KR20190007056A - Multivariable vaccine against major swine viral diseases - Google Patents

Abstract

The present invention relates to the field of vaccines. More specifically, the present invention relates to multivalent vaccines for major porcine viral diseases. In one embodiment, the multivalent vaccine is a recombinant rabies rabies viral vector.

Description

Multivariable vaccine against major swine viral diseases

The present invention relates to the field of vaccines. More specifically, the present invention relates to multivalent vaccines for major porcine viral diseases.

Sequence List

This application is being filed with the sequence listing in electronic form. The sequence list is titled 2577254PCTSequenceListing.txt, which was created on May 4, 2017 and is 23 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

The present invention relates to the field of vaccines. More specifically, the present invention relates to a multivalent vaccine against major porcine viral diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies viral vector.

The publications and other materials used herein to identify the context of the present invention or to provide additional details regarding the present invention are incorporated by reference and categorized in the respective References for convenience.

Pseudorabies virus (PRV), belonging to the subfamily Alphaherpesvirinae subfamily of the herpesviridae family, is a causative agent of Aujeszky's disease. PRV is widespread in developing countries and results in significant economic losses in the pig industry. Live attenuated PRV vaccines have been key to the prevention and eradication of PRV (Pomeranz et al., 2005). PRV Bartha-K61 is an attenuated PRV vaccine strain with gE and part of the gI gene has been deleted (Klupp et al., 2012; Dong et al., 2014). In addition, the attenuated PRV Bartha-K61 live vaccine is an excellent vaccine vector for heterologous antigen gene expression (Nie et al., 2011; Li et al., 2008; Song et al., 2007; ., 2007). Therefore, we used the attenuated PRV Bartha-K61 live vaccine strain as a vector expressing several antigen genes of major porcine viral diseases.

Porcine circovirus (PCV), a member of the family Circoviridae , is a single-stranded circular DNA genome. PCV2 is a major cause of post-weaning multisystemic wasting syndrome (PMWS) in infected pigs. This infection is characterized by diarrhea, decreased weight gain, sudden death, lymphadenopathy, dyspnea, and multinucleated giant cell formation (Liu et al., 2005). ORF2 is one of the major open reading frames within the PCV2 genome. It encodes capsid protein (Cap), an immunologically strong viral protein that can be an ideal target for vaccine development in pigs.

Classical swine fever (CSF) viruses are highly contagious and economically important viral diseases affecting domestic pigs and wild boars. CSF virus (CSFV) is a positive sense single-stranded RNA virus in the positive direction and belongs to the genus Pestivirus in Flaviviridae and family. Cortical glycoprotein E2 contains four antigenic domains and can induce protective immunity against CSFV in the pig populations. Therefore, E2 glycoprotein is a potential candidate for CSFV vaccine design (Zhang et al., 2014). Total inactivated vaccines based on commercially available C-strains were effective and provided complete protection against the three groups of CSFV, but could not provide differentiability of the infection from the vaccinated animals (Zhang et al., 2014).

Porcine reproductive and respiratory syndrome virus (PRRSV) are classified as Arteriviridae and family in the order Nidovirales . It is a enveloped, positive strand RNA virus with envelope that has led to the development of Porcine Reproductive and Respiratory Syndrome (PRRS). Infection with PRRSV can cause late-term abortion of sows, massive reproductive failure, respiratory disorder of young pigs. The PRRSV genome consists of nine open reading frames encoding seven structural proteins and 14 non-structural proteins. Among them, glycoprotein (GP) 5 is a major envelope protein encoded by ORF5. It is one of the important immunogenic proteins of PRRSV essential for the induction of viral assembly, infectious and neutralizing antibodies. ORF5 is one of the most variable regions of the PRRSV genome and has been widely used to study the molecular dynamics of PRRSV. GP5 is also a major target of vaccine development for PRRSV infection (Li et al., 2012).

Currently available vaccines and vaccination programs are complex and difficult to individually immunize for all four diseases and are not suitable for multi-injections and multi-boosts. . Therefore, the development of multivalent vaccines for four diseases can be time consuming, cost-effective, and can lead to more effective vaccines.

The present invention is directed to providing a multivalent vaccine against major porcine viral diseases.

SUMMARY OF THE INVENTION

The present invention relates to the field of vaccines. More specifically, the present invention relates to multivalent vaccines against major porcine viral diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies viral vector.

The present invention relates to established attenuated pseudorabies (PRV) such as Bartha-K61 as a vaccine vector expressing multi immunogens from the main pig virus diseases of PCV2, CSF and PRRSV, Describe the use of live vaccine strains. The PRV genome is about 140 kb and contains a unique long (UL) region, a unique long (US) region, large inverted repeat sequences, internal repeats (IRs) (terminal repeats, TRs). Half of the genome is considered nonessential regions such as protein kinase (PK), thymidine kinase (TK), gE, gG and gI, so that nonessential regions Deformed or inserted. In addition, the well-documented PRV Bartha-K61 vaccine strain stability and protective efficacy profiles have been used for decades to successfully control Aujeszky's disease. , PRRSV, PCV2, CSF and PRV vaccines and PCV2, CSF and PRV A trivalent PRV vaccine was produced.

Thus, in one aspect, the invention provides a tetravalent PRV vaccine against PRRSV, PCV2, CSF and PRV. In accordance with this aspect, a nucleic acid construct comprising a gene of PRRSV, a gene of PCV2 and a gene of CSF is produced. In some embodiments, the PRRSV gene is the PRRSV ORF5 gene. In some embodiments, the PRRSV ORF5 gene is derived from a highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1). In some embodiments, the PCV2 gene is the PCV2 ORF2 gene. In some embodiments, the PCV2 gene is derived from the PCV2 Indonesian strain (genotype 2B) (PCV2 TLL-Indo, GenBank Accession No. KX130941). In some embodiments, the CFS gene is a CFS E2 gene. In some embodiments, the CFS E2 gene results from a new appearance of the subtype 2.1 of the CSF Indonesian strain (CSF TLL-Indo, GenBank Accession No. KX130940).

In some embodiments, each gene is operably linked to a promoter active in mammalian cells in the mammalian cell. Any suitable promoter having activity in mammalian cells may be used in accordance with the present invention. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter is the CMV intermediate early (CMV ie) promoter. In some embodiments, the promoter is an elongation factor 1 a (EF1 alpha) promoter.

In some embodiments, each gene is operably linked to an operative terminator sequence in a mammalian cell. Any suitable terminator having activity in a mammalian cell may be used in accordance with the present invention. In some embodiments, the terminator sequence is a bovine growth hormone polyadenylation (BGH poly A) sequence. In some embodiments, the terminator sequence is the SV40 virus polyadenylation (SV40 poly A) sequence.

In some embodiments, a nucleic acid construct is provided that comprises the PRRSV gene, the PCV2 gene, and the CSF gene described herein. In some embodiments, the nucleic acid construct further comprises a promoter and / or a terminator as described herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of a PRV. In some embodiments, the PRV is a PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO: 1.

In some embodiments, the PRV strain is modified to contain the nucleic acid construct described herein. In some embodiments, the modified PRV is a modified PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct of the modified PRV strain is stable without mutation or deletion after five passages in pig kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell is a PK-15 cell ATCC (R) CCL-33 ( ^TM) cell obtained from the American Type Culture Collection.

In some embodiments, a cell line transfected with the nucleic acid construct described herein is provided in a manner suitable for producing a virus useful for a tetravalent vaccine. In some embodiments, the nucleic acid construct described herein is inserted into the PRV strain described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is the PK-15 cell described herein.

In a second aspect, the invention provides a trivalent PRV vaccine against PCV2, CSF and PRV. In accordance with this aspect, a nucleic acid construct comprising a gene for PCV2 and a gene for CSF is produced. In some embodiments, the PCV2 gene and the CSF gene are as described herein.

In some embodiments, each gene is operably linked to a promoter having activity in the mammalian cell. In some embodiments, the promoter is as described herein.

In some embodiments, each gene is operably linked to a terminator sequence that is operative in a mammalian cell. In some embodiments, the terminator sequence is as described herein.

In some embodiments, nucleic acid constructs comprising the PCV2 gene and the CSF gene described herein are provided. In some embodiments, the nucleic acid construct further comprises a promoter and / or a terminator as described herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is a PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO: 2.

In some embodiments, a strain of PRV modified to include the nucleic acid construct described herein is provided. In some embodiments, the modified PRV strain is as described herein. In some embodiments, the nucleic acid construct of the modified PRV strain is stable without mutation or deletion after 5 passages in pig kidney 15 (PK-15) cells. In some embodiments, PK-15 cells are as described herein.

In some embodiments, a cell line transfected with the nucleic acid construct described herein is provided in a manner suitable for producing a virus useful for a trivalent vaccine. In some embodiments, the nucleic acid construct described herein is inserted into the PRV strain described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is the PK-15 cell described herein.

The invention also provides a kit for immunizing a subject having a recombinant PRV as described herein. The kit includes a recombinant PRV as described herein, a pharmaceutically acceptable carrier, an applicator, and an instructional material for use thereof.

The present invention also provides a method of use. In one embodiment, the invention provides a method of treating a subject, for example a human, in a pig, comprising administering to the subject a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV as described herein A method of inducing a protective immune response is provided. In another embodiment, the invention provides a method of treating a subject suffering from infection with PRV, PRRSV, PCV and CSF or PRV, PCV and CSF, comprising administering a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV as described herein ≪ / RTI >

According to the present invention, a multivalent vaccine against major porcine viral diseases can be provided.

Figure 1 shows a strategy for the construction of rPRV according to one embodiment of the present invention. The genomes of the psdudorabies virus (PRV) genome include a unique long region (UL), an internal repeat (IR), a unique short region (US), and a terminal repeat , TR). Tetravalent PRV expressing PRRSV-ORF5, PCV2-ORF2, and CSF-E2; 3-valent PRV expressing PCV2-ORF2, CSF-E2. Abbreviation: N-gG = N (amino) terminus of glycoprotein G; C-gG = carboxy-terminal of glycoprotein; PK = protein kinase; CMV ie immediate immediate early promoter of human cytomegalovirus; EF1? Promoter = kidney factor 1 alpha promoter; Terminator SV40 poly A, bovine growth hormone polyadenylation (BGH poly A).
Figures 2A and 2B show immunofluorescence analysis of PK15 cells infected with the multivalent vaccine. FIG 2A: 5% CO _2, PK15 cells infected with 37 ℃ 36 hours 2 is PRV (ORF2-PRV) or trivalent PRV (ORF2-E2-PRV) or PRV (ORF5-ORF2-E2- PRV) 4 during the Immunofluorescence analysis of. Anti-ORF2 (mouse hyperimmune sera) signal appeared in all constructs. Immunofluorescence analysis of 5% CO _2, PK15 cells infected with trivalent PRV (PRV-ORF2-E2) or tetravalent PRV (ORF5-ORF2-E2- PRV) for from 37 ℃ 36 hours: Fig. 2B. An anti-E2 (mouse elevated serum) signal appeared in all constructions.
Figure 3 shows mouse groups (n = 8 / group) immunized with trivalent or tetravalent PRV vaccine on days 0 and 21. Serum was collected on days 20 and 42. Serum PRV / CSF / PCV2 / PRRSV specific IgG antibody levels at 20 days and 42 days as measured by indirect ELISA.
Figure 4 shows mouse groups (n = 8 / group) immunized with trivalent or tetravalent PRV vaccines at days 0 and 21. Serum was collected on days 20 and 42. The results show serum PCV2-ORF2 or CSF-E2 specific antibody titers at 42 days (21 days after second immunization).

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to the field of vaccines. More specifically, the present invention relates to a multivalent vaccine against major porcine viral diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies viral vector.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The term " expression " for a gene sequence refers to the transcription of a gene and, preferably, the translation of the resulting mRNA transcript into a protein. Thus, as is clear from the context, expression of protein coding sequences occurs due to transcription and translation of coding sequences.

As used herein, " gene " means a nucleic acid sequence comprising the coding region of a gene product.

"Introduced" in connection with the insertion of a nucleic acid fragment (eg a recombinant DNA construct) into a cell means "transfection" or "transformation" or "transduction" A nucleic acid fragment is integrated into a yeast or fungal cell integrated into the genome of the cell (e.g., chromosome, plasmid or mitochondrial DNA), converted into an autonomous replicon, transiently expressed (E. G., Transfected mRNA).

As used herein, the term " operable linkage " or " operably linked ", or " operatively linked ", for example refers to the sequential arrangement of the promoter and the expressed nucleic acid, If appropriate, it is understood, for example, that each of the regulatory factors is intended to mean additional regulatory factors such as, for example, terminators, in such a way that they can perform their function in the recombinant expression of the nucleic acid to produce the desired product. This does not necessarily require a direct connection in the chemical sense. For example, genetic control sequences, such as enhancer sequences, may also exert their function in a target sequence from a slightly distant or indeed other DNA molecule (cis or trans localization). A preferred arrangement is that the recombinantly expressed nucleic acid sequence is located downstream of the sequence acting as a promoter and these two sequences are covalently linked to each other. The rgulatory or control sequences may be located on the 5 'side of the nucleotide sequence well known in the art or on the 3' side of the nucleotide sequence.

The terms "polynucleotide", "nucleic acid" and "nucleic acid molecule" are used interchangeably herein to refer to nucleotides and / or nucleosides Refers to polymers of nucleotides that can be natural or synthetic linear and sequential arrays, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof. These include chromosomal DNA, self-replicating plasmids, infectious polymers of DNA or RNA, and DNA or RNA that primarily plays a structural role. Unless otherwise specified, nucleic acids or polynucleotides are written from left to right in the 5 'to 3' direction. Nucleotides are commonly referred to as allowed single-letter codes. Numerical ranges include numbers that define a range.

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term applies not only to natural (naturally occurring) amino acid polymers but also to amino acid polymers wherein one or more amino acid residues are artificial chemical analogues corresponding to natural amino acids. Amino acids can be represented by the commonly used three-letter or one-letter symbols. Amino acid sequences are written from left to right in the amino group to the carboxy direction, respectively. The numerical range includes a number defining the range.

&Quot; Promoter " refers to a nucleic acid fragment capable of regulating the transcription of other nucleic acid fragments.

&Quot; Promoter active in a mammalian cell " is a promoter capable of regulating transcription in mammalian cells, whether derived from mammalian cells or not.

&Quot; Recombinant " means an artificial combination of two separate fragments of a sequence, for example, by chemical synthesis or by manipulation of separate fragments of nucleic acid by genetic engineering techniques. &Quot; Recombinant " also refers to a naturally occurring event that has been altered by the introduction of a cell derived from a heterologous nucleic acid or such modified cell, but which occurs without intentional human intervention (e. G., Spontaneous mutation, Reference to a cell or vector that does not involve a change in the cell or vector by transfection / transduction / transposition).

&Quot; Recombinant DNA construct " refers to a combination of nucleic acid fragments that are not commonly found together in nature. Thus, recombinant DNA constructs may contain regulatory sequences and coding sequences derived from different sources, or control sequences and coding sequences derived from the same source, but are not normally found in nature Can be arranged in other ways. The terms " recombinant DNA construct " and " recombinant constructor " are used interchangeably herein. In various embodiments described herein, a recombinant DNA construct may also be considered an " over expression DNA construct ". The term " nucleic acid construct " may also be used interchangeably with a " recombinant DNA construct ".

"Regulatory sequences" refer to nucleotide sequences located upstream (5 'non-coding sequences), within, or downstream (3' non-coding coding sequences) of a coding sequence , Which affects transcription, RNA processing or stability, or translation of the relevant coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms " regulatory sequence " and " regulatory element " are used interchangeably herein.

Sequence alignments and percent identity calculations are designed to detect homologous sequences including the Megalign® program of the LASERGENE® Bioinformatics Computing Suite (DNASTAR® Inc., Madison, WI) May be determined using various comparison methods, but are not limited thereto. Unless otherwise stated, the multiple alignment of the sequences provided herein is based on the Clustal V alignment method (Higgins and Sharp, 1989) with default parameters (GAP PENALTY = 10, GAP LENGTH PENALTY = 10) ) CABIOS 5 : 151-153.) The basic parameters for calculating the percent identity of pairwise alignments and protein sequences using the Clustal V method are KTUPLE = 1, GAP PENALTY = 3 , WINDOW = 5, and DIAGONALS SAVED = 5. For nucleic acids, these parameters are KTUPLE = 2, GAP PENALTY = 5, WINDOW = 4, and DIAGONALS SAVED = 4.

After sorting the sequences using the Clustal V program, you can get the "identity identity" and "divergence" values by viewing the "sequence distances" table in the same program; Unless otherwise specified, percent claimed identity and divergence provided and claimed herein are calculated in this manner.

Alternatively, a Clustal W sorting method may be used. Clustal W sorting method (described by Higgins and Sharp, CABIOS. 5: 151-153 (1989); Higgins, DG et al., Comput. Appl. Biosci. 8: 189-191 (1992) The basic parameters for multiple alignments are GAP PENALTY = 10, GAP LENGTH PENALTY = 0.2, Delay Divergent Sequences, = 30%, DNA Transition Weight = 0.5, Protein Weight Matrix = Gonnet Series, and DNA Weight Matrix = IUB. In case of pairwise alignment, parameter is Alignment = Slow-Accurate, Gap Penalty = 10.0, Gap Length = 0.10, a protein weight matrix (protein Weight matrix) = Gonnet 250 and DNA weight matrix (DNA Weight matrix) = IUB. sequences using the Clustal W program And then in the same program, look at the "sequence distance" table, Bit identity "and" divergence "can get the value.

The term " under stringent conditions " means that two sequences are hybridized under moderately or highly stringent conditions. More specifically, moderately stringent conditions can be readily determined by those skilled in the art depending on, for example, the length of the DNA. Basic conditions are described in Sambrook et al., Molecular Cloning : A Laboratory Manual , 3rd ed., Chapters 6 and 7, Cold Spring Harbor Laboratory Press, 2001; nitrocellulose filters 5xSSC, 0.5% SDS, Hybridization conditions of EDTA (pH 8.0), about 50% formamide, 2xSSC to 6xSSC at about 40-50 ° C (or other similar hybridization solution such as Stark's solution in about 50% formamide at about 42 ° C) And a wash condition of about 40-60 ° C, 0.5-6 × SSC, 0.1% SDS. Highly stringent conditions can also be readily determined by those skilled in the art, for example, depending on the length of the DNA.

Generally, these conditions are selected for hybridization and / or higher temperature and / or lower salt concentration (about 65 占 폚, 6xSSC to 0.2xSSC, preferably 6xSSC, more preferably For example, hybridization at 2xSSC, most preferably at 0.2xSSC. For example, highly stringent conditions include hybridization as defined above and hybridization at about 65-68 DEG C, 0.2xSSC, 0.1% SDS may include a wash in. SSPE (1xSSP is 0.15M NaCl, 10mM NaH ₂ PO _4, and 1.25mM EDTA, pH 7.4) is an SSC (Im 1xSSC is 0.15M NaCl and 15mM sodium citrate) in the hybridization and wash buffer Washing is performed for 15 minutes after hybridization is complete.

A commercially available (commercially available) hybridization kit that does not use a radioactive material as a probe may be used. Specific examples include hybridization with ECL direct labeling and detection systems (Amersham). Strict conditions include, for example, hybridization for 4 hours at 42 ° C using a hybridization buffer included in a kit supplemented with 5% (w / v) Blocking reagent and 0.5M NaCl and hybridization at 55 ° C Of 0.4% SDS, 0.5x SSC twice for 20 minutes, and 2x SSC at room temperature for 5 minutes.

As used herein, the term " substantially homologous " or " substantial homology " in relation to a nucleic acid sequence refers to a portion or sequence of the mentioned sequence under stringent conditions, Wherein the sequence comprises a nucleotide sequence that hybridizes to its complement and allows an antiparallel orientation to occur between the two sequences and forms a hydrogen bond with the corresponding base on the opposite strand under stringent conditions, which is capable of forming a sufficiently stable duplex molecule under conditions of appropriate stringency, including high stringency, which is detectable using methods well known to those skilled in the art. Substantially homologous sequences may comprise from about 70% to about 80% sequence identity, more preferably from about 80% to about 85% sequence identity, to the indicated nucleotide sequence or complements thereof as set forth in the sequence listing, Sequence identity, or most preferably from about 90% to about 95% sequence identity, and about 99% sequence identity. Alternatively, substantially homologous sequences include sequences that hybridize under stringent conditions to a target site of an intron of plant genes. For stringent conditions, reference is made to the description herein, and also to U.S. Patent Nos. 8,455,716 and 8,536,403.

The "PRRSV ORF5 gene" or "ORF5 gene" means the ORF5 gene derived from the highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1). In some embodiments, the ORF5 gene has the sequence described in nucleotides 1041-1643 of SEQ ID NO: 1. In another embodiment, the ORF5 gene is at least 85%, 86%, 87%, 88%, 89%, 90%, 90%, 90%, 90% 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

"PCV ORF2 gene" or "ORF2 gene" means the ORF2 gene derived from the PCV2 Indonesian strain (genotype 2B) (PCV2 TLL-Indo, GenBank Accession No. KX130941). In some embodiments, the ORF2 gene has the sequence described in nucleotides 3063-3767 of SEQ ID NO: 1. In another embodiment, the ORF2 gene is at least 85%, 86%, 87%, 88%, 89%, 90%, 90%, 90%, 90%, 90% 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

"CSF E2 gene" or "E2 gene" refers to the E2 gene derived from the new appearance of sub-genotype 2.1 of the CSF Indonesian strain (CSF TLL-Indo, GenBank Accession No. KX130940). In some embodiments, the E2 gene has the sequence described in nucleotide 4729-5916 of SEQ ID NO: 1. In another embodiment, the E2 gene comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 90%, 90%, 90% 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

In one aspect, the invention provides a tetravalent PRV vaccine against PRRSV, PCV2, CSF, and PRV. In accordance with this aspect, a nucleic acid construct comprising a PRRSV gene, a PCV2 gene, and a CSF gene is produced. In some embodiments, the PRRSV gene is the PRRSV ORF5 gene. In some embodiments, the PRRSV ORF5 gene is derived from the highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1). In some embodiments, the ORF5 gene has the nucleotide sequence described herein. In some embodiments, the PCV2 gene is the PCV2 ORF2 gene. In some embodiments, the PCV2 gene is derived from the PCV2 Indianaceae strain (genotype 2B). In some embodiments, the ORF2 gene has the nucleotide sequence described herein. In some embodiments, the CFS gene is a CFS E2 gene. In some embodiments, the CFS E2 gene is derived from a new appearance of sub-genotype 2.1 of the CSF Indonesian strain. In some embodiments, the E2 gene has the nucleotide sequence described herein.

In some embodiments, each gene is operably linked to a promoter having activity in the mammalian cell. Any suitable promoter having activity in a mammalian cell may be used in accordance with the present invention. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter is the CMV intermediate early (CMV ie) promoter. In some embodiments, the CMV ie promoter has a sequence described by nucleotides 445-1034 of SEQ ID NO: 1. In some embodiments, the CMV promoter has at least 85%, 86%, 87%, 88%, 89%, 90%, or 90% sequence identity, based on the Clustal V or Clustal W alignment method as compared to nucleotides 445-1034 of SEQ ID NO: , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity. In some embodiments, the promoter is an extension factor 1 alpha (EF1 alpha) promoter. In some embodiments, the EFl [alpha] promoter has the sequence described by nucleotides 1869-3056 of SEQ ID NO: 1. In some embodiments, the EFl [alpha] promoter is at least 85%, 86%, 87%, 88%, 89%, 90%, or 90%, based on the Clustal V or Clustal W alignment method, as compared to the nucleotide 1869-3056 of SEQ ID NO: , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

In some embodiments, each gene is operably linked to a terminator sequence that is operative in a mammalian cell. Any suitable terminator having activity in a mammalian cell may be used in accordance with the present invention. In some embodiments, the terminator sequence is bovine growth hormone polyadenylation (BGH poly A) sequence. In some embodiments, the BGH polyA sequence has the sequence described in nucleotides 1644-1868 of SEQ ID NO: 1. In some embodiments, the BGH polyA sequence is at least 85%, 86%, 87%, 88%, 89%, or 90% identical to the nucleotide 1644-1868 of SEQ ID NO: , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity. In some embodiments, the terminator sequence is the SV40 virus polyadenylation (SV40 poly A) sequence. In some embodiments, the SV40 poly A sequence has the sequence described as nucleotides 5925 to 6192 of SEQ ID NO: 1. In some embodiments, the SV40 poly-A sequence has at least 85%, 86%, 87%, 88%, 89%, or 90% identity, based on the Clustal V or Clustal W alignment method as compared to the nucleotide 5925-6192 of SEQ ID NO: , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

In some embodiments, a nucleic acid construct is provided that comprises the PRRSV gene, the PCV2 gene, and the CSF gene described herein. In some embodiments, the nucleic acid construct further comprises a promoter and / or a terminator as described herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is a PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO: 1.

In some embodiments, the PRV strain is modified to contain the nucleic acid construct described herein. In some embodiments, the modified PRV is a modified PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct in the modified PRV strain is stable without mutation or deletion after five passages in pig kidney 15 (PK-15) cells. In some embodiments, PK-15 cells are PK-15 cells ATCC (R) CCL-33 ( ^TM) cells obtained from the American Type Culture Collection.

In some embodiments, a cell line transfected with the nucleic acid construct described herein is provided in a manner suitable for producing a virus useful for a tetravalent vaccine. In some embodiments, the nucleic acid construct described herein is inserted into the PRV strain described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is the PK-15 cell described herein.

In a second aspect, the invention provides a trivalent PRV vaccine against PCV2, CSF and PRV. In accordance with this aspect, a nucleic acid construct comprising a gene for PCV2 and a gene for CSF is produced. In some embodiments, the PCV2 gene and the CSF gene are as described herein.

In some embodiments, each gene is operably linked to a promoter having activity in the mammalian cell. In some embodiments, the promoter is as described herein.

In some embodiments, each gene is operably linked to a terminator sequence that is operative in a mammalian cell. In some embodiments, the terminator sequence is as described herein.

In some embodiments, nucleic acid constructs comprising the PCV2 gene and the CSF gene described herein are provided. In some embodiments, the nucleic acid construct further comprises a promoter and / or a terminator as described herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is a PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO: 2.

In some embodiments, the PRV strain is modified to contain the nucleic acid construct described herein. In some embodiments, the modified PRV strain is as described herein. In some embodiments, the nucleic acid construct in the modified PRV strain is stable without mutation or deletion after 5 passages in pig kidney 15 (PK-15) cells. In some embodiments, PK-15 cells are as described herein.

In some embodiments, a cell line transfected with the nucleic acid construct described herein is provided in a manner suitable for producing a virus useful for a trivalent vaccine. In some embodiments, the nucleic acid construct described herein is inserted into the PRV strain described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is the PK-15 cell described herein.

In preparing the nucleic acid construct, various DNA fragments can be manipulated to provide the DNA sequence in the proper orientation, and suitably in a suitable reading frame. For this purpose, adapters or linkers can be used to bind DNA fragments or other manipulations can be included to provide convenient restriction sites, removal of unwanted DNA, removal of restriction sites, and the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, such as transitions and transversions, .

The nucleic acids of the present invention can be synthesized by methods known in the art, if desired to provide, in whole or in part, particularly plant-preferred sequences. Thus, all or a portion of the nucleic acids of the present invention can be synthesized using the codons preferred by the selected host. Species-preferred codons can be determined, for example, from codons most frequently used in proteins expressed in a particular host species. Other variants of the nucleotide sequence may result in mutations with slightly modified activity.

A tetravalent recombinant PRV or tri-recombinant TRV is produced by transfecting a suitable cell line such as the PK-15 cell line described herein. In some embodiments, the cell line is transfected with the nucleic acid construct described herein and PRV nucleocapsid DNA. In some embodiments, the PRV nucleocapsid DNA is modified to contain a nucleic acid construct for expression of a red fluorescent protein (RFP). A tetravalent recombinant PRV or tri-recombinant TRV is diverted in several ways in PK-15 cells to ensure a stable recombinant virus free of mutations or deletions in the viral nucleic acid. In some embodiments, five passages are sufficient to produce a stable recombinant virus.

Once produced, the recombinant TRV virus can be replicated in a suitable cell line. In some embodiments, the cell line is the PK-15 cell line (cell) described herein. In some embodiments, the cell line (cell) is a baby hamster kidney 21 (BHK21) cell line. In some embodiments, the BHK21 cell line is BHK21 (clone 13). In some embodiments, the BHK21 (clone 13) cell line is ATCC® CCL-10 ™ and is available from the American Type Culture Collection.

Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and pseudorabies virus (PRV) are major causes of infectious reproductive failure in pigs and cause serious losses to the pig industry worldwide . In addition, PCV2 and Classical Swine Fever cause fatal diseases and have a serious impact on animal welfare and economy in many Asian countries. The development of a multivalent vaccine approach can greatly reduce the dose of vaccine that can cover all four viruses in a single dose, greatly helping to protect the pig from these four diseases have. We chose live attenuated PRV Bartha-K61 as the vaccine development vector. The genome and genetic background of the PRV Bartha-K61 strain are relatively well defined and it has been reported that the proliferation and stable expression of foreign genes do not affect the stability of the virus itself (Boldogkoi, Nogradi, 2003).

As described herein, the tetravalent PRV expressing PCV2-ORF2, CSF-E2 and PRRSV-ORF5 and the ternary PRV expressing PCV2-ORF2 and CSF-E2 were obtained from the gG locus of the PRV Bartha K-61 vaccine strain ). ≪ / RTI > As a result of replication analysis and stability test, trivalent or tetravalent PRV recombinant PRVs were stable and efficiently replicated in vitro, such as PRV Bartha K-61, and PRV Lt; RTI ID = 0.0 > replication. ≪ / RTI > In addition, immunogenicity studies in mouse experiments have demonstrated that tetravalent PRV induces high levels of serum-specific humoral antibodies against the PCV2-ORF2, CSF-E2 and PRRSV-ORF5 antigens, Similarly, trivalent PRVs proved to induce serum-specific humoral antibodies against PCV2-ORF2 and CSF-E2. These results suggest that the expression of multivalent immunogens of major pig viruses in PRV Bartha K-61 is a novel approach to the development of multivalent vaccines against PCV2, CSF or PRRSV, including pseudorabies.

Recombinant rabies rabies viral vectors of the present invention comprising ORF2 of PCV2, E2 of CSF and ORF5 of PRRSV are useful in all four diseases that enable mass production of cost-effective products in a single manufactured product Gt; antibody < / RTI >

According to the present invention, trivalent and tetravalent recombinant vaccines were found to be stable after 5 sequential passages in the PK15 / BHK21 cell line. Insertion of two or three genes at the single insertion site is very stable and does not indicate gene instability or modifications in the transcription of the inserted gene.

According to the present invention, insertion of a large number of genes into the single insertion site of the gG gene locus of PRV-Bartha does not affect viral titers.

The present invention also provides a method of use. In one embodiment, the invention provides a method of inducing a protective immune response in a subject, e.g., a pig, comprising administering to the subject a preventive, therapeutic, or immunologically effective amount of the recombinant PRV described herein ≪ / RTI > In another embodiment, the invention provides a method of treating a subject, comprising administering to the subject a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV as described herein, wherein the subject is selected from the group consisting of PRV, PRRSV, PCV and CSF or PRV, PCV and CSF Of the < / RTI >

As used herein, " administering " means delivering using any of a variety of methods and delivery systems known to those skilled in the art. Administration can be, for example, intraperitoneally, intracerebrally, intravenously, orally, transmucosally, subcutaneously, transdermally, intradermally, Intramuscularly, topically, parenterally, implant, intrathecally, intralymphatically, intralesionally, pericardially or epidurally (e.g., intramuscularly, topically, parenterally, epidurally. < / RTI > The agent or composition may also be administered in the form of an aerosol, such as pulmonary and / or intranasal delivery. Administration may be carried out, for example, once, multiple times, and / or over one or more extended periods.

Inducing a protective immune response in a subject can be accomplished, for example, by administering the subject a primary dose of the vaccine, followed by one or more subsequent vaccine doses after a reasonable period of time. The appropriate time interval between administration of the vaccine can be readily determined by those skilled in the art and is typically several weeks to months. However, the invention is not limited to any particular method, route or frequency of administration.

A " prophylactically effective dose " or " a immunologically effective dose ", when administered to a subject susceptible to viral infection or susceptible to a virus-related disorder, Lt; RTI ID = 0.0 > a < / RTI > immune response in a subject. "Protecting" a subject means reducing the likelihood that the subject will become infected with the virus or at least twice, preferably at least 10 times, the likelihood of the disorder occurring in the subject. For example, if the test subject has a probability of being infected with a virus of 1%, the probability that the test subject is infected with the virus is 0.5% if the test subject is twice as likely to be infected with the virus. Most preferably, a " prophylactically effective amount " induces in the subject an immune response that completely prevents the subject from infecting the virus or completely prevents the onset of the disorder in the subject.

Any particular embodiment of instant immunization and treatment methods may further comprise administering one or more adjuvants to the subject. &Quot; Adjuvant " means any agent suitable for enhancing the immunogenicity of an antigen and enhancing the immune response in the subject. Many adjuvants, including particulate adjuvants, suitable for use with both protein- and nucleic acid-based vaccines, and methods of combining antigens and adjuvants are well known to those skilled in the art. Suitable adjuvants for use in protein immunization include alum, Freund ' s complete adjuvant, Freund ' s incomplete adjuvant (FIA), alfentanil adjuvant, saponin-based adjuvants such as Quil A and QS- But are not limited to,

The viral strains described herein may be used in combination with one or more physiologically or pharmaceutically acceptable carriers in addition to the subject in order to induce a protective immune response in the subject or to prevent the subject from suffering from virus- Or a pharmaceutically acceptable salt thereof. Pharmaceutically acceptable carriers are well known to those skilled in the art and include any of the following: 0.01 M to 0.1 M, preferably 0.05 M phosphate buffer, phosphate-buffered saline (PBS) or 0.9% saline But is not limited to, one or more. Such carriers also include aqueous or non-aqueous solutions, suspensions and emulsions. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, saline solutions and buffered media. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils.

Intravenous vehicles include fluid and nutritional supplements, electrolyte supplements such as those based on Ringer ' s dextrose, and the like. Solid compositions may include, for example, non-toxic solid carriers such as glucose, sucrose, mannitol, sorbitol, lactose, starch, magnesium stearate, cellulose or cellulose derivatives, sodium carbonate and magnesium carbonate. For aerosol administration, such as pulmonary and / or intranasal administration, the formulation or composition is preferably a non-toxic surfactant, such as an ester or partial ester of a C ₆ to C ₂₂ fatty acid or a natural glyceride, and a propellant propellant. To facilitate intranasal delivery, additional carriers such as lecithin may be included. Pharmaceutically acceptable carriers may additionally comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives and other additives such as antimicrobial agents, antioxidants and chelating agents which improve the shelf life and / or effectiveness of the active ingredients. The compositions of the present invention may be formulated to provide rapid, sustained or delayed release of the active ingredient after administration to the subject, as is well known in the art.

The present invention also provides a kit for immunizing a subject with the recombinant PRV described herein. The kit comprises a recombinant PRV as described herein, a pharmaceutically acceptable carrier, an applicator and an instructional material for its use. The present invention includes other embodiments of kits known to those skilled in the art. Instructions may provide any information useful for directing the administration of a stable cold-adapted temperature sensitive virus strain or an inactive form thereof, as described herein.

The present invention provides vaccine technology related to the virus strains described herein. In one embodiment, the viral strains described herein are used in a vaccine preparation method. In another embodiment, the nucleic acid construct described herein is used in a vaccine preparation method. In another embodiment, the viral strains described herein are used in vaccine development. In a further embodiment, the nucleic acid construct described herein is used in vaccine development.

The practice of the present invention employs conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture, and transformational biology within the skill of the art unless otherwise stated. For example, Maniatis et al. , 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook et al. , 1989, Molecular Cloning , 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook and Russell, 2001, Molecular Cloning , 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et al. , 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); Anand, Techniques for the Analysis of Complex Genomes , (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988, Antibodies , (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Nucleic Acid Hybridization (BD Hames & SJ Higgins eds. 1984); Transcription And Translation (BD Hames & SJ Higgins eds., 1984); Culture of Animal Cells (RI Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., NY); Methods In Enzymology , Vols. 154 and 155 (Wu et al. Eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology , Volumes I-IV (DM Weir and CC Blackwell, eds., 1986); Riott, Essential Immunology , 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA Interference Technology: From Basic Science to Drug Development , Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice , Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology , DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology) , Human Press, Totowa, NJ, 2004; See Sohail, Gene Silencing by RNA Interference: Technology and Application , CRC, 2004.

EXAMPLES (EXAMPLES)

The invention is illustrated by reference to the following examples, which are provided by way of illustration and are not intended to limit the invention in any way. Standard techniques known in the art or techniques specifically described below have been used.

Example 1

Methods

Selection of immunogens: The ORF2 gene of the PCV2 indigenous strain (genotype 2B) (PCV2 TLL-Indo, GenBank Accession No. KX130941) was transfected with phylogenetic analysis using circulating strains ). ≪ / RTI > PCV2 genotype 2B is also a highly dominant genotype in pig populations (Opriessnig et al., 2013). The E2 gene was selected from a new emergence of the sub-genotype 2.1 of the CSF Indenesian strain (CSF TLL-Indo, GenBank Accession No. KX130940). The ORF5 gene was selected from the Chinese strain of HP-PRRSV (high virulence PRRSV-JXA1) Chinese strain with high similarity to the circulating PRRSV strain (Yin et al., 2012; Jantafong et al., 2015) .

Construction of recombinant transfer plasmids and synthetic genes: The ORF2 gene from PCV2 and the E2 from the CSF strain were amplified and cloned into the XhoI / EcoRI region of the intermediate pcDNA3.1 + vector (Invitrogen) ApaI and HindIII / BamHI restriction sites, respectively.

A synthetic gene, bovine growth hormone (BGH) sequence and elongation factor 1α promoter (EF1α) sequence (ORF5-BGH-EF1α) composed of a combination of ORF5 of the PRRSV strain was synthesized (Genscript, USA). One of such synthetic genes has the sequence shown in SEQ ID NO: 3. BglII and AgeI restriction sites.

The ORF5-BGH-EF1 fragment was cloned into the BglII / AgeI restriction site of the transfer plasmid pUC-gG-MCS (Fig. 1) (kindly provided by Prof. Enquist, Princeton University , USA). pUC-gG-MCS is a pUC57 plasmid with a synthetic construct inserted into the gG locus of PRV Bartha. The ORF2-BGH fragment from pcDNA3.1 + was amplified by PCR using the primers AgeI -ORF2 F: CTG ACCGGT ATGACGTATCCAAGGAGGCG-3 '(SEQ ID NO: 4; underline AgeI site) and ORF2-R- XhoI: 5'- CGG CTCGAG CCATAGAGCCCACCGCATC-3' SEQ ID NO: 5; underlined XhoI site) and cloned into the AgeI / XhoI restriction site of the transfer plasmid pUC-gG-MCS (Fig. 1). Similarly, the CMV-E2 fragment from pcDNA3.1 + was cloned into the primer SalI-CMV + E2-F: 5'-CGC GTCGAC GTTGACATTGATTATTGAC-3 '(SEQ ID NO: 6; underlined SalI site) and NotI-E2- Was amplified using '-TAAA GCGGCCGC ACCAGCGGCGAGTG TTCTG-3' (SEQ ID NO: 7; underlined NotI site) and cloned into the SalI / NotI restriction site of the transfer plasmid pUC-gG-MCS (FIG. The recombinant transfer plasmid pUC-gG-ORF5-ORF2-E2 was confirmed by PCR and sequencing. The sequence of the nucleic acid comprising gG-CMV-ORF5-BGH-EF1-orf2-BGH-CMV-E2-SV40-gG is shown in SEQ ID NO:

The ORF2-BGH fragment from pcDNA3.1 + was cloned into the primer AgeI-ORF2 F: 5'-CTG ACCGGT ATGACGTATCCA AGGAGGCG-3 '(SEQ ID NO: 4; underlined AgeI site) and ORF2-R -XhoI: 5'-CGG CTCGAG CCATAGAGCCCACCGCATC-3 '(SEQ ID NO: 5; underlined XhoI site) and cloned into the AgeI / XhoI restriction site of the transfer plasmid pUC-gG-MCS (FIG. The synthetic EF1? Promoter and the amplified E2 fragment were ligated with the primers SalI-EF1 F PCR: 5'-GC GTCG AC CGTGAGGCTCCGGT 3 '(SEQ ID NO: 8; underlined SalI site) and NotI-E2-R: 5'-TAAA GCGGCCGC ACCAGCGGCGAGTTGTTCTG 3 (SEQ ID NO: 7; underline NotI site), respectively, in the SalI / NotI restriction site of the transfer plasmid pUC-gG-MCS (FIG. The recombinant transfer plasmid pUC-gG-ORF2-E2 was confirmed by PCR and sequencing. The nucleic acid sequence containing gG-CMV-ORF2-BGH-EF1-E2-SV40-gG is shown in SEQ ID NO: 2.

Generation of tetravalent and trivalent recombinant PRV: PRV Bartha's nucleocapsid DNA (kindly provided by Prof. Enquist, Princeton University, USA) expressing red fluorescent protein (RFP) Lt; RTI ID = 0.0 > EcoRI < / RTI > The transfer plasmid pUC-gG-ORF5-ORF2-E2 or pUC-gG-ORF2-E2 was digested with HindIII to release the construct for the combination. Briefly, PK-15 cells were seeded into 6 well plates at 1x10 ⁶ cells per well. ORF2-E2 (tetravalent PRV vaccine) or gG-ORF2-E2 (trivalent PRV vaccine) and 5 占 퐂 of linearized PRV-RFP nucleocapsid DNA were digested with Lipofectamine 200 was co-transfected into PK-15 cells. After the occurrence of the cytopathic effect, transfection progenies were plated onto PK-15 cells for plaque purification.

Plaque assay: The transfection supernatant containing the recombinant virus (after freeze-thaw) was titrated from 10 ^-1 to 10 ^-6 dilution and incubated at 37 ° C with 5% CO ₂ for 1 hour And incubated with PK-15 cell culture. The supernatant was removed and replaced with a 1% agarose overlay. Viral plaques that did not exhibit a fluorescent signal were selected after 48 hours. After 3 to 4 rounds of plaque purification, the selected plaques were transferred to PK-15 cells and the recombinant viruses were sequenced to confirm the presence of the introduced genes (ORF2, E2 and ORF5) and absence of mutation.

Expression analysis by indirect immunofluorescence assay: Cells infected with trivalent or tetravalent rPRV were transfected with CSF-E2-specific polyclonal or PCV2-ORF2-specific monoclonal antibodies And analyzed by immunofluorescent staining. Briefly, PK15 cells were infected with 3% or 4% rPRV in 5% CO ₂ , 37 ° C for 36 hours. After fixation, the cells were infiltrated with 0.1% Triton X-100 and incubated with anti-E2 or anti-ORF2 polyclonal antibodies at 37 ° C for 1 hour. Cells were then incubated with FITC-conjugated rabbit anti-mouse antibody (DAKO Cytomation, Copenhagen, Denmark). Fluorescence signals were detected using an inverted fluorescence microscope (Olympus, Essex, UK) and images were captured with a digital imaging system (Nikon, Tokyo, Japan).

Replication kinetics of recombinant PRV vaccines in PK15 and BHK21 cell lines in PK15 and BHK21 cell lines: To investigate viral replication in different cell lines, at MOI 5 (at an MOI of 5), PK15 Or BHK21 cells were infected with PRV-Bartha or trivalent rPRV or tetravalent rPRV. After 1 hour at 37 < 0 > C. Cells were washed twice with phosphate buffered saline (PBS) and 1 mL of medium containing 2% FBS was added. The culture plates were incubated at 37 占 폚 for 24 hours and 48 hours. At this point, the cells were lysed by three freeze and thaw cycles and the supernatant containing the virus was stored at -80 ° C. Each cell type and time point was replicated three times (with each cell type and time point replicated three times) and virus titration was performed in PK15 cells three times. Virus titers were calculated and expressed in terms of tissue culture-infectious doses (TCID50 / mL) in a 50% per volume volume using the Reed and Muench method (Reed and Muench, 1938).

Genetic stability of recombinant PRV vaccine constructs: Recombinant PRV vaccine constructs were serially transferred up to five times in PK15 cells. After 5 sequential passages, the 3-rPRV or 4-rPRV vaccine construct was identified by PCR and sequencing to confirm the absence of mutation or deletion.

Immunogenicity study in mouse model: Female BALB / c mice (n = 8 / group) at 6-7 weeks of age were immunized with 10 ⁶ TCID50 of attenuated PRV Bartha (negative control ), 2-valent rPRV (PRV and ORF2), 3-valent rPRV (PRV, ORF2 & E2), 4-valent (PRV, ORF2, E2 & ORF5) and PBS control were intramuscularly vaccinated. Serum was collected on days 20 and 42. The immunogenicity of recombinant vaccine constructs was assessed by serum PRV-specific antibody titers, PCV2-ORF2, CSF-E2 and PRRSV-ORF5 specific antibody titers measured by indirect ELISA at 20 and 42 days.

Measurement of specific antibody titers by indirect ELISA Serum-specific antibody titers for PRV, PCV2-ORF2, CSF-E2 and PRRSV-ORF5 antigens were tested using an indirect ELISA . Briefly, microtiter well ELISA plates were coated with purified PRV viral antigen or PCV2-ORF2 or CSF-E2 or PRRSV-ORF5 antigen in coating buffer (0.1 mol / L carbonate-bicarbonate, pH 9.6) . A 2 fold serial diluted serum sample (1:10 dilution) in 3% nonfat dry milk in PBS containing 0.05% Tween 20 was added to the plate three times. Tween 20 was added to the plates in triplicates. After washing three times with PBS-T, the cells were diluted 1000-fold with PBS-T HRP (horseradish peroxidase) conjugated DAKO (goat anti-mouse immunoglobulins) was added to each well. The reaction was developed with 100 ml of 100 ml TMB substrate (3, 39, 5, 59-etramethylbenzidine) and then terminated with 50 ml of 2M H ₂ SO ₄ . The optical density at 450 nm was determined using a microwell plate absorbance reader (Tecan, Switzerland).

Example 2

Construction and Characterization of Recombinant PRV Vaccine

(PRV-ORF2-E2) and PCV2-ORF2, CSF-E2 and PRRSV-ORF5 (4) that express PCV2-ORF2 and CSF-E2 (trivalent PRV- ORF2- (PUC-gG-4 / pUC-gG-3) cassette into the PRV Bartha DNA by homologous recombination was generated by the homologous recombination of the PRV-ORF5-ORF2-E2 (Fig. 1). After transfection, the resulting recombinants were plaque-purified on PK15 cells by selection of non-red fluorescent plaques. Positive recombinants were re-examined. After 3-4 round of plaque purification, positive recombinants were analyzed by sequencing and titrated in PK15 cells. In addition, immunofluorescence analysis for individual ORF2 or E2 specific antibodies demonstrated effective expression of the ORF2 or E2 protein by a single PRV vector (FIGS. 2A and 2B). In contrast, no fluorescent cells were observed in the PRV negative control group. In addition, stability studies showed that the recombinant vaccine (4-valent rPRV or 3-valent rPRV) showed no stability and no mutation or deletion after 5 consecutive passages in PK15 cells.

Example 3

Replication in PK15 and BHK21 cells

In the PK15 and BHK21 cells, the recombinant PRV vaccine construct 3, a 4-membered rPRV and a parental PRV Bartha strain of the PRV Bartha strain, were used to investigate whether the insertion or expression of the foreign gene in the gG locus affects the replication characteristics. Step growth kinetic was compared. The viral potency of the trivalent and four-prism PRV vaccine constructs showed 10 ⁸ TCID ₅₀ and 10 ^8.3 TCID ₅₀ in PK15 and BHK21 cells, respectively, and the replicative ^{gene was} PRV-Bartha (TCID ₅₀ 10 ^8.5-8.7 ) parental strain ).

Example 4

Immunogenicity studies in mouse models

The results showed that mice immunized with quadrivalent PRV vaccines exhibited serum specific antibody levels for PRV, E2, ORF2 and PRRSV. In addition, mice inoculated with the trivalent PRV vaccine induced serum-specific antibody levels against the PRV, ORF2 and E2 antigens (Figure 3). Antibody titer results showed that mice immunized with bivalent rPRV (ORF2) exhibited antibody titers of> 260 for the PCV2-ORF2 antigen. In addition, mice immunized with trivalent PRV and tetravalent PRV vaccines exhibited antibody titers of 240 and 180 for the ORF2 antigen, respectively. In addition, both tri- and tetravalent PRV vaccines showed> 256 antibody titers for classical swine fever E2 glycoproteins (FIG. 4).

The use of the terms "a" and "an" and "the" and similar directives in the context of describing the invention (especially in the context of the following claims) , And the singular and the plural are to be construed as being included. The terms " comprising, "" having, "" including, " and " containing ", unless the context clearly dictates otherwise, Quot;). ≪ / RTI > The recitation of ranges of values herein is intended to serve as an abbreviated way of referring individually to each individual value falling within its scope, unless otherwise indicated herein, and each individual value is herein incorporated by reference in its entirety ≪ / RTI > All methods described herein may be performed in any suitable order, unless otherwise indicated herein. The use of any and all examples or exemplary language (e.g., " as such ") provided herein is intended to better describe the invention unless otherwise indicated herein and is not to be construed as limiting the scope of the invention Do not. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

Embodiments of the invention are described herein, including the best mode known to the inventors for carrying out the invention. Modifications of these embodiments may be apparent to those skilled in the art from a reading of the foregoing description. The inventors expect skilled artisans to make appropriate use of such variations, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, the invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Also, unless otherwise indicated herein or otherwise clearly contradicted by context, any combination of the above-mentioned elements in all possible variations is included in the present invention.

references

Dong B, Zarlenga DS, Ren X (2014). An overview of live attenuated recombinant pseudorabies viruses for use as novel vaccines. J Immunol Res 214: 824630.

Jantafong T, Sangtong P, Saenglub W et al., (2015). Genetic diversity of porcine reproductive and respiratory syndrome virus in Thailand and Southeast Asia from 2008 to 2013. Vet Microbiol. 176 (3-4): 229-38.

Jiang Y, Fang L, Xiao S. et al. (2007). Immunogenicity and protective efficacy of recombinant pseudorabies virus expressing the two major membrane-associated proteins of porcine reproductive and respiratory syndrome virus. Vaccine, 25, no. 3, 547-560.

Klingbeil K, Lange E, Teifke JP, Mettenleiter TC, Fuchs W. (2014). Immunization of pigs with an attenuated pseudorabies virus recombinant expressing the hemagglutinin of pandemic swine origin H1N1 influenzae virus. J Gen Virol, vol. 95, 948-959.

Klupp BG, Lominiczi B, Visser N et al. (2012). Mutations affecting the UL21 gene contribute to the avirulence of pseudorabies virus vaccine strain Bartha. Virol 212: 466-473.

Li G, Shi N, Suo S, Cui J, Zarlenga D, Ren X. (2012). Vaccination of mice with ORF5 plasmid DNA of PRRSV; enhanced effects by co-immunizing with porcine IL-15. Immunol Invest. 41 (3): 231-48.

Li X, Liu R, Tang H, Jin M, Chen H, Qian P. (2008). Induction of protective immunity in swine by immunization with live attenuated recombinant pseudorabies virus expressing the capsid precursor encoding regions of foot-and-mouth disease virus. Vaccine, vol. 26, no. 22,2714-2722.

Liu, J., Chen, I. and Kwang, J. (2005). Characterization of viral proteins in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis. J. Virol. 79: 8262-8274.

Nie H, Fang R, Xiong BQ. et al. (2011). Immunogenicity and protective efficacy of two recombinant pseudorabies viruses expressing Toxoplasma gondii SAG1 and MIC3 proteins. Vet Parasitol, vol. 181, no. 2-4, 215-221.

Opriessnig T, O'Neill K, Gerber PF, de Castro AM, et al., (2013). A PCV2 vaccine based on genotype 2b is more effective than a 2a-based vaccine to protect against PCV2b or combined PCV2a / 2b viremia in pigs with concurrent PCV2, PRRSV and PPV infection. Vaccine. 31 (3): 487-94.

Pomeranz, L. E., Reynolds, A. E. & Hengartner, C. J. (2005). Molecular biology of pseudorabies virus: impact on neurovirology and veterinary medicine. Microbiol Mol Biol Rev 69, 462-500.

Qiu HJ, Tian ZJ, Tong GZ,. et al. (2005). Protective immunity induced by a recombinant pseudorabies virus expressing the GP5 of porcine reproductive and respiratory syndrome virus in piglets. Vet Immunol Immunopathol, vol. 106, no. 3-4, 309-319.

Reed, LJ. Muench, H. A (1938). Simple method of estimating fifty percent endpoints. Am. J. Epidemiol. 27, 493-497.

Song Y, Jin M, Zhang S et al. (2007). Generation and immunogenicity of a recombinant pseudorabies virus expressing cap protein of porcine circovirus type 2. Vet Microbiol, vol. 119, no. 2-4, 97-104.

Xu G, Xu X, Li Z et al. (2004). Construction of recombinant pseudorabies virus expressing NS1 protein of Japanese encephalitis (SA14-14-2) virus and its safety and immunogenicity. Vaccine, vol. 22, no. 15-16, 1846-1853.

Yin G, Gao L, Shu X, Yang G, Guo S, Li W. (2012). Genetic diversity of the ORF5 gene of porcine reproductive and respiratory syndrome virus isolates in southwest China from 2007 to 2009. PLoS One. 7 (3): e33756

Zhang H, Li X, Peng G, Tang C, Zhu S, Qian S, Xu J, Qian P. (2014). Glycoprotein E2 classical swine fever virus expressed by baculovirus induces the protective immune responses in rabbits. Vaccine. 32 (49): 6607-13.

<110> Temasek Life Sciences Laboratory Limited <120> Multivalent Vaccines Against Major Swine Viral Diseases <130> 2577-254PCT <150> US 62 / 338,939 <151> 2016-05-19 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 6619 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid comprising swine viral disease sequences <220> <221> misc_feature <222> (1) (6) <223> HindIII restriction site <220> <221> misc_feature <222> (7). (438) <223> PRV gG sequence <220> <221> misc_feature <222> (439). (444) <223> PstI restriction site <220> <221> misc_feature <222> (445). (1034) <223> CMV ie promoter sequence <220> <221> misc_feature (1035). (1040) <223> BglI restriction site <220> <221> misc_feature &Lt; 222 > (1041) .. (1643) <223> PRRSV ORF5 sequence <220> <221> misc_feature <222> (1644). (1868) <223> BGH polyA sequence <220> <221> misc_feature <222> (1869). (3056) <223> EF1-1alpha promoter sequence <220> <221> misc_feature &Lt; 222 > (3057). (3062) <223> AgeI restriction site <220> <221> misc_feature <222> (3063). (3767) <223> PCV ORF2 sequence <220> <221> misc_feature &Lt; 222 > (3799) .. (4023) <223> BGH polyA sequence <220> <221> misc_feature &Lt; 222 > (4024) .. (4029) <223> XhoI restriction site <220> <221> misc_feature <222> (4038). (4043) <223> SalI restriction site <220> <221> misc_feature &Lt; 222 > (4044) .. (4631) <223> CMV ie promoter sequence <220> <221> misc_feature &Lt; 222 > (4729) .. (5916) <223> CSF E2 sequence <220> <221> misc_feature &Lt; 222 > (5917) .. (5924) <223> NotI restriction site <220> <221> misc_feature &Lt; 222 > (5925) .. (6192) <223> SV40 polyA sequence <220> <221> misc_feature &Lt; 222 > (6193) .. (6613) <223> PRV gG sequence <220> <221> misc_feature &Lt; 222 > (6614) .. (6619) <223> HindIII restriction site <400> 1 aagctttggg caacgtggat cctcgccctc gggctcctcg tggtccgcac cgtcgtggcc 60 agagaggccc ctcgggagct ctgctacggc caccccgtcc acgacgaccg gcggcccgtc 120 gggcccgcga ccgacgccca gcccgtgaac ccgctcgccc ccgccaacgc caccgggacg 180 gactactctc gcggctgcga gatgcgcctc ctggatccgc ctctcgacgt atcgtcccgc 240 tcctcggacc ccgtcaacgt gaccgtcgcc tggttctttg acggcggcca ctgcaaggtg 300 cccctcgtcc accgcgagta ctacggctgc cccggggacg ccatgccctc cgtcgagacg 360 tgcaccggcg ggtactcgta cacccgcacg cgcatcgaca ccctgatgga gtacgccctc 420 gtgaacgcca gcctcgtgct gcagtagtta ttaatagtaa tcaattacgg ggtcattagt 480 tcatagccca tatatggagt tccgcgttac ataacttacg gtaaatggcc cgcctggctg 540 accgcccaac gacccccgcc cattgacgtc aataatgacg tatgttccca tagtaacgcc 600 aatagggact ttccattgac gtcaatgggt ggagtattta cggtaaactg cccacttggc 660 agtacatcaa gtgtatcata tgccaagtac gccccctatt gacgtcaatg acggtaaatg 720 gcccgcctgg cattatgccc agtacatgac cttatgggac tttcctactt ggcagtacat 780 ctacgtatta gtcatcgcta ttaccatggt gatgcggttt tggcagtaca tcaatgggcg 840 tggatagcgg tttgactcac ggggatttcc aagtctccac cccattgacg tcaatgggag 900 tttgttttgg caccaaaatc aacgggactt tccaaaatgt cgtaacaact ccgccccatt 960 gacgcaaatg ggcggtaggc gtgtacggtg ggaggtctat ataagcagag ctggtttagt 1020 gaaccgtcag atccagatct atgttgggga agtgcttgac cgcgtgctgt tgctcgcgat 1080 tgcttttttt gtggtgtatc gtgccgttct atcttgctgt gctcgtcaac gccagcaaca 1140 acaacagctc tcatattcag ttgatttata acttaacgct atgtgagctg aatggcacag 1200 attggctggc acaaaaattt gactgggcag tggagacttt tgtcatcttc cccgtgttga 1260 ctcacattgt ttcctatggg gcactcacca ccagccattt ccttgacaca gttggtctgg 1320 ccactgtgtc caccgccgga tattatcacg ggcggtatgt cttgagtagc atttacgcag 1380 tctgtgctct ggctgcgctg atttgctttg tcattaggct tgcgaagaac tgcatgtcct 1440 ggcgctactc ttgtaccaga tataccaact tccttctgga cactaagggc agactctatc 1500 gttggcggtc gcccgtcatt gtggagaaag ggggtaaggt tgaggtcgaa ggtcacctga 1560 tcgacctcaa gagagttgtg cttgatggtt ccgcggcaac ccctttaacc agagtttcag 1620 cggaactatg gggtcgtctc tagctgtgcc ttctagttgc cagccatctg ttgtttgccc 1680 ctcccccgtg ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa 1740 tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct attctggggg gtggggtggg 1800 gcaggacagc aagggggagg attgggaaga caatagcagg catgctgggg atgcggtggg 1860 ctctatggcg tgaggctccg gtgcccgtca gtgggcagag cgcacatcgc ccacagtccc 1920 cgagaagttg gggggagggg tcggcaattg agccggtgcc tagagaaggt ggcgcggggt 1980 aaactgggaa agtgatgtcg tgtactggct ccgccttttt cccgagggtg ggggagaacc 2040 gtatataagt gcagtagtcg ccgtgaacgt tctttttcgc aacgggtttg ccgccagaac 2100 acaggtaagt gccgtgtgtg gttcccgcgg gcctggcctc tttacgggtt atggcccttg 2160 cgtgccttga attacttcca cgcccctggc tgcagtacgt gattcttgat cccgagcttc 2220 gggttggaag tgggtgggag agttcgaggc cttgcgctta aggagcccct tcgcctcgtg 2280 cttgagttga ggcctggctt gggcgctggg gccgccgcgt gcgaatctgg tggcaccttc 2340 gcgcctgtct cgctgctttc gataagtctc tagccattta aaatttttga tgacctgctg 2400 cgacgctttt tttctggcaa gatagtcttg taaatgcggg ccaggatctg cacactggta 2460 tttcggtttt tggggccgcg ggcggcgacg gggcccgtgc gtcccagcgc acatgttcgg 2520 cgaggcgggg cctgcgagcg cggccaccga gaatcggacg ggggtagtct caagctggcc 2580 ggcctgctct ggtgcctggc ctcgcgccgc cgtgtatcgc cccgccctgg gcggcaaggc 2640 tggcccggtc ggcaccagtt gcgtgagcgg aaagatggcc gcttcccggc cctgctgcag 2700 ggagctcaaa atggaggacg cggcgctcgg gagagcgggc gggtgagtca cccacacaaa 2760 ggaaaagggc ctttccgtcc tcagccgtcg cttcatgtga ctccacggag taccgggcgc 2820 cgtccaggca cctcgattag ttctcgagct tttggagtac gtcgtcttta ggttgggggg 2880 aggggtttta tgcgatggag tttccccaca ctgagtgggt ggagactgaa gttaggccag 2940 cttggcactt gatgtaattc tccttggaat ttgccctttt tgagtttgga tcttggttca 3000 ttctcaagcc tcagacagtg gttcaaagtt tttttcttcc atttcaggtg tcgtgaaccg 3060 gtatgacgta tccaaggagg cgtttccgca gacgaagaca ccgcccccgc agccatcttg 3120 gccagatcct ccgccgccgc ccctggctcg tccacccccg ccaccgttac cgctggagaa 3180 ggaaaaatgg catcttcaac acccgcctct cccgcacctt cggatatact gtcaagaaaa 3240 ccacagtcag aacgccctcc tgggcggtgg acatgatgag atttaatatt aacgatttcc 3300 ttcccccagg agggggctca aaccccctca ctgtgccctt tgaatactac agaataagaa 3360 aggttaaggt tgaattctgg ccctgctccc caatcaccca gggtgacagg ggagttggat 3420 ccactgctgt tattctagat gataactttg taacaaaggc cacagccctg acttatgatc 3480 cctatgtaaa ctactcctcc cgccatacca taacccagcc cttctcctac cactcccggt 3540 actttacccc caaacctgtt cttgattcca ctattgatta cttccaacca aataacaaaa 3600 ggaatcagct ttggctgagg ctacaaacca ctgcaaatgt ggaccacgta ggcctcggca 3660 ctgcgttcga aaacagtata tacgaccagg actacaatat ccgtgtaacc atgtatgtac 3720 aattcagaga atttaatctt aaagaccccc cacttcaccc taagtgaggg cccgtttaaa 3780 cccgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 3840 ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 3900 aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 3960 acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 4020 tggctcgagc ttctccagtc gacgttgaca ttgattattg actagttatt aatagtaatc 4080 aattacgggg tcattagttc atagcccata tatggagttc cgcgttacat aacttacggt 4140 aaatggcccg cctggctgac cgcccaacga cccccgccca ttgacgtcaa taatgacgta 4200 tgttcccata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 4260 gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 4320 cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag tacatgacct tatgggactt 4380 tcctacttgg cagtacatct acgtattagt catcgctatt accatggtga tgcggttttg 4440 gcagtacatc aatgggcgtg gatagcggtt tgactcacgg ggatttccaa gtctccaccc 4500 cattgacgtc aatgggagtt tgttttggca ccaaaatcaa cgggactttc caaaatgtcg 4560 taacaactcc gccccattga cgcaaatggg cggtaggcgt gtacggtggg aggtctatat 4620 aagcagagct ctctggctaa ctagagaacc cactgcttac tggcttatcg aaattaatac 4680 gactcactat agggagaccc aagctggcta gcgtttaaac ttaaacttat aaaagtatta 4740 agaggacaga tcgtgcaagg tgtggtatgg ctgttactag taactggggc acaaggccgg 4800 ctagcctgca aggaagatta caggtacgca atatcgtcaa ccgatgagat agggctactt 4860 ggggccggag gtctcaccac cacctggaag gaatacaacc acgatttgca actgaatgac 4920 gggaccgtta aggccagttg cgtggcaggt tcctttaaag tcacagcact taatgtggtc 4980 agtaggaggt atttggcatc attgcataag aaggctttac ccacttccgt gacattcgag 5040 ctcctgttcg acgggaccaa cccatcaact gagggaatgg gagatgactt caggtccggg 5100 ctgtgcccgt ttgatacgag tcctgttgtt aagggaaagt acaatacgac cttgttgaac 5160 ggtagtgctt tctatcttgt ctgcccaata gggtggacgg gtgtcataga gtgcacagca 5220 gtgagcccaa caactctgag aacagaagtg gtaaagacct tcaggagaga caagcccttt 5280 ccgcacagaa tggattgtgt gaccaccaca gtggaaaatg aagatttatt ctattgtaag 5340 ttggggggca actggacatg tgtgaaaggc gagccagtgg tctacacagg ggggctagta 5400 aaacaatgta gatggtgtgg cttcgacttc gatgggcctg acggactccc gcattacccc 5460 ataggtaagt gcattttggc aaatgagaca ggttacagaa tagtagattc aacggactgt 5520 aacagagatg gcgttgtaat cagcacagag gggagtcatg agtgcttgat cggtaacacg 5580 actgtcaagg tgcatgcatc agatgaaaga ctgggcccta tgccatgcag acctaaagag 5640 attgtctcta gtgctggacc tgtaatgaaa acctcctgta cattcaacta cacaaaaact 5700 ttgaagaaca ggtactatga gcccagggac agctacttcc agcaatatat gcttaagggt 5760 gagtatcagt actggtttga cctggatgcg actgaccgcc actcagatta cttcgcagaa 5820 tttgttgtct tggtggtggt agcactgtta ggaggaagat atgtcctgtg gctgatagtg 5880 acctacgtag ttctaacaga acaactcgcc gctggtgcgg ccgcctagct agctagaatt 5940 ctagctagct aggactctag aagactctag atcataatca gccataccac atttgtagag 6000 gttttacttg ctttaaaaaa cctcccacac ctccccctga acctgaaaca taaaatgaat 6060 gcaattgttg ttgttaactt gtttattgca gcttataatg gttacaaata aagcaatagc 6120 atcacaaatt tcacaaataa agcatttttt tcactgcatt ctagttgtgg tttgtccaaa 6180 ctcatcacta gtcccgggtt gtacgacgcc ggcctctaca tcgtcgtgct cgtctttggc 6240 gacgacgcct acctcggcac cgtctccctg tcggtggagg ccaacctgga ctacccctgc 6300 ggcatgaagc acgggctcac gatcacccgc cccggggcca ccctcccacc catcgccccc 6360 acggccggcg accaccagcg ctggcgcggg tgcttcccct cgaccgacga gggcgcctgg 6420 gagaacgtga ccgccgccga gaagggcctg tccgacgact acgccgacta ctacgacgtg 6480 cacatcttcc gctcggagtc tgacgacgag gtcgtccacg gcgatgcccc cgaggccccc 6540 gagggcgagg aggtgaccga ggaggaggcc gagctgacct ccagcgacct cgacaacatc 6600 gagatcgagg tcgaagctt 6619 <210> 2 <211> 5119 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid comprising swine viral disease sequences <220> <221> misc_feature <222> (1) (6) <223> HindIII restriction site <220> <221> misc_feature <222> (7). (438) <223> PRV gG sequence <220> <221> misc_feature <222> (439). (444) <223> PstI restriction site <220> <221> misc_feature <222> (445). (1047) <223> CMV ie promoter sequence <220> <221> misc_feature <222> (1048). (1053) <223> AgeI restriction site <220> <221> misc_feature <222> (1054). (1764) <223> PCV ORF2 sequence <220> <221> misc_feature &Lt; 222 > (1790) .. (2014) <223> BGH polyA sequence <220> <221> misc_feature (2015). (2020) <223> XhoI restriction site <220> <221> misc_feature (2029). (2034) <223> SalI restriction site <220> <221> misc_feature <222> (2035). (3222) <223> EF1-1alpha promoter sequence <220> <221> misc_feature &Lt; 222 > (3229). (4416) <223> CSF E2 sequence <220> <221> misc_feature &Lt; 222 > (4417) .. (4424) <223> NotI restriction sequence <220> <221> misc_feature &Lt; 222 > (4425) .. (4692) <223> SV40 polyA sequence <220> <221> misc_feature <222> (4693). (5113) <223> PRV gG sequence <220> <221> misc_feature (5114). (5119) <223> HindIII restriction site <400> 2 aagctttggg caacgtggat cctcgccctc gggctcctcg tggtccgcac cgtcgtggcc 60 agagaggccc ctcgggagct ctgctacggc caccccgtcc acgacgaccg gcggcccgtc 120 gggcccgcga ccgacgccca gcccgtgaac ccgctcgccc ccgccaacgc caccgggacg 180 gactactctc gcggctgcga gatgcgcctc ctggatccgc ctctcgacgt atcgtcccgc 240 tcctcggacc ccgtcaacgt gaccgtcgcc tggttctttg acggcggcca ctgcaaggtg 300 cccctcgtcc accgcgagta ctacggctgc cccggggacg ccatgccctc cgtcgagacg 360 tgcaccggcg ggtactcgta cacccgcacg cgcatcgaca ccctgatgga gtacgccctc 420 gtgaacgcca gcctcgtgct gcagtagtta ttaatagtaa tcaattacgg ggtcattagt 480 tcatagccca tatatggagt tccgcgttac ataacttacg gtaaatggcc cgcctggctg 540 accgcccaac gacccccgcc cattgacgtc aataatgacg tatgttccca tagtaacgcc 600 aatagggact ttccattgac gtcaatgggt ggagtattta cggtaaactg cccacttggc 660 agtacatcaa gtgtatcata tgccaagtac gccccctatt gacgtcaatg acggtaaatg 720 gcccgcctgg cattatgccc agtacatgac cttatgggac tttcctactt ggcagtacat 780 ctacgtatta gtcatcgcta ttaccatggt gatgcggttt tggcagtaca tcaatgggcg 840 tggatagcgg tttgactcac ggggatttcc aagtctccac cccattgacg tcaatgggag 900 tttgttttgg caccaaaatc aacgggactt tccaaaatgt cgtaacaact ccgccccatt 960 gacgcaaatg ggcggtaggc gtgtacggtg ggaggtctat ataagcagag ctggtttagt 1020 gaaccgtcag atccagatct gctagcgacc ggtatgacgt atccaaggag gcgtttccgc 1080 agacgaagac accgcccccg cagccatctt ggccagatcc tccgccgccg cccctggctc 1140 gtccaccccc gccaccgtta ccgctggaga aggaaaaatg gcatcttcaa cacccgcctc 1200 tcccgcacct tcggatatac tgtcaagaaa accacagtca gaacgccctc ctgggcggtg 1260 gacatgatga gatttaatat taacgatttc cttcccccag gagggggctc aaaccccctc 1320 actgtgccct ttgaatacta cagaataaga aaggttaagg ttgaattctg gccctgctcc 1380 ccaatcaccc agggtgacag gggagttgga tccactgctg ttattctaga tgataacttt 1440 gtaacaaagg ccacagccct gacttatgat ccctatgtaa actactcctc ccgccatacc 1500 ataacccagc ccttctccta ccactcccgg tactttaccc ccaaacctgt tcttgattcc 1560 actattgatt acttccaacc aaataacaaa aggaatcagc tttggctgag gctacaaacc 1620 actgcaaatg tggaccacgt aggcctcggc actgcgttcg aaaacagtat atacgaccag 1680 gactacaata tccgtgtaac catgtatgta caattcagag aatttaatct taaagacccc 1740 ccacttcacc ctaagtgagg gcccgtttaa acccgctgat cagcctcgac tgtgccttct 1800 agttgccagc catctgttgt ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc 1860 actcccactg tcctttccta ataaaatgag gaaattgcat cgcattgtct gagtaggtgt 1920 cattctattc tggggggtgg ggtggggcag gacagcaagg gggaggattg ggaagacaat 1980 agcaggcatg ctggggatgc ggtgggctct atggctcgag cttctccagt cgaccgtgag 2040 gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 2100 gaggggtcgg caattgagcc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 2160 atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 2220 tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 2280 tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 2340 cttccacgcc cctggctgca gtacgtgatt cttgatcccg agcttcgggt tggaagtggg 2400 tgggagagtt cgaggccttg cgcttaagga gccccttcgc ctcgtgcttg agttgaggcc 2460 tggcttgggc gctggggccg ccgcgtgcga atctggtggc accttcgcgc ctgtctcgct 2520 gctttcgata agtctctagc catttaaaat ttttgatgac ctgctgcgac gctttttttc 2580 tggcaagata gtcttgtaaa tgcgggccag gatctgcaca ctggtatttc ggtttttggg 2640 gccgcgggcg gcgacggggc ccgtgcgtcc cagcgcacat gttcggcgag gcggggcctg 2700 cgagcgcggc caccgagaat cggacggggg tagtctcaag ctggccggcc tgctctggtg 2760 cctggcctcg cgccgccgtg tatcgccccg ccctgggcgg caaggctggc ccggtcggca 2820 ccagttgcgt gagcggaaag atggccgctt cccggccctg ctgcagggag ctcaaaatgg 2880 aggacgcggc gctcgggaga gcgggcgggt gagtcaccca cacaaaggaa aagggccttt 2940 ccgtcctcag ccgtcgcttc atgtgactcc acggagtacc gggcgccgtc caggcacctc 3000 gattagttct cgagcttttg gagtacgtcg tctttaggtt ggggggaggg gttttatgcg 3060 atggagtttc cccacactga gtgggtggag actgaagtta ggccagcttg gcacttgatg 3120 taattctcct tggaatttgc cctttttgag tttggatctt ggttcattct caagcctcag 3180 acagtggttc aaagtttttt tcttccattt caggtgtcgt gaaaacttat aaaagtatta 3240 agaggacaga tcgtgcaagg tgtggtatgg ctgttactag taactggggc acaaggccgg 3300 ctagcctgca aggaagatta caggtacgca atatcgtcaa ccgatgagat agggctactt 3360 ggggccggag gtctcaccac cacctggaag gaatacaacc acgatttgca actgaatgac 3420 gggaccgtta aggccagttg cgtggcaggt tcctttaaag tcacagcact taatgtggtc 3480 agtaggaggt atttggcatc attgcataag aaggctttac ccacttccgt gacattcgag 3540 ctcctgttcg acgggaccaa cccatcaact gagggaatgg gagatgactt caggtccggg 3600 ctgtgcccgt ttgatacgag tcctgttgtt aagggaaagt acaatacgac cttgttgaac 3660 ggtagtgctt tctatcttgt ctgcccaata gggtggacgg gtgtcataga gtgcacagca 3720 gtgagcccaa caactctgag aacagaagtg gtaaagacct tcaggagaga caagcccttt 3780 ccgcacagaa tggattgtgt gaccaccaca gtggaaaatg aagatttatt ctattgtaag 3840 ttggggggca actggacatg tgtgaaaggc gagccagtgg tctacacagg ggggctagta 3900 aaacaatgta gatggtgtgg cttcgacttc gatgggcctg acggactccc gcattacccc 3960 ataggtaagt gcattttggc aaatgagaca ggttacagaa tagtagattc aacggactgt 4020 aacagagatg gcgttgtaat cagcacagag gggagtcatg agtgcttgat cggtaacacg 4080 actgtcaagg tgcatgcatc agatgaaaga ctgggcccta tgccatgcag acctaaagag 4140 attgtctcta gtgctggacc tgtaatgaaa acctcctgta cattcaacta cacaaaaact 4200 ttgaagaaca ggtactatga gcccagggac agctacttcc agcaatatat gcttaagggt 4260 gagtatcagt actggtttga cctggatgcg actgaccgcc actcagatta cttcgcagaa 4320 tttgttgtct tggtggtggt agcactgtta ggaggaagat atgtcctgtg gctgatagtg 4380 acctacgtag ttctaacaga acaactcgcc gctggtgcgg ccgcctagct agctagaatt 4440 ctagctagct aggactctag aagactctag atcataatca gccataccac atttgtagag 4500 gttttacttg ctttaaaaaa cctcccacac ctccccctga acctgaaaca taaaatgaat 4560 gcaattgttg ttgttaactt gtttattgca gcttataatg gttacaaata aagcaatagc 4620 atcacaaatt tcacaaataa agcatttttt tcactgcatt ctagttgtgg tttgtccaaa 4680 ctcatcacta gtcccgggtt gtacgacgcc ggcctctaca tcgtcgtgct cgtctttggc 4740 gacgacgcct acctcggcac cgtctccctg tcggtggagg ccaacctgga ctacccctgc 4800 ggcatgaagc acgggctcac gatcacccgc cccggggcca ccctcccacc catcgccccc 4860 acggccggcg accaccagcg ctggcgcggg tgcttcccct cgaccgacga gggcgcctgg 4920 gagaacgtga ccgccgccga gaagggcctg tccgacgact acgccgacta ctacgacgtg 4980 cacatcttcc gctcggagtc tgacgacgag gtcgtccacg gcgatgcccc cgaggccccc 5040 gagggcgagg aggtgaccga ggaggaggcc gagctgacct ccagcgacct cgacaacatc 5100 gagatcgagg tcgaagctt 5119 <210> 3 <211> 2028 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid-containing synthetic swine viral disease sequence <220> <221> misc_feature <222> (1) (6) <223> BglII restriction site <220> <221> misc_feature &Lt; 222 > (7) <223> PRRSV ORF5 sequence <220> <221> misc_feature <222> (610). (834) <223> BGH poly A sequence <220> <221> misc_feature <222> (835). (2022) <223> EF1-1alpha promoter <220> <221> misc_feature (2023). (2028) <223> AgeI restriction site <400> 3 agatctatgt tggggaagtg cttgaccgcg tgctgttgct cgcgattgct ttttttgtgg 60 tgtatcgtgc cgttctatct tgctgtgctc gtcaacgcca gcaacaacaa cagctctcat 120 attcagttga tttataactt aacgctatgt gagctgaatg gcacagattg gctggcacaa 180 aaatttgact gggcagtgga gacttttgtc atcttccccg tgttgactca cattgtttcc 240 tatggggcac tcaccaccag ccatttcctt gacacagttg gtctggccac tgtgtccacc 300 gccggatatt atcacgggcg gtatgtcttg agtagcattt acgcagtctg tgctctggct 360 gcgctgattt gctttgtcat taggcttgcg aagaactgca tgtcctggcg ctactcttgt 420 accagatata ccaacttcct tctggacact aagggcagac tctatcgttg gcggtcgccc 480 gtcattgtgg agaaaggggg taaggttgag gtcgaaggtc acctgatcga cctcaagaga 540 gttgtgcttg atggttccgc ggcaacccct ttaaccagag tttcagcgga actatggggt 600 cgtctctagc tgtgccttct agttgccagc catctgttgt ttgcccctcc cccgtgcctt 660 ccttgaccct ggaaggtgcc actcccactg tcctttccta ataaaatgag gaaattgcat 720 cgcattgtct gagtaggtgt cattctattc tggggggtgg ggtggggcag gacagcaagg 780 gggaggattg ggaagacaat agcaggcatg ctggggatgc ggtgggctct atggcgtgag 840 gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 900 gaggggtcgg caattgagcc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 960 atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 1020 tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 1080 tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 1140 cttccacgcc cctggctgca gtacgtgatt cttgatcccg agcttcgggt tggaagtggg 1200 tgggagagtt cgaggccttg cgcttaagga gccccttcgc ctcgtgcttg agttgaggcc 1260 tggcttgggc gctggggccg ccgcgtgcga atctggtggc accttcgcgc ctgtctcgct 1320 gctttcgata agtctctagc catttaaaat ttttgatgac ctgctgcgac gctttttttc 1380 tggcaagata gtcttgtaaa tgcgggccag gatctgcaca ctggtatttc ggtttttggg 1440 gccgcgggcg gcgacggggc ccgtgcgtcc cagcgcacat gttcggcgag gcggggcctg 1500 cgagcgcggc caccgagaat cggacggggg tagtctcaag ctggccggcc tgctctggtg 1560 cctggcctcg cgccgccgtg tatcgccccg ccctgggcgg caaggctggc ccggtcggca 1620 ccagttgcgt gagcggaaag atggccgctt cccggccctg ctgcagggag ctcaaaatgg 1680 aggacgcggc gctcgggaga gcgggcgggt gagtcaccca cacaaaggaa aagggccttt 1740 ccgtcctcag ccgtcgcttc atgtgactcc acggagtacc gggcgccgtc caggcacctc 1800 gattagttct cgagcttttg gagtacgtcg tctttaggtt ggggggaggg gttttatgcg 1860 atggagtttc cccacactga gtgggtggag actgaagtta ggccagcttg gcacttgatg 1920 taattctcct tggaatttgc cctttttgag tttggatctt ggttcattct caagcctcag 1980 acagtggttc aaagtttttt tcttccattt caggtgtcgt gaaccggt 2028 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide primer <220> <221> misc_feature <222> (4) <223> AgeI restriction site <400> 4 ctgaccggta tgacgtatcc aaggaggcg 29 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide primer <220> <221> misc_feature <222> (4) <223> XhoI restriction site <400> 5 cggctcgagc catagagccc accgcatc 28 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide primer <220> <221> misc_feature <222> (4) <223> SalI restriction site <400> 6 cgcgtcgacg ttgacattga ttattgac 28 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide primer <220> <221> misc_feature &Lt; 222 > (5) <223> NotI restriction site <400> 7 taaagcggcc gcaccagcgg cgagttgttc tg 32 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide primer <220> <221> misc_feature &Lt; 222 > (3) <223> SaII restriction site <400> 8 gcgtcgaccg tgaggctccg gt 22

Claims (40)

(PRV) gG gene inserted in a nucleic acid construct containing the following:
(a) a promoter having activity in a mammalian cell operably linked to a porcine circovirus (PCV2) ORF2 gene operably linked to an active terminator in a mammalian cell; and
(b) a promoter having activity in a mammalian cell operably linked to a CSF (classical swine fever) virus E2 gene operably linked to a terminator having activity in a mammalian cell. 2. The nucleic acid construct of claim 1, wherein each promoter having activity in a mammalian cell is a cytomegalovirus (CMV) intermediate early (ie) promoter or a kidney factor 1 alpha (EF1α) promoter. The nucleic acid construct according to claim 1 or 2, wherein each terminator having activity in mammalian cells is bovine growth hormone (BGH) polyadenylation sequence (polyA) or simian virus 40 (SV40) polyA. 4. The nucleic acid according to any one of claims 1 to 3, wherein the PCV2 ORF2 gene has the sequence described in nucleotides 3063 to 3767 of SEQ ID NO: 1 and the CSF E2 gene has the sequence described in nucleotide 4729 to 5916 of SEQ ID NO: CONSTRUCTION. The nucleic acid construct according to any one of claims 1 to 4, wherein the nucleic acid construct has the nucleotide sequence set forth in SEQ ID NO: 2. A vector comprising a nucleic acid construct according to any one of claims 1 to 5. A nucleic acid construct according to any one of claims 1 to 5 and a mammalian cell line transfected with a linearized PRV nucleocapsid nucleic acid. 8. The mammalian cell line of claim 7, wherein the PK-15 cell line is a mammalian cell line. The mammalian cell line according to claim 7 or 8, wherein the PRV is PRV Bartha-K61. A trivalent recombinant PRV comprising a nucleic acid construct according to any one of claims 1 to 5. 11. The recombinant PRV according to claim 10, wherein said PRV is PRV Bartha-K61. A vaccine comprising the recombinant PRV of claim 10 or claim 11 and a physiologically acceptable carrier. Use of the recombinant PRV of claim 10 or claim 11 for the manufacture of a medicament for inducing a protective immune response in a subject. Use of the recombinant PRV of claim 10 or claim 11 for the manufacture of a medicament for preventing subjects from infecting PRV, PCV and CSF. Use of the recombinant PRV of claim 10 or claim 11 to induce a protective immune response in the subject. Use of the recombinant PRV of claim 10 or claim 11 to prevent the subject from infecting PRV, PCV and CSF. A method of inducing a protective immune response in a subject comprising administering to the subject a prophylactically, therapeutically or immunologically effective amount of the recombinant PRV of claim 10 or claim 11. A method for preventing a subject to be infected with PRV, PCV2 and CSF, comprising administering to the subject a prophylactically, therapeutically or immunologically effective amount of the recombinant PRV of claim 10 or claim 11. Use of the recombinant PRV of claim 10 or claim 11 for vaccine development. The recombinant PRV of claim 10 or claim 11 for use in vaccine development. (PRV) gG gene inserted in a nucleic acid construct containing the following:
(a) a promoter having activity in a mammalian cell operably linked to a porcine reproductive-respiratory syndrome virus (PRRSV) ORF5 gene operably linked to a terminator having activity in a mammalian cell.
(b) a promoter having activity in a mammalian cell operably linked to a porcine circovirus (PCV2) ORF2 gene operably linked to a terminator having activity in a mammalian cell; And
(c) a promoter having activity in a mammalian cell operably linked to a CSF (classical swine fever) virus E2 gene operably linked to a terminator having activity in a mammalian cell. 22. The nucleic acid construct of claim 21, wherein each promoter having activity in the mammalian cell is a cytomegalovirus (CMV) intermediate early (ie) promoter or a kidney factor 1 alpha (EF1 alpha) promoter. 22. The nucleic acid construct of claim 21 or 22, wherein each terminator having activity in a mammalian cell is a bovine growth hormone (BGH) polyadenylation sequence (polyA) or a simian virus 40 (SV40) polyA. The method according to any one of claims 21 to 23, wherein the PCV2 ORF2 gene has the sequence described in nucleotides 3063 to 3767 of SEQ ID NO: 1, the CSF E2 gene has the sequence described in nucleotides 4729 to 5916, the PRRSV ORF5 has the sequence described in SEQ ID NO: 1, &lt; / RTI &gt; nucleotides &lt; RTI ID = 0.0 &gt; 1041-1643. &Lt; / RTI &gt; The nucleic acid construct according to any one of claims 21 to 24, wherein the nucleic acid construct has a nucleotide sequence as set forth in SEQ ID NO: 1. A vector comprising a nucleic acid construct according to any one of claims 21 to 25. A nucleic acid construct according to any one of claims 21 to 25 and a mammalian cell line transfected with a linearized PRV nucleocapsid nucleic acid. 29. The mammalian cell line according to claim 27, which is a PK-15 cell line. 29. The mammalian cell line according to claim 27 or 28, wherein the PRV is PRV Bartha-K61. A quadrivalent recombinant PRV comprising a nucleic acid construct according to any one of claims 21 to 25. 31. The recombinant PRV of claim 30, wherein said PRV is PRV Bartha-K61. A vaccine comprising the recombinant PRV of claim 30 or 31 and a physiologically acceptable carrier. Use of the recombinant PRV of claim 30 or claim 31 for the manufacture of a medicament for inducing a protective immune response in a subject. Use of a recombinant PRV according to claim 30 or claim 31 for the manufacture of a medicament for preventing subjects from infecting PRV, PRRSV, PCV and CSF. Use of a recombinant PRV according to claim 30 or claim 31 for inducing a protective immune response in a subject. Use of the recombinant PRV of claim 30 or claim 31 to prevent the subject from infecting PRV, PRRSV, PCV and CSF. 31. A method of inducing a protective immune response in a subject comprising administering to the subject a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV of claim 30 or 31. 29. A method for preventing a subject from infecting PRV, PRRSV, PCV2 and CSF, comprising administering to the subject a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV of claim 30 or 30. Use of the recombinant PRV of claim 30 or claim 31 for vaccine development. The recombinant PRV of claim 30 or claim 31 for use in vaccine development.

Images