trichoderma harzianum ( T. harzianum ) and Trichoderma viride ( T. viride ).

Among strains of the Trichoderma genus, the present inventors isolated the marine-derived Trichoderma longibrachiatum SFC100166 strain, which exhibits antibacterial activity against plant pathogens, and identified it as follows.

The Trichoderma longibrachiatum SFC100166 strain was selected by diluting mudflat soil collected from Jangheung-ri, Gilsang-myeon, Ganghwa-gun, Incheon, Korea, diluting it with artificial seawater, culturing it, and pure culturing the formed flora. The selected strain was identified as Trichoderma longibrachiatum by performing molecular phylogenetic analysis based on the translation elongation factor 1-α gene base sequence. The identified strain was named Trichoderma longibrachiatum SFC100166 strain, and was deposited at the Agricultural Genetic Resources Center of the National Institute of Agricultural Sciences and given accession number KACC 83038BP. In addition, it was confirmed that the Trichoderma longibrachiatum strain contained the base sequence represented by SEQ ID NO: 1.

[SEQ ID NO: 1]

TTTGCCTCTGCCCAACATCTGTCGACCAGGTGGTCTGCGTCGATGGACTTTTTTTCACCACCCCGCTTTCTCCTACCCCTCCTTTGGGCGACGCAAATTTTTTTTGTTGCGTTTCGGGTTTTAGTGGGGATGCACCTCCAGCAAACCACTATGCTCTGCCGCCCTCTGCTCTCGTCTGCAACACCTTTGGCGCTTGCGTCATCAACCTTCCAACAGTCTGCGCAGCAAATGCTAATCATTTTCCCCTCAACAGGAA GCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTGATCCCGTGCACTCATTGCATCATCGCCACAACAACATACTAATGCCCTCTGACAGACGCTCCCGGCCACCGTGATTTCATCA

In an embodiment of the present invention, it was specifically confirmed that the newly isolated Trichoderma longibrachiatum SFC100166 strain has significant antibacterial activity against plant disease-causing bacteria.

In the present invention, “plant pathogens” refer to fungi that cause disease in plants, such as fungi that live parasitic on plants (parasites), fungi that live a life-killing life on plants (bactericidal fungi), and conditional parasites that live on specific plants. it means.

In an embodiment of the present invention, the plant pathogens include Brassica plant black spot fungus ( Alternaria brassicicola ), gray mold fungus ( Botrytis cinerea ), cucumber black spot fungus ( Cladosporium cucumerinum ), pepper anthracnose fungus ( Colletotrichum coccodes ), and ginseng root rot fungus. ( Cylindrocarpon destructans ), wilt fungus ( Fusarium oxysporum ), rice blast fungus ( Magnaporthe oryzae ), potato/tomato blight fungus ( Phytophthora infestans ), Phalaenopsis orchid brown spot fungus ( Acidovorax avenae subsp. cattleyae ), fruit tree root nodule fungus ( Agrobacterium tumefaciens ) , wheat red rust ( Puccinia triticina ), and barley powdery mildew ( Blumeria graminis f. sp. hordei ), but is not limited thereto.

According to another aspect of the present invention, the present invention provides the Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP); its culture medium; its culture filtrate; and a water-insoluble fraction of the culture filtrate. It provides a composition for controlling plant diseases containing at least one member selected from the group consisting of.

In an embodiment of the present invention, the culture medium of the Trichoderma longibrachiatum SFC100166 strain contains cellulose, glucose, lactose, maltose, cellobiose, and carboxymethyl cellulose sodium salt. It may be a medium containing a carbon source selected from the group consisting of xylan, avicel, starch, and rice straw, but is not limited thereto.

In an embodiment of the present invention, the plant disease may be a fungal disease or a bacterial disease, and is preferably a brassica plant black spot disease ( Alternaria) . brassicicola ), gray mold fungus ( Botrytis cinerea ), cucumber black star spot fungus ( Cladosporium cucumerinum ), pepper anthracnose ( Colletotrichum ) coccodes ), ginseng root rot fungus ( Cylindrocarpon destructans ), wilt fungus ( Fusarium oxysporum ), rice blast fungus ( Magnaporthe oryzae ), potato/tomato late blight fungus ( Phytophthora infestans ), Phalaenopsis orchid bacterial brown spot disease ( Acidovorax avenae subsp. cattleyae ), fruit tree root nodule fungus ( Agrobacterium tumefaciens ), wheat red rust fungus ( Puccinia triticina ), barley powdery mildew ( Blumeria graminis f. sp. hordei ), bacterial rice blight fungus ( Burkholderia) glumae ), pepper canker ( Clavibacter michiganensis subsp. michiganensis ), Phalaenopsis orchid soft rot ( Dickeya) chrysanthemi ), vegetable soft rot fungus ( Pectobacterium) carotovorum subsp. carotovorum ), kiwi canker ( Pseudomonas) syringae pv. actinidiae ), Solanaceae crop green blight fungus ( Ralstonia solanacearum ) and peach bacterial borer ( Xanthomonas arboricola pv. pruni ).

In addition, plant diseases are a group consisting of late blight, soft rot, wilt, gray mold, blight, white mold, root rot, sesame seed spot, canker, mosaic, red rust, scab, hole, scab, and anthracnose. It may be one or more types selected from, but is not limited thereto.

The term “culture medium” used in the present invention includes the result of culturing the Trichoderma longibrachiatum SFC100166 strain in a culture medium for a certain period of time, the strain obtained by culturing, and its metabolites.

The term "culture filtrate" used in the present invention includes the result of culturing the Trichoderma longibrachiatum SFC100166 strain in a culture medium for a certain period of time, and the liquid obtained by removing solids from the strain and its metabolites obtained by culturing.

In an embodiment of the present invention, the culture filtrate of Trichoderma longibrachiatum SFC100166 strain showed excellent activity in controlling plant diseases. Specifically, rice blast (causing bacteria: Magnaporthe oryzae ), tomato gray mold disease (causing bacteria: Botrytis cinerea ), tomato blight (causing bacteria: Phytophthora infestans ), wheat red rust (causing bacteria: Puccinia triticina ), barley powdery mildew (causing bacteria: Blumeria graminis f. sp. hordei ) and pepper anthracnose (causing bacteria: Colletotrichum coccodes ), and in particular, it effectively controlled tomato gray mold and tomato late blight.

The term "non-aqueous fraction" used in the present invention refers to an organic layer fraction obtained by fractionating the culture filtrate by adding an organic solvent, preferably an ethyl acetate fraction obtained by fractionating the culture filtrate with ethyl acetate, and the remaining culture filtrate again with butanol. It may be a butanol fraction fractionated.

In an embodiment of the present invention, the non-aqueous fraction of the culture filtrate of the Trichoderma longibrachiatum SFC100166 strain is the black spot fungus of Brassica plants ( Alternaria brassicicola ), gray mold fungus ( Botrytis cinerea ), cucumber black star spot fungus ( Cladosporium cucumerinum ), and pepper anthracnose fungus. ( Colletotrichum coccodes ), ginseng root rot fungus ( Cylindrocarpon destructans ), wilt fungus ( Fusarium oxysporum ), rice blast fungus ( Magnaporthe oryzae ), potato/tomato blight fungus ( Phytophthora infestans ), Phalaenopsis orchid brown spot fungus ( Acidovorax avenae subsp. cattleyae ), fruit tree root nodule fungus ( Agrobacterium tumefaciens ), wheat red rust fungus ( Puccinia triticina ), barley powdery mildew ( Blumeria graminis f. sp. hordei ), bacterial rice blight fungus ( Burkholderia glumae ), pepper canker fungus ( Clavibacter michiganensis subsp. michiganensis ) , Phalaenopsis orchid soft rot ( Dickeya chrysanthemi ), vegetable soft rot ( Pectobacterium carotovorum subsp. carotovorum ), kiwi canker ( Pseudomonas syringae pv. actinidiae ), Solanaceae crop green blight ( Ralstonia solanacearum ) or peach bacterial borer ( Xanthomonas arboricola pv. pruni ) can exhibit bactericidal activity.

According to the present invention, the plant disease control active ingredient derived from the Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) of the present invention, preferably the plant disease control active ingredient in the culture medium of the Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP), more preferably Trichoderma The plant disease control active ingredient in the culture filtrate of Longibrachiatum SFC100166 strain (KACC 83038BP), particularly preferably the plant disease control active ingredient in the non-aqueous fraction of the Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) culture filtrate, is represented by the following formulas 1 and 2: It may be any one or more compounds selected from the compounds represented by 3, 4, 5, 6, 7, 8, 10, 11, 12 and 13, and these compounds may be metabolites of the Trichoderma longibrachiatum SFC100166 strain.

.

In an embodiment of the present invention, the composition for controlling plant diseases of the present invention may further include, in addition to the active ingredient, one or more substances having plant disease controlling activity known in the art.

The composition for controlling plant diseases of the present invention can be formulated in various forms known in the pesticide field, and for formulation, any formulation method commonly used in the pesticide field can be used. The composition may be formulated, for example, in the form of a liquid, granule, powder, emulsion, oil, moisturizer or coating agent, but is not limited thereto.

The composition for controlling plant diseases of the present invention may contain various ingredients for formulation, for example, liquid carriers, solid carriers, surfactants, or auxiliaries.

The liquid carrier may be water, vegetable oil, ethanol, etc., and the vegetable oil may include soybean oil, rapeseed oil, palm oil, palm kernel oil, rice bran oil, corn oil, palm oil, olive oil, etc. Included, but not limited to.

The solid carrier may include mineral powder, gelatin, alginic acid, etc., but is not limited thereto.

The mineral powder may include, but is not limited to, cation clay, bentonite, kaolin, talc, and diatomaceous earth.

The surfactant may include, but is not limited to, ethylene oxide, diethanolamine, sorbitol, and glycerine.

The auxiliary agent may be an extender, antifreeze, solvent, thickener, electrodeposition agent, etc., but is not limited thereto.

The concentration of the active ingredient contained in the composition for controlling plant diseases of the present invention can be appropriately adjusted by a person skilled in the art in consideration of the growth degree of the plant, the cultivation environment, the degree of occurrence of plant disease, etc.

The composition for controlling plant diseases of the present invention can be used for irrigation, dipping, foliar spraying, seed disinfection, or agricultural equipment disinfection, but is not limited thereto.

According to another aspect of the present invention, the present invention includes at least one selected from the group consisting of the Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP), its culture, its culture filtrate, and the non-aqueous fraction of the culture filtrate. A fertilizer composition is provided.

In an embodiment of the present invention, the fertilizer composition may include nitrogen, phosphorus, potassium, sodium silicate, chitosan, wood vinegar, calcium, magnesium, iron, manganese, boron, sulfur, zinc, copper, molybdenum and chlorine as additives. , it can be added by referring to the type of crop and the antagonistic and synergistic effects of fertilizer ingredients.

Among the above additives, nitrogen, phosphoric acid, and potassium are the three essential fertilizer elements for crops.

The phosphorus is a component of important elements in plant physiology, such as the plant nuclear meristem and phosphorylase, and plays a role in promoting root development.

The sodium silicate improves the production and quality of crops, increases stress resistance, and neutralizes various harmful ingredients. When silicic acid present in the soil is absorbed into the roots of crops in the form of soluble silicic acid, it is deposited in the epidermal cells of leaves and stems, improving the plant's resistance to pests and diseases. In addition, silicic acid has the effect of reducing production costs by increasing resistance to cold damage, thereby improving fertilization efficiency, improving soil fertility, and reducing pests and diseases.

The chitosan is a substance obtained by deacetylating chitin in the shells of crustaceans such as crabs and shrimp, and plays a role in increasing crop production and improving disease resistance of crops by exhibiting excellent antibacterial activity. Examples of chitosan that can be used include water-soluble chitosan or their derivatives. Specifically, carboxymethyl chitosan or sulfated chitosan, preferably carboxymethyl chitosan, can be used as the chitosan derivative. there is.

The wood vinegar contains a large amount of acetic acid, so it has a repellent effect on pests and provides high resistance to some pathogenic bacteria.

Calcium is a component of cell membranes, participates in protein synthesis, and helps absorb and utilize nitrogen. Additionally, it neutralizes harmful organic acids in the body, inhibits excessive absorption of aluminum, and reduces its toxicity. In addition, the magnesium increases the activity of enzymes involved in photosynthesis and phosphoric acid metabolism and helps the accumulation of lipids in seeds.

The iron is a component of respiratory enzymes. In addition, manganese increases the activity of various enzymes and is involved in the synthesis and decomposition of assimilate substances, respiration, photosynthesis, etc. The boron acts as a catalyst or reaction regulator and reduces the effects of lime deficiency. When sulfur is deficient, overall growth is inhibited.

When zinc is deficient, yellowing occurs and leaves become small. When copper is deficient, the tips of new leaves turn yellow and the crop wilts. When molybdenum is deficient, it causes nitrate reduction disorder. If the chlorine is deficient, sprouts or new buds become yellow and the quality of crops deteriorates.

According to another aspect of the present invention, the present invention provides Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP); its culture medium; its culture filtrate; and a water-insoluble fraction of the culture filtrate; treating one or more types selected from plants, seeds, soil, seed storage locations, and plant care workers' clothing or shoes with a composition containing at least one selected from the group consisting of Provides a plant disease control method comprising.

The treatment method may include, but is not limited to, treatment methods applied to foliage treatment, soil treatment, soaking treatment, spraying, branch cutting, or farm equipment disinfection.

Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) according to the present invention, its culture medium; its culture filtrate; And the non-aqueous fraction of the culture filtrate exhibits antibacterial activity against plant pathogens. This means that Trichoderma longibrachiatum SFC100166 strain and its metabolites can be used as a microbial agent for plant disease control, and can be used in a variety of fields in the field of plant disease control.

Figure 1 is a culture image of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP).
Figure 2 schematically shows the phylogenetic tree of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP).
Figure 3 schematically shows the separation of the active substance from the ethyl acetate fraction and butanol fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP).
Figure 4 shows the results of three-dimensional analysis of the chemical structure of Compound 1 isolated from the ethyl acetate fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP). Figure 4a shows the main correlations of Compound 1 with HMBC (arrow) and COZY. This is the result of analysis with (thick line), Figure 4b shows the result of analyzing the main correlation of Compound 1 with NOE (dotted line), and Figure 4c shows the results of Compound 1 (black dotted line, 1) and Spirosorbisilinol A (red). These are the CD spectrum results of dotted line, 3), spirosorbisilinol B (solid black line, 4), and spirosorbisilinol C (solid red line, 5).
Figure 5 shows the results of evaluating the effect of compounds 4, 6, 7, and 11 on the occurrence of tomato blight, Figure 5a shows the control efficacy of tomato blight according to the treatment concentration of compounds 4, 6, 7, and 11, and Figure 5b shows the effect on plants. This is the result of the tomato blight control efficacy of Compound 6, which was confirmed by treating compound 6 at different concentrations and infecting tomato blight bacteria one day later.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example One. Trichoderma Longibrachiatum SFC100166 Isolation and identification of strains

Step 1: Isolation of strain SFC100166

5 g of mud flat soil collected from Jangheung-ri, Gilsang-myeon, Ganghwa-gun, Incheon Metropolitan City was mixed with artificial seawater (NaCl 28.32 g, KCl 0.77 g, MgCl ₂ ·6H ₂ O 5.48 g, MgSO ₄ ·7H ₂ O 7.39 g, CaCl ₂ 1.11 g, NaHCO ₃ 0.2 g, 1 L of distilled water), and 100 μL of the diluted solution was spread on dichloran rose bengal chloramphenicol agar (BD Biosciences, Sparks, MD) supplemented with artificial seawater, and cultured at 25°C for 1 to 2 weeks. The formed flora were pure cultured to isolate the SFC100166 strain. An image of the strain being cultured is shown in Figure 1.

The isolated strain was immersed in a sterilized 20% glycerol aqueous solution and stored at -80°C.

Step 2: Identification of strain SFC100166

For taxonomic identification of the SFC100166 strain isolated in Step 1, molecular phylogenetic analysis was performed based on the base sequence of the translation elongation factor 1-α gene. Specifically, the SFC100166 strain was inoculated into PDB medium (4 g of potato starch, 20 g of glucose, 1 L of distilled water) and cultured at 25°C with shaking at 150 rpm for one week. For culturing, the AccuPrep DNA extraction kit (Bioneer, Daejeon, Korea) was used, genomic DNA was extracted from the obtained bacterial cells, and PCR was performed using the extracted DNA as a template. PCR (polymerase chain reaction) was performed using forward primer EF1 (5'-ATGGGTAAGGARGACAAGAC-3': SEQ ID NO: 2), reverse primer EF2 (5'-GGARGTACCAGTSATCATGTT-3': SEQ ID NO: 3), and AccuPower. 94°C for 5 minutes once using PCR premix (Bioneer, Daejeon, Korea); 35 cycles at 94°C for 40 seconds, 55°C for 40 seconds, and 72°C for 60 seconds; It was carried out once at 72°C for 10 minutes. The obtained PCR product was electrophoresed and purified using the Expin PCR purification kit (GeneAll, Seoul, Korea), and then requested to a sequencing analysis service (Macrogen, Daejeon, Korea) for base sequence analysis.

Based on the sequenced base sequence results (SEQ ID NO: 1 below), it was compared and analyzed with the β gene base sequences of other strains registered in the NCBI BLASTn database. After aligning the base sequences with the MAFFT program, a phylogenetic tree (neighbor-joining tree) was created using the MEGA program using the Kimura 2-parameter model and 1,000 bootstrap methods, which is shown in Figure 2.

Referring to Figure 2, the SFC100166 strain cultured according to the present invention showed high homology (more than 99.3%) with the Trichoderma longibrachiatum CBS 816.68 strain. Accordingly, the SFC100166 strain was identified as Trichoderma longibrachiatum .

[SEQ ID NO: 1]

TTTGCCTCTGCCCAACATCTGTCGACCAGGTGGTCTGCGTCGATGGACTTTTTTTCACCACCCCGCTTTCTCCTACCCCTCCTTTGGGCGACGCAAATTTTTTTTGTTGCGTTTCGGGTTTTAGTGGGGATGCACCTCCAGCAAACCACTATGCTCTGCCGCCCTCTGCTCTCGTCTGCAACACCTTTGGCGCTTGCGTCATCAACCTTCCAACAGTCTGCGCAGCAAATGCTAATCATTTTCCCCTCAACAGGAA GCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTGATCCCGTGCACTCATTGCATCATCGCCACAACAACATACTAATGCCCTCTGACAGACGCTCCCGGCCACCGTGATTTCATCA

Based on these analysis results, the SFC100166 strain was named Trichoderma longibrachiatum SFC100166 strain, and was deposited with the Agricultural Genetic Resources Center of the National Institute of Agricultural Sciences under the accession number KACC 83038BP on November 17, 2020.

Example 2. Trichoderma Longibrachiatum SFC100166 strain of Culture filtrate Preparation of a composition for controlling plant diseases containing active ingredients

Step 1: Preparation of Trichoderma longibrachiatum SFC100166 strain culture filtrate

The Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) isolated in Example 1 was cultured on sterilized PDA medium (4 g of potato starch, 10 g of glucose, 15 g of agar, 1 L of distilled water), and then the flora formed in the medium were corked. Mycelial disks (8 mm in diameter) were prepared by perforating them with a bore. Inoculate the mycelial discs into sterilized PDB medium (4 g of potato starch, 20 g of glucose, 1 L of distilled water) and culture with shaking (150 rpm) at 25°C for one week, then filter the strain culture through filter paper (or gauze) and extract the culture filtrate. prepared.

Step 2: Preparation of a plant disease control composition containing Trichoderma longibrachiatum SFC100166 strain culture filtrate

Surfactant Tween 20 was added to the culture filtrate prepared in step 1 to a concentration of 0.025% (w/v) to longibrachiatum ) SFC100166 strain 40 mL of a plant disease control composition solution containing the culture filtrate was prepared.

Example 3. Trichoderma Longibrachiatum SFC100166 strain of of culture filtrate fraction Contains as an active ingredient plant disease Preparation of composition for pest control

Step 1: Preparation of solvent fraction of Trichoderma longibrachiatum SFC100166 strain culture filtrate

Trichoderma longibrachiatum SFC100166 strain culture filtrate was prepared in the same manner as in Example 2, and fractions were obtained using the prepared culture filtrate. Specifically, Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) SFC100166 strain culture filtrate (10 L) was extracted twice with an equal amount of ethyl acetate, and an ethyl acetate layer and an aqueous solution layer were obtained. The aqueous solution layer was extracted twice with the same amount of butanol, and a butanol layer and an aqueous solution layer were obtained. Each layer was concentrated under reduced pressure to obtain dried ethyl acetate fraction (2.6 g), butanol fraction (1.8 g), and water fraction (16.7 g).

Step 2: Preparation of a plant disease control composition containing the solvent fraction of Trichoderma longibrachiatum SFC100166 strain culture filtrate

The ethyl acetate (EA) fraction, butanol (BuOH) fraction, and water fraction prepared in step 1 were each dissolved in methanol at a concentration of 20 mg/mL, and then the electrodeposition agent Tween 20 was added to 2 mL of each sample in distilled water. It was added to 38 mL of the solution so that the final concentration was 0.025% (w/v). Through this, 40 mL of a composition solution for controlling plant diseases containing the solvent fraction (EA, BuOH, water) of the Trichoderma longibrachiatum SFC100166 strain culture filtrate at a concentration of 1000 μg/mL was prepared.

Example 4. Separation of active substances

Bactericidal active substances were isolated from the ethyl acetate fraction and butanol fraction of the Trichoderma longibrachiatum SFC100166 strain culture filtrate. Specifically, the Biotage Isolera One mid-pressure liquid chromatography (MPLC) system combined with Sephadex LH-20 (Merck) column chromatography, Biotage SNAP KP-Sil (50 g) column, or Biotage SNAP Ultra C18 column. Separation was performed using a Shimadzu LC-20AR high pressure liquid chromatography (HPLC) system combined with a Shiseido Capcell Pak C18 (250 × 21.2 mm, 5 μm) column.

Specifically, the ethyl acetate fraction (2.6 g) was loaded into an MPLC system combining a Biotage SNAP KP-Sil (50 g) column, and dichloromethane/ethyl acetate (85:15, 80:20, 75:25, 0: 100, v/v) mixture was eluted at a flow rate of 5 mL per minute under concentration gradient conditions and fractionated into E1 to E7. 118.7 mg of the E2 fraction was loaded into the HPLC system and eluted with 50% aqueous acetonitrile solution (containing 0.1% formic acid) at a flow rate of 5 mL per minute to separate 45.4 mg of compound 7 and 6.8 mg of compound 8 . The E3 fraction (315.5 mg) was added to a column (3 × 100 cm) filled with Sephadex LH-20 resin and eluted with methanol to separate 16.1 mg of compound 12 . The remaining fraction, E31 (218.1 mg), was loaded into the HPLC system and eluted with 79% methanol aqueous solution (containing 0.1% formic acid) at a flow rate of 5 mL per minute to separate 124.2 mg of Compound 6 and 14.2 mg of Compound 10 . The E5 fraction (294.6 mg) was loaded into the HPLC system and eluted with 60% aqueous methanol solution at a flow rate of 5 mL per minute to obtain 73.7 mg of Compound 5 . 45.7 mg of compound 4 was isolated. The E6 fraction (273.9 mg) was added to a column (3 × 100 cm) filled with Sephadex LH-20 resin and eluted with methanol to separate 64.9 mg of Compound 9 and 11.9 mg of Compound 13 . The remaining fraction, E63 (60.6 mg), was loaded into the HPLC system and eluted with 65% methanol aqueous solution to separate 28.2 mg of Compound 3 and 17.0 mg of Compound 1 .

Next, the butanol fraction (1.8 g) was loaded onto an MPLC system equipped with a Biotage SNAP Ultra C18 (60 g) column, and 20%, 30%, 40%, 50%, and 100% methanol aqueous solution (containing 0.1% formic acid) was added to the butanol fraction (1.8 g). Fraction B2 (355.0 mg) obtained by eluting at a flow rate of 5 mL per minute under concentration gradient conditions was recrystallized to isolate 289.0 mg of Compound 11 . Another active fraction B3 (78.4 mg) was loaded into the HPLC system and eluted with 35% aqueous acetonitrile solution (containing 0.1% formic acid) to isolate 7.6 mg of compound 2 .

The separation of the active material is schematically shown in Figure 3.

Example 5. Structure identification

The structure of the isolated compound was identified using nuclear magnetic resonance (NMR) and mass spectrometry (MS) equipment. Specifically, each compound was dissolved in CDCl ₃ or CD ₃ OD (Cambridge Isotope Laboratories), and then ¹ H-NMR, ¹³ C-NMR, and 2D-NMR spectra were obtained using Bruker AMX-400 or AMX-500 equipment. The chemical shift value was expressed as δ ( ppm) based on the solvent peak. The chemical positions of the peaks in the spectrum were determined by combining NMR data found in the literature, ¹ H ^-1 H correlation spectroscopy (hereinafter COSY), heteronuclear single quantum correlation (hereinafter HSQC), and heteronuclear multiple bond correlation (hereinafter HMBC). The mass of the separated compounds was measured using electrospray ionization mass spectrometry (ESIMS). The chemical formula of the isolated compound was completed using a high-resolution mass spectrometer (Synapt G2 HRMS Q-TOF). In addition, the specific optical rotation of the separated compounds was measured using a polarimeter (Auto Digital Polarieter, Rudolph Research Analytical) and an infrared analyzer (Identify IR, Smiths). The three-dimensional structure of the isolated compound was completed through nuclear overhauser effect spectroscopy (NOESY) and circular dichroism (CD) analysis.

Example 5.1 Structure identification of Chemical Formula 1

Compound 1 (=spirosorbicillinol A): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 206.8, 195.4, 172.2, 168.3, 167.2, 143.8, 140.6, 134.2, 132.3, 131.7, 119.3, 111.1, 85.8, 84.1, 74.6, 70.3, 69.2, 67.1 , 52.7, 41.4, 38.0, 34.4, 24.9, 18.9, 8.3; ESIMS m/z 511 [M+Na] ⁺

Figure 4a shows the results of analyzing the main correlation of Compound 1 with HMBC (arrow) and COZY (thick line), Figure 4b shows the result of analyzing the main correlation of Compound 1 with NOE (dotted line), and Figure 4c shows the result of analyzing the main correlation of Compound 1 with NOE (dotted line). CD spectrum results of 1 (black dotted line, 1), spirosorbisilinol A (red dotted line, 3), spirosorbisilinol B (black solid line, 4), and spirosorbisilinol C (red solid line, 5) am.

By combining the NMR spectrum of new compound 1 , CD analysis, and data found in the literature, it was confirmed that compound 1 was a compound with a trichothecene skeleton. Finally, the chemical structure of new Compound 1 was determined to be represented by Chemical Formula 1, and Compound 1 was named spirosorbicillinol D.

[Formula 1]

Example 5-2. Structure identification of compound 2

Compound 2 (= 2',3'-dihydro-epoxysorbicillinol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H 5.48 (2H, m), 3.59 (1H, s), 2.65 (2H, m), 2.28 (2H, m), 1.69 (3H, s), 1.65 (3H, d, J = 6.8 Hz), 1.48 (3H, s); ESIMS m/z 289 [M+Na] ⁺ , m/z 265 [MH] ⁺

The isolated compound 2 has been produced during the chemical synthesis of epoxysorbicillinol, but has never been reported as a natural product, and was first isolated from the Trichoderma longibrachiatum SFC100166 strain by the present applicant.

Example 5-3. Structure identification of compound 3

Compound 3 (=spirosorbicillinol A): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 206.8, 195.6, 172.0, 168.3, 167.4, 143.8, 140.7, 139.6, 132.3, 129.0, 119.3, 111.1, 85.9, 84.3, 74.6, 70.6, 69.3, 67.1 , 52.7, 41.4, 37.2, 30.5, 24.8, 18.9, 8.1; ESIMS m/z 511 [M+Na] ⁺

Example 5-4. Structure identification of compound 4

Compound 4 (=spirosorbicillinol B): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 207.2, 196.2, 171.0, 167.9, 167.4, 143.2, 140.1, 139.3, 132.3, 128.8, 119.5, 111.4, 84.3, 82.6, 74.9, 71.3, 70.8, 70.7 , 52.7, 41.2, 40.4, 31.4, 24.8, 18.9, 8.8; ESIMS m/z 511 [M+Na] ⁺

Example 5-5. Structure identification of compound 5

Compound 5 (= spirosorbicillinol C): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 207.2, 196.1, 171.2, 167.9, 167.3, 143.3, 140.2, 134.2, 132.3, 130.8, 119.5, 111.2, 83.7, 82.9, 74.9, 74.9, 70.9, 67.1 , 52.7, 41.2, 40.2, 34.0, 24.8, 18.9, 8.2; ESIMS m/z 511 [M+Na] ⁺

Example 5-6. Structure identification of compound 6

compound 6 (= bisvertinolone): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 201.2, 197.8, 193.1, 186.3, 169.6, 169.1, 148.4, 144.4, 139.9, 137.8, 132.4, 132.4, 123.8, 121.6, 110.7, 109.2, 105.1, 101.9, 80.5, -, 61.3, 55.7, 25.9, 22.9, 19.6, 19.2, 18.8, 7.3; ESIMS m/z 535 [M+Na] ⁺

Example 5-7. Structure identification of compound 7

Compound 7 (=bisorbicillinol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H 7.24 (2H, dt, J = 15.0, 11.2 Hz), 6.15-6.50 (6H, m), 3.67 (1H, s) , 3.41 (1H, s), 1.90 (6H, m), 1.62 (3H, s), 1.43 (3H, s), 1.21 (3H, s), 1.15 (3H, s); ESIMS m/z 519 [M+Na] ⁺ _, 495 [MH] ^-

Example 5-8. Structure identification of compound 8

compound 8 (= bisvertinoquinol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H 7.23 (1H, m), 6.36 (2H, m), 6.19 (1H, m), 5.46 (2H, m), 3.64 ( 1H, d, J = 2.4 Hz), 3.40 (1H, d, J = 2.4 Hz), 2.76 (1H, dt, J = 17.9, 7.2 Hz), 2.55 (1H, dt, J = 17.9, 7.2 Hz), 2.24 (2H, t, J = 6.8 Hz), 1.89 (3H, d, J = 6.7 Hz), 1.64 (3H, d, J = 6.0 Hz), 1.59 (3H, s), 1.47 (3H, s), 1.20 (3H, s), 1.14 (3H, s); ESIMS m/z 521 [M+Na] ⁺ _, 497 [MH] ^-

Example 5-9. Structure identification of compound 9

compound 9 (= trichotetronine): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 210.1, 202.4, 197.4, 179.5, 176.9, 169.6, 147.8, 145.1, 143.8, 140.8, 132.3, 131.6, 128.4, 119.5, 110.0, 97.5, 84.4, 7 5.8, 63.5, 52.7, 43.9, 43.4, 24.2, 23.5, 19.1, 18.9, 11.3, 6.5; ESIMS m/z 519 [M+Na] ⁺ , 496 [MH] ^-

Example 5-10. Structure identification of compound 10

Compound 10 (= trichodimerol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H 7.28 (2H, dd, J = 14.8, 11.0 Hz), 6.37 (2H, ddd, J = 14.8, 11.0, 2.0 Hz) , 6.31 (2H, d, J = 14.7 Hz), 6.21 (2H, dq, J = 14.1, 6.7 Hz), 3.08 (2H, s), 1.89 (6H, d, J = 6.8 Hz), 1.37 (6H, s), 1.35 (6H, s); ESIMS m/z 519 [M+Na] ⁺ , 495 [MH] ^-

Example 5-11. Structure identification of compound 11

compound 11 (=epoxysorbicillinol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H ddd. ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 194.4, 188.7, 175.7, 147.3, 144.4, 131.5, 124.4, 107.8, 70.4, 63.7, 62.7, 26.1, 19.0, 7.9; ESIMS m/z 287 [M+Na] ⁺

Example 5-12. Structure identification of compound 12

compound 12 (=oxosorbicillinol): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 198.6, 192.6, 185.6, 173.8, 145.7, 141.9, 132.4, 124.8, 105.9, 76.5, 28.8, 19.0, 7.3; ESIMS m/z 287 [M+Na] ⁺ , 263 [MH] ^-

Example 5-13. Structure identification of compound 13

compound 13 (=cyclonerodiol): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 132.0, 125.9, 82.0, 75.5, 55.4, 45.5, 42.1, 41.4, 26.1, 25.9, 25.1, 24.7, 23.7, 17.7, 15.4

As seen above, among the 13 compounds isolated by combining NMR spectra and data appearing in the literature, one was identified as a new compound and the remaining 12 were identified as known compounds. The obtained new compound 1 was named spirosorbicillinol D, and each of the 12 known compounds was named 2 ',3'-dihydro-epoxysorbicillinol (2',3'-dihydro). -epoxysorbicillinol), Compound 3 is spirosorbicillinol A, Compound 4 is spirosorbicillinol B, Compound 5 is spirosorbicillinol C, and Compound 6 is bis. Bisvertinolone, compound 7 is bisorbicillinol, compound 8 is bisvertinoquinol, compound 9 is trichotetronine, compound 10 is trichodimerol, compound Compound 11 was identified as epoxysorbicillinol, compound 12 as oxosorbicillinol, and compound 13 as cyclonerodiol.

The structures of the isolated compounds are shown in Formulas 1 to 13 below.

Test example One. Trichoderma Longibrachiatum SFC100166 strain of Culture filtrate Contains as an active ingredient plant disease Control composition plant disease Control effect evaluation

Under greenhouse conditions, the plant disease control composition prepared in Example 2 was used against six types of plant diseases, specifically rice blast (causing bacteria: Magnaporthe oryzae ), tomato gray mold disease (causing bacteria: Botrytis cinerea ), tomato blight (causing bacteria: Phytophthora infestans ), barley powdery mildew (causing bacteria: Blumeria graminis f. sp. hordei ), wheat red rust (causing bacteria: Puccinia triticina ), and pepper anthracnose (causing bacteria: Colletotrichum coccodes ) to see if there was a control effect. The untreated control was treated with distilled water containing 5% (v/v) methanol and 0.025% (w/v) Tween 20.

rice blast disease

Rice blast is caused by Magnaporthe oryzae , the causative agent of rice blast in seedlings at the 2-3 leaf stage. KACC 46552) spore suspension (5 × 10 ⁵ spores/mL) was spray-inoculated, treated in a humid room at 25°C for one day, and then cultivated in a constant temperature and humidity room at 25°C and 80% relative humidity for 4 days to induce the disease. did.

tomato blight

Tomato late blight is caused by spraying 3-4 leaf stage tomato seedlings with a zoospore suspension (2×10 ⁴ sporangia/mL) of Phytophthora infestans KACC 48738, the causative agent of late blight, at 20°C. Disease was induced by treatment in a wet room for 2 days and cultivation in a constant temperature room at 20°C for 2 days.

Tomato gray mold disease

Tomato gray mold disease is caused by Botrytis cineria, the causative agent of gray mold disease, on tomato seedlings at the 3-4 leaf stage. cinerea KACC 48736) spore suspension (5×10 ⁵ spores/mL) and then grown in a wet room at 20°C for 3 days to induce disease development.

wheat red rust

Wheat red rust is caused by Puccinia triticina, the causative agent of rust, known as an active parasitic bacterium on first-leaf seedlings. triticina (Korea Research Institute of Chemical Technology) spores were suspended in a 250 μg/mL Tween 20 solution at an amount of 0.67 g spores/L and inoculated by spray. After being treated in a wet room at 20°C for one day, they were transferred to a constant temperature room at 20°C. Disease was induced by cultivation for 6 days.

barley powdery mildew

Barley powdery mildew is caused by Blumeria graminis pomegranate spessalis holday (Blumeria graminis pomegranate), the causative agent of powdery mildew, subcultured from a host plant to 1-leaf stage seedlings of barley . graminis f. sp. hordei (Korea Research Institute of Chemical Technology) spores were shaken off and inoculated and grown in a constant temperature room at 20°C for 7 days to induce disease.

pepper anthracnose

Pepper anthracnose is caused by spraying and inoculating seedlings at the 3-4 leaf stage of pepper with a spore suspension (4×10 ⁵ spores/mL) of Colletotrichum coccodes KACC 48737, the causative agent of pepper anthracnose, in a wet room at 25°C. After treatment in a humid room for 2 days, disease was induced by culturing in a constant temperature and humidity room (25°C, 80% relative humidity) for 1 day.

Assessment Methods

The percentage of diseased spots on leaves was examined for tomato gray mold and pepper anthracnose 3 days after inoculation, tomato late blight 4 days after inoculation, rice blast 5 days after inoculation, and wheat red rust and barley powdery mildew 7 days after inoculation. .

Using the disease spot area ratio (%) obtained above, the control value (%) was calculated according to Equation 1 below. The control values obtained are shown in Table 1.

[Equation 1]

target disease RCB TGM TLB WLR BPM PAN Control (%) 44 85 90 27 25 15

Abbreviation: RCB, rice blast disease (causing agent: Magnaporthe oryzae ); TGM, tomato gray mold disease (causing bacteria: Botrytis cinerea ); TLB, tomato late blight (causing agent: Phytophthora infestans ); WLR, wheat red rust (causing agent: Puccinia triticina ); BPM, barley powdery mildew (causing bacteria: Blumeria graminis f. sp. hordei ); PAN, pepper anthracnose (causing bacteria: Colletotrichum coccodes )

As shown in Table 1, the culture filtrate of Trichoderma longibrachiatum SFC100166 strain according to the present invention was confirmed to exhibit control activity against plant diseases. In particular, it showed an excellent control effect of 85% to 90% against tomato gray mold and tomato blight, and also showed an excellent control effect of 44%, 27%, 25%, and 15% against rice blast, wheat red rust, barley powdery mildew, and pepper anthracnose, respectively. It showed a control effect and proved its potential as a biological control agent.

Test example 2. Trichoderma Longibrachiatum SFC100166 strain of of culture filtrate Evaluation of plant disease control effectiveness of compositions for plant disease control containing solvent fractions as active ingredients

Under greenhouse conditions, a plant disease control composition containing three solvent fractions (EA, BuOH, water) of the culture filtrate of the Trichoderma longibrachiatum SFC100166 strain prepared in Example 3 was used to treat rice blast disease (causing bacteria: Magnaporthe oryzae ), tomato gray mold (causing bacteria: Botrytis cinerea ), tomato late blight (causing bacteria: Phytophthora infestans ), barley powdery mildew (causing bacteria: Blumeria graminis f. sp. hordei ), wheat red rust (causing bacteria: Puccinia triticina ) and pepper anthracnose (causing bacteria: Colletotrichum coccodes ) to see if it had a control effect. The control group was treated with distilled water containing 5% (v/v) methanol and 0.025% (w/v) Tween 20. The disease area rate (%) was obtained using the same evaluation method as Test Example 1, and the control value (%) was calculated according to Equation I and shown in Table 2.

division Control (%) RCB TGM TLB WLR BPM PAN EA fraction 88 95 100 60 0 60 BuOH fraction 25 80 100 33 0 35 water fraction 0 0 0 0 0 0

Fraction concentration: 1000 μg/mL

Abbreviation: RCB, rice blast disease (causing agent: Magnaporthe oryzae ); TGM, tomato gray mold disease (causing bacteria: Botrytis cinerea ); TLB, tomato late blight (causing agent: Phytophthora infestans ); WLR, wheat red rust (causing agent: Puccinia triticina ); BPM, barley powdery mildew (causing bacteria: Blumeria graminis f. sp. hordei ); PAN, pepper anthracnose (causing bacteria: Colletotrichum coccodes )

As shown in Table 2, the ethyl acetate (EA) fraction was confirmed to have a control effect against rice blast, tomato gray mold, tomato late blight, wheat red rust, and pepper anthracnose at a treatment concentration of 1000 μg/mL, especially , it was found to have an excellent control effect of more than 95% against tomato gray mold disease and tomato late blight.

Meanwhile, the butanol (BuOH) fraction was also found to have an excellent control effect of 80% and 100% against tomato gray mold and tomato late blight, respectively, and was also found to have a control effect against rice blast, wheat red rust, and pepper anthracnose. .

Meanwhile, the water fraction was found to have no control activity against the six tested plant diseases, and unlike the culture filtrate, the water fraction was observed to have no control activity against barley powdery mildew.

From the above results, it was confirmed that the substance showing bactericidal activity against plant pathogens in the Trichoderma longibrachiatum SFC100166 strain culture filtrate was a non-polar substance, not water-soluble. In particular, the ethyl acetate fraction and the butanol fraction showed a very high level of control effect against both tomato gray mold and tomato late blight, and in the case of the ethyl acetate fraction, the control effect against rice blast, wheat red rust, and pepper anthracnose was improved. It was confirmed that the low control effect of the culture filtrate was raised to a high level.

Test example 3. Trichoderma Longibrachiatum SFC100166 strain of of culture filtrate Evaluation of bactericidal activity of compounds isolated from solvent fractions against phytopathogenic fungi and bacteria

Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) 13 compounds isolated from the culture medium of strain SFC100166, a plant pathogenic fungus, Alternaria brassicicola , and gray mold ( Botrytis ) of plants in the Brassica family. cinerea ), cucumber black spot fungus ( Cladosporium cucumerinum ), pepper anthracnose fungus ( Colletotrichum coccodes ), ginseng root rot fungus ( Cylindrocarpon ) destructans ), wilt fungus ( Fusarium oxysporum ), rice blast fungus ( Magnaporthe oryzae ), potato/tomato blight fungus ( Phytophthora infestans ), and the plant pathogenic bacterium Phalaenopsis orchid brown spot fungus ( Acidovorax avenae subsp. cattleyae ), fruit tree root nodule fungus ( Agrobacterium) tumefaciens ), bacterial rice blight ( Burkholderia glumae ), pepper canker ( Clavibacter) michiganensis subsp. michiganensis ), Phalaenopsis orchid soft rot fungus ( Dickeya chrysanthemi ), vegetable soft rot ( Pectobacterium carotovorum subsp. carotovorum ), kiwi canker ( Pseudomonas syringae pv. actinidiae ), solanaceae crop green blight ( Ralstonia ) solanacearum ), Peach bacterial borer ( Xanthomonas) arboricola pv. pruni ) was evaluated by the broth micro-dilution method using a 96-well plate, and the minimum inhibitory concentration (MIC) value was obtained.

Brassica plant black spot fungus ( A. brassicicola ), wilt fungus ( F. oxysporum ), and ginseng root rot fungus ( C. destructans ) were inoculated into PDA medium and incubated at 25°C for 10 days, and the formed spores were used in the experiment.

Gray mold ( B. cinerea ) and potato/tomato blight ( P. infestans ) were inoculated into PDA medium and oatmeal agar medium, respectively, cultured at 20°C for 6 days, and then spores formed by culturing for 4 days under light conditions of 14 hours a day. was used in the experiment.

Pepper anthracnose ( C. coccodes ) and rice blast fungus ( M. oryzae ) were inoculated on oatmeal agar medium and cultured at 25°C for 7 days, then mycelia were removed and placed in a constant temperature and humidity room (25°C, relative humidity 80%). ) was treated with light for 12 hours a day for 2 days to induce spore formation.

In the case of plant pathogenic bacteria, after inoculation into TSB (tryptic soy broth ) medium, kiwi canker ( P. syringae pv . actinidiae ) and peach bacterial borer ( Culture was performed with shaking (150 r/min) for 2 days at ℃. For the fungi used in the experiment, spores were harvested using PDB medium and filtered through 4-ply gauze to prepare a spore suspension, and bacteria were diluted in TSB medium to prepare a bacterial suspension.

Finally, 100 μL wells were allowed to contain 1000 fungal spores or bacteria, and methanol extract was dispensed at concentrations of 0.8, 1.6, 3.1, 6.3, 12.5, 25, 50, 100, 200, and 400 μg/mL, respectively. . At this time, the methanol content did not exceed 1%. One with only 1% methanol added was used as an untreated group, and the experiment was repeated three times for each concentration. After culturing them at 20°C or 25°C for 2 to 3 days, the concentration at which the growth of molds and bacteria was completely inhibited was determined as the minimum inhibitory concentration (MIC). The experimental results are shown in Table 3.

compound Minimum inhibitory concentration (μg/mL) alt Bot Col fus Mag Phy Cla Cyl Aci Bur ral One 400 2 400 3 400 4 400 5 400 6 100 12.5 400 50 6.3 50 25 50 400 7 400 200 100 400 8 200 200 9 10 200 11 200 400 200 50 12 400 200 100 25 400 200 13 400 400

Abbreviation: Alt, Alternaria brassicicola ( Alternaria brassicicola ); Gray mold pathogen (Bot, Botrytis cinerea ); Pepper anthracnose (Col, Colletotrichum coccodes ); Wilt pathogen (Fus, Fusarium oxysporum ); Rice blast fungus (Mag, Magnaporthe oryzae ); Potato/tomato blight fungus (Phy, Phytophthora infestans ); Cucumber black star spot fungus (Cla, Cladosporium cucumerinum ); Ginseng root rot bacteria (Cyl, Cylindrocarpon destructans ); Phalaenopsis orchid brown spot disease (Aci, Acidovorax avenae subsp. cattleyae ), a plant pathogenic bacterium; Bacterial rice blight fungus (Bur, Burkholderia glumae ); Solanaceae crop green blight fungus (Ral, Ralstonia solanacearum )

As shown in Table 3, Compound 9 was found to have no control activity, but Compounds 1 to 8 and Compounds 10 to 13 were effective against the plant pathogenic fungus Brassica and black spot disease ( A brassicicola ), gray mold fungus ( B. cinerea ), pepper anthracnose fungus ( C. coccodes ), wilt fungus ( F. oxysporum ), rice blast fungus ( M. oryzae ), potato/tomato late blight fungus ( P. infestans ), Cucumber black spot fungus ( C. cucumerinum ), ginseng root rot fungus ( C. destructans ), plant pathogenic bacteria Phalaenopsis orchid brown spot fungus ( A. avenae subsp. cattleyae ), bacterial rice blight fungus ( B. glumae ), Solanaceae crops It was shown to be effective in inhibiting the growth of one or more plant pathogens selected from the group consisting of green blight bacteria ( R. solanacearum ).

Meanwhile, except for compounds 9 and 10, all 11 compounds showed bactericidal activity against potato/tomato blight ( P. infestans ), of which compounds 6 , 11 , and 12 had 6.3, 50, and 25 μg/mL, respectively. It was confirmed to be particularly effective in controlling potato/tomato late blight ( P. infestans ) by showing a minimum inhibitory concentration (MIC) of . And spirosorbisilinol series compounds (new compound 1 and compounds 3 - 5 ) showed excellent control activity, completely inhibiting the growth of potato/tomato late blight fungus ( P. infestans ) at a treatment concentration of 400 μg/mL.

In particular, compound 6 completely inhibited the growth of potato/tomato blight ( P. infestans ), pepper anthracnose ( C. coccodes ), and ginseng root rot ( C. destructans ) in the concentration range of 6.3-25 μg/mL. , in the concentration range of 50-100 μg/mL, black spot fungus ( A. brassicicola ), cucumber black spot fungus ( C. cucumerinum ), rice blast fungus ( M. oryzae ), and Phalaenopsis orchid brown spot fungus ( A. avenae ) in the concentration range of 50-100 μg/mL. Not only did it completely inhibit the growth of (subsp. cattleyae ), but at a concentration of 400 μg/mL, it also had bactericidal activity against wilt fungus ( F. oxysporum ) and bacterial rice blight fungus ( B. glumae ), and was found to exhibit broad antimicrobial efficacy. lost.

Compound 12 showed excellent bactericidal activity against potato/tomato blight ( P. infestans ) and rice blast fungus ( M. oryzae ), with minimum inhibitory concentrations of 25 μg/mL and 100 μg/mL, respectively, and pepper anthracnose fungus. Treatment at a concentration of 200-400 μg/mL against ( C. coccodes ), brassica plant black spot fungus ( A. brassicicola ), ginseng root rot fungus ( C. destructans ), and Phalaenopsis orchid brown spot fungus ( A. avenae subsp. cattleyae ). showed a killing effect.

Compound 11 showed excellent bactericidal activity against potato/tomato blight ( P. infestans ) at a minimum inhibitory concentration of 50 μg/mL, and gray mold fungus ( B. cinerea ) and pepper anthracnose at a concentration of 200-400 μg/mL. It was effective in completely killing bacteria ( C. coccodes ) and rice blast fungus ( M. oryzae ).

Test example 4. Trichoderma Longibrachiatum SFC100166 strain of of culture filtrate Evaluation of plant disease control effects of compounds isolated from solvent fractions

To evaluate the in vivo plant disease control activity of compounds isolated from the solvent fraction of the culture filtrate of the Trichoderma airbrachiatum SFC100166 strain according to the present invention, tomato gray mold disease (causing bacteria) of compounds 4 , 6 , 7 , and 11 were tested in greenhouse conditions. : The control activity against Botrytis cinerea ), tomato late blight (causing bacteria: Phytophthora infestans ), and wheat red rust (causing bacteria: Puccinia triticina ) was evaluated.

Specifically, compounds 4 , 6 , 7 , and 11 were each dissolved in methanol, and 250 μg/mL of Tween 20 solution was added to adjust the final concentrations to 125 μg/mL, 250 μg/mL, and 500 μg/mL, respectively. The final methanol concentration of all samples was set to 5%. As a control, a solution containing 5% methanol and 250 μg/mL of Tween 20 was used. Four pots were used for each plant disease, and the active ingredient sample was sprayed on the leaves, air-dried for 24 hours, and then inoculated with each plant pathogen. The control activity against these three plant diseases was evaluated according to the method described in Test Example 1 and is shown in Table 4 and Figure 5a.

compound Treatment concentration
(μg/mL) Control price (%) TGM TLB WLR
Compound 4 500 0 71 0 250 0 14 0 125 0 7 0
Compound 6 500 92 96 60 250 50 71 33 125 0 68 0
Compound 7 500 38 82 0 250 0 71 0 125 0 0 0
Compound 11 500 25 75 0 250 15 64 0 125 10 36 0

Abbreviation: TGM, tomato gray mold disease (causing bacteria: Botrytis cinerea ); TLB, tomato blight (causing bacteria: Phytophthora infestans ); WLR, wheat red rust (causing bacteria: Puccinia triticinia )

As shown in Table 4 and Figure 5a, treatment with compounds 4 , 6 , 7 , and 11 at a concentration level of 500 μg/mL showed an excellent control effect of 71% to 96% against tomato blight (causing bacteria: P. infestans ). It was. In particular, compound 6 had an excellent control effect, showing a high control effect of 68% even at a low concentration of 125 μg/mL, and compound 11 began to show a control effect of 36% even at a low concentration of 125 μg/mL. and treatment at 250 μg/mL showed a 64% control effect.

Meanwhile, compounds 6, 7 , and 11 were found to have a control effect against tomato gray mold disease (causing bacteria: B. cinerea ). In particular, compound 6 had an excellent control effect, reducing the control effect by 92% at a treatment concentration of 500 μg/mL. showed control efficacy.

Compound 6 was confirmed to have a control effect against wheat red rust (causing bacteria: P. triticina ).

Plants were treated with Compound 6, which has excellent control effects, at different concentrations, and 1 day later, a spore suspension of the tomato blight fungus ( Phytophthora infestans ) was inoculated into the plants to induce tomato late blight, and then the control effect of Compound 6 was confirmed. This is shown in Figure 5b. NC is a negative control treated with 0.025% Tween 20 solution containing 5% MeOH, and PC is a positive control treated with the chemical disinfectant dimethomorph (10 g/mL). As can be observed in Figure 5b, treatment with Compound 6 according to the present invention shows excellent sterilization effect even compared to known chemical disinfectants for tomato late blight bacteria.

National Institute of Agricultural Sciences Agricultural Genetic Resources Center KACC83038BP 20201117

<110> KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY Seoul National University R&DB Foundation <120> Composition for controlling plant diseases comprising Trichoderma longibrachiatum strain and method to control plant diseases <130> KCT1-13 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 482 <212> DNA <213> Artificial Sequence <220> <223> Trichoderma longibrachiatum <400> 1 tttgcctctg cccaacatct gtcgaccagg tggtctgcgt cgatggactt tttttcacca 60 ccccgctttc tcctacccct cctttgggcg acgcaaattt tttttgttgc gtttcgggtt 120 ttagtgggga tgcacctcca gcaaaccact atgctctgcc gccctctgct ctcgtctgca 180 acacctttgg cgcttgcgtc atcaaccttc caacagtctg cgcagcaatg ctaatcattt 240 tcccctcaac aggaagccgc cgaactcggc aagggttcct tcaagtacgc gtgggttctt 300 gacaagctca aggccgagcg tgagcgtggt atcaccatcg acattgccct ctggaagttc 360 gagactccca agtactatgt caccgtcatt ggtatgtttg atcccgtgca ctcattgcat 420 catcgccaca acaacatact aatgccctct gacagacgct cccggccacc gtgatttcat 480 ca 482 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EF1 Forward <400> 2 atgggtaagg argacaagac 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EF2 Reverse <400> 3 ggargtacca gtsatcatgt t 21

Claims (9)

Brassica family crops black spot fungus ( A. brassicicola ), gray mold fungus ( B. cinerea ), pepper anthracnose ( C. coccodes ), wilt fungus ( F. oxysporum ), rice blast fungus ( M. oryzae ), potato/tomato Bacteria ( P. infestans ), Cucumber black spot fungus ( C. cucumerinum ), Ginseng root rot fungus ( C. destructans ), Phalaenopsis orchid bacterial brown spot fungus ( A. avenae subsp. cattleyae ), Bacterial rice blight fungus ( B. glumae ) , Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP), which has bactericidal activity against two or more species selected from the group consisting of Solanaceae crop green blight fungus ( R. solanacearum ). According to paragraph 1,
The strain is a Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) containing the base sequence shown in SEQ ID NO: 1. delete Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) according to any one of claims 1 or 2; its culture medium; its culture filtrate; And the non-aqueous fraction of the culture filtrate; Control of at least one plant disease selected from the group consisting of rice blast, tomato gray mold, tomato late blight, wheat red rust, and pepper anthracnose, including at least one selected from the group consisting of Composition for. delete delete delete Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) according to any one of claims 1 or 2; its culture medium; its culture filtrate; and a water-insoluble fraction of the culture filtrate; treating one or more types selected from plants, seeds, soil, seed storage locations, and plant care workers' clothing or shoes with a composition containing at least one selected from the group consisting of A method for controlling one or more plant diseases selected from the group consisting of rice blast, tomato gray mold, tomato late blight, wheat red rust, and pepper anthracnose, including;
delete