KR20230001353A - Composition for controlling plant diseases comprising compound lsolated from Trichoderma longibrachiatum as an active ingredient and method of controlling plant diseases using the same - Google Patents

Abstract

The present invention relates to a microbicidal compound derived from Trichoderma longibrachiatum strain, a composition for controlling plant diseases comprising the same, and a method for controlling plant diseases using the same. The present invention provides a composition for controlling plant pathogens comprising an ethyl acetate fraction or a butanol fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) having bactericidal activity against plant pathogens.

Description

A composition for controlling plant diseases comprising a bactericidal compound derived from a Trichoderma longibrachiatum strain and a method for controlling plant diseases using the same }

The present invention is Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) It relates to a fungicidal compound derived from the strain, a composition for controlling plant diseases comprising the same, and a plant disease controlling method using the same.

Plant pathogens cause serious damage to crops, reducing yield and compromising quality, threatening global food security. Although synthetic fungicides are effective in controlling plant diseases, misuse and abuse of drugs have caused problems such as ecosystem disturbance, environmental pollution, toxicity to humans and livestock, and drug resistance. Therefore, there is a demand for the development of a new eco-friendly plant disease control means to reduce or replace the use of chemical pesticides in future agricultural production, and a method of using natural materials such as plants, microorganisms or their secondary metabolites for plant disease control are being studied.

Biopesticide is an eco-friendly plant disease control means used to control pathogens, pests and weeds using microorganisms and natural materials derived from nature, and plant extracts or microorganisms are used as main materials. In this regard, a number of studies have been reported that microorganisms and secondary metabolites of microorganisms are effective in controlling plant diseases. For example, it has been reported that lipopeptides of Bacillus subtilis are effective in controlling rice blast (causative fungus: Magnaporthe oryzae ), and aceric acid A isolated from a fungus of the genus Aspergillus (aseric acid A) is Candida alcyclocans ( Candida albicans ) and Cryptococcus neoformans ( Cryptococcus ) in in vitro experiments neoformans ) and exhibited antibacterial activity against the basidiomycete Crinipellis lysomaticola ( Crinipellis Various studies on plant disease control using microorganisms have been reported, such as the antibiotic crinipellins isolated from the culture of rhizomaticola ) showing effects on rice blast and pepper anthracnose. In addition, strobilurin or oudemansin, which is produced by various wood-decaying basidiomycetes, is the lead compound of QoI fungicide sold the most in the global fungicide market.

Trichoderma genus strains are fungi that live in the soil and rhizosphere, and are antagonistic to plant pathogens such as Fusarium , Pythium , Alternaria , and Phytophthora . It is widely used for plant disease control. Representative strains of the Trichoderma genus used for plant disease control are Trichoderma harzianum ( Trichoderma harzianum ) and Trichoderma viride , etc., and are used as major components of over 200 biocrop protection agents on the market worldwide.

Biological control methods are positively recognized as natural alternatives to chemical pesticides with the advantages of high public acceptance, reduced environmental pollution and increased persistence. Nevertheless, in the case of biological control, there is a problem that the control effect is poor or economical. Thus, the development of novel biological control agents is still required.

In order to solve the problems of the prior art as described above, the present inventors isolated various microorganisms from the sea and investigated their bactericidal activity, while Trichoderma longibrachiatum SFC100166 strain showed excellent bactericidal activity. The present invention was completed by discovering and confirming the antibacterial activity of this strain against various plant pathogens.

Therefore, the problem to be solved by the present invention is the ethyl acetate fraction of Trichoderma longibrachiatum strain culture filtrate, which can be used as a biocrop protection agent by controlling plant pathogens; butanol fraction; And to provide a plant pathogen control composition or fertilizer composition comprising at least one member selected from the group consisting of compounds isolated from metabolites of Trichoderma longibrachiatum strains.

Another problem to be solved by the present invention is to provide a novel compound having a bactericidal activity derived from a Trichoderma longibrachiatum strain.

Another problem to be solved by the present invention is to provide a plant disease control method comprising the step of providing a plant pathogen control composition comprising an ethyl acetate fraction or a butanol fraction of the Trichoderma longibrachiatum strain culture filtrate to plants or the environment is to do

According to one aspect of the present invention, the present invention is Trichoderma longibrachiatum having a bactericidal activity against plant pathogens ( Trichoderma longibrachiatum ) Provides a composition for controlling plant pathogens comprising an ethyl acetate fraction or a butanol fraction of the culture filtrate of SFC100166 strain (KACC 83038BP).

In the present invention, " Trichoderma " is a fungus that lives in the soil, ocean and rhizosphere, and microorganisms belonging to the genus Trichoderma include Trichoderma harzianum ( T. harzianum ), Trichoderma viride ( T. viride ) and the like.

The present inventors isolated a marine-derived Trichoderma longibrachiatum SFC100166 strain, which exhibits antibacterial activity against plant pathogens, among strains of the genus Trichoderma, and identified it as follows.

The Trichoderma longibrachiatum SFC100166 strain was selected by diluting tidal flat soil collected in Jangheung-ri, Gilsang-myeon, Ganghwa-gun, Incheon, Korea with artificial seawater, culturing, and culturing the formed flora in pure water. The selected strain was identified as Trichoderma longibrachiatum by molecular phylogenetic analysis based on the translation elongation factor 1-α gene sequence. The identified strain was named Trichoderma longibrachiatum SFC100166 strain, and was deposited with the Agricultural Genetic Resources Center of the National Institute of Agricultural Sciences and given accession number KACC 83038BP. In addition, it was confirmed that the Trichoderma longibrachiatum strain contained the nucleotide sequence represented by SEQ ID NO: 1.

[SEQ ID NO: 1]

TTTGCCTCTGCCCAACATCTGTCGACCAGGTGGTCTGCGTCGATGGACTTTTTTTCACCACCCCGCTTTCTCCTACCCCTCCTTTGGGCGACGCAAATTTTTTTTGTTGCGTTTCGGGTTTTAGTGGGGATGCACCTCCAGCAAACCACTATGCTCTGCCGCCCTCTGCTCTCGTCTGCAACACCTTTGGCGCTTGCGTCATCAACCTTCCAACAGTCTGCGCAGCAATGCTAATCATTTTCCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTGATCCCGTGCACTCATTGCATCATCGCCACAACAACATACTAATGCCCTCTGACAGACGCTCCCGGCCACCGTGATTTCATCA

In the present invention, the culture filtrate of the Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) is the result of culturing the Trichoderma longibrachiatum SFC100166 strain in a culture medium for a certain period of time, the strain obtained by culturing, and the solid content in the "culture medium" that is its metabolite. It may be one containing a liquid phase obtained by removing the.

In the present invention, the ethyl acetate fraction or butanol fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) is obtained by fractionating the culture filtrate with ethyl acetate to obtain an ethyl acetate fraction, and fractionating the remaining culture filtrate with butanol to obtain butanol It may be obtained as a fraction.

In a specific example of the present invention, it was specifically confirmed that the newly isolated Trichoderma longibrachiatum SFC100166 strain has significant antibacterial activity against plant pathogens.

In the present invention, "plant pathogens" are fungi that cause plant diseases, such as fungi (parasites) that live as parasites on plants, fungi that live on plants (bactericides), and conditional parasitic bacteria that parasitize on specific plants. it means.

In the present invention, the composition may have antifungal activity against plant pathogenic fungi and/or bactericidal activity against plant pathogenic bacteria.

In an embodiment of the present invention, a composition for controlling plant pathogens comprising the ethyl acetate fraction or the butanol fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) has antifungal activity against plant pathogenic fungi, Here, plant pathogenic fungi include, for example, brassicaceae crop black spot fungi ( Alternaria brassicicola ), gray mold fungus ( Botrytis cinerea ), cucumber black star spot fungus ( Cladosporium cucumerinum ), pepper anthracnose ( Colletotrichum coccodes ), ginseng root rot ( Cylindrocarpon destructans ), wilting bacteria ( Fusarium oxysporum ), rice blast bacteria ( Magnaporthe oryzae ), potato / tomato blight ( Phytophthora infestans ), phalaenopsis bacterial brown spot disease ( Acidovorax avenae subsp. cattleyae ), fruit tree root gall fungus ( Agrobacterium tumefaciens ), wheat rust blight ( Puccinia triticina ) and barley powdery mildew ( Blumeria graminis f. sp. hordei ) may be one or more selected from the group consisting of.

In the present invention, the composition for controlling plant pathogens comprising the ethyl acetate fraction or the butanol fraction of the culture filtrate of the Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) has antibacterial or bactericidal activity against phytopathogenic bacteria , Here, the phytopathogenic bacteria are, for example, bacterial rice blight ( Burkholderia glumae ), pepper ulcer disease ( Clavibacter michiganensis subsp. michiganensis ), phalaenopsis soft rot ( Dickeya chrysanthemi ), vegetable soft rot ( Pectobacterium carotovorum subsp . carotovorum ), kiwi canker ( Pseudomonas syringae pv . There may be one or more selected.

In one embodiment of the present invention, pepper anthracnose, rice blast blight or potato / tomato blight is Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) SFC100166 strain (KACC 83038BP) may be controlled with the ethyl acetate fraction or butanol fraction of the culture filtrate.

In one embodiment of the present invention, brassicaceae crop black spot, pepper anthracnose, wilt, rice blast, potato / tomato blight, cucumber black spot, ginseng root rot, tomato gray mold or wheat red rust and plants Phalaenopsis bacterial brown spot disease, bacterial rice egg blight, and solanaceae crop green blight, which are pathogenic bacteria, may be controlled by the ethyl acetate fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP).

In one embodiment of the present invention, gray mold disease ( Botrytis cinerea ) is, in particular, Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) may be controlled with the butanol fraction of the culture filtrate of SFC100166 strain (KACC 83038BP).

According to the present invention, the plant diseases caused by the plant pathogens include late blight, scab disease, soft rot, wilt disease, gray mold disease, blight, white mold disease, root rot disease, seed blotch disease, ulcer disease, mosaic disease, red rust disease, and black mold disease. , it may be at least one selected from the group consisting of hole disease, lump disease, and anthrax, but is not limited thereto.

In the present invention, the ethyl acetate fraction or butanol fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) exhibiting plant pathogen control activity is represented by the following formulas 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, may include one or more compounds selected from the compounds represented by 12 and 13 as an active ingredient.

.

.

Preferably, the compounds represented by Formulas 1, 3, 4, 5, 6, 7, 8, 10, 12 and 13 are the ethyl acetate fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) may be separated from

Preferably, the compounds represented by Formulas 2 and 11 may be separated from the butanol fraction of the culture filtrate of Trichoderma longibrachiatum strain SFC100166 (KACC 83038BP).

Trichoderma longibrachiatum according to the present invention ( Trichoderma longibrachiatum ) SFC100166 strain (KACC 83038BP), the composition for controlling plant pathogens containing the ethyl acetate fraction or butanol fraction of the culture filtrate is derived from natural products, is non-toxic or low-toxic to the human body, and is biodegradable in nature and does not cause environmental pollution It also has excellent control against plant pathogens. In addition, since each of the compounds obtained from the ethyl acetate fraction or the butanol fraction independently has antifungal or antibacterial activity against specific plant pathogens, it can be applied as a target biological pesticide that can act quickly against infection of specific pathogens, Since some compounds have complex antifungal or antibacterial activity against a wide range of plant pathogens, they can be applied as comprehensive biological pesticides, so they can greatly contribute to pest control and increase production in farms. In addition, since the composition for controlling plant pathogens according to the present invention is derived from natural products, it can be developed as an environmentally friendly biological pesticide and can be usefully used in the production of high value-added organic products.

In addition, the present invention Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) SFC100166 strain (KACC 83038BP) isolated from the culture medium and containing at least one selected from compounds represented by the following formulas 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12 and 13 A composition for controlling plant diseases is provided.

.

.

The present invention is Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) Separating compounds represented by Formulas 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12 and 13 from the ethyl acetate fraction or butanol fraction of the culture filtrate of SFC100166 strain (KACC 83038BP) And provides a structure identified by identification, and the compound of Formula 1 (Compound 1) is classified as spirosorbicillinol D based on structural similarity with a compound known as a material of a novel structure that has not been previously reported. named. On the other hand, the compounds represented by Formulas 2, 3, 4, 5, 6, 7, 8, 10, 11, 12 and 13 (referred to as Compounds 2 to 8 and 10 to 13, respectively) are known compounds, respectively. 2',3'-dihydro-epoxysorbicillinol (2',3'-dihydro-epoxysorbicillinol), compound 3 is spirosorbicillinol A (spirosorbicillinol A), compound 4 is spirosorbicillinol B ( spirosorbicillinol B), compound 5 is spirosorbicillinol C, compound 6 is bisvertinolone, compound 7 is bisorbicillinol, compound 8 is bisvertinoquinol , Compound 10 is trichodimerol, compound 11 is epoxysorbicillinol, compound 12 is oxosorbicillinol, and compound 13 is cyclonerodiol.

The compounds represented by Formulas 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12 and 13 according to the present invention are each independently a Chinese cabbage crop black spot ( Alternaria brassicicola ), gray mold fungus ( Botrytis cinerea ), Cucumber Black Star Bacteria ( Cladosporium cucumerinum ), Pepper Anthrax ( Colletotrichum ) coccodes ), ginseng root rot bacteria ( Cylindrocarpon destructans ), wilt bacteria ( Fusarium oxysporum ), rice blast bacteria ( Magnaporthe oryzae ), potato / tomato blight bacteria ( Phytophthora infestans ), phalaenopsis bacterial brown spot disease ( Acidovorax avenae subsp. cattleyae ), fruit root gall fungus ( Agrobacterium tumefaciens ), wheat red rust ( Puccinia triticina ), barley powdery mildew ( Blumeria graminis f. sp. hordei ), bacterial rice blight ( Burkholderia glumae ), pepper ulcer disease ( Clavibacter michiganensis subsp. michiganensis ), phalaenopsis soft rot ( Dickeya chrysanthemi ), vegetable soft rot ( Pectobacterium carotovorum subsp. carotovorum ), kiwi ulcer disease ( Pseudomonas syringae pv. actinidiae ), solanaceous crop green blight ( Ralstonia solanacearum ) and peach bacterial pit fungus ( Xanthomonas arboricola pv. pruni ) It may exhibit antifungal or bactericidal activity against one or more plant pathogens selected from the group consisting of.

In one embodiment of the present invention, compounds 1, 2, 3, 4, 5, 6, 7, 8, 11, 12 and 13 have bactericidal activity against potato / tomato blight ( P. infestans ) , in particular, the compounds 1, 2, 3, 4, 5, 7, 8, 11 and 13 have excellent tomato blight control activity.

In another embodiment of the present invention, compounds 6, 7, 8, 11, 12 and 13 have bactericidal activity against rice blast fungus ( M. oryzae ) and have excellent rice blast control activity.

In another embodiment of the present invention, the compounds 6, 7 and 12 have excellent bactericidal activity against Brassicaceae crop black blotch ( A. brassicicola ) .

In another embodiment of the present invention, compounds 7 and 10 have excellent activity against solanaceous crop green blight ( R. solanacearum ) and .

In another embodiment of the present invention, compound 6 is a brassicaceae crop black spot bacteria ( A. brassicicola ) , pepper anthracnose bacteria ( C. coccodes ) ; Wilting germs ( F. oxysporum ) ; Rice blast fungus ( M. oryzae ) ; Potato/tomato late blight ( P. infestans ) , cucumber black star bacillus ( C. cucumerinum ) , ginseng root rot bacillus ( C. destructans ) , phytopathogenic bacterium Phalaenopsis bacterial brown spot bacillus ( A. avenae subsp. cattleyae ) and bacterial rice blight ( B. glumae ) , and has a wide range of phytopathogen bactericidal activity.

The composition for controlling plant diseases of the present invention may be formulated in various forms known in the field of agrochemicals, and for formulation, any formulation method commonly used in the field of agrochemicals may be used. The composition may be formulated in the form of, for example, liquids, granules, powders, emulsions, oils, moisturisers, or coating agents, but is not limited thereto.

The composition for controlling plant diseases of the present invention may include various components for formulation, and may include, for example, a liquid carrier, a solid carrier, a surfactant or an adjuvant.

Water, vegetable oil, ethanol, etc. may be used as the liquid carrier, and the vegetable oil includes soybean oil, rapeseed oil, palm oil, palm kernel oil, rice bran oil, corn oil, palm oil, olive oil, and the like. Included, but not limited to.

Mineral powder, gelatin, alginic acid, etc. may be used as the solid carrier, but is not limited thereto.

As the mineral powder, cation clay, bentonite, kaolin, talc, diatomaceous earth, and the like may be used, but are not limited thereto.

Ethyleneoxide-based, diethanolamine-based, sorbitol-based, glycerine-based, etc. may be used as the surfactant, but is not limited thereto.

As the adjuvant, extenders, antifreezes, solvents, thickeners, spreading agents, etc. may be used, but are not limited thereto.

The concentration of the active ingredient included in the composition for controlling plant diseases of the present invention can be appropriately adjusted by those skilled in the art in consideration of the degree of plant growth, the arable land environment, the degree of occurrence of plant diseases, and the like.

The composition for controlling plant diseases of the present invention may be used for irrigation, immersion, foliar spraying, seed disinfection, or agricultural disinfection, but is not limited thereto.

In addition, the present invention Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) Provides a compound represented by Formula 1 or Formula 2 isolated from metabolites of SFC100166 strain (KACC 83038BP).

.

.

The compound represented by Chemical Formula 1 of the present invention is a compound having a trichothecene skeleton having a novel structure and is named spirosorbisilinol D.

The compound of Formula 2 of the present invention has been synthesized as a side reactant in the process of chemically synthesizing epoxysorbicillinol, but has not been found as a natural product in nature. The present invention is Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) Provides 2',3'-dihydro-epoxysorbicillinol represented by Formula 2 isolated from the culture medium of SFC100166 strain (KACC 83038BP).

According to the present invention, the compound of Formula 1 or Formula 2 can exhibit excellent bactericidal activity against, in particular, potato/tomato late blight ( Phytophthora infestans ).

In addition, the present invention Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) SFC100166 strain (KACC 83038BP) plant pathogen control composition containing the ethyl acetate fraction or butanol fraction of the culture filtrate is selected from among plants, seeds, plant habitats, seed storage places, and plant management worker's clothing or shoes It provides a plant disease control method comprising the; step of treating one or more species.

In the present invention, plant pathogens and plant diseases are as described above.

In the present invention, the composition for controlling plant pathogens containing the ethyl acetate fraction or the butanol fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) contains formulas 1, 2, 3, 4, 5, 6, It may include any one or more compounds selected from compounds represented by 7, 8, 10, 11, 12 and 13.

In one embodiment of the present invention, the plant disease control method is separated from the ethyl acetate fraction or butanol fraction of the culture filtrate of the Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP), Formulas 1, 2, 3, 4, 5, 6, Step of treating at least one selected from the compounds represented by 7, 8, 10, 11, 12 and 13 to at least one selected from among plants, seeds, soil, seed storage places, and plant management worker's clothing or shoes It may contain;

The treatment method may include, but is not limited to, a treatment method applied to foliar treatment, soil treatment, immersion treatment, spraying, branch cutting, or disinfection of agricultural tools.

The treatment can protect plants by killing plant pathogens generated in plants, inhibit growth of plant pathogens, and block plant pathogens from inhabiting, thereby contributing to controlling plant diseases.

In addition, the present invention Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) Provides a fertilizer composition comprising an ethyl acetate fraction or a butanol fraction of the culture filtrate of SFC100166 strain (KACC 83038BP).

In an embodiment of the present invention, the fertilizer composition may add nitrogen, phosphorus, potassium, sodium silicate, chitosan, wood vinegar, calcium, magnesium, iron, manganese, boron, sulfur, zinc, copper, molybdenum and chlorine as additives, , types of crops, and antagonistic and synergistic effects of fertilizer components can be added as a reference.

Among the above additives, nitrogen, phosphoric acid and potassium are three elements of fertilizer essential for crops.

Phosphorus is a component of plant physiologically important elements such as plant nuclear meristem and phosphorus polylase, and serves to promote the growth of roots.

The sodium silicate serves to improve yield and quality of crops, increase stress resistance, and neutralize various harmful components. When silicic acid present in the soil is absorbed by the roots of crops in the form of soluble silicic acid, it is deposited in the epidermal cells of the leaves or stems to improve the resistance of plants to diseases and pests. In addition, silicic acid has an effect of reducing production costs due to actions such as increased resistance to cold damage, thereby improving fertilization efficiency, enhancing soil fertility, and reducing pests and diseases.

The chitosan is a material obtained by deacetylating chitin in the shells of crustaceans such as crabs and shrimps, and serves to increase the yield of crops and improve disease resistance of crops by exhibiting excellent antibacterial activity. Examples of chitosan that can be used include water-soluble chitosan or derivatives thereof, and specifically, carboxymethyl chitosan or sulfated chitosan, preferably carboxymethyl chitosan, can be used as the chitosan derivative. there is.

The wood vinegar contains a large amount of acetic acid, so it acts to repel pests and imparts high resistance to some pathogenic bacteria.

The calcium is a component of cell membranes, is involved in the synthesis of proteins, and helps absorb and use nitrogen. In addition, it neutralizes harmful organic acids in the body, inhibits excessive absorption of aluminum, and reduces its toxicity. In addition, the magnesium increases the activity of enzymes involved in photosynthetic action and phosphate metabolism and helps the accumulation of lipids in seeds.

The iron is a component of respiratory enzymes. In addition, the manganese increases the activity of various enzymes and is involved in the synthesis and decomposition of anabolic substances, respiration, and photosynthesis. The boron acts as a catalyst or reaction regulator and reduces the effects of lime deficiency. When the sulfur is deficient, overall growth is inhibited.

When the zinc is deficient, yellowing occurs and the leaves become small. When the copper is deficient, the young leaves are yellowed from the tips and the crops wither. Deficiency of the molybdenum causes nitrate reduction failure. When the chlorine is deficient, sprouts or buds become yellow and the quality of crops deteriorates.

Trichoderma longibrachiatum according to the present invention ( Trichoderma longibrachiatum ) SFC100166 strain (KACC 83038BP), the composition for controlling plant pathogens containing the ethyl acetate fraction or butanol fraction of the culture filtrate is derived from natural products, is non-toxic or low-toxic to the human body, and is biodegradable in nature and does not cause environmental pollution It also has excellent control against plant pathogens. In addition, since each of the compounds obtained from the ethyl acetate fraction or the butanol fraction independently has antifungal or antibacterial activity against specific plant pathogens, it can be used as a target biological pesticide that can act quickly against infection of specific pathogens, Since some compounds have complex antifungal or antibacterial activity against a wide range of plant pathogens, they can be used as comprehensive biopesticides, which can greatly contribute to pest control and productivity increase in farms. In addition, since the composition for controlling plant pathogens according to the present invention is derived from natural products, it can be developed as an environmentally friendly biological pesticide and can be usefully used in the production of high value-added organic products.

1 is a culture image of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP).
Figure 2 is a schematic diagram showing the phylogenetic tree of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP).
FIG. 3 schematically shows the separation of active substances from the ethyl acetate and butanol fractions of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP).
Figure 4 is a three-dimensional analysis result of the chemical structure of Compound 1 isolated from the ethyl acetate fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP). Figure 4a shows the main correlations of Compound 1 with HMBC (arrow) and COZY (thick line), Figure 4b is the result of analyzing the main correlation of compound 1 with NOE (dotted line), Figure 4c is the compound 1 (black dotted line, 1) and spirosorvicilinol A (red) Dotted line, 3), CD spectrum results of spirosorvicilinol B (black solid line, 4), and spirosorvicilinol C (red solid line, 5).
Figure 5 is a result of evaluating the effect of compounds 4, 6, 7, and 11 on tomato blight occurrence, Figure 5a is the control efficacy of tomato blight according to the treatment concentration of compounds 4, 6, 7, and 11, and Figure 5b is a plant Compound 6 was treated by concentration, and 1 day later, tomato blight control efficacy result of compound 6 confirmed by infecting tomato blight bacteria.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example One. Trichoderma longibrachiatum SFC100166 Isolation and identification of strains

Step 1: Isolation of strain SFC100166

Artificial seawater (NaCl 28.32 g, KCl 0.77 g, MgCl ₂ 6H ₂ O 5.48 g, MgSO ₄ 7H ₂ O 7.39 g, CaCl ₂ 1.11 g, NaHCO ₃ 0.2 g, distilled water 1 L), 100 μL of the diluted solution was spread on dichloran rose bengal chloramphenicol agar (BD Biosciences, Sparks, MD) to which artificial seawater was added, and incubated at 25 ° C for 1 to 2 weeks. The formed flora was pure cultured to isolate the SFC100166 strain. An image of the strain in culture is shown in FIG. 1 .

The isolated strain was immersed in a sterilized 20% glycerol aqueous solution and stored at -80°C.

Step 2: Identification of strain SFC100166

For taxonomic identification of strain SFC100166 isolated in step 1, molecular phylogenetic analysis was performed based on the nucleotide sequence of translation elongation factor 1-α gene. Specifically, the SFC100166 strain was inoculated into PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and cultured with shaking at 25 ° C. for one week at 150 rpm. The culture was performed using AccuPrep DNA extraction kit (Bioneer, Daejeon, Korea), genomic DNA was extracted from the obtained cells, and PCR was performed using the extracted DNA as a template. PCR (polymerase chain reaction) was performed using forward primer EF1 (5'-ATGGGTAAGGARGACAAGAC-3': SEQ ID NO: 2), reverse primer EF2 (5'-GGARGTACCAGTSATCATGTT-3': SEQ ID NO: 3) and AccuPower Using a PCR premix (Bioneer, Daejeon, Korea), 94 ℃ 5 minutes once; 35 times at 94°C for 40 seconds, 55°C for 40 seconds, and 72°C for 60 seconds; It was carried out at 72 ° C. for 10 minutes once. After electrophoresis of the obtained PCR product and purification using an Expin PCR purification kit (GeneAll, Seoul, Korea), a sequencing analysis service (Macrogen, Daejeon, Korea) was requested for sequencing.

Based on the sequenced nucleotide sequence result (SEQ ID NO: 1 below), the β gene nucleotide sequences of other strains registered in the NCBI BLASTn database were compared and analyzed. After aligning the base sequences with the MAFFT program, a neighbor-joining tree was created using the MEGA program with the Kimura 2-parameter model and 1,000 times bootstrap method, which is shown in FIG. 2.

Referring to Figure 2, the SFC100166 strain cultured according to the present invention Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) showed high homology (more than 99.3%) with CBS 816.68 strain. Accordingly, the SFC100166 strain was identified as Trichoderma longibrachiatum .

[SEQ ID NO: 1]

TTTGCCTCTGCCCAACATCTGTCGACCAGGTGGTCTGCGTCGATGGACTTTTTTTCACCACCCCGCTTTCTCCTACCCCTCCTTTGGGCGACGCAAATTTTTTTTGTTGCGTTTCGGGTTTTAGTGGGGATGCACCTCCAGCAAACCACTATGCTCTGCCGCCCTCTGCTCTCGTCTGCAACACCTTTGGCGCTTGCGTCATCAACCTTCCAACAGTCTGCGCAGCAATGCTAATCATTTTCCCCTCAACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTGATCCCGTGCACTCATTGCATCATCGCCACAACAACATACTAATGCCCTCTGACAGACGCTCCCGGCCACCGTGATTTCATCA

Based on these analysis results, the SFC100166 strain was named Trichoderma longibrachiatum SFC100166 strain, and deposited with the National Institute of Agricultural Sciences Agricultural Genetic Resources Center on November 17, 2020 under accession number KACC 83038BP.

Example 2. Trichoderma longibrachiatum SFC100166 of the strain culture filtrate Preparation of a composition for controlling plant diseases containing as an active ingredient

Step 1: Preparation of Trichoderma longibrachiatum SFC100166 strain culture filtrate

The Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) isolated in Example 1 was cultured in a sterilized PDA medium (potato starch 4 g, glucose 10 g, agar 15 g, distilled water 1 L), and then the flora formed on the medium was corked. Hyphal discs (8 mm in diameter) were prepared by puncturing with a borer. Inoculate the mycelial disk into a sterilized PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and incubate with shaking (150 rpm) for 1 week at 25 ° C. Filter the strain culture medium with filter paper (or gauze) to obtain the culture filtrate. prepared.

Step 2: Preparation of plant disease control composition containing Trichoderma longibrachiatum SFC100166 strain culture filtrate

To the culture filtrate prepared in step 1, the surfactant Tween 20 was added to a concentration of 0.025 % (w / v), and longibrachiatum ) 40 mL of a plant disease control composition solution containing SFC100166 strain culture filtrate was prepared.

Example 3. Trichoderma longibrachiatum SFC100166 of the strain culture filtrate fraction Preparation of a composition for controlling plant diseases containing as an active ingredient

Step 1: Preparation of solvent fraction of Trichoderma longibrachiatum SFC100166 strain culture filtrate

Trichoderma longibrachiatum SFC100166 strain culture filtrate was prepared in the same manner as in Example 2, and fractions were obtained using the prepared culture filtrate. Specifically, Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) SFC100166 strain culture filtrate (10 L) was extracted twice with the same amount of ethyl acetate to obtain an ethyl acetate layer and an aqueous solution layer. The aqueous layer was extracted twice with the same amount of butanol, and a butanol layer and an aqueous layer were obtained. Each layer was concentrated under reduced pressure to obtain a dried ethyl acetate fraction (2.6 g), butanol fraction (1.8 g) and water fraction (16.7 g).

Step 2: Preparation of plant disease control composition containing solvent fraction of Trichoderma longibrachiatum SFC100166 strain culture filtrate

The ethyl acetate (EA) fraction, the butanol (BuOH) fraction, and the water fraction prepared in step 1 were dissolved in methanol at a concentration of 20 mg/mL, respectively, and then 2 mL of each sample was added to distilled water with the spreading agent Tween 20 and added to 38 mL of a solution made to a final concentration of 0.025% (w/v). Through this, 40 mL of a composition solution for controlling plant diseases containing the solvent fraction (EA, BuOH, water) of Trichoderma longibrachiatum SFC100166 strain culture filtrate at a concentration of 1000 μg / mL was prepared.

Example 4. Separation of Active Substances

A bactericidal active substance was isolated from the ethyl acetate fraction and the butanol fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain. Specifically, a Biotage Isolera One mid-pressure liquid chromatography (MPLC) system in combination with a Sephadex LH-20 (Merck) column chromatography, a Biotage SNAP KP-Sil (50 g) column, or a Biotage SNAP Ultra C18 column Separation was performed using a Shimadzu LC-20AR high pressure liquid chromatography (HPLC) system combined with a Shiseido Capcell Pak C18 (250×21.2 mm, 5 μm) column.

Specifically, the ethyl acetate fraction (2.6 g) was loaded into an MPLC system in which a Biotage SNAP KP-Sil (50 g) column was combined, and dichloromethane/ethyl acetate (85:15, 80:20, 75:25, 0: 100, v/v) The mixed solution was eluted at a flow rate of 5 mL per minute under concentration gradient conditions and fractionated into E1 to E7. 118.7 mg of the E2 fraction was loaded into the HPLC system and eluted with a 50% acetonitrile aqueous solution (including 0.1% formic acid) at a flow rate of 5 mL per minute to separate 45.4 mg of Compound 7 and 6.8 mg of Compound 8 . The E3 fraction (315.5 mg) was added to a column (3×100 cm) packed with Sephadex LH-20 resin and eluted with methanol to separate 16.1 mg of Compound 12 . The remaining fraction, E31 (218.1 mg), was loaded into an HPLC system, and 124.2 mg of Compound 6 and 14.2 mg of Compound 10 were separated by elution with a 79% methanol aqueous solution (including 0.1% formic acid) at a flow rate of 5 mL per minute. The E5 fraction (294.6 mg) was loaded into the HPLC system and eluted with a 60% methanol aqueous solution at a flow rate of 5 mL per minute to obtain 73.7 mg of Compound 5 and 45.7 mg of compound 4 was isolated. The E6 fraction (273.9 mg) was added to a column (3×100 cm) packed with Sephadex LH-20 resin and eluted with methanol to separate 64.9 mg of Compound 9 and 11.9 mg of Compound 13 . The remaining fraction, E63 (60.6 mg), was loaded into an HPLC system and eluted with a 65% methanol aqueous solution to separate 28.2 mg of Compound 3 and 17.0 mg of Compound 1 .

Next, the butanol fraction (1.8 g) was loaded into an MPLC system with a Biotage SNAP Ultra C18 (60 g) column combined, and 20%, 30%, 40%, 50%, and 100% methanol aqueous solution (including 0.1% formic acid) 289.0 mg of Compound 11 was isolated by recrystallizing fraction B2 (355.0 mg) obtained by eluting at a flow rate of 5 mL per minute under concentration gradient conditions. Another active fraction B3 (78.4 mg) was loaded into the HPLC system and eluted with 35% acetonitrile aqueous solution (containing 0.1% formic acid) to isolate 7.6 mg of compound 2 .

Separation of the active material is schematically shown in FIG. 3 .

Example 5. Identification of structures of isolated compounds 1 to 13

The structures of compounds 1 to 13 isolated in Example 4 were identified using nuclear magnetic resonance (NMR) and mass spectrometry (MS). Specifically, after dissolving each compound in CDCl ₃ or CD ₃ OD (Cambridge Isotope Laboratories), ¹ H-NMR, ¹³ C-NMR and 2D-NMR spectra were obtained using a Bruker AMX-400 or AMX-500 instrument. Based on the solvent peak, the chemical shift value was expressed as δ ( ppm). NMR data from the literature, ¹ H- ¹ H correlation spectroscopy (hereinafter referred to as COSY), heteronuclear single quantum correlation (hereinafter referred to as HSQC), and heteronuclear multiple bond correlation (hereinafter referred to as HMBC) were combined to determine the chemical position of the peak appearing in the spectrum. The mass of the separated compound was measured using electrospray ionization mass spectrometry (ESIMS). Chemical formulas of the isolated compounds were completed using a high-resolution mass spectrometer (Synapt G2 HRMS Q-TOF). In addition, the specific optical rotation of the separated compounds was measured with a polarization analyzer (Auto Digital Polarieter, Rudolph Research Analytical) and an infrared analyzer (Identify IR, Smiths). The three-dimensional structure of the separated compound was completed through nuclear overhauser effect spectroscopy (NOESY) and circular dichroism (CD) analysis.

Example 5-1. Identification of the chemical structure of compound 1

Compound 1 was isolated as a yellow, irregular powder. In the HRESIMS analysis, m/z 511.1580 [M+Na] ⁺ (calculated m/z 511.1580) was detected as a cation, and the chemical formula was determined to be C ₂₅ H ₂₈ O ₁₀ . The NMR spectrum is shown in Table 1.

carbon δC , _Type δ _H , ( J in Hz) One 41.4, CH 3.38, overlapping 2 111.1, C. - 3 195.4, C. - 4 69.2, C. - 5 206.8, C. - 6 74.6, C. - 7 38.0 CH ₂ 2.24, d d (14.2, 3.7); 3.13, dd(14.2, 2.3) 8 85.8, C - 9 172.2, C. - 10 84.1, CH 4.24, d d (10.4, 8.5) 11 67.1, CH 4.09, td (9.7, 6.8) 12 34.4 CH ₂ 2.32 m; 2.95, dd (18.3, 6.9) 13 131.7, C. - 14 134.2, CH 6.57, s 15 70.3, CH 4.66 m One' 168.3, C. - 2' 119.3, CH 6.46, d (14.9) 3′ 143.8, CH 7.36, dd(14.9, 10.9) 4' 132.3, CH 6.44 m 5′ 140.6, CH 6.26, dt (14.6, 7.0) 6′ 18.9 CH ₃ 1.92, d (6.8) ₄ - CH3 8.3 CH ₃ 1.25, s ₆ - CH3 24.9 CH ₃ 1.23, s 14-COO C H ₃ 52.7 CH ₃ 3.77, s 14- COOCH ₃ 167.2, C. -

structure elucidation

As shown in Table 1, in the ¹³ C-NMR spectrum of novel compound 1 , two ketone carbons ( δ _C 206.8, 195.4), two carboxyl carbons ( δ _C 172.2, 167.2), and three quaternary sp ² carbons ( δ _C 168.3, 131.7, 111.1), 3 quaternary sp ³ carbon ( δ _C 85.8, 74.6, 69.2), 5 methine sp ² carbons ( δ _C 143.8, 140.6, 134.2, 132.3, 119.3), 4 methine sp ³ carbons ( δ _C 84.1, 70.3, 67.1 41.4), 2 A 25-carbon signal appeared, consisting of a methylene sp ³ carbon ( δ _C 38.0, 34.4) and four methyl carbons ( δ _C 52.7, 24.9, 18.9, 8.3).

Next, the positions of hydrogen and carbon were determined through analysis of COZY, HMBC and HSQC data, and the chemical structure was identified as follows. Specifically, in the HMBC spectrum, the hydrogen signal H-1 is associated with C-2, C-3, C-5, C-6 and C-8, and H-7 is associated with C-2, C-4, C-8 and C-8. 9, and it was confirmed that the COZY spectrum showed a strong correlation between the hydrogen signals H-1 and H-7, which is characteristic of trichothecene. Bicyclo [2.2.2] octane ( The bicyclo[2.2.2]octane) ring structure was confirmed. In the HMBC spectrum, a methyl hydrogen signal ( δ _H 1.23) is associated with C-1, C-5 and C-6, and another methyl hydrogen signal ( δ _H 1.25) is associated with C-3, C-4, C-5 and C-3. By confirming the correlation with 8, it was confirmed that the two methyl groups were located at C-6 and C-4, respectively. Through COZY and HMBC analysis, the enoyl-sorbyl chain structure (consisting of C-1', C-2', C-3', C-4', C-5' and C-6') is located at C-2. It was confirmed that

The rest of the chemical structure of Compound 1 confirms that the hydrogen signal H-10 correlates with H-12, H-14 with H-15, and H-15 with H-10 in COZY analysis, and in HMBC analysis, H-10 correlates with H-12. It was identified by confirming that -14 showed a correlation with C-10 and C-12. In addition, by confirming that methoxy hydrogen ( δ _H 3.77), methylene hydrogen H-12, and olefin hydrogen H-14 show a correlation with the carboxyl carbon signal ( δ _C 167.2), the methyl ester group is bonded to the C-13 position. confirmed. By confirming the correlation between H-15 and C-8 in the HMBC analysis, it was determined that the remaining chemical structures were connected through the bicyclo[2.2.2]octane structure and the oxygen atom. did

Three-dimensional chemical structure identification

Meanwhile, except for C-7, C10 and C-15, the chemical shift values of Compound 1 were similar to those of spirosorbisilinol C for the rest of the carbon signals. Therefore, it was assumed that compound 1 has a stereoisomer relationship with spirosorvicilinol C. The stereochemical structure of Compound 1 was determined through coupling constants and NOESY spectral analysis.

Figure 4a is the result of analyzing the main correlation of compound 1 with HMBC (arrow) and COZY (thick line), Figure 4b is the result of analyzing the main correlation of compound 1 with NOE (dotted line), Figure 4c is the compound CD spectrum results of 1 (black dotted line, 1), spirosorvicilinol A (red dotted line, 3), spirosorvicilinol B (black solid line, 4), and spirosorvicilinol C (red solid line, 5) to be.

C-2 of the enol-sorbyl chain structure through the confirmation of the 14.9 Hz coupling constant between H-2' and H-3' and the NOESY correlation between H-3' and H-5' It was confirmed that the '/C-3' and C-4'/C-5' double bonds were E and E configurations, respectively. The coupling constants of H-10 and H-11 (10.4 Hz) and the coupling constants of H-10 and H-15 (8.5 Hz) and the NOESY correlation between H-11 and H-15 show that they are opposite to each other. Indicates that there is an orientation relationship.

The NOESY correlation between 6-methyl, H-2' and H-1 indicates that 6-methyl and C-2 are in a qauche orientation, indicating that they are in the 1 S configuration. In the HMBC spectrum, it was confirmed that H-7a had a strong correlation with C-6 and H-7b with C-2 and C-9, but H-7a had no correlation with C-2 and C-9. Therefore, it was confirmed that H-7a and C-2 were in the Goshi orientation, H-7b and C-9a were in the eclipse orientation, and were in the 8 S configuration. Combining with NOESY analysis results, it was confirmed that C-10, C-11, and C-15 are 10 R , 11 S , and 15 R coordinations, respectively.

= +142 (c = 0.05, 메탄올)은 스피로소르비실리놀 B

= +428 (c = 0.05, 메탄올)나스피로소르비실리놀 C

= +464 (c = 0.05, 메탄올) 보다는 스피로소르비실리놀 A의

= +184 (c = 0.05, 메탄올)와 유사했다. 이러한 결과는 화합물 1이 8R 배위인 스피로소르비실리놀 A와 B와 달리 스피로소르비실리놀 C 처럼 8S 배위를 가지고 있음을 나타낸다. In addition, the specific rotation value of Compound 1

= +142 ( c = 0.05, methanol) is spirosorvicilinol B

= +428 ( c = 0.05, methanol) Naspirosorbicilinol C

= +464 ( c = 0.05, methanol) of spirosorvicilinol A

= +184 ( c = 0.05, methanol). These results indicate that Compound 1 has an 8 S configuration like spirosorvicilinol C, unlike spirosorvicilinols A and B, which are 8 R configurations.

In the CD spectrum analysis of FIG. 4c, Compound 1 and spirosorvicilinols A to C showed Δε > + 24 values at 350-360 nm and Δε < - 35 values at 310-320 nm. These results indicate that these compounds are both 1 R and 4 S configurations.

By combining the NMR spectrum, CD analysis, and literature data of novel compound 1 shown in Table 1, it was confirmed that the compound has a trichothecene skeleton. Finally, the chemical structure of novel compound 1 was determined as the chemical structure represented by Formula 1, and compound 1 was named spirosorbicillinol D.

[Formula 1]

Example 5-2. Structure elucidation of compound 2

Diatoms were identified in the same manner as in Compound 1, and the NMR results are as follows.

Compound 2 (= 2',3'-dihydro-epoxysorbicillinol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H 5.48 (2H, m), 3.59 (1H, s), 2.65 (2H, m), 2.28 (2H, m), 1.69 (3H, s), 1.65 (3H, d, J = 6.8 Hz), 1.48 (3H, s); ESIMS m/z 289 [M+Na] ⁺ , m/z 265 [MH] ⁺

The isolated compound 2 has been produced in the process of chemical synthesis of epoxysorbicillinol, but has never been reported as a natural product, and was first isolated from Trichoderma longibrachiatum SFC100166 strain by the present applicant.

Example 5-3. Structure elucidation of compound 3

Compound 3 (= spirosorbicillinol A): ¹³ C-NMR (CD ₃ OD, 100 MHz) _ΔC 206.8 , 195.6, 172.0, 168.3, 167.4, 143.8, 140.7, 139.6, 132.3, 129.0, 119.3, 111.1, 85.9, 84.3, 74.6, 70.6, 69.3, 67.1, 52.7 8.1; ESIMS m/z 511 [M+Na] ⁺

Example 5-4. Structure elucidation of compound 4

Compound 4 (=spirosorbicillinol B): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 207.2, 196.2, 171.0, 167.9, 167.4, 143.2, 140.1, 139.3, 132.3, 128.8, 119.5, 111.4, 84.3, 82.6, 74.9, 71.3, 70.8, 70.7, 52.7 8.8; ESIMS m/z 511 [M+Na] ⁺

Example 5-5. Structure elucidation of compound 5

Compound 5 (= spirosorbicillinol C): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 207.2, 196.1, 171.2, 167.9, 167.3, 143.3, 140.2, 134.2, 132.3, 130.8, 119.5, 111.2, 83.7, 82.9, 74.9, 74.9, 70.9, 67.1, 52.7 8.2; ESIMS m/z 511 [M+Na] ⁺

Example 5-6. Structure elucidation of compound 6

compound 6 (= bisvertinolone): ¹³ C-NMR (CD ₃ OD, 100 MHz) ΔC 201.2, 197.8 , 193.1, _186.3 , 169.6, 169.1, 148.4, 144.4, 139.9, 137.8, 132.4, 132.4, 123.8, 121.6, 110.7, 109.2, 105.1, 101.9, 80.5, 61.3, 55.7, 25.9, 22.9 19.6, 19.2, 18.8, 7.3; ESIMS m/z 535 [M+Na] ⁺

Example 5-7. Structure elucidation of compound 7

Compound 7 (= bisorbicillinol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H 7.24 (2H, dt, J = 15.0, 11.2 Hz), 6.15-6.50 (6H, m), 3.67 (1H, s) , 3.41 (1H, s), 1.90 (6H, m), 1.62 (3H, s), 1.43 (3H, s), 1.21 (3H, s), 1.15 (3H, s); ESIMS m/z 519 [M+Na] ⁺ _, 495 [MH] ^-

Example 5-8. Structure elucidation of compound 8

compound 8 (= bisvertinoquinol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H 7.23 (1H, m), 6.36 (2H, m), 6.19 (1H, m), 5.46 (2H, m), 3.64 ( 1H, d, J = 2.4 Hz), 3.40 (1H, d, J = 2.4 Hz), 2.76 (1H, dt, J = 17.9, 7.2 Hz), 2.55 (1H, dt, J = 17.9, 7.2 Hz), 2.24 (2H, t, J = 6.8 Hz), 1.89 (3H, d, J = 6.7 Hz), 1.64 (3H, d, J = 6.0 Hz), 1.59 (3H, s), 1.47 (3H, s), 1.20 (3H, s), 1.14 (3H, s); ESIMS m/z 521 [M+Na] ⁺ _, 497 [MH] ^-

Example 5-9. Structure elucidation of compound 9

compound 9 (= trichotetronine): ¹³ C-NMR (CD ₃ OD, 100 MHz) ΔC 210.1, 202.4, 197.4 , 179.5, _176.9 , 169.6, 147.8, 145.1, 143.8, 140.8, 132.3, 131.6, 128.4, 119.5, 110.0, 97.5, 84.4, 75.8, 63.5 19.1, 18.9, 11.3, 6.5; ESIMS m/z 519 [M+Na] ⁺ , 496 [MH] ^-

Example 5-10. Structure elucidation of compound 10

Compound 10 (= trichodimerol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H 7.28 (2H, dd, J = 14.8, 11.0 Hz), 6.37 (2H, ddd, J = 14.8, 11.0, 2.0 Hz) , 6.31 (2H, d, J = 14.7 Hz), 6.21 (2H, dq, J = 14.1, 6.7 Hz), 3.08 (2H, s), 1.89 (6H, d, J = 6.8 Hz), 1.37 (6H, s), 1.35 (6H, s); ESIMS m/z 519 [M+Na] ⁺ , 495 [MH] ^-

Example 5-11. Structural elucidation of compound 11

compound 11 (= epoxysorbicillinol): ¹ H-NMR (CD ₃ OD, 400 MHz) δ _H ddd. ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 194.4, 188.7, 175.7, 147.3, 144.4, 131.5, 124.4, 107.8, 70.4, 63.7, 62.7, 26.1, 19.0, 7.9; ESIMS m/z 287 [M+Na] ⁺

Example 5-12. Structure elucidation of compound 12

compound 12 (= oxosorbicillinol): ¹³ C-NMR (CD ₃ OD, 100 MHz) δ _C 198.6, 192.6, 185.6, 173.8, 145.7, 141.9, 132.4, 124.8, 105.9, 76.5, 28.8, 19.0, 7.3; ESIMS m/z 287 [M+Na] ⁺ , 263 [MH] ^-

Example 5-13. Structural elucidation of compound 13

compound 13 (= cyclonerodiol): ¹³ C-NMR (CD ₃ OD, 100 MHz) δC 132.0, _125.9 , 82.0, 75.5, 55.4, 45.5, 42.1, 41.4, 26.1, 25.9, 25.1, 24.7, 23.7, 17.7, 15.4

As shown above, one of the 13 compounds isolated by synthesizing the NMR spectrum and the data shown in the literature was identified as a new compound and the remaining 12 as known compounds. The obtained novel compound 1 was named spirosorbicillinol D, and each of the 12 known compounds 2 is 2',3'-dihydro-epoxysorbicillinol (2',3'-dihydro -epoxysorbicillinol), compound 3 is spirosorbicillinol A, compound 4 is spirosorbicillinol B, compound 5 is spirosorbicillinol C, compound 6 is bis bisvertinolone, compound 7 is bisorbicillinol, compound 8 is bisvertinoquinol, compound 9 is trichotetronine, compound 10 is trichodimerol, compound Compound 11 was identified as epoxysorbicillinol, compound 12 as oxosorbicillinol, and compound 13 as cyclonerodiol.

Structures of the separated compounds are shown in Formulas 1 to 13 below.

test example One. Trichoderma longibrachiatum SFC100166 of the strain culture filtrate Composition for controlling plant diseases containing as an active ingredient plant disease Control effect evaluation

In greenhouse conditions, the plant disease control composition prepared in Example 2 was treated with 6 plant diseases, specifically rice blast (causative fungus: Magnaporthe oryzae ), tomato gray mold (causative fungus: Botrytis ) cinerea ), tomato blight (causative fungus: Phytophthora infestans ), barley powdery mildew (causative fungus: Blumeria graminis f. sp. hordei ), wheat red rust (causative fungus: Puccinia triticina ) and pepper anthracnose (causative fungus: Colletotrichum coccodes ) to confirm the control effect. Untreated controls were treated with distilled water containing 5% (v/v) methanol and 0.025% (w/v) Tween 20.

rice blast

Rice blast is caused by Magnaporthe oryzae , the causative bacterium of rice blast, in seedlings of the 2-3 leaf stage. KACC 46552) spore suspension (5 × 10 ⁵ spores / mL) was spray inoculated, treated in a humid room at 25 ° C for one day, and then cultivated for 4 days in a constant temperature and humidity room at 25 ° C and a relative humidity of 80% to induce outbreak did

tomato blight

Tomato blight was caused by spray inoculation of sporangia (2 × 10 4 sporangia / mL) of sporangia (2 × 10 ⁴ sporangia / mL) of Phytophthora infestans KACC 48738, the causative agent of the blight, on tomato seedlings in the 3-4 leaf stage, and then inoculated at 20 ° C. It was treated in a wet room for 2 days in a humid room, and then cultivated for 2 days in a constant temperature room at 20 ° C. to induce onset.

Tomato gray mold

Tomato gray mold disease is caused by Botrytis cinerea, the causative agent of gray mold disease, on tomato 3-4 leaf stage seedlings. cinerea KACC 48736) was treated with a spore suspension (5×10 ⁵ spores/mL), and then cultivated in a wet room at 20° C. for 3 days to induce onset.

wheat red rust

Wheat rust is caused by Puccinia triticinae, a causative bacterium known as a live parasitic fungus on seedlings of the first leaf stage. triticina , Korea Research Institute of Chemical Technology) spores were suspended in a 250 μg/mL Tween 20 solution in an amount of 0.67 g spores/L, sprayed and inoculated, treated in a humid room at 20 ° C for one day, and then transferred to a constant temperature room at 20 ° C. Cultivation was induced for 6 days.

barley powdery mildew

Barley powdery mildew is caused by the causative agent of powdery mildew, Blumeria graminis pome sphesalis hallei ( Blumeria graminis f. sp. hordei , Korea Research Institute of Chemical Technology) was inoculated by shaking off spores, and cultivated in a constant temperature room at 20 ° C for 7 days to induce onset.

pepper anthracnose

Pepper anthracnose was spray-inoculated with a spore suspension (4 × 10 ⁵ spores/mL) of Colletotrichum coccodes KACC 48737, the causative agent of pepper anthracnose, on seedlings of the 3-4 leaf stage of pepper, and in a wet room at 25 ° C. After 2 days of humid room treatment, onset was induced by culturing for 1 day in a constant temperature and humidity room (25° C., 80% relative humidity).

Assessment Methods

The percentage of lesion area (%) on leaves was investigated 3 days after inoculation for tomato gray mold and pepper anthracnose, 4 days after inoculation for tomato blight, 5 days after inoculation for rice blast, and 7 days after inoculation for wheat red rust and powdery mildew of barley. .

The control value (%) was calculated according to Equation 1 below using the lesion area ratio (%) obtained from the above. The control values obtained are shown in Table 2.

[Equation 1]

target disease RCB TGM TLB WLR BPM PAN Prevention (%) 44 85 90 27 25 15

Abbreviation: RCB, rice blast (causative fungus: Magnaporthe oryzae ); TGM, Tomato gray mold (causative fungus: Botrytis ) cinerea ); TLB, tomato late blight (causative fungus: Phytophthora infestans ); WLR, wheat red rust (causative fungus: Puccinia ) triticina ); BPM, barley powdery mildew (causative bacteria: Blumeria graminis f. sp. hordei ); PAN, pepper anthracnose (causative fungus: Colletotrichum coccodes )

As shown in Table 2, it was confirmed that the culture filtrate of the Trichoderma longibrachiatum SFC100166 strain exhibits control activity against plant diseases. In particular, it showed an excellent control effect of 85% to 90% against tomato gray mold and tomato blight, and in addition, rice blast, wheat red rust, barley powdery mildew, and pepper anthracnose were 44%, 27%, 25%, and 15%, respectively. It showed a control effect and proved its potential as a biological control agent.

test example 2. Trichoderma Longibrachiatum SFC100166 of the strain culture filtrate Plant disease control effect evaluation of plant disease control composition containing solvent fraction as an active ingredient

A plant disease control composition containing three solvent fractions (EA, BuOH, water) of the culture filtrate of the Trichoderma longibrachiatum SFC100166 strain prepared in Example 3 under greenhouse conditions was tested for rice blast (causative fungus: Magnaporthe oryzae ), tomato gray mold (causative fungus: Botrytis ) cinerea ), tomato blight (causative fungus: Phytophthora infestans ), barley powdery mildew (causative fungus: Blumeria graminis f. sp. hordei ), wheat red rust (causative fungus: Puccinia triticina ) and pepper anthracnose (causative fungus: Colletotrichum coccodes ) were treated to confirm the control effect. Controls were treated with distilled water containing 5% (v/v) methanol and 0.025% (w/v) Tween 20. The lesion area ratio (%) was obtained by the same evaluation method as in Test Example 1, and the control value (%) was calculated according to Equation I and shown in Table 3.

division Prevention (%) RCB TGM TLB WLR BPM PAN EA fraction 88 95 100 60 0 60 BuOH fraction 25 80 100 33 0 35 water fraction 0 0 0 0 0 0

Fraction concentration: 1000 μg/mL

Abbreviation: RCB, rice blast (causative fungus: Magnaporthe oryzae ); TGM, Tomato gray mold (causative fungus: Botrytis ) cinerea ); TLB, tomato late blight (causative fungus: Phytophthora infestans ); WLR, wheat red rust (causative fungus: Puccinia ) triticina ); BPM, barley powdery mildew (causative bacteria: Blumeria graminis f. sp. hordei ); PAN, pepper anthracnose (causative fungus: Colletotrichum coccodes )

As shown in Table 3, it was confirmed that the ethyl acetate (EA) fraction had a control effect against rice blast, tomato gray mold, tomato blight, wheat red rust and pepper anthracnose at a treatment concentration of 1000 μg/mL, in particular , it was found to have an excellent control effect of over 95% against tomato gray mold and tomato blight.

On the other hand, the butanol (BuOH) fraction was also found to have excellent control effects of 80% and 100%, respectively, against tomato gray mold and tomato blight, and also against rice blast, wheat red rust, and pepper anthracnose. .

On the other hand, the water fraction was found to have no control activity against the six plant diseases tested, and unlike the culture filtrate, it was observed that the fraction did not show control activity against barley powdery mildew.

From the above results, it was confirmed that the substance exhibiting bactericidal activity against plant pathogens in the culture filtrate of Trichoderma longibrachiatum SFC100166 was a non-polar substance, not water-soluble. In particular, the ethyl acetate fraction and the butanol fraction showed very high levels of control against tomato gray mold and tomato blight, and the ethyl acetate fraction showed improved control effects against rice blast, wheat rust, and pepper anthracnose. It was confirmed that the low control effect of the culture filtrate was raised to a high level.

test example 3. Trichoderma longibrachiatum SFC100166 of the strain culture filtrate Evaluation of bactericidal activity against phytopathogenic fungi and bacteria of compounds isolated from solvent fractions

Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) Brassicaceae crops, which are phytopathogenic fungi of 13 compounds isolated from the culture broth of SFC100166 strain ( Alternaria brassicicola ), gray mold ( Botrytis cinerea ), cucumber black star blight ( Cladosporium cucumerinum ), pepper anthracnose ( Colletotrichum coccodes ), ginseng root rot ( Cylindrocarpon ) destructans ), wilt fungus ( Fusarium oxysporum ), rice blast bacteria ( Magnaporthe oryzae ), potato / tomato blight bacteria ( Phytophthora infestans ) and phytopathogenic bacteria Phalaenopsis bacterial brown spot disease ( Acidovorax avenae subsp. cattleyae ), fruit tree root gall fungus ( Agrobacterium tumefaciens ), bacterial rice blight ( Burkholderia glumae ), pepper ulcer disease ( Clavibacter michiganensis subsp. michiganensis ), phalaenopsis soft rot ( Dickeya chrysanthemi ), vegetable soft rot ( Pectobacterium carotovorum subsp. carotovorum ), kiwi ulcer disease ( Pseudomonas syringae pv. actinidiae ), solanaceae crop green blight ( Ralstonia solanacearum ), peach bacterial borer ( Xanthomonas arboricola pv. pruni ) was evaluated by a broth micro-dilution method using a 96-well plate to obtain a minimum inhibitory concentration (MIC) value.

Brassicaceae crop black blotch bacillus ( A. brassicicola ), wilting bacillus ( F. oxysporum ), and ginseng root rot bacillus ( C. destructans ) were inoculated on PDA medium and incubated at 25 ° C for 10 days, and the spores formed were used in the experiment.

Gray mold bacteria ( B. cinerea ) and potato / tomato bacillus ( P. infestans ) were inoculated on PDA medium and oatmeal agar medium, respectively, and incubated at 20 ° C for 6 days, and then spores formed by culturing for 4 days under light treatment conditions of 14 hours a day. was used in the experiment.

Pepper anthrax bacteria ( C. coccodes ) and rice blast bacteria ( M. oryzae ) are inoculated on oatmeal agar medium and incubated at 25 ° C for 7 days, and then the mycelia are removed and kept in a constant temperature and humidity room (25 ° C, 80% relative humidity). ) was treated with light for 12 hours a day for 2 days to induce sporulation.

In the case of phytopathogenic bacteria, after inoculation in TSB (tryptic soy broth) medium, kiwi ulcer disease ( P. syringae pv. actinidiae ) and peach bacterial hole disease ( X. arboricola pv. pruni ) were incubated at 25 ° C. and the rest of the bacteria at 30 ° C. It was cultured with shaking (150 r/min) for 2 days at ℃. The fungus used in the experiment harvested spores using PDB medium and filtered them through 4-layer gauze to prepare a spore suspension, and the bacteria were diluted in TSB medium to prepare a bacterial suspension.

Finally, 1000 fungal spores or bacteria were included in 100 μL wells, and methanol extracts were dispensed at concentrations of 0.8, 1.6, 3.1, 6.3, 12.5, 25, 50, 100, 200, and 400 μg/mL, respectively. . At this time, the content of methanol did not exceed 1%. Only 1% methanol was used as an untreated group, and the experiment was repeated three times for each concentration. After culturing them at 20 ° C. or 25 ° C. for 2 to 3 days, the concentration at which the growth of fungi and bacteria is completely inhibited was determined as the minimum inhibitory concentration (MIC). The experimental results are shown in Table 4.

compound Minimum inhibitory concentration (μg/mL) Alt Bot Col Fus Mag Phy Cla Cyl Aci Bur Ral One 400 2 400 3 400 4 400 5 400 6 100 12.5 400 50 6.3 50 25 50 400 7 400 200 100 400 8 200 200 9 10 200 11 200 400 200 50 12 400 200 100 25 400 200 13 400 400

Abbreviation: Brassica crop black spot (Alt, Alternaria ) brassicicola ); Gray mold (Bot, Botrytis ) cinerea ); Pepper anthracnose (Col, Colletotrichum ) coccodes ); Wilt disease (Fus, Fusarium ) oxysporum ); Rice blast fungus (Mag, Magnaporthe oryzae ); Potato/tomato blight (Phy, Phytophthora ) infestans ); Cucumber black star blight (Cla, Cladosporium cucumerinum ); Ginseng root rot bacteria (Cyl, Cylindrocarpon destructans ); Phalaenopsis, a phytopathogenic bacterium, bacterial brown spot disease (Aci, Acidovorax avenae subsp. cattleyae ); Bacterial rice blight (Bur, Burkholderia ) glumae ); Solanaceae crop green blight (Ral, Ralstonia ) solanacearum )

As shown in Table 4, compound 9 was found to have no control activity, but compounds 1 to 8 and compounds 10 to 13 were phytopathogenic fungi in the concentration range of 6.3-400 μg / mL Brassica crop black spot ( A Brassicicola ), gray mold bacteria ( B. cinerea ), pepper anthracnose ( C. coccodes ), wilt bacteria ( F. oxysporum ), rice blast bacteria ( M. oryzae ), potato / tomato blight ( P. infestans ), Cucumber black spot disease ( C. cucumerinum ), ginseng root rot ( C. destructans ) and phytopathogenic bacteria Phalaenopsis bacterial brown spot disease ( A. avenae subsp. cattleyae ), bacterial rice blight ( B. glumae ), solanaceae crops Green blight ( R. solanacearum ) It was shown to exhibit the efficacy of inhibiting the growth of one or more plant pathogens selected from the group consisting of.

On the other hand, all of the remaining 11 compounds except compounds 9 and 10 showed bactericidal activity against potato / tomato blight ( P. infestans ), and among them, compounds 6 , 11 , and 12 had 6.3, 50, and 25 μg/mL, respectively. It showed a minimum inhibitory concentration (MIC) of potato / tomato blight ( P. infestans ) It was confirmed that it is particularly effective for control. In addition, spirosorvicilinol-based compounds (new compound 1 and compounds 3 - 5 ) exhibited excellent control activity to completely inhibit the growth of potato / tomato blight ( P. infestans ) at a treatment concentration of 400 μg / mL.

In particular, compound 6 completely inhibited the growth of potato/tomato late blight ( P. infestans ), pepper anthracnose ( C. coccodes ), and ginseng root rot ( C. destructans ) in the concentration range of 6.3-25 μg/mL. , in the concentration range of 50-100 μg/mL, brassicaceae crop black spot fungus ( A. brassicicola ), cucumber black spot fungus ( C. cucumerinum ), rice blast fungus ( M. oryzae ) and phalaenopsis bacterial brown spot fungus ( A. avenae subsp . _ lost.

Compound 12 exhibited excellent bactericidal activity by showing minimum inhibitory concentrations of 25 μg/mL and 100 μg/mL, respectively, against potato/tomato blight ( P. infestans ) and rice blast ( M. oryzae ), and pepper anthracnose. ( C. coccodes ), brassicaceae crop black spot fungus ( A. brassicicola ), ginseng root rot fungus ( C. destructans ), phalaenopsis bacterial brown spotted fungus ( A. avenae subsp. cattleyae ) at a concentration of 200-400 μg/mL treatment showed a killing effect.

Compound 11 showed excellent bactericidal activity by showing a minimum inhibitory concentration of 50 μg/mL against potato/tomato blight ( P. infestans ), and at a concentration of 200-400 μg/mL, gray mold ( B. cinerea ), pepper anthracnose Fungi ( C. coccodes ), rice blast blight ( M. oryzae ) showed the effect of completely killing.

test example 4. Trichoderma longibrachiatum SFC100166 of the strain culture filtrate of compounds isolated from solvent fractions. plant disease Control effect evaluation

In the compound isolated from the solvent fraction of the culture filtrate of Trichoderma airbrachytum SFC100166 strain according to the present invention In order to evaluate the in vivo plant disease control activity, compounds 4 , 6 , 7 and 11 were tested against tomato gray mold (causative fungus: Botrytis cinerea ) and tomato blight (causative fungus: Phytophthora ) in greenhouse conditions. infestans ) and wheat red rust (causative fungus: Puccinia triticina ) were evaluated for control activity.

Specifically, compounds 4 , 6 , 7 , and 11 were dissolved in methanol, respectively, and a 250 μg/mL Tween 20 solution was added to adjust the final concentrations to 125 μg/mL, 250 μg/mL, and 500 μg/mL, respectively, The final methanol concentration of all samples was adjusted to 5%. As a control, a solution containing 5% methanol and 250 μg/mL Tween 20 was used. Four ports were used for each plant bottle, and the active ingredient sample was sprayed on the leaf surface, air-dried for 24 hours, and then each plant pathogen was inoculated. The control activity against these three plant diseases was evaluated according to the method described in Test Example 1, and is shown in Table 5 and FIG. 5a. Figure 5a below shows the control efficacy results of tomato blight according to the treatment concentrations of compounds 4, 6, 7, and 11.

compound treatment concentration
(μg/mL) Prevention (%) TGM TLB WLR
compound 4 500 0 71 0 250 0 14 0 125 0 7 0
compound 6 500 92 96 60 250 50 71 33 125 0 68 0
compound 7 500 38 82 0 250 0 71 0 125 0 0 0
compound 11 500 25 75 0 250 15 64 0 125 10 36 0

Abbreviation: TGM, Tomato gray mold (causative fungus: Botrytis ) cinerea ); TLB, tomato blight (causative fungus: Phytophthora infestans ); WLR, wheat red rust (causative fungus: Puccinia triticinia )

As shown in Table 5 and FIG. 5a, treatment with compounds 4 , 6 , 7 and 11 at a concentration level of 500 μg/mL against tomato blight (causative fungus: P. infestans ) showed excellent control effects of 71% to 96% was In particular, compound 6 has excellent control effect, showing a high control effect of 68% even at a low concentration level of 125 μg / mL, and compound 11 shows a control effect of 36% even at a low concentration of 125 μg / mL In the treatment of 250 μg / mL, a control effect of 64% was shown.

On the other hand, for tomato gray mold disease (causative fungus: B. cinerea ), compounds 6, 7, and 11 were found to have a control effect, and in particular, compound 6 had an excellent control effect, resulting in a control effect of 92% at a treatment concentration of 500 μg / mL. showed the control efficacy of

For wheat red rust (causative fungus: P. triticina ), it was confirmed that compound 6 exhibits a control effect.

Compound 6, which has excellent control effect, was treated with plants at each concentration, and after 1 day, a spore suspension of tomato blight ( Phytophthora infestans ) was inoculated into plants to induce tomato blight, and the control effect by compound 6 was confirmed. This is shown in Figure 5b. NC is a negative control group treated with a 0.025% Tween 20 solution containing 5% MeOH, and PC is a positive control group treated with a chemical fungicide dimethomorph (10 g/mL). As can be observed in Figure 5b, it can be seen that the treatment with compound 6 according to the present invention shows an excellent bactericidal effect compared to known tomato blight fungicides.

National Institute of Agricultural Sciences Agricultural Genetic Resources Center KACC83038BP 20201117

<110> KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY <120> Composition for controlling plant diseases comprising compound lsolated from Trichoderma longibrachiatum as an active ingredient and method of controlling plant diseases using the same <130> KCT1-12 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 482 <212> DNA <213> artificial sequence <220> <223> Trichoderma longibrachiatum <400> 1 tttgcctctg cccaacatct gtcgaccagg tggtctgcgt cgatggactt tttttcacca 60 ccccgctttc tcctacccct cctttgggcg acgcaaattt tttttgttgc gtttcgggtt 120 ttagtgggga tgcacctcca gcaaaccact atgctctgcc gccctctgct ctcgtctgca 180 acacctttgg cgcttgcgtc atcaaccttc caacagtctg cgcagcaatg ctaatcattt 240 tcccctcaac aggaagccgc cgaactcggc aagggttcct tcaagtacgc gtgggttctt 300 gacaagctca aggccgagcg tgagcgtggt atcaccatcg acattgccct ctggaagttc 360 gagactccca agtactatgt caccgtcatt ggtatgtttg atcccgtgca ctcattgcat 420 catcgccaca acaacatact aatgccctct gacagacgct cccggccacc gtgatttcat 480 ca 482 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> EF1 Forward <400> 2 atgggtaagg argacaagac 20 <210> 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> EF2 Reverse <400> 3 ggargtacca gtsatcatgt t 21

Claims (11)

Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) A composition for controlling plant pathogens comprising an ethyl acetate fraction or a butanol fraction of the culture filtrate of SFC100166 strain (KACC 83038BP). According to claim 1,
Having antifungal activity against plant pathogenic fungi or bactericidal activity against plant pathogenic bacteria, a composition for controlling plant pathogens. According to claim 1,
Plant pathogens are cabbage crops black spot ( Alternaria brassicicola ), gray mold ( Botrytis cinerea ), cucumber black spot ( Cladosporium cucumerinum ), pepper anthracnose ( Colletotrichum coccodes ), ginseng root rot ( Cylindrocarpon ) destructans ), wilt fungus ( Fusarium oxysporum ), rice blast bacteria ( Magnaporthe oryzae ), potato / tomato blight bacteria ( Phytophthora infestans ), phalaenopsis bacterial brown spot disease ( Acidovorax avenae subsp. cattleyae ), fruit root gall fungus ( Agrobacterium tumefaciens ), wheat red rust ( Puccinia triticina ), barley powdery mildew ( Blumeria graminis f. sp. hordei ), bacterial rice blight ( Burkholderia glumae ), pepper ulcer disease ( Clavibacter michiganensis subsp. michiganensis ), phalaenopsis soft rot ( Dickeya chrysanthemi ), vegetable soft rot ( Pectobacterium carotovorum subsp. carotovorum ), kiwi ulcer disease ( Pseudomonas syringae pv. actinidiae ), solanaceae crop green blight ( Ralstonia solanacearum ) and peach bacterial borer disease ( Xanthomonas arboricola pv. pruni ) At least one selected from the group consisting of, plant disease control composition. According to claim 1,
The ethyl acetate fraction or butanol fraction of the culture filtrate of Trichoderma longibrachiatum SFC100166 strain (KACC 83038BP) exhibiting plant pathogen control activity is represented by the following formulas 1, 2, 3, 4, 5, 6, 7, 8, 10 , 11, 12 and 13, comprising any one or more compounds selected from the compounds represented by the active ingredient, a composition for controlling plant diseases:

. Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) SFC100166 strain (KACC 83038BP) isolated from the culture medium and containing at least one selected from compounds represented by the following formulas 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12 and 13 Composition for controlling plant diseases:

. According to claim 5,
The compounds represented by Formulas 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12 and 13 are each independently a black blotch of Chinese cabbage crops ( Alternaria brassicicola ), gray mold ( Botrytis cinerea ) , Cucumber black star blight ( Cladosporium cucumerinum ), pepper anthracnose ( Colletotrichum coccodes ), ginseng root rot ( Cylindrocarpon destructans ), wilting bacillus ( Fusarium oxysporum ), rice blast fungus ( Magnaporthe oryzae ), potato / tomato blight ( Phytophthora infestans ), phalaenopsis bacterial brown spot disease ( Acidovorax avenae subsp. cattleyae ), fruit tree root gall fungus ( Agrobacterium tumefaciens ), wheat red rust ( Puccinia triticina ), barley powdery mildew ( Blumeria graminis f. sp. hordei ), bacterial rice blight ( Burkholderia glumae ), pepper ulcer disease ( Clavibacter michiganensis subsp. michiganensis ), phalaenopsis soft rot ( Dickeya chrysanthemi ), vegetable soft rot ( Pectobacterium carotovorum subsp. carotovorum ), kiwi ulcer disease ( Pseudomonas syringae pv. actinidiae ), solanaceous crop green blight ( Ralstonia solanacearum ) and peach bacterial hole disease ( Xanthomonas arboricola pv. pruni ) antifungal activity against one or more plant pathogens selected from the group consisting of; Which exhibits bactericidal activity, a composition for controlling plant diseases. Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) Compounds represented by Formula 1 or Formula 2 isolated from metabolites of SFC100166 strain (KACC 83038BP):

. According to claim 1,
The compound of Formula 1 or Formula 2 is a compound that exhibits bactericidal activity against potato / tomato blight ( Phytophthora infestans ). Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) SFC100166 strain (KACC 83038BP), a composition for controlling plant pathogens containing an ethyl acetate fraction or a butanol fraction of the culture filtrate of a plant, seed, soil, seed storage place, and one selected from clothing or shoes of plant management workers Plant disease control method comprising the; step of treating the above. 10. The method of claim 9, wherein the plant disease is brassicaceae crop black pattern blight ( Alternaria brassicicola ), gray mold blight ( Botrytis cinerea ), cucumber black star blight ( Cladosporium cucumerinum ), pepper anthracnose ( Colletotrichum coccodes ), ginseng root rot ( Cylindrocarpon ) destructans ), wilt fungus ( Fusarium oxysporum ), rice blast bacteria ( Magnaporthe oryzae ), potato / tomato blight bacteria ( Phytophthora infestans ), phalaenopsis bacterial brown spot disease ( Acidovorax avenae subsp. cattleyae ), fruit root gall fungus ( Agrobacterium tumefaciens ), wheat red rust ( Puccinia triticina ), barley powdery mildew ( Blumeria graminis f. sp. hordei ), bacterial rice blight ( Burkholderia glumae ), pepper ulcer disease ( Clavibacter michiganensis subsp. michiganensis ), phalaenopsis soft rot ( Dickeya chrysanthemi ), vegetable soft rot ( Pectobacterium carotovorum subsp. carotovorum ), kiwi ulcer disease ( Pseudomonas syringae pv. actinidiae ), solanaceae crop green blight ( Ralstonia solanacearum ) and peach bacterial borer ( Xanthomonas arboricola pv. pruni ) Plant disease caused by infection with one or more bacteria selected from the group consisting of, plant disease control method. Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) ethyl acetate fraction of the culture filtrate of SFC100166 strain (KACC 83038BP); butanol fraction; And compounds of Formulas 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12 and 13 separated from the ethyl acetate fraction or the butanol fraction; Composition:

.

Images