KR20200055666A - DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof - Google Patents

DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof Download PDF

Info

Publication number
KR20200055666A
KR20200055666A KR1020190142763A KR20190142763A KR20200055666A KR 20200055666 A KR20200055666 A KR 20200055666A KR 1020190142763 A KR1020190142763 A KR 1020190142763A KR 20190142763 A KR20190142763 A KR 20190142763A KR 20200055666 A KR20200055666 A KR 20200055666A
Authority
KR
South Korea
Prior art keywords
radish
seq
cabbage
primer set
present
Prior art date
Application number
KR1020190142763A
Other languages
Korean (ko)
Other versions
KR102172478B1 (en
Inventor
허진회
박정은
신호섭
유승화
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Publication of KR20200055666A publication Critical patent/KR20200055666A/en
Application granted granted Critical
Publication of KR102172478B1 publication Critical patent/KR102172478B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a DNA marker capable of distinguishing genotypes of Chinese cabbage, radish, and their intergeneric hybrid, and uses thereof. When an intergeneric hybrid of Chinese cabbage and radish has a specific phenotype or characteristic through a marker of the present invention, it is possible to determine from which parents it originated at a lower cost and in efficient time, thereby being able to be usefully used for breeding horticultural crops.

Description

배추, 무 및 이들의 속간교배체의 유전형을 구분할 수 있는 DNA 마커 및 이의 용도{DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof}DNA marker for discriminating genotype of Chinese cabbage, radish and their interbreeding and its use {DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof}

본 발명은 배추, 무 및 이들의 속간교배체의 유전형을 구분할 수 있는 DNA 마커 및 이의 용도에 관한 것이다.The present invention relates to a DNA marker capable of distinguishing genotypes of Chinese cabbage, radish, and their interbreeding, and uses thereof.

배추(Bassica campestris var. Pekinensis)와 무(Raphanus sativus)의 속간교배체를 형성할 때, 순계 배추와 순계 무를 사용하는 경우에는 새롭게 합성된 개체가 임성(fertility)을 가지는 경우를 찾아보기 어렵다. 기존에 배추와 무의 속간교배를 통해 형성되어 현재 시판되고 있는 배무채(BB1호)의 경우, 부모로 이용된 배추와 무가 모두 1대 잡종(F1) 품종이었음이 알려져 있으며, BB1호는 안정적으로 후대를 생산할 수 있는 특징을 보인다. 따라서 F1 배추와 F1 무를 이용한 속간교배체의 제작을 통해 임성을 가진 새로운 속간교배체가 출현할 수 있는 가능성을 높이고 그 원인을 파악하기 위한 연구가 진행되고 있다. 그러나 F1 품종을 부모로 이용하는 경우에는, 순계 품종을 부모로 이용하는 경우보다 부모의 유전형(genotype)과 그로 인한 표현형의 변화 등을 파악하기 어려운 단점이 있다.When forming an interbreed hybrid of Chinese cabbage ( Bassica campestris var. Pekinensis) and radish ( Raphanus sativus ), it is difficult to find a case where newly synthesized individuals have fertility when using pure Chinese cabbage and pure radish. It is known that in the case of baemuchae (BB1), which was previously formed through interbreeding of cabbage and radish, both cabbage and radish used as parents were known to be one of the hybrid (F 1 ) varieties, and BB1 was stable. It shows characteristics that can produce future generations. Therefore, research is being conducted to increase the likelihood of the emergence of new intergeneric hybrids with fertility through the production of intergeneric hybrids using F 1 cabbage and F 1 radish. However, when the F 1 variety is used as a parent, there is a disadvantage in that it is difficult to grasp the genotype of the parent and the resulting phenotype change than when using the pure breed as a parent.

원예작물의 품종을 개발할 때, 새롭게 형성된 개체가 어떤 유전형을 가지고 있는지를 파악하기 위한 방법으로는 염기서열을 시퀀싱하거나, 분자마커를 이용하여 연관된 부분의 정보를 활용하는 방법 등이 있다. 이 중 염기서열 시퀀싱의 경우는 비용이 많이 필요한 단점이 있다. 이에 본 발명에서는 부모의 유전체 정보를 이용하여 F1 배추와 F1 무를 부모로 이용하여 만들어진 새로운 속간교배체가 부모 중 어떤 품종의 유전형을 가지고 있는지를 파악할 수 있는 CAPS(cleavage amplified polymorphic sequence) 마커를 개발하였다.When developing a variety of horticultural crops, a method for determining the genotype of a newly formed individual includes sequencing a sequencing sequence, or using a molecular marker to use information on an associated part. Among them, there is a disadvantage in that sequencing of sequences is expensive. Accordingly, in the present invention, a new genus hybrid made using F 1 cabbage and F 1 radish as parents is developed using parental genome information to develop a CAPS (cleavage amplified polymorphic sequence) marker that can identify the genotype of the parent. Did.

한편, 한국등록특허 제1636111호에는 '배추과 작물의 종 식별을 위한 범용 프라이머 세트 COS0084 및 이를 포함하는 분자마커'가 개시되어 있고, 한국등록특허 제1266193호에는 '종간교잡을 통해 육성된 탄저병 저항성 고추품종 및 이를 선별하기 위한 프라이머 세트'가 개시되어 있으나, 본 발명의 배추, 무 및 이들의 속간교배체의 유전형을 구분할 수 있는 DNA 마커 및 이의 용도에 대해서는 기재된 바가 없다.On the other hand, Korean Registered Patent No. 1636111 discloses' Universal Primer Set COS0084 for Identification of Species of Cabbage Crops and Molecular Markers Containing the Same ', and Korean Registered Patent No. 1226293' Anthrax resistant peppers grown through cross-breeding. Varieties and primer sets for selecting them 'have been disclosed, but there has been no description of DNA markers and their use for distinguishing the genotypes of Chinese cabbage, radish and their interbreeding.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 순계 배추의 1대 잡종을 모본으로, 순계 무의 1대 잡종을 부본으로 하여 생산된 새로운 속간교배체의 유전형을 파악하기 위하여, 순계 배추 두 품종의 염기서열 정보와 순계 무 두 품종의 염기서열 정보로부터 각각 두 품종 간의 다형성을 파악하였으며, 이 중 SNP(single nucletide polymorphism) 정보를 이용하여 두 품종 중 한 품종의 서열은 특정 제한효소를 이용하여 자를 수 있고, 나머지 한 품종의 서열은 해당 제한효소로 잘리지 않는 부위를 파악하여 해당 부위를 포함하도록 DNA를 증폭할 수 있는 프라이머를 제작하였으며, 배추의 염기서열을 기반으로 만들어진 프라이머는 무 DNA에서 증폭되지 않고, 무 염기서열을 기반으로 만들어진 프라이머는 배추 DNA에서 증폭되지 않는 부위를 탐색할 수 있도록하여 서브게놈(subgenome) 특이적으로 마커가 증폭될 수 있도록 고안하였다. 그 후, 제작된 3개의 프라이머 세트를 이용하여 순계 배추인 CR291M-64와 휘M-2의 1대 잡종을 모본으로, 순계 무인 KB-68-1과 원연-25-9-1의 1대 잡종을 부본으로 하여 생산된 새로운 속간교배체의 유전형을 분석한 결과, 각 속간교배체에서 부본으로 사용된 무 1대 잡종의 모부본 유전형이 다양하게 혼재되어 나타나는 것을 확인함으로써, 본 발명을 완성하였다.The present invention has been derived by the above-mentioned demands, and the present inventors have identified a genus of a new interbreeding cultivar produced by using one hybrid of pure cabbage, as a parent, and one hybrid of pure radish as a copy. From the sequence information of two varieties of Chinese cabbage and the sequence information of two varieties of pure radish, polymorphism between the two varieties was identified. Among them, the sequence of one of the two varieties was identified by using SNP (single nucletide polymorphism) information. A primer capable of amplifying the DNA to include the site was identified by identifying the site that was not cut with the restriction enzyme, and the primers made based on the nucleotide sequence of cabbage were free of DNA. The primer that is not amplified in, and is based on a non-sequence sequence was designed to allow a marker to be amplified specifically for a subgenome by allowing a search for a region that is not amplified in Chinese cabbage DNA. Subsequently, using the produced three primer sets, one hybrid of the pure cabbage CR291M-64 and Whee M-2 was modeled, and one hybrid of the pure unmanned KB-68-1 and the original 25-9-1 As a result of analyzing the genotypes of the new intergeneric cultivars produced as a copy, the present invention was completed by confirming that the genotypes of the parental hybrids of the first generation hybrids used as transcripts in each intergeneric hybrid were diversely mixed.

상기 과제를 해결하기 위해, 본 발명은 서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 3 및 서열번호 4의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 5 및 6의 올리고뉴클레오티드 프라이머 세트;로 이루어진 군으로부터 선택되는 하나 이상의 프라이머 세트를 포함하는, 배추와 무의 속간교배체의 유전형을 판별하기 위한 프라이머 세트를 제공한다.In order to solve the above problems, the present invention is an oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4; And at least one primer set selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 5 and 6, to provide a primer set for discriminating genotypes of cabbage and radish.

또한, 본 발명은 상기 프라이머 세트, 증폭반응을 수행하기 위한 시약 및 제한효소를 포함하는, 배추와 무의 속간교배체의 유전형을 판별하기 위한 키트를 제공한다.In addition, the present invention provides a kit for discriminating genotypes of interbreeding of Chinese cabbage and radish, including the primer set, a reagent for performing an amplification reaction, and a restriction enzyme.

또한, 본 발명은 상기 프라이머 세트를 이용하여 배추와 무의 속간교배체의 유전형을 판별하는 방법을 제공한다.In addition, the present invention provides a method for discriminating genotypes of cabbage and radish using the primer set.

본 발명에 따른 분자마커를 이용하면 배추와 무의 속간교배체가 특이적인 표현형이나 특질을 가질 때 그것이 어떤 부모로부터 유래하였는지를 보다 저렴한 비용으로 효율적인 시간 내에 판단할 수 있으므로, 원예작물의 육종에 유용하게 사용될 수 있을 것이다. 또한, 새로운 속간잡종 품종을 개발하여 농가에 보급, 농가 소득 증대를 꾀하고, 나아가 해외 시장 개척에도 일조할 수 있을 것으로 기대된다.When using the molecular marker according to the present invention, when the interbreeding of cabbage and radish has a specific phenotype or characteristic, it is possible to determine which parent it originated from within a more efficient and cost-effective manner, so it can be usefully used for breeding horticultural crops. Will be able to. In addition, it is expected to develop new interspecies hybrids to spread to farm households, increase farm household income, and further contribute to pioneering overseas markets.

도 1은 본 발명의 DNA 마커 탐색 과정이다.
도 2는 본 발명에 따른 마커 세트를 이용한 PCR 결과로, 좌측은 순계 무 시료에서 증폭된 산물의 제한효소 처리 전·후의 겔 로딩 결과이며, 우측은 순계 무의 1대 잡종 시료에서 증폭된 산물의 겔 로딩 결과이다.
1 is a DNA marker search process of the present invention.
2 is a PCR result using the marker set according to the present invention, the left is the result of gel loading before and after restriction enzyme treatment of the amplified product in the pure turnip sample, and the right is the product amplified in one hybrid sample of pure turnip Gel loading results.

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 3 및 서열번호 4의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 5 및 6의 올리고뉴클레오티드 프라이머 세트;로 이루어진 군으로부터 선택되는 하나 이상의 프라이머 세트를 포함하는, 배추와 무의 속간교배체의 유전형을 판별하기 위한 프라이머 세트를 제공한다.In order to achieve the object of the present invention, the present invention provides an oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4; And at least one primer set selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 5 and 6, to provide a primer set for discriminating genotypes of cabbage and radish.

본 발명에 따른 상기 프라이머 세트는 바람직하게는 CAPS(Cleaved amplified polymorphic sequences)용 프라이머 세트일 수 있다. CAPS는 제한 증폭 다형성 시퀀스라고도 하며, 개체간 단형성 PCR 산물에 대한 제한효소 처리로 생성된 다형성 단편을 의미한다. 사전에 품종 간에 염기서열의 차가 있다는 것을 알고 있는 유전자를 목적으로 해서 검출이 이루어지며, 종의 게놈 중에서 해당 유전자만을 PCR법에 의해 선별하여 증폭한다. 대부분의 표지에서는 증폭된 유전자의 길이와 품종 간의 차이가 없으나, 유전자 내부의 서열은 다르기 때문에 그 서열의 차를 인식하는 제한효소를 선발해서 처리한다. 제한효소로 절단된 DNA를 보유하는 품종과 절단되지 않는 DNA 를 가지는 품종과의 차이를 구별할 수 있으며 그 길이의 차이는 전기영동법에 의해 쉽게 검출된다.The primer set according to the present invention may preferably be a primer set for cleaved amplified polymorphic sequences (CAPS). CAPS is also referred to as a restriction amplification polymorphic sequence, and refers to a polymorphic fragment generated by restriction enzyme treatment on an inter-individual monomorphic PCR product. Detection is made for the purpose of a gene that knows that there is a difference in base sequence between varieties in advance, and only the relevant gene among the genomes of the species is selected and amplified by PCR. In most markers, there is no difference between the length of the amplified gene and the cultivar, but since the sequence inside the gene is different, a restriction enzyme that recognizes the difference in the sequence is selected and processed. Differences between varieties with restriction enzyme digested DNA and varieties with uncut DNA can be distinguished, and the difference in length is easily detected by electrophoresis.

본 발명의 일 구현 예에 따른 프라이머 세트에 있어서, 상기 3개의 프라이머 세트는 순계 무의 염색체 상에 위치하는 SNP(single nucletide polymorphism) 염기를 포함하는 서열을 증폭할 수 있는 프라이머 세트로(표 1 참고), 배추 게놈 DNA에서는 결합되지 않는 것이 특징이다.In the primer set according to one embodiment of the present invention, the three primer sets are primer sets capable of amplifying a sequence comprising a single nucletide polymorphism (SNP) base located on a pure chromosome (see Table 1). ), Chinese cabbage genomic DNA is characterized by not being bound.

본 발명의 프라이머 세트는 바람직하게는 상기 3개의 프라이머 세트로 이루어진 군으로부터 선택되는 1개 이상의 프라이머 세트를 포함하며, 3개의 프라이머 세트, 즉, 서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 3 및 서열번호 4의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 5 및 6의 올리고뉴클레오티드 프라이머 세트;를 모두 포함할 수 있다. 3개의 프라이머 세트를 동시에 이용하면 배추와 무의 속간교배체의 유전형을 더욱 효율적으로 판별할 수 있다.The primer set of the present invention preferably includes one or more primer sets selected from the group consisting of the three primer sets, three primer sets, that is, an oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4; And an oligonucleotide primer set of SEQ ID NOs: 5 and 6; When three primer sets are used simultaneously, genotypes of cabbage and radish can be more efficiently discriminated.

상기 프라이머는 각 프라이머의 서열 길이에 따라, 서열번호 1 내지 6의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드를 포함할 수 있다. 예를 들면, 서열번호 1의 프라이머(21개 올리고뉴클레오티드)는 서열번호 1의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드를 포함할 수 있다. 또한, 상기 프라이머는 서열번호 1 내지 6의 염기서열의 부가, 결실 또는 치환된 서열도 포함할 수 있다.The primer may include oligonucleotides consisting of segments of 16 or more, 17 or more, 18 or more, 19 or more, or 20 or more consecutive nucleotides in the sequences of SEQ ID NOs: 1 to 6, depending on the sequence length of each primer. have. For example, the primer of SEQ ID NO: 1 (21 oligonucleotides) refers to an oligonucleotide consisting of 16 or more, 17 or more, 18 or more, 19 or more, 20 or more consecutive nucleotide segments in the sequence of SEQ ID NO: 1. It can contain. In addition, the primer may also include addition, deletion or substituted sequences of the nucleotide sequences of SEQ ID NOs: 1-6.

본 발명의 프라이머 세트에서, 서열번호 1, 3 및 5로 나타낸 염기서열은 정방향 프라이머를 나타내며, 서열번호 2, 4 및 6으로 나타낸 염기서열은 역방향 프라이머를 나타낸다.In the primer set of the present invention, base sequences represented by SEQ ID NOs: 1, 3 and 5 represent forward primers, and base sequences represented by SEQ ID NOs: 2, 4 and 6 represent reverse primers.

본 발명에 있어서, "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of primer extension products. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the desired DNA or RNA target complexity, as well as the conditions of primer use, such as temperature and ionic strength.

본 명세서에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질(intercalating agent)를 포함할 수 있다.As used herein, oligonucleotides used as primers may also include nucleotide analogs, such as phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or And an intercalating agent.

본 발명의 일 구현 예에 따른 프라이머 세트에 있어서, 상기 배추와 무의 속간교배체는 이에 한정되지 않으나, 순계 배추인 CR291M-64와 휘M-2의 1대 잡종을 모본으로, 순계 무인 KB-68-1과 원연-25-9-1의 1대 잡종을 부본으로 하여 생산된 속간교배체일 수 있다.In the primer set according to the embodiment of the present invention, the interbreeding of the cabbage and the radish is not limited thereto, but is based on one hybrid of the pure cabbage CR291M-64 and the wheat M-2, and the pure unmanned KB- It may be an interbreeding breed produced with a copy of the first hybrid of 68-1 and Wonyeon-25-9-1.

본 발명은 또한, 본 발명의 프라이머 세트, 증폭반응을 수행하기 위한 시약 및 제한효소를 포함하는, 배추와 무의 속간교배체의 유전형을 판별하기 위한 키트를 제공한다.The present invention also provides a kit for discriminating genotypes of Chinese cabbage and radish, which includes the primer set of the present invention, a reagent for performing an amplification reaction, and a restriction enzyme.

본 발명의 키트에서, 상기 프라이머 세트는 전술한 것과 같으며, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs, 버퍼 등을 포함할 수 있으며, 상기 제한효소는 바람직하게는 HindⅢ일 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.In the kit of the present invention, the primer set is as described above, and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffers, etc., and the restriction enzyme may be preferably Hind III. have. In addition, the kit of the present invention may further include a user guide describing optimal conditions for performing the reaction. The handbook is a printout that explains how to use the kit, for example, how to make PCR buffers, and the reaction conditions presented. The handbook includes a brochure in the form of a brochure or leaflet, a label attached to the kit and a description on the surface of the package containing the kit. In addition, the handbook includes information that is disclosed or provided through electronic media, such as the Internet.

본 발명은 또한, 본 발명의 프라이머 세트를 이용하여 배추와 무의 속간교배체의 유전형을 판별하는 방법을 제공한다. 상기 방법은 구체적으로는,The present invention also provides a method for discriminating genotypes of cabbage and radish interbreeding using the primer set of the present invention. Specifically, the method

배추와 무의 속간교배체 시료에서 게놈 DNA를 분리하는 단계;Isolating genomic DNA from a sample of Chinese cabbage and radish;

상기 분리된 게놈 DNA를 주형으로 하고, 본 발명의의 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계;Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of the present invention;

상기 증폭 단계의 산물을 제한효소로 절단하는 단계; 및Cutting the product of the amplification step with a restriction enzyme; And

상기 절단 산물을 분석하는 단계;를 포함할 수 있다.And analyzing the cut product.

본 발명의 배추와 무의 속간교배체의 유전형을 판별하는 방법은 배추와 무의 속간교배체 시료로부터 게놈 DNA를 분리하는 단계를 포함한다. 상기 배추와 무의 속간교배체 시료에서 게놈 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으며, 예를 들면, CTAB 방법을 이용할 수도 있고, Wizard prep 키트(Promega 사)를 이용할 수도 있다.The method for discriminating genotypes of cabbage and radish of the present invention includes separating genomic DNA from a sample of cabbage and radish. As a method of separating genomic DNA from the interbreeding sample of Chinese cabbage and radish, a method known in the art may be used, for example, a CTAB method may be used, or a Wizard prep kit (Promega) may be used. .

상기 분리된 게놈 DNA를 주형으로 하고, 본 발명의 일 실시예에 따른 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. 표적핵산을 증폭하는 방법은 중합효소연쇄반응(polymerase chain reaction, PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Qβ 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, PCR이란 중합효소를 이용하여 표적핵산에 특이적으로 결합하는 프라이머 쌍으로부터 표적 핵산을 증폭하는 방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용 가능한 키트를 이용할 수도 있다.Using the isolated genomic DNA as a template, an amplification reaction may be performed using a primer set according to an embodiment of the present invention to amplify a target sequence. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. amplification system, strand displacement amplification, or any other suitable method for amplifying via Qβ replication enzymes or amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

본 발명에서 용어, "제한효소"란 DNA의 특정한 염기배열을 식별하고 이중사슬을 절단하는 엔도뉴클레아제(endonuclease)로서 특수한 효소를 의미한다. 본 발명의 구체적인 실시예에서는, 선택되어진 프라이머 세트를 기반으로 PCR를 수행하고 PCR 정제 키트로 정제한 후 프라이머와 조합인 제한효소를 이용하여 활성 온도 내에서 처리하였다. 본 발명의 방법에 있어서, 상기 제한효소는 바람직하게는 HindⅢ일 수 있다.In the present invention, the term "restriction enzyme" refers to a specific enzyme as an endonuclease (endonuclease) that identifies a specific nucleotide sequence of DNA and cuts a double chain. In a specific embodiment of the present invention, PCR is performed based on the selected primer set, purified with a PCR purification kit, and then treated at an active temperature using a restriction enzyme in combination with a primer. In the method of the present invention, the restriction enzyme may be preferably Hind III.

본 발명의 방법은 상기 증폭 단계의 산물을 제한효소로 절단하여 절단된 산물을 분석하는 단계를 포함한다. 상기 절단된 산물의 분석은 겔 전기영동, 모세관 전기영동 또는 시퀀싱을 통해 수행될 수 있으나, 이에 제한되지 않는다. 겔 전기영동은 증폭 산물의 크기에 따라 아크릴아미드 겔 전기영동 또는 아가로스 겔 전기영동을 이용할 수 있다. 또한, 모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABi Sequencer를 이용할 수 있다.The method of the present invention includes the step of analyzing the cut product by cutting the product of the amplification step with a restriction enzyme. Analysis of the cut product may be performed through gel electrophoresis, capillary electrophoresis, or sequencing, but is not limited thereto. Gel electrophoresis may use acrylamide gel electrophoresis or agarose gel electrophoresis depending on the size of the amplification product. In addition, capillary electrophoresis can be performed. For capillary electrophoresis, for example, an ABi Sequencer can be used.

본 발명의 일 구현 예에 따른 배추와 무의 속간교배체의 유전형 판별 방법에 있어서, 상기 배추와 무의 속간교배체는 순계 배추인 CR291M-64와 휘M-2의 1대 잡종을 모본으로, 순계 무인 KB-68-1과 원연-25-9-1의 1대 잡종을 부본으로 하여 생산된 속간교배체일 수 있으나, 이에 제한되지 않는다.In the genotype discrimination method of Chinese cabbage and radish according to an embodiment of the present invention, the Chinese cabbage and radish interbreeding is based on one hybrid of pure Chinese cabbage, CR291M-64 and Whee M-2, It may be an interbreed hybrid produced by using one hybrid of the unmanned KB-68-1 and the original 25-9-1 as a copy, but is not limited thereto.

본 발명의 방법에 있어서, 서열번호 1 및 2; 서열번호 3 및 4; 또는 서열번호 5 및 6;의 올리고뉴클레오티드 프라이머 세트에 의해 증폭된 증폭 산물이 HindⅢ 제한효소 처리에 의해 절단되지 않으면 속간교배체의 부본 유전형이 KB-68-1 유래인 것으로 판별할 수 있고, 제한효소 처리에 의해 절단되면 속간교배체의 부본 유전형이 원연-25-9-1 유래인 것으로 판별할 수 있다.In the method of the present invention, SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; Or, if the amplification product amplified by the oligonucleotide primer set of SEQ ID NOs: 5 and 6; is not cut by Hind III restriction enzyme treatment, it can be determined that the subgenotype of the interbreeding gene is derived from KB-68-1, and is restricted. When cleaved by enzymatic treatment, it can be determined that the subgenotype of the interbreeding is derived from the original-25-9-1.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

실시예 1. 분자마커의 제작Example 1. Preparation of molecular markers

먼저 순계 배추인 CR291M-64와 휘M-2 (바이오브리딩 연구소 제공)의 염기서열 정보와 순계 무인 KB-68-1(KB)과 원연-25-9-1(WY) (바이오브리딩 연구소 제공)의 염기서열 정보로부터 배추 두 품종 간, 또는 무 두 품종 간의 SNP(single nucletide polymorphism)와 InDel(insertion/deletion) 등의 다형성을 파악하였으며, 이 중 SNP 정보를 이용하여 두 품종 중 한 품종의 서열은 특정 제한효소를 이용하여 자를 수 있고, 나머지 한 품종의 서열은 해당 제한효소로 잘리지 않는 부위를 파악하여 해당 부위를 포함하도록 DNA를 증폭할 수 있는 PCR 프라이머를 제작하였다. 또한 배추의 염기서열을 기반으로 만들어진 프라이머는 무 DNA에서 증폭되지 않고, 무 염기서열을 기반으로 만들어진 프라이머는 배추 DNA에서 증폭되지 않는 부위를 탐색할 수 있도록 하여 서브게놈(subgenome) 특이적으로 마커가 증폭될 수 있도록 고안하였다. 이를 통해 SNP의 위치정보를 이용하여 각각의 마커가 염색체의 어떤 부위를 목표로 하는지를 알 수 있고, 서브게놈을 파악할 수 있으며, 해당 서브게놈의 염기서열이 부모로 이용된 1대 잡종 품종의 어떤 유전형을 나타내는지를 알 수 있는 마커를 제작하였다.First, the sequence information of the pure cabbage CR291M-64 and Hui M-2 (provided by the Bio-Briding Research Institute) and the original unmanned KB-68-1 (KB) and the original 25-25-1 (WY) (provided by the Bio-Briding Research Institute) Polymorphisms such as SNP (single nucletide polymorphism) and InDel (insertion / deletion) between two varieties of cabbage or between two radish varieties were identified from the nucleotide sequence information of. Among them, the sequence of one of the two varieties was determined using SNP information. PCR primers that can be cut using a specific restriction enzyme and amplified the DNA to include the site were identified by identifying the site that was not cut with the restriction enzyme. In addition, primers made based on the nucleotide sequence of Chinese cabbage are not amplified in DNA, and primers made based on the non-sequence allow the detection of regions that are not amplified in Chinese cabbage DNA, thereby allowing subgenome-specific markers to be detected. It was designed to be amplified. Through this, the location information of the SNP can be used to find out which region of each marker is targeted to the chromosome, the subgenomic can be identified, and the genotype of the 1st hybrid variety in which the base sequence of the subgenomic is used as a parent A marker was prepared to know whether or not.

시퀀싱된 염기서열의 fastq 파일을 바탕으로, Genome-analysis-toolkit(https://software.broadinstitute.org/gatk/) 또는 SAMtools 프로그램(www.htslib.org)을 이용하여 SNP와 InDel을 파악하였다. 이를 통해 얻은 vcf(variant-calling-format) 파일의 SNP 위치정보를 이용하여 품종 간 SNP가 존재하여 특정 제한효소를 통해 한 품종은 자를 수 있고, 다른 품종은 잘리지 않는 특이적인 부위들을 탐색하였다. 다음으로 이 부위를 포함하는 특정 길이의 DNA 서열을 증폭할 수 있는 PCR 프라이머를 Primer3 프로그램을 이용하여 선택한 뒤, BLAST(Basic Local Alignment Search Tool)를 이용하여 같은 서브게놈 내에서는 해당 SNP 부위에서만 특이적으로 증폭될 수 있으며 다른 서브게놈에서는 증폭되지 않을 것으로 판단되는 부위만을 남기고 나머지를 여과하였다. 그리고 남은 프라이머들을 Bowtie aligner 프로그램(http://gensoft.pasteur.fr/docs/bowtie/1.0.0/)을 이용하여 해당 부위를 특이적으로 증폭할 수 있는 능력을 평가하여, 비특이적 증폭의 가능성이 가장 낮으며, 유전체 상에서 정확히 일치하는 부위를 가진 프라이머를 선택하였다(도 1).Based on the sequenced sequencing fastq file, SNP and InDel were identified using Genome-analysis-toolkit (https://software.broadinstitute.org/gatk/) or SAMtools program (www.htslib.org). Using the SNP location information of the vcf (variant-calling-format) file obtained through this, SNPs between varieties existed, so specific varieties could be cut through specific restriction enzymes, and specific regions that were not cut by other varieties were searched. Next, select a PCR primer capable of amplifying a DNA sequence of a specific length containing this site using the Primer3 program, and then use the BLAST (Basic Local Alignment Search Tool) to be specific only in the SNP site within the same subgenomic. It was amplified, and the rest was filtered, leaving only the part that was not amplified in other subgenomics. And the remaining primers were evaluated using the Bowtie aligner program (http://gensoft.pasteur.fr/docs/bowtie/1.0.0/) to evaluate the ability to specifically amplify the site. Primers with the lowest, exact matching sites on the genome were selected (FIG. 1).

상기와 같은 과정을 통해 선택된 배추와 무의 속간교배체 유전형을 판별하기 위한 마커 및 이를 증폭할 수 있는 프라이머 세트의 정보는 하기 표 1 및 표 2와 같다. 본 발명의 분자마커는 배추의 게놈 DNA에는 증폭하지 않으며, 순계 무인 KB-68-1(KB)과 원연-25-9-1(WY)에서 두 품종 간 단일염기다형성이 확인된 서열에 기반한 마커로, 표 2의 프라이머 세트를 이용하여 PCR을 수행한 후 증폭 산물에 HindⅢ 제한효소를 처리하여 밴드 절단 패턴을 확인하여 유전형을 구분할 수 있도록 제작된 것이다. Marker 2의 경우 표 1에 개시된 단일염기다형성 외에 삽입/결실 다형성 서열이 증폭 구간에 포함되어 있어 순계 무 두 품종에서 제한효소 처리 전에도 69bp의 산물 크기 차이가 발생한다. 그러나, 69bp의 크기 차이를 구분하기 위해서는 겔을 오랜시간 내려야 하므로, 제한효소 처리에 의해 증폭 산물의 패턴을 확인하여 유전형을 보다 신속하고 정확하게 구분할 수 있게 하였다.The markers for discriminating the genotypes of the cabbage and radish selected through the above process and the information of the primer sets capable of amplifying them are shown in Tables 1 and 2 below. The molecular marker of the present invention does not amplify the genomic DNA of Chinese cabbage, and is a marker based on a sequence in which single nucleotide polymorphism between two varieties is confirmed in pure unmanned KB-68-1 (KB) and original 25-9-1 (WY). As a result, PCR was performed using the primer set of Table 2, and then the Hind III restriction enzyme was treated with the amplification product to identify the band cutting pattern to identify the genotype. In the case of Marker 2, in addition to the single-base polymorphism disclosed in Table 1, the insertion / deletion polymorphic sequence was included in the amplification section, resulting in a product size difference of 69 bp even before restriction enzyme treatment in both pure radish varieties. However, to distinguish the size difference of 69 bp, the gel has to be unloaded for a long time, so the pattern of the amplification product can be confirmed by restriction enzyme treatment, so that the genotype can be classified more quickly and accurately.

본 발명의 다형성 마커 정보Polymorphic marker information of the present invention 마커Marker 염색체chromosome 위치location 유전형Genotype KBKB WYWY Marker 1Marker 1 R1R1 546789-547350546789-547350 GG AA 547202547202 Marker 2Marker 2 R3R3 14882425-1488293514882425-14882935 GG AA 1488278414882784 Marker 3Marker 3 R5R5 12257981-1225876612257981-12258766 TT AA 1225824512258245

속간교배체 유전형 판별을 위한 프라이머 세트 정보Primer set information for discriminating genotypes 프라이머primer 프라이머 서열(5'→3')Primer sequence (5 '→ 3') Tm(℃)Tm (℃) 예상 크기 (bp)Estimated size (bp) KBKB WYWY Marker 1-FMarker 1-F GAGGCTTGCACATCAGTATGG (서열번호 1)GAGGCTTGCACATCAGTATGG (SEQ ID NO: 1) 60.760.7 562562 562
(414/148)
562
(414/148)
Marker 1-RMarker 1-R CTTTTTGGGGATCTTTAGATGG (서열번호 2)CTTTTTGGGGATCTTTAGATGG (SEQ ID NO: 2) 59.059.0 Marker 2-FMarker 2-F CGTACATAGCAGCAACCATGAG (서열번호 3)CGTACATAGCAGCAACCATGAG (SEQ ID NO: 3) 60.760.7 580580 511
(361/150)
511
(361/150)
Marker 2-RMarker 2-R AGTTGCCCAGTTTTGACTTTTG (서열번호 4)AGTTGCCCAGTTTTGACTTTTG (SEQ ID NO: 4) 60.560.5 Marker 3-FMarker 3-F ACCACATCCAGAACTCATTCAC (서열번호 5)ACCACATCCAGAACTCATTCAC (SEQ ID NO: 5) 58.958.9 786786 786
(261/525)
786
(261/525)
Marker 3-RMarker 3-R GCTTCGGCGTAAAACTCAAC (서열번호 6)GCTTCGGCGTAAAACTCAAC (SEQ ID NO: 6) 59.959.9

실시예 2. 분자마커를 이용한 속간교배체의 유전형 분석Example 2. Genotyping analysis of interbreeding using molecular markers

상기 실시예 1을 통해 선발된 분자마커(표 2)를 이용하여 순계 배추인 CR291M-64와 휘M-2의 1대 잡종을 모본으로, 순계 무인 KB-68-1(KB)과 원연-25-9-1(WY)의 1대 잡종을 부본으로 하여 생산된 속간교배체의 유전형을 분석하였다. 그 결과 하기 표 3에 개시된 것과 같이, 속간교배체에서 부본인 F1 무의 모부본 유전형이 혼재되어 나타나는 것을 확인할 수 있었다.Using the molecular markers selected in Example 1 (Table 2) as a model for one hybrid of pure cabbage CR291M-64 and Whee M-2, pure unmanned KB-68-1 (KB) and original-25 Genotypes of intergeneric cultivars produced by using one hybrid of -9-1 (WY) as a copy were analyzed. As a result, as shown in Table 3, it was confirmed that the parental genotype of the parent F 1 radish in the interbreeding hybrid appears.

Figure pat00001
Figure pat00001

본 발명의 3개의 분자마커는 모두 intergenic region을 증폭하는 마커로, 특정한 형질과 연관이 되어있는 것은 아니지만, 기본적으로 속간교배체는 부모 간의 유전적 거리가 굉장히 멀기 때문에 애초에 형성되기가 상당히 어렵고, 따라서 교배 후에 자라난 식물체가 진정 속간교배를 통해 만들어진 것인지, 아니면 모체의 자가수정이나 다른 화분에 의한 오염으로 인해 발생한 개체는 아닌지에 대한 확인이 필요하다. 상기 표 3에서 속간교배체 시료로 사용한 sample 1 내지 32가 모체의 자가수정이나, 다른 식물체로부터 오염된 것이었다면, 증폭 산물이 확인되지 않게 된다. 추가적으로 속간교배가 정확히 이루어졌다고 하더라도, 잡종간의 교배를 통해 얻어진 식물체이기 때문에 그 유전적 조성이 속간교배체마다 모두 다를 것이고, 따라서 어떠한 유용한 형질을 나타내는 속간교배체 개체를 얻는다면 그 형질이 어떤 품종으로부터 기인한 것인지를 분석할 필요가 있으므로, 본 발명에 따른 분자마커는 부본이 무로부터 왔음을 확인할 수 있을 뿐 아니라, 해당 대립유전자가 어떤 품종 유래인지를 동시에 판별할 수 있으므로, 속간교배체의 육종 효율성을 증진시킬 수 있을 것으로 사료된다.All three molecular markers of the present invention are markers that amplify the intergenic region, and are not associated with a specific trait, but basically, the interbreeding is very difficult to form in the first place because the genetic distance between parents is very long, and thus It is necessary to confirm whether the plants grown after mating have been made through interbreeding, or whether they have been caused by self-fertilization of the mother or contamination by other pollen. In Table 3, if samples 1 to 32 used as samples for interbreeding were self-fertilizing mothers or contaminated from other plants, amplification products would not be identified. In addition, even if the interbreeding was done correctly, the genetic composition will be different for each interbreeding because it is a plant obtained through hybridization between hybrids, so if you get an interbreeding individual that shows some useful traits, the trait from a breed Since it is necessary to analyze whether it is attributable to it, the molecular marker according to the present invention can not only confirm that the copy is from radish, but also can simultaneously determine which breed the allele is from, and thus breeding efficiency of interbreeding It is thought to be able to enhance the.

본 발명에서는 속간교배체 육종에 부모로 이용된 F1 배추와 F1 무의 모ㆍ부본의 염기서열 정보를 이용하여, 배추 품종 간, 또는 무 품종 간 다형성을 나타내는 부위를 보다 효율적으로 탐색할 수 있음과 동시에, 속간교배체에서 서브게놈 특이적인 부위를 탐색할 수 있는 방법을 융합하여 서브게놈과 그 유전형을 동시에 탐색할 수 있는 분자마커를 개발하였다. 따라서, 본 발명의 분자마커를 통해 배추와 무의 F1 품종 간 속간교배체가 특이적인 표현형이나 특질을 가질 때 그것이 어떤 부모로부터 유래하였는지를 보다 저렴한 비용으로 효율적인 시간 내에 판단할 수 있으므로, F1 배추와 F1 무를 이용한 속간교배체의 육종에 본 발명의 분자마커를 유용하게 활용할 수 있을 것으로 판단된다.In the present invention, by using the sequence information of the parent and the parent of the F 1 cabbage and F 1 radish used as a parent for interbreeding breeding, it is possible to more efficiently search for a site showing polymorphism between cabbage varieties or between no varieties. At the same time, a molecular marker was developed that can simultaneously search subgenomes and their genotypes by fusion of methods that can search for subgenome specific regions in intergenerators. Therefore, through the molecular marker of the present invention, when the interbreeding between the Chinese cabbage and the radish F 1 varieties has a specific phenotype or characteristic, it is possible to determine which parent it was derived from in a more efficient and cost-effective manner, so that the F 1 cabbage and It is judged that the molecular marker of the present invention can be usefully used for breeding an interbreeding medium using F 1 radish.

<110> Seoul National University R&DB Foundation <120> DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof <130> PN19368 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gaggcttgca catcagtatg g 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctttttgggg atctttagat gg 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cgtacatagc agcaaccatg ag 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 agttgcccag ttttgacttt tg 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 accacatcca gaactcattc ac 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gcttcggcgt aaaactcaac 20 <110> Seoul National University R & DB Foundation <120> DNA marker for discriminating genotype of Chinese cabbage, radish          and their intergeneric hybrid and uses thereof <130> PN19368 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gaggcttgca catcagtatg g 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctttttgggg atctttagat gg 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cgtacatagc agcaaccatg ag 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 agttgcccag ttttgacttt tg 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 accacatcca gaactcattc ac 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gcttcggcgt aaaactcaac 20

Claims (6)

서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 3 및 서열번호 4의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 5 및 6의 올리고뉴클레오티드 프라이머 세트;로 이루어진 군으로부터 선택되는 하나 이상의 프라이머 세트를 포함하는, 배추와 무의 속간교배체의 유전형을 판별하기 위한 프라이머 세트.Oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4; And one or more primer sets selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 5 and 6; primer sets for discriminating genotypes of cabbage and radish. 제1항에 있어서, 서열번호 1 및 서열번호 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 3 및 서열번호 4의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 5 및 6의 올리고뉴클레오티드 프라이머 세트;를 포함하는, 배추와 무의 속간교배체의 유전형을 판별하기 위한 프라이머 세트.The oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2; Oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4; And oligonucleotide primer sets of SEQ ID NOs: 5 and 6; containing, primer set for discriminating genotypes of cabbage and radish. 제1항 또는 제2항의 프라이머 세트, 증폭반응을 수행하기 위한 시약 및 제한효소를 포함하는, 배추와 무의 속간교배체의 유전형을 판별하기 위한 키트.A kit for determining the genotype of a cross between cabbage and radish, comprising the primer set of claim 1 or 2, a reagent for performing an amplification reaction, and a restriction enzyme. 제3항에 있어서, 상기 제한효소는 HindⅢ인 것을 특징으로 하는 키트.The kit according to claim 3, wherein the restriction enzyme is Hind III. 배추와 무의 속간교배체 시료에서 게놈 DNA를 분리하는 단계;
상기 분리된 게놈 DNA를 주형으로 하고, 제1항 또는 제2항의 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계;
상기 증폭 단계의 산물을 제한효소로 절단하는 단계; 및
상기 절단 산물을 분석하는 단계;를 포함하는, 배추와 무의 속간교배체의 유전형을 판별하는 방법.
Isolating genomic DNA from a sample of Chinese cabbage and radish;
Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of claim 1 or 2;
Cutting the product of the amplification step with a restriction enzyme; And
A method of determining the genotype of the interbreeding of cabbage and radish, including; analyzing the cutting product.
제5항에 있어서, 상기 제한효소는 HindⅢ인 것을 특징으로 하는, 배추와 무의 속간교배체의 유전형을 판별하는 방법.The method according to claim 5, wherein the restriction enzyme is Hind III.
KR1020190142763A 2018-11-13 2019-11-08 DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof KR102172478B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180139130 2018-11-13
KR1020180139130 2018-11-13

Publications (2)

Publication Number Publication Date
KR20200055666A true KR20200055666A (en) 2020-05-21
KR102172478B1 KR102172478B1 (en) 2020-10-30

Family

ID=70910631

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190142763A KR102172478B1 (en) 2018-11-13 2019-11-08 DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof

Country Status (1)

Country Link
KR (1) KR102172478B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210156227A (en) * 2020-06-17 2021-12-24 서울대학교산학협력단 Molecular marker for discriminating genotype of Chinese cabbage pure line cultivar and uses thereof
KR20220056806A (en) * 2020-10-28 2022-05-06 서울대학교산학협력단 DNA marker for discriminating genotype of Brassica rapa, Brassica oleracea and their interspecific hybrid and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106011257A (en) * 2016-06-24 2016-10-12 江苏省农业科学院 Molecular identification method for sitaris and raphanus distant-hybridization generation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106011257A (en) * 2016-06-24 2016-10-12 江苏省农业科学院 Molecular identification method for sitaris and raphanus distant-hybridization generation

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
GENBANK ACCESSION NO. JRUI02000001, JRUI02000003, JRUI02000005 *
LINA LOU ET AL, SCIENTIA HORTICULTURAE, 2017, VOL.220, 57_65 *
Y.P. WANG ET AL, PLANT CELL TISS ORGAN CULT (2006) 86:279_283 *
YUYU WANG ET AL, MOL BREEDING, 2017, 37(26), PP.1_14 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210156227A (en) * 2020-06-17 2021-12-24 서울대학교산학협력단 Molecular marker for discriminating genotype of Chinese cabbage pure line cultivar and uses thereof
KR20220056806A (en) * 2020-10-28 2022-05-06 서울대학교산학협력단 DNA marker for discriminating genotype of Brassica rapa, Brassica oleracea and their interspecific hybrid and uses thereof

Also Published As

Publication number Publication date
KR102172478B1 (en) 2020-10-30

Similar Documents

Publication Publication Date Title
US11649494B2 (en) High throughput screening of populations carrying naturally occurring mutations
US20170233831A1 (en) Sidt1 GENE CONTROLLING DETERMINATE GROWTH HABIT IN SESAME AND SNP MOLECULAR MARKER THEREOF
Zhu et al. Transcriptome and complexity-reduced, DNA-based identification of intraspecies single-nucleotide polymorphisms in the polyploid Gossypium hirsutum L.
KR102172478B1 (en) DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof
CN108642201B (en) SNP (Single nucleotide polymorphism) marker related to millet plant height character as well as detection primer and application thereof
KR102298723B1 (en) Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker
CN108715901B (en) SNP marker related to millet plant height character and detection primer and application thereof
CN108707685B (en) SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof
CN108642199B (en) SNP (Single nucleotide polymorphism) marker related to growth of millet flag leaves as well as detection primer and application thereof
CN111778346A (en) Molecular marker for detecting stripe rust resistant QTL QYr. hbaas-4BL.1 and using method thereof
KR102510016B1 (en) Molecular marker for discriminating genotype of Chinese cabbage pure line cultivar and uses thereof
Elec et al. In silico mining and validation of simple sequence repeat (SSR) markers derived from the Fragaria x ananassa genome assembly
CN114606341B (en) dCAPS molecular marker of aegilops sieboldii based on genome resequencing SNP and application
KR102505574B1 (en) Molecular marker for discriminating genotype of ESP2 gene regulating amylose content in rice and uses thereof
JP3836451B2 (en) Genotyping method using a DNA marker located near the pungent locus of Capsicum plants, primers used for detecting the DNA marker, and genotyping method using the same
KR102613521B1 (en) Molecular marker for discriminating Sinano Gold apple and its bud mutation cultivar and use thereof
CN108642197B (en) SNP (Single nucleotide polymorphism) marker related to millet code number character as well as detection primer and application thereof
CN108660240B (en) SNP (Single nucleotide polymorphism) marker related to long shape of neck of millet as well as detection primer and application thereof
KR102380677B1 (en) Marker for selection of powdery mildew resistance cucumber and selection method using the same marker
CN108728567B (en) SNP (Single nucleotide polymorphism) marker related to width character of millet flag leaf as well as detection primer and application thereof
CN108774645B (en) SNP (Single nucleotide polymorphism) marker related to millet code number character as well as detection primer and application thereof
CN108642198B (en) SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof
CN108715900B (en) SNP (Single nucleotide polymorphism) marker related to weight of millet ears as well as detection primer and application thereof
CN108707683B (en) SNP (Single nucleotide polymorphism) marker related to grain ear length character as well as detection primer and application thereof
KR101818420B1 (en) Molecular marker for discrimination of powdery mildew-resistant pepper cultivar and uses thereof

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant