TWI808940B - Multivalent vaccines against major swine viral diseases - Google Patents

Abstract

The present invention relates to the field of vaccines. More specifically, the present invention relates to a multivalent vaccine against major swine viral diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies viral vector.

Description

Multivalent Vaccine Against Major Porcine Viral Diseases

The present invention relates to the field of vaccines. More particularly, the present invention relates to multivalent vaccines against major porcine viral diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies virus vector.

The publications and other materials used herein to illuminate the background of the invention or to provide other details about the practice are incorporated by reference and are each grouped in the bibliography for convenience. Pseudorabies virus (PRV) belonging to the subfamily Alphasporiaviridae of the family Herpesviridae is the causative agent of Aujeszky's disease. PRV is prevalent in developing countries and causes significant economic losses in the swine industry. Live attenuated PRV vaccines have played a key role in the prevention and eradication of PRV (Pomeranz et al., 2005). PRV Bartha-K61 is an attenuated PRV vaccine strain in which part of the gE and gl genes have been deleted (Klupp et al., 2012; Dong et al., 2014). Moreover, several previous reports have demonstrated that live attenuated PRV Bartha-K61 is an excellent vaccine vector expressing heterologous antigen genes (Nie et al., 2011; Li et al., 2008; Song et al., 2007; Xu et al., 2004; Jiang et al. et al., 2007). Therefore, live attenuated PRV Bartha-K61 vaccine strain was used as a carrier to express multiple antigenic genes of major porcine viral diseases. Porcine circoviruses (PCVs), members of the Circoviridae family, are single-stranded circular DNA genomes. PCV2 is the main cause of post-lactation multisystemic wasting syndrome (PMWS) in infected pigs. The infection is characterized by diarrhea, decreased weight gain, sudden death, enlarged lymph nodes, respiratory distress, and multinucleated giant cell formation (Liu et al., 2005). ORF2 is one of the main open reading frames in the PCV2 gene. It encodes the capsid protein (Cap), an immunodominant viral protein that can be used as an ideal target for vaccine development in pigs. Classical swine fever (CSF) virus is a highly contagious and economically important viral disease that attacks domestic and wild pigs. CSF virus (CSFV) is a positive-sense single-stranded RNA virus and a member of the genus Pestivirus within the family Flaviviridae. Envelope glycoprotein E2 contains 4 antigenic domains and it induces protective immunity against CSFV in porcine populations. Therefore, the E2 glycoprotein is a potential candidate for CSFV vaccine design (Zhang et al., 2014). Commercially available whole inactivated vaccines based on C-strains are effective and provide complete protection against the 3 CSFV groups, but fail to provide discrimination between infected and vaccinated animals (Zhang et al., 2014). Porcine reproductive and respiratory syndrome virus (PRRSV) is classified in the family Arteriviridae of the order Nidovirales. It is an enveloped positive-sense RNA virus that causes porcine reproductive and respiratory syndrome (PRRS). Infection with PRRSV can cause late abortion in sows, mass reproductive failure and respiratory failure in piglets. The PRRSV genome consists of 9 open reading frames encoding 7 structural proteins and 14 non-structural proteins. Among them, glycoprotein (GP) 5 is the major envelope protein encoded by ORF5. It is one of the key immunogenic proteins of PRRSV, which is crucial for virus assembly, infectivity and induction of neutralizing antibodies. ORF5 is one of the most variable regions of the PRRSV genome and has been widely used to study the molecular epidemiology of PRRSV. GP5 is also a leading target in the development of vaccines against PRRSV infection (Li et al., 2012). Currently available vaccines and vaccination schedules are complex and difficult to immunize against all four diseases individually, resulting in multiple injections and multiple boosters. Therefore, developing a multivalent vaccine against the four diseases would be time-consuming and cost-effective, and would also result in a more effective vaccine.

The present invention relates to the field of vaccines. More particularly, the present invention relates to multivalent vaccines against major porcine viral diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies virus vector. The present invention describes the use of defined live attenuated pseudorabies (PRV) vaccine strains (eg, Bartha-K61 strain) as vaccine vectors to express multiple immunogens from major porcine viral diseases of PCV2, CSF and PRRSV. The PRV gene body is approximately 140 kb and consists of the following: unique long (UL) region, unique short (US) region, large inverted repeat, internal repeat (IR) and terminal repeat (TR). One half of the gene body is considered non-essential, such as protein kinase (PK), thymidine kinase (TK), gE, gG, and gl, thereby allowing modification or insertion of foreign genes without affecting viral replication. Moreover, its well-documented safety and protective efficacy profile of the PRV Bartha-K61 vaccine strain has been successfully used for decades to control Ojeski's disease. According to the present invention, a quadrivalent PRV vaccine against PRRSV, PCV2, CSF and PRV and a trivalent PRV vaccine against PCV2, CSF and PRV have been generated. Thus, in one aspect, the invention provides a quadrivalent PRV vaccine against PRRSV, PCV2, CSF and PRV. According to this aspect, a nucleic acid construct comprising the gene of PRRSV, the gene of PCV2 and the gene of CSF was prepared. In some embodiments, the PRRSV gene is the PRRSV ORF5 gene. In some embodiments, the PRRSV ORF5 gene line is derived from a highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1 ). In some embodiments, the PCV2 gene is the PCV2 ORF2 gene. In some embodiments, the PCV2 gene line is derived from PCV2 Indonesian strain (genotype 2B) (PCV2 TLL-Indo, GenBank Accession No. KX130941). In some embodiments, the CFS gene is the CFS E2 gene. In some embodiments, the CFS E2 gene is derived from the emerging genotype 2.1 of the CSF Indonesian strain (CSF TLL-Indo, GenBank Accession No. KX130940). In some embodiments, each gene is operably linked to a promoter active in mammalian cells. According to the present invention, any suitable promoter active in mammalian cells may be used. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter is a CMV immediate early (CMV ie) promoter. In some embodiments, the promoter is the elongation factor 1 alpha (EF1 alpha) promoter. In some embodiments, each gene is operably linked to a terminator sequence operable in mammalian cells. According to the present invention, any suitable terminator active in mammalian cells may be used. In some embodiments, the terminator sequence is a bovine growth hormone polyadenylation (BGH polyA) sequence. In some embodiments, the terminator sequence is an SV40 viral polyadenylation (SV40 polyA) sequence. In some embodiments provided are nucleic acid constructs comprising the PRRSV genes, PCV2 genes and CSF genes described herein. In some embodiments, the nucleic acid construct further comprises a promoter and/or terminator as described herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, PRV strains are provided, wherein the PRV strains are modified to contain the nucleic acid constructs described herein. In some embodiments, the modified PRV is a modified PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct in the modified PRV strain is stable and has no mutation or deletion after five passages in porcine kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell line is ATCC® CCL-33™ cells obtained from the American Type Culture Collection. In some embodiments are provided cell lines transfected with the nucleic acid constructs described herein in a manner suitable for the production of viruses useful in quadrivalent vaccines. In some embodiments, a nucleic acid construct described herein is inserted into a PRV strain described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is a PK-15 cell as described herein. In another aspect, the present invention provides a trivalent PRV vaccine against PCV2, CSF and PRV. According to this aspect, a nucleic acid construct comprising the gene of PCV2 and the gene of CSF was prepared. In some embodiments, the PCV2 gene and CSF gene are as described herein. In some embodiments, each gene is operably linked to a promoter active in mammalian cells. In some embodiments, the promoter is as described herein. In some embodiments, each gene is operably linked to a terminator sequence operable in mammalian cells. In some embodiments, terminator sequences are as set forth herein. In some embodiments are provided nucleic acid constructs comprising the PCV2 gene and the CSF gene described herein. In some embodiments, the nucleic acid construct further comprises a promoter and/or terminator as described herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO:2. In some embodiments, PRV strains are provided, wherein the PRV strains are modified to contain the nucleic acid constructs described herein. In some embodiments, the modified PRV strain is as described herein. In some embodiments, the nucleic acid construct in the modified PRV strain is stable and has no mutation or deletion after five passages in porcine kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell line is as described herein. In some embodiments are provided cell lines transfected with the nucleic acid constructs described herein in a manner suitable for the production of virus useful in trivalent vaccines. In some embodiments, a nucleic acid construct described herein is inserted into a PRV strain described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is a PK-15 cell as described herein. The invention also provides kits for immunizing an individual with a recombinant PRV described herein. The kit comprises the recombinant PRV described herein, a pharmaceutically acceptable carrier, an applicator, and instructional materials for its use. The invention also provides methods of use. In one embodiment, the invention provides a method of eliciting a protective immune response in an individual (eg, a pig) comprising administering to the individual a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV described herein. In another embodiment, the present invention provides a method of preventing a subject from suffering from PRV, PRRSV, PCV2 and CSF, or PRV, PCV2 and CSF, comprising administering to the subject a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV as described herein .

The present invention relates to the field of vaccines. More particularly, the present invention relates to multivalent vaccines against major porcine viral diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies virus vector. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The term "expression" in reference to a gene sequence refers to the transcription of a gene and, if necessary, the translation of the resulting mRNA transcript into protein. Thus, as will be apparent from the context, expression of a protein coding sequence results from the transcription and translation of the coding sequence. As used herein, "gene" refers to a nucleic acid sequence encompassing the coding region of a gene product. "Introducing" in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell means "transfecting" or "transformation" or "transduction" and includes reference to incorporating the nucleic acid fragment into yeast or fungi In cells, nucleic acid fragments thereof can be incorporated into the cell's genome (eg, chromosomal, plastid, or mitochondrial DNA), converted into autonomous replicons, or expressed transiently (eg, by transfection of mRNA). As used herein, "operably linked (Operable linkage or operably linked or operatively linked)" should be understood to mean, for example, that each regulatory element can perform its function in the recombinant expression of the nucleic acid. and the nucleic acid to be expressed and, if necessary, other regulatory elements (eg, terminators) to produce the desired product. This does not necessarily require a direct linkage in the chemical sense. Genetic control sequences (such as enhancer sequences) can also exert their effect on target sequences from somewhat distant locations or indeed from other DNA molecules (positioned in cis or trans). Preferred arrangements are those in which the nucleic acid sequence to be expressed recombinantly is located downstream of the sequence used as a promoter, such that the two sequences are covalently bonded to each other. Regulatory or control sequences can be located on the 5' side of the nucleotide sequence or on the 3' side of the nucleotide sequence, as is well known in the art. The terms "polynucleotide", "nucleic acid" and "nucleic acid molecule" are used interchangeably herein and refer to a polymer of nucleotides, which may be nucleotides and/or nucleosides (including deoxyribonucleic acid , ribonucleic acid and its derivatives) natural or synthetic linear and sequential arrays,. These include chromosomal DNA, self-replicating plastids, infectious polymers of DNA or RNA, and DNA or RNA that fulfill major structural functions. Unless otherwise indicated, nucleic acids or polynucleotides are written left to right in 5' to 3' orientation. Nucleotides are referred to by their commonly accepted single-letter codes. Numerical ranges include numbers defining the range. The terms "polypeptide", "peptide" and "protein" are used interchangeably herein and refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are man-made chemical analogs of the corresponding natural amino acid, as well as to natural amino acid polymers. Amino acids may be referred to by their well known three-letter or one-letter symbols. Amino acid sequences are written left to right in amine to carboxyl orientation, respectively. Numerical ranges include numbers defining the range. "Promoter" refers to a nucleic acid segment capable of controlling the transcription of another nucleic acid segment. A "promoter active in mammalian cells" is a promoter capable of controlling transcription in mammalian cells, whether or not derived from mammalian cells. "Recombinant" refers to the artificial combination of two otherwise separate sequence segments obtained, for example, by chemical synthesis or by manipulation of separate nucleic acid segments by genetic engineering techniques. "Recombinant" also includes reference to a cell or vector that has been modified by the introduction of heterologous nucleic acid, or a cell derived from a cell so modified, but does not cover cells that have been modified by natural events (e.g., spontaneous mutation, natural transformation/transformation). translocation) altered cells or vectors, such as those that arise without deliberate human intervention. "Recombinant DNA construct" refers to a combination of nucleic acid segments not normally found together in nature. Thus, recombinant DNA constructs may contain regulatory and coding sequences of different origin, or regulatory and coding sequences of the same origin but arranged in a manner different from that normally found in nature. The terms "recombinant DNA construct" and "recombinant construct" are used interchangeably herein. In some of the embodiments described herein, recombinant DNA constructs can also be considered "overexpressing DNA constructs." The term "nucleic acid construct" is also used interchangeably with "recombinant DNA construct". "Regulatory sequence" means a nucleoside located upstream (5' non-coding sequence), within a coding sequence or downstream (3' non-coding sequence) of a coding sequence and affects the transcription, RNA processing or stability or translation of the associated coding sequence acid sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein. Sequence alignments and percent identity calculations can be determined using a number of comparison methods designed to detect homologous sequences including, but not limited to, the LASERGENE® bioinformatics computing suite (DNASTAR ® Inc., Madison, WI), the Megalign® program. Unless otherwise stated, multiple alignments of sequences presented herein were made using the Clustal V alignment method (Higgins and Sharp (1989) CABIOS. 5:151-153) with default parameters (gap penalty = 10, gap length penalty =10) to implement. The default parameters for pairwise alignment and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1, Gap Penalty=3, Window=5 and Retained Diagonal=5. For nucleic acids, the parameters are KTUPLE=2, Gap Penalty=5, Window=4, and Diagonals Retained=4. After aligning the sequences, using the Clustal V program, the "Percent Identity" and "Divergence" values can be obtained by viewing the "Sequence Distance" table on the same program; Percent sex and divergence were calculated in this way. Alternatively, the Clustal W alignment method can be used. The Clustal W alignment method (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, DG et al., Comput. Appl. Biosci. 8:189-191 (1992)) can be found in LASERGENE® Bios MegAlign™ v6.1 program of Informatics Computing Software Group (DNASTAR® Inc., Madison, Wis.). The default parameters for multiple alignments correspond to Gap Penalty=10, Gap Length Penalty=0.2, Delayed Divergence Sequence=30%, DNA Transformation Weight=0.5, Protein Weighting Matrix=Gonnet Series, DNA Weighting Matrix=IUB. For pairwise alignments, the default parameters are alignment=slow-accurate, gap penalty=10.0, gap length=0.10, protein weighting matrix=Gonnet 250, and DNA weighting matrix=IUB. After aligning sequences using the Clustal W program, the values for "Percent Identity" and "Divergence" can be obtained by viewing the "Sequence Distance" table in the same program. The term "under stringent conditions" means that two sequences hybridize under conditions of moderate or high stringency. More particularly, conditions of moderate stringency can be readily determined by one skilled in the art, for example, based on the length of the DNA. Basic conditions are set forth by Sambrook et al., Molecular Cloning: A Laboratory Manual , 3rd Edition, Chapters 6 and 7, Cold Spring Harbor Laboratory Press, 2001, and include the use of a prewash for nitrocellulose filters Solution (5×SSC, 0.5% SDS, 1.0 mM EDTA (pH 8,0)), about 50% formamide, 2×SSC to 6×SSC, hybridization conditions at about 40°C-50°C (or other Similar hybridization solutions, such as Stark's solution in about 50% formamide at about 42°C) and wash conditions of, for example, about 40°C-60°C, 0.5xSSC-6xSSC, 0.1% SDS. Preferably, moderately stringent conditions include hybridization (and washing) at about 50° C. and 6×SSC. Highly stringent conditions can also be readily determined by one skilled in the art, eg, based on the length of the DNA. Typically, such conditions include hybridization and/or washing at higher temperatures and/or lower salt concentrations than moderately stringent conditions (e.g., hybridization at about 65°C, 6×SSC to 0.2×SSC, relatively best 6×SSC, better 2×SSC, best 0.2×SSC). For example, highly stringent conditions may include hybridization as defined above and washing at about 65°C-68°C, 0.2 x SSC, 0.1% SDS. In the hybridization and washing buffer, SSPE (1×SSPE is 0.15 M NaCl, 10 mM NaH ₂ PO ₄ and 1.25 mM EDTA, pH 7.4) can be used instead of SSC (1×SSC is 0.15 M NaCl and 15 mM sodium citrate) ; A 15-minute wash was performed after completion of hybridization. Commercially available hybridization kits using non-radioactive substances as probes can also be used. Specific examples include hybridization using the ECL Direct Labeling and Detection System (Amersham). Stringent conditions include, for example, hybridization at 42°C for 4 hours using hybridization buffer included in the kit supplemented with 5% (w/v) blocking reagent and 0.5 M NaCl, and at 55°C in 0.4% Two washes in SDS, 0.5X SSC for 20 minutes and one wash in 2X SSC for 5 minutes at room temperature. The terms "substantially homologous" or "substantial homology" as used herein with respect to nucleic acid sequences include nucleotide sequences that hybridize under stringent conditions to the referenced SEQ ID NO: or a portion or complement thereof, which is Those that allow an antiparallel alignment to occur between the two sequences, and the two sequences are then able to form hydrogen bonds with the corresponding bases on opposite strands under stringent conditions, to form hydrogen bonds at the appropriate stringency (including A double-stranded molecule sufficiently stable under conditions of high stringency to be detected using methods well known in the art. A substantially homologous sequence may have about 70% to about 80% sequence identity, or more preferably about 80% to about 85% sequence identity, to a reference nucleotide sequence as set forth in the Sequence Listing or its complement, or Optimally about 90% to about 95% sequence identity, up to about 99% sequence identity. Alternatively, substantially homologous sequences include those that hybridize under stringent conditions to target regions of plant gene introns. For stringent conditions, see the specification herein and see also US Patent Nos. 8,455,716 and 8,536,403. "PRRSV ORF5 gene" or "ORF5 gene" refers to the ORF5 gene derived from a highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1). In some embodiments, the ORF5 gene has the sequence set forth in nucleotides 1041-1643 of SEQ ID NO:1. In other embodiments, the ORF5 gene has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. "PCV ORF2 gene" or "ORF2 gene" refers to the ORF2 gene derived from PCV2 Indonesian strain (genotype 2B) (PCV2 TLL-Indo, GenBank Accession No. KX130941). In some embodiments, the ORF2 gene has the sequence set forth in nucleotides 3063-3767 of SEQ ID NO:1. In other embodiments, the ORF2 gene has at least 85%, 86%, 87%, 88%, 89% when compared to nucleotides 3063-3767 of SEQ ID NO: 1 based on the Clustal V or Clustal W alignment method. %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. "CSF E2 gene" or "E2 gene" refers to the E2 gene derived from the emerging subgenotype 2.1 of the CSF Indonesian strain (CSF TLL-Indo, GenBank accession number KX130940). In some embodiments, the E2 gene has the sequence set forth in nucleotides 4729-5916 of SEQ ID NO:1. In other embodiments, the E2 gene has at least 85%, 86%, 87%, 88%, 89% when compared to nucleotides 4729-5916 of SEQ ID NO: 1 based on the Clustal V or Clustal W alignment method. %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In one aspect, the invention provides a quadrivalent PRV vaccine against PRRSV, PCV2, CSF and PRV. According to this aspect, a nucleic acid construct comprising the gene of PRRSV, the gene of PCV2 and the gene of CSF was prepared. In some embodiments, the PRRSV gene is the PRRSV ORF5 gene. In some embodiments, the PRRSV ORF5 gene line is derived from a highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1 ). In some embodiments, the ORF5 gene has the nucleotide sequence set forth herein. In some embodiments, the PCV2 gene is the PCV2 ORF2 gene. In some embodiments, the PCV2 gene line is derived from an Indonesian strain of PCV2 (genotype 2B). In some embodiments, the ORF2 gene has the nucleotide sequence set forth herein. In some embodiments, the CFS gene is the CFS E2 gene. In some embodiments, the CFS E2 gene is derived from emerging subgenotype 2.1 of the CSF Indonesian strain. In some embodiments, the E2 gene has the nucleotide sequence set forth herein. In some embodiments, each gene is operably linked to a promoter active in mammalian cells. According to the present invention, any suitable promoter active in mammalian cells may be used. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter is a CMV immediate early (CMV ie) promoter. In some embodiments, the CMV ie promoter has the sequence set forth in nucleotides 445-1034 of SEQ ID NO:1. In some embodiments, based on the Clustal V or Clustal W alignment method, the CMV promoter has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the promoter is the elongation factor 1 alpha (EF1 alpha) promoter. In some embodiments, the EF1α promoter has the sequence set forth in nucleotides 1869-3056 of SEQ ID NO:1. In some embodiments, based on the Clustal V or Clustal W alignment method, the EF1α promoter has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity. In some embodiments, each gene is operably linked to a terminator sequence operable in mammalian cells. According to the present invention, any suitable terminator active in mammalian cells may be used. In some embodiments, the terminator sequence is a bovine growth hormone polyadenylation (BGH polyA) sequence. In some embodiments, the BGH polyA sequence has the sequence set forth in nucleotides 1644-1868 of SEQ ID NO:1. In some embodiments, the BGH polyA sequence has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the terminator sequence is an SV40 viral polyadenylation (SV40 polyA) sequence. In some embodiments, the SV40 polyA sequence has the sequence set forth in nucleotides 5925-6192 of SEQ ID NO:1. In some embodiments, the SV40 polyA sequence has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments provided are nucleic acid constructs comprising the PRRSV genes, PCV2 genes and CSF genes described herein. In some embodiments, the nucleic acid construct further comprises a promoter and/or terminator as described herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, PRV strains are provided, wherein the PRV strains are modified to contain the nucleic acid constructs described herein. In some embodiments, the modified PRV is a modified PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct in the modified PRV strain is stable and has no mutation or deletion after five passages in porcine kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell line is ATCC® CCL-33™ cells obtained from the American Type Culture Collection. In some embodiments are provided cell lines transfected with the nucleic acid constructs described herein in a manner suitable for the production of viruses useful in quadrivalent vaccines. In some embodiments, a nucleic acid construct described herein is inserted into a PRV strain described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is a PK-15 cell as described herein. In another aspect, the present invention provides a trivalent PRV vaccine against PCV2, CSF and PRV. According to this aspect, a nucleic acid construct comprising the gene of PCV2 and the gene of CSF was prepared. In some embodiments, the PCV2 gene and CSF gene are as described herein. In some embodiments, each gene is operably linked to a promoter active in mammalian cells. In some embodiments, the promoter is as described herein. In some embodiments, each gene is operably linked to a terminator sequence operable in mammalian cells. In some embodiments, terminator sequences are as set forth herein. In some embodiments are provided nucleic acid constructs comprising the PCV2 gene and the CSF gene described herein. In some embodiments, the nucleic acid construct further comprises a promoter and/or terminator as described herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises the nucleotide sequence set forth in SEQ ID NO:2. In some embodiments, PRV strains are provided, wherein the PRV strains are modified to contain the nucleic acid constructs described herein. In some embodiments, the modified PRV strain is as described herein. In some embodiments, the nucleic acid construct in the modified PRV strain is stable and has no mutation or deletion after five passages in porcine kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell line is as described herein. In some embodiments are provided cell lines transfected with the nucleic acid constructs described herein in a manner suitable for the production of virus useful in trivalent vaccines. In some embodiments, a nucleic acid construct described herein is inserted into a PRV strain described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is a PK-15 cell as described herein. In preparing nucleic acid constructs, the multiple DNA segments can be manipulated to provide the DNA sequence in the proper orientation and, if desired, in the proper reading frame. To this end, adapters or linkers may be used to join the DNA fragments, or other manipulations may be involved to provide convenient restriction sites, remove excess DNA, remove restriction sites, or the like. In vitro mutagenesis, primer repair, restriction, annealing, de novo substitutions (eg, transitions and transversions) may be involved for this purpose. The nucleic acids of the invention can also be synthesized in whole or in part by methods known in the art, especially when it is desired to provide plant-preferred sequences. Thus, all or a portion of the nucleic acids of the invention can be synthesized using codons preferred by the host of choice. Species-preferred codons can be determined, for example, based on the most commonly used codons in proteins expressed in a particular host species. Other modifications of the nucleotide sequence can produce mutants with slightly altered activities. Tetravalent recombinant PRV or trivalent recombinant TRV are prepared by transfecting an appropriate cell line, such as the PK-15 cell line described herein. In some embodiments, cell lines are transfected with the nucleic acid constructs described herein and PRV nucleocapsid DNA. In some embodiments, the PRV nucleocapsid DNA is modified to contain a nucleic acid construct expressing red fluorescent protein (RFP). The tetravalent recombinant PRV or the trivalent recombinant TRV was passaged in PK-15 cells for several generations to ensure that there was no mutation or deletion in the viral nucleic acid of the stable recombinant virus. In some embodiments, 5 passages are sufficient to generate stable recombinant virus. After production, recombinant TRV viruses can be replicated in appropriate cell lines. In some embodiments, the cell line is a PK-15 cell line (cell) as described herein. In some embodiments, the cell line (cell) is a baby hamster kidney 21 (BHK21) cell line. In some embodiments, the BHK21 cell line is BHK21 (clonal line 13). In some embodiments, the BHK21 (clone 13) cell line is ATCC® CCL-10 ^™ and is commercially available from the American Type Culture Collection. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and Pseudorabies Virus (PRV) are the main causes of porcine infectious reproductive disorders and cause significant losses to the swine industry worldwide. In addition, PCV2 and classical swine fever cause devastating diseases and have serious impacts on animal welfare and economies in many Asian countries. Developing a multivalent vaccine approach could potentially reduce vaccine administration to a single dose schedule covering all four viruses, which would greatly help protect pigs from the current status of these four diseases. Live attenuated PRV Bartha-K61 was selected as the carrier for multivalent vaccine development. The genome structure and genetic background of the PRV Bartha-K61 strain are relatively fully defined, and the amplification and stable expression of the reported exogenous gene will not affect the stability of the virus itself (Boldogkoi, Nogradi, 2003). As described herein, tetravalent PRV expressing PCV2-ORF2, CSF-E2, and PRRSV-ORF5 and trivalent PRV expressing PCV2-ORF2 and CSF-E2 were generated by homologous recombination into the PRV Bartha K-61 vaccine strain. generated in the gG locus. Replication assays and stability tests revealed that recombinant PRVs (trivalent or tetravalent PRVs) stabilized and replicated as efficiently as PRV Bartha K-61 in vitro, demonstrating that insertion of foreign genes in the PK and gG loci of PRVs does not Will affect the replication of PRV. In addition, immunogenicity studies in mice showed that tetravalent PRV induced a large number of serum-specific humoral antibodies against PCV2-ORF2, CSF-E2, and PRRSV-ORF5 antigens, and similarly, trivalent PRV induced anti-PCV2-ORF2 and Serum-specific humoral antibody to CSF-E2. These results suggest that expressing in PRV Bartha K-61 a polyvalent immune gene line from a major porcine virus is a novel way to develop a multivalent vaccine against PCV2, CSF or PRRSV, including pseudorabies. The inventive recombinant pseudorabies virus vector comprising ORF2 of PCV2, E2 of CSF and ORF5 of PRRSV can efficiently induce antibodies against all four diseases, which allows cost-effective mass production in a single preparation. According to the present invention it was found that both trivalent and tetravalent recombinant vaccines were stable after 5 serial passages in the PK15/BHK21 cell line. Insertion of two or three genes in a single insertion site was extremely stable and showed neither genetic instability nor transcriptional modification of the inserted genes. According to the present invention it was found that insertion of multiple genes in a single insertion site of the gG locus of PRV-Bartha does not affect virus titer. The invention also provides methods of use. In one embodiment, the invention provides a method of eliciting a protective immune response in an individual (eg, a pig) comprising administering to the individual a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV described herein. In another embodiment, the present invention provides a method of preventing a subject from suffering from PRV, PRRSV, PCV2 and CSF, or PRV, PCV2 and CSF, comprising administering to the subject a prophylactically, therapeutically or immunologically effective amount of a recombinant PRV as described herein . As used herein, "administration" means delivery using any of a variety of methods and delivery systems known to those skilled in the art. Administration can be carried out, for example, by intraperitoneal, intracerebral, intravenous, oral, transmucosal, subcutaneous, transdermal, intradermal, intramuscular, topical, parenteral, via implantation, intrathecal, intralymphatic, Intralesional, pericardial, or epidural. The agent or composition can also be administered in aerosol form, eg, for pulmonary and/or intranasal delivery. Administration can be performed, for example, once, multiple times, and/or over one or more extended periods of time. Eliciting a protective immune response in an individual can be achieved, for example, by administering to the individual a single dose of the vaccine, followed by one or more subsequent administrations of the vaccine after a suitable period of time. A suitable period of time between administrations of the vaccines can be readily determined by one skilled in the art, and will generally be on the order of several weeks to several months. However, the invention is not limited to any particular method, route or frequency of administration. A "prophylactically effective dose" or "immunologically effective dose" is any vaccine that, when administered to an individual predisposed to infection with a virus or a disease associated with a virus, induces in the individual an immune response that protects the individual from contracting the virus or suffering from a disease. quantity. "Protecting" an individual means reducing the likelihood of the individual being infected with the virus or reducing the likelihood of the onset of symptoms in the individual by at least 2-fold, preferably at least 10-fold. For example, if an individual has a 1% chance of being infected with the virus, a 2-fold reduction in the likelihood of the individual being infected with the virus would give the individual a 0.5% chance of being infected with the virus. Optimally, a "prophylactically effective dose" induces an immune response in an individual that completely prevents the individual from contracting the virus or completely prevents the onset of the individual's condition. Certain embodiments of any of the present methods of immunization and treatment can further comprise administering to the individual at least one adjuvant. "Adjuvant" shall mean any agent suitable for enhancing the immunogenicity of an antigen and enhancing the immune response of a subject. The numerous adjuvants, including particulate adjuvants, suitable for use with both protein-based and nucleic acid-based vaccines, and methods of combining adjuvants and antigens, are well known to those skilled in the art. Adjuvants suitable for use with protein immunization include, but are not limited to, alum, Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), alum adjuvant, saponin-based adjuvant agents (eg, Quil A and QS-21) and the like. It should be understood that when the virus strains described herein are used to elicit a protective immune response in an individual or to prevent an individual from suffering from a virus-related disease, it is in a composition additionally comprising one or more physiologically or pharmaceutically acceptable carriers The form is invested in the individual. Pharmaceutically acceptable carriers are well known to those skilled in the art and include, but are not limited to, 0.01 M - 0.1 M and preferably 0.05 M phosphate buffered saline, phosphate buffered saline (PBS) or 0.9% saline. one or more. Such carriers also include aqueous or non-aqueous solutions, suspensions and emulsions. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, saline and buffered media. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (eg, olive oil), and injectable organic esters (eg, ethyl oleate). Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (eg, those based on Ringer's dextrose), and the like. Solid compositions may comprise non-toxic solid carriers such as glucose, sucrose, mannitol, sorbitol, lactose, starch, magnesium stearate, cellulose or cellulose derivatives, sodium carbonate and magnesium carbonate. For administration in aerosol form, e.g., for pulmonary and/or intranasal delivery, the agent or composition is preferably combined with a non-toxic surfactant (e.g., esters or partial esters of C6 to C22 fatty acids or natural glycerides and propellant) together. Additional carriers such as lecithin may be included to facilitate intranasal delivery. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives and other additives such as antimicrobials, antioxidants and chelating agents which increase the shelf life of the active ingredients and/or effectiveness. The compositions of the invention can be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to a subject, as is well known in the art. The invention also provides kits for immunizing an individual with a recombinant PRV described herein. The kit comprises the recombinant PRV described herein, a pharmaceutically acceptable carrier, an applicator and instructional materials for its use. The invention includes other embodiments of the kit known to those skilled in the art. The instructions can provide any information that can be used to direct the administration of the stable cold-adapted temperature-sensitive virus strains described herein, or inactivated forms thereof. The present invention provides vaccine technology related to the strains described herein. In one embodiment, the virus strains described herein are used in a method of making a vaccine. In another embodiment, the nucleic acid constructs described herein are used in a method of making a vaccine. In another embodiment, the virus strains described herein are used in vaccine development. In another embodiment, the nucleic acid constructs described herein are used in vaccine development. The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture, and transgenic biology, which are known to those skilled in the art . See, for example, Maniatis et al., 1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook et al., 1989, Molecular Cloning , 2nd Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York ); Sambrook and Russell, 2001, Molecular Cloning , 3rd edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et al., 1992, Current Protocols in Molecular Biology (John Wiley & Sons, includes regular updates) ; Glover, 1985, DNA Cloning (IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); Anand, Techniques for the Analysis of Complex Genomes , (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988, Antibodies , (Cold Spring Harbor Laboratory Press, Cold Spring Harbor , New York); Nucleic Acid Hybridization (edited by BD Hames and SJ Higgins, 1984); Transcription And Translation (edited by BD Hames and SJ Higgins, 1984); Culture Of Animal Cells (RI Freshney, Alan R. Liss, Inc., 1987 ); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); Paper Methods In Enzymology (Academic Press, Inc., NY); Methods In Enzymology , Volumes 154 and 155 (Edited by Wu et al.), Immunochemical Methods In Cell And Molecular Biology (Edited by Mayer and Walker, Academic Press, London, 1987); Handbook Of Experimental Immunology , Volumes I-IV (Edited by DM Weir and CC Blackwell, 1986); Riott , Essential Immunology , 6th edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al., RNA Interference Technology: From Basic Science to Drug Development , Cambridge University Press, Cambridge, 2005; Schepers, RNA Interference in Practice , Wiley-VCH, 2005; Engelke, RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology , DNA Press, 2003; Gott, RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology) , Human Press, Totowa, NJ, 2004; Sohail, Gene Silencing by RNA Interference: Technology and Application , CRC, 2004. EXAMPLES The present invention is illustrated by reference to the following examples, which are provided by way of illustration and are not intended to limit the invention in any way. Use standard techniques well known in the art or those detailed below. Example 1 Method Selection of immunogen : The ORF2 gene from PCV2 Indonesian strain (genotype 2B) (PCV2 TLL-Indo, GenBank Accession No. KX130941) was selected based on phylogenetic analysis using circulating strains. In addition, PCV2 genotype 2B is a highly dominant genotype in pig populations (Opriessnig et al., 2013). The E2 gene was selected from the emerging subgenotype 2.1 of the CSF Indonesian strain (CSF TLL-Indo, GenBank Accession No. KX130940). The ORF5 gene was selected from a Chinese strain of HP-PRRSV (highly pathogenic PRRSV-JXA1), which is highly similar to currently circulating PRRSV strains (Yin et al., 2012; Jantafong et al., 2015). Construction of recombinant transfer plastids and synthetic genes : amplify ORF2 gene from PCV2 strain and E2 from CSF strain and individually select and colonize the XhoI/ApaI and HindIII/BamHI restriction sites of the intermediate pcDNA3.1+ vector (Invitrogen) hit. A synthetic gene (ORF5-BGH-EF1α) (Genscript, USA) comprising the combination of ORF5 of the PRRSV strain, the bovine growth hormone (BGH) sequence and the elongation factor 1α promoter (EF1α) sequence was synthesized. One such synthetic gene has the sequence shown in SEQ ID NO:3. BglII and AgeI restriction sites were included. For the construction of a quadrivalent rPRV vaccine, the ORP5-BGH-EF1 fragment was cloned into the BglII/AgeI restriction of the transfer plasmid pUC-gG-MCS (Figure 1) (kindly provided by Prof. Enquist, Princeton University, USA) site. pUC-gG-MCS is a pUC57 plasmid inserted with a synthetic construct consisting of the gG locus of PRV Bartha. Use primers AgeI-ORF2 F: 5'-CTG ACCGGT ATGACGTATCCAAGGAGGCG-3' (SEQ ID NO: 4; the underlined place is the AgeI site) and ORF2-R-XhoI: 5'-CGG CTCGAG CCATAGAGCCCACCGCATC-3' (SEQ ID NO:5; the XhoI site is underlined) amplifies the ORF2-BGH fragment from pcDNA3.1+ and colonizes it into the AgeI/XhoI restriction site of the transfer plasmid pUC-gG-MCS (Figure 1) . Similarly, primers SalI-CMV+E2-F: 5'-CGC GTCGAC GTTGACATTGATTATTGAC-3' (SEQ ID NO: 6; the SalI site is underlined) and NotI-E2-R: 5'-TAAA GCGGCCG CACCAGCGGCGAGTG were used TTCTG-3' (SEQ ID NO:7; NotI site is underlined) amplifies the CMV-E2 fragment from pcDNA3.1+ and colonizes it into the transfer plasmid pUC-gG-MCS (Figure 1) In the SalI/NotI restriction site. The recombinant transfer plasmid pUC-gG-ORF5-ORF2-E2 was verified by PCR and sequencing. The sequence of the nucleic acid comprising gG-CMV-ORF5-BGH-EF1-orf2-BGH-CMV-E2-SV40-gG is set forth in SEQ ID NO:1. For the construction of the trivalent rPRV vaccine, use the primer AgeI-ORF2 F: 5'-CTG ACCGGT ATCACGTATCCA AGGAGGCG-3' (SEQ ID NO: 4; the underlined place is the AgeI site) and ORF2-R-XhoI: 5 '-CGG CTCGAG CCATAGAGCCCACCGCATC-3' (SEQ ID NO:5; XhoI site is underlined) amplifies the ORF2-BGH fragment from pcDNA3.1+ and colonizes it into the transfer plasmid pUC-gG-MCS ( Figure 1) in the AgeI/XhoI restriction site. Use primers SalI-EF1 F PCR: 5'-GC GTCGAC CGTGAGGCTCCGGT 3' (SEQ ID NO: 8; the SalI site is underlined) and NotI-E2-R: 5'-TAAA GCGGCCGC ACCAGCGGCGAGTTGTTCTG 3' (SEQ ID NO :7; the underlined place is the NotI site) The synthetic EF1α promoter and the amplified E2 fragment were cloned into the SalI/NotI restriction site of the transfer plasmid pUC-gG-MCS (Fig. 1). The recombinant transfer plasmid pUC-gG-ORF2-E2 was verified by PCR and sequencing. The sequence of the nucleic acid comprising gG-CMV-ORF2-BGH-EF1-E2-SV40-gG is set forth in SEQ ID NO:2. Generation of tetravalent and trivalent recombinant PRV : The nucleocapsid DNA of PRV Bartha expressing red fluorescent protein (RFP) (kindly provided by Prof. Enquist, Princeton University, USA) was linearized by EcoRI enzyme for recombination. Transfer plasmids pUC-gG-ORF5-ORF2-E2 or pUC-gG-ORF2-E2 were digested with HindIII to release the constructs for combination. Briefly, PK-15 cells were seeded in 6-well plates at 1×10 ⁶ cells/well. 3 ug digested construct DNA gG-ORF5-ORF2-E2 (quadrivalent PRV vaccine) or gG-ORF2-E2 (trivalent PRV vaccine) was mixed with 5 ug linearized PRV-RFP nucleocapsid using Lipofectamine 2000 DNA was co-transfected into PK-15 cells. Following cytopathic effect, the transfected progeny were plated in PK-15 cells for plaque purification. Plaque analysis : (frozen-thawed) the transfection supernatant containing the recombinant virus was titrated from a dilution of 10 ^-1 to 10 ^-6 , and cultured with PK-15 cells at 37°C and supplied with 5% CO ₂ Next incubate together for 1 hour. Remove supernatant and replace with 1% agarose overlay. After 48 hours, virus plaques showing no fluorescent signal were selected. After 3 to 4 rounds of plaque purification, selected plaques were passaged on PK-15 cells and the recombinant virus was sequenced to confirm the presence of the introduced genes (ORF2, E2 and ORF5) and the absence of mutations. Expression analysis by indirect immunofluorescence analysis : Trivalent or tetravalent rPRV-infected cells were analyzed by immunofluorescent staining using CSF-E2-specific polyclonal or PCV2-ORF2-specific monoclonal antibodies. Briefly, PK15 cells were infected with trivalent or tetravalent rPRV for 36 h at 37°C and 5% CO ₂ . After fixation, cells were permeabilized with 0.1% Triton X-100 and incubated with anti-E2 or anti-ORF2 polyclonal antibodies for 1 h at 37°C. Cells were then incubated with FITC-conjugated rabbit anti-mouse antibody (DAKO Cytomation, Copenhagen, Denmark). Fluorescent signals were detected with an inverted fluorescent microscope (Olympus, Essex, UK) and images were captured by a digital imaging system (Nikon, Tokyo, Japan). Replication kinetics of recombinant PRV vaccines in PK15 and BHK21 cell lines : To study virus replication in different cell lines, PK15 or BHK21 cells were infected with PRV-Bartha or trivalent rPRV or tetravalent rPRV at an MOI of 5. After 1 h at 37°C, cells were washed twice with phosphate-buffered saline (PBS) and 1 mL of medium containing 2% FBS was added. The plates were incubated at 37°C for 24 h and 48 h. At these time points, cells were lysed by three cycles of freezing and thawing, and virus-containing supernatants were stored at -80°C. Virus titrations were performed on PK15 cells in triplicate, with three replicates for each cell type and time point. Virus titers were calculated using the method of Reed and Muench (Reed and Muench, 1938) and expressed as 50% tissue culture infectious dose/volume (TCID ₅₀ /mL). Genetic Stability of Recombinant PRV Vaccine Constructs : Recombinant PRV vaccine constructs were serially passaged up to 5 times in PK15 cells. After 5 serial passages, the trivalent rPRV or tetravalent rPRV vaccine constructs were verified by PCR and sequencing to confirm the absence of mutations or deletions. Immunogenicity studies in mouse models : Attenuated PRV Bartha (negative control), _bivalent rPRV (PRV and ORF2), trivalent ^rPRV (PRV, ORF2 and E2), quadrivalent (PRV, ORF2, E2 and ORF5) and PBS controls were vaccinated intramuscularly against six to seven-week-old female BALB/c mice (n=8/group). Serum was collected on day 20 and day 42. The immunogenicity of the recombinant vaccine constructs was assessed by indirect ELISA on days 20 and 42 based on serum PRV-specific antibody titers, PCV2-ORF2, CSF-E2 and PRRSV-ORF5-specific antibody titers. Measurement of specific antibody titers by indirect ELISA : Serum specific antibody titers against PRV, PCV2-ORF2, CSF-E2 and PRRSV-ORF5 antigens were tested by indirect ELISA. Briefly, microtiter wells were coated with purified PRV viral antigen or PCV2-ORF2 or CSF-E2 or PRRSV-ORF5 antigen in coating buffer (0.1 mol/liter carbonate-bicarbonate, pH 9.6) ELISA plate. Serum samples (diluted 1:10) were serially diluted 2-fold in 3% nonfat dry milk in PBS containing 0.05% Tween 20 and added to the plate in triplicate. After washing three times with PBS-T, horseradish peroxidase (HRP)-conjugated goat anti-mouse immunoglobulin (DAKO) diluted 1000 times was added to each well. The reaction was initiated by 100 ml TMB substrate (3,3',5,5'-tetramethylbenzidine) and terminated by 50 ml 2 M H2SO4. Optical density at 450 nm was determined using a microplate absorbance reader (Tecan, Switzerland). Example 2 Construction and Characterization of Recombinant PRV Vaccine Through homologous recombination, the linear transfer plastid (pUC-gG-tetravalent/pUC-gG-trivalent) cassette was integrated into PRV Bartha DNA to generate and express PCV2-ORF2 and CSF-E2 The recombinant trivalent PRV vector (trivalent PRV-ORF2-E2) and the tetravalent PRV vector expressing PCV2-ORP2, CSF-E2 and PRRSV-ORF5 (tetravalent PRV-ORF5-ORF2-E2) (Figure 1). After transfection, the resulting recombinants were plaque purified on PK15 cells by selecting for non-red fluorescent plaques. Positive recombinants were rescreened. After 3-4 plaque purifications, positive recombinants were analyzed by sequencing and titrated in PK15 cells. In addition, immunofluorescence analysis against individual ORF2 or E2 specific antibodies demonstrated efficient expression of ORF2 or E2 proteins by a single PRV vector (Figures 2A and 2B). In contrast, no fluorescent cells were observed for the PRV negative control. Furthermore, stability tests revealed that the recombinant vaccine (tetravalent rPRV or trivalent rPRV) was stable after 5 serial passages in PK15 cells without mutations or deletions. Example 3 Replication in PK15 and BHK21 cells To investigate whether the insertion or expression of an exogenous transgene at the gG locus affects the replication properties, the recombinant PRV vaccine constructs (trivalent rPRV, tetravalent rPRV) and the parental generation were compared in PK15 and BHK21 cells One-step growth kinetics of the PRV Bartha strain. The viral titers of both trivalent and quadrivalent PRV vaccine constructs showed 10 ⁸ TCID ₅₀ and 10 ^8.3 TCID ₅₀ in PK15 cells and BHK21 cells, respectively, and the replication titers were similar to PRV-Bartha (TCID ₅₀ 10 ^8.5-8.7 ) The parental strains were comparable. Example 4 The results of the immunogenicity study in the mouse model showed that the mice immunized with the quadrivalent PRV vaccine showed serum specific antibody levels against PRV, E2, ORF2 and PRRSV. In addition, mice vaccinated with the trivalent PRV vaccine induced serum-specific antibody levels against PRV, ORF2 and E2 antigens (Figure 3). Antibody titer results showed that mice immunized with bivalent rPRV (ORF2) showed an antibody titer of >260 against PCV2-ORF2 antigen. In addition, mice immunized with trivalent PRV and quadrivalent PRV vaccines showed antibody titers of 240 and 180 against the ORF2 antigen, respectively. Furthermore, both trivalent and quadrivalent PRV vaccines showed antibody titers of >256 against classical swine fever E2 glycoprotein (Figure 4). Unless otherwise indicated herein or clearly contradicted by context, the terms "a" and "an" are used in the context of describing the invention, particularly in the context of the claims below, and "the" and similar referents Both should be understood to encompass both singular and plural forms. The terms "comprising", "having", "including" and "containing" are to be construed as open-ended terms (ie, meaning "including but not limited to") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (eg, "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention. Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations on those embodiments may become apparent to those skilled in the art immediately after reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors expect that the invention may be practiced otherwise than as specifically set forth herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context. Bibliography Dong B, Zarlenga DS, Ren X (2014). An overview of live attenuated recombinant pseudorabies viruses for use as novel vaccines. J Immunol Res 214:824630. Jantafong T, Sangtong P, Saenglub W et al. (2015). Genetic Diversity of porcine reproductive and respiratory syndrome virus in Thailand and Southeast Asia from 2008 to 2013. Vet Microbiol. 176(3-4):229-38. Jiang Y, Fang L, Xiao S. et al. (2007). Immunogenicity and protective Efficacy of recombinant pseudorabies virus expressing the two major membrane-associated proteins of porcine reproductive and respiratory syndrome virus. Vaccine, 25, No. 3, 547-560. Klingbeil K, Lange E, Teifke JP, Mettenleiter TC, Fuchs W. (201 4 ). Immunization of pigs. with an attenuated pseudorabies virus recombinant expressing the hemagglutinin of pandemic swine origin H1N1 influenza A virus. J Gen Virol, Vol. 95, 948-959. Klupp BG, Lominiczi B, Visser N et al. (2012). Mutations affecting the UL21 gene contribute to avirulence of pseudorabies virus vaccine strain Bartha. Virol 212:466-473. Li G, Shi N, Suo S, Cui J, Zarlenga D, Ren X.(2012). Vaccination of mice with ORF5 plasma DNA of PRRSV; enhanced effects by co-immunizing with porcine IL-15. Immunol Invest. 41(3):231-48. Li X, Liu R, Tang H, Jin M, Chen H, Qian P. (2008). Induction of protective immunity in swine by immunization with live attenuated recombinant pseudorabies virus expressing the capsid precursor encoding regions of foot-and-mouth disease virus. Vaccine, Vol. 26, No. 22, 2714-2722. Liu, J., Chen, I. and Kwang, J. (2005). Characterization of a previously unidentified viral protein in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis. J. Virol.79: 8262-8274. Nie H, Fang R , Xiong BQ. et al. (2011). Immunogenicity and protective efficacy of two recombinant pseudorabies viruses expressing Toxoplasma gondii SAG1 and MIC3 proteins. Vet Parasitol, Vol. 181, No. 2-4, 215-221. Opriessnig T, O'Neill K, Gerber PF, de Castro AM et al. (2013). A PCV2 vaccine based on genotype 2b is more effective than a 2a-based vaccine to protect against PCV2b or combined PCV2a/2b viremia in pigs with concurrent PCV2, PRRSV and PPV infection . Vaccine. 31(3):487-94. PomeranZ, LE, Reynolds, AE and Hengartner, CJ (2005). Molecular biology of pseudorabies virus: impact on neurovirology and veterinary medicine. Microbiol Mol Biol Rev 69, 462-500. Qiu HJ, Tian ZJ, Tong GZ et al., (2005). Protective immunity induced by a recombinant pseudorabies virus expressing the GP5 of porcine reproductive and respiratory syndrome virus in piglets. Vet Immunol Immunopathol, Vol. 106, No. 3-4, 309-319. Reed, LJ. Muench, H. A (1938). Simple method of estimating fifty percent endpoints. Am. J. Epidemiol. 27, 493-497. Song Y, Jin M _, Zhang S et al. (2007). Generation and immunogenicity of a recombinant pseudorabies virus expressing cap protein of porcine circovirus type 2. Vet Microbiol, Vol. 119, No. 2-4, 97-104. Xu G, Xu X, Li Z et al. (2004). Construction of recombinant pseudorabies virus expressing NS1 protein of Japanese encephalitis (SA14-14-2) virus and its safety and immunogenicity. Vaccine, Vol. 22, Nos. 15-16, 1846-1853. Yin G, Gao L, Shu X, Yang G, Guo S, Li W. (2012). Genetic diversity of the ORF5 gene of porcine reproductive and respiratory syndrome virus isolates in southwest China from 2007 to 2009. PLoS One. 7(3):e33756 Zhang H, Li X, Peng G, Tang C, Zhu S, Qian S, Xu J, Qian P. (2014). Glycoprotein E2 of classical swine fever virus expressed by baculovirus induces the protective immune responses in rabbits. Vaccine, 32(49):6607-13.

Figure 1 shows the strategy for constructing rPRV according to one embodiment of the present invention. Pseudorabies virus (PRV) gene body: unique long region ( _UL ), internal repeat sequence (IR), unique short region (Us) and terminal repeat sequence (TR). Quadrivalent PRV showed PRRSV-ORF5, PCV2-ORF2, CSF-E2; trivalent PRV showed PCV2-ORF2, CSF-E2. Abbreviations: N-gG = N (amino) terminus of glycoprotein G; C-gG = carboxy terminus of glycoprotein; PK = protein kinase; CMV ie = immediate early promoter of human cytomegalovirus; EF1α promoter = elongation Factor 1 alpha promoter; terminator SV40 polyA, bovine growth hormone polyadenylation (BGH polyA). Figures 2A and 2B show immunofluorescence analysis of PK15 cells infected with multivalent vaccine. Figure 2A: PK15 infected with bivalent PRV (ORF2-PRV) or trivalent PRV (ORF2-E2-PRV) or tetravalent PRV (ORF5-ORF2-E2-PRV) for 36 h at 37°C and 5% CO ₂ Immunofluorescence analysis of cells. Anti-ORF2 (mouse hyperimmune serum) signal was observed in all constructs. Figure 2B: Immunofluorescence analysis of PK15 cells infected with trivalent PRV (ORF2-E2-PRV) or tetravalent PRV (ORP5-ORF2-E2-PRV) for 36 h at 37°C and 5% CO ₂ . Anti-E2 (mouse hyperimmune serum) signal was observed in all constructs. Figure 3 shows groups of mice (n=8/group) immunized with trivalent or tetravalent PRV vaccines on day 0 and day 21. Serum was collected on day 20 and day 42. The results show serum PRV/CSF/PCV2/PRRSV-specific IgG antibody levels measured by indirect ELISA on day 20 and day 42. Figure 4 shows groups of mice (n=8/group) immunized with trivalent or tetravalent PRV vaccines on day 0 and day 21. Serum was collected on day 20 and day 42. The results show the serum PCV2-ORF2 or CSF-E2 specific antibody titers on day 42 (21 days after the second immunization).

<110> Temasek Life Sciences Laboratory Limited, Singapore

<120> Multivalent vaccines against major porcine viral diseases

<130> 2577-254PCT

<140> 106116602

<141> 2017-05-19

<151> 2016-05-19

<151> 2016-05-19

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 6619

<212>DNA

<213> Artificial sequence

<220>

<223> Nucleic acid containing porcine viral disease sequences

<220>

<221> misc_feature

<222> (1)..(6)

<223> HindIII restriction site

<220>

<221> misc_feature

<222> (7)..(438)

<223> PRV gG sequence

<220>

<221> misc_feature

<222> (439)..(444)

<223> PstI restriction site

<220>

<221> misc_feature

<222> (445)..(1034)

<223> CMV ie promoter sequence

<220>

<221> misc_feature

<222> (1035)..(1040)

<223> BglI restriction site

<220>

<221> misc_feature

<222> (1041)..(1643)

<223> PRRSV ORF5 sequence

<220>

<221> misc_feature

<222> (1644)..(1868)

<223> BGH polyA sequence

<220>

<221> misc_feature

<222> (1869)..(3056)

<223> EF1-1a promoter sequence

<220>

<221> misc_feature

<222> (3057)..(3062)

<223> AgeI restriction site

<220>

<221> misc_feature

<222> (3063)..(3767)

<223> PCV ORF2 sequence

<220>

<221> misc_feature

<222> (3799)..(4023)

<223> BGH polyA sequence

<220>

<221> misc_feature

<222> (4024)..(4029)

<223> XhoI restriction site

<220>

<221> misc_feature

<222> (4038)..(4043)

<223> SalI restriction site

<220>

<221> misc_feature

<222> (4044)..(4631)

<223> CMV ie promoter sequence

<220>

<221> misc_feature

<222> (4729)..(5916)

<223> CSF E2 sequence

<220>

<221> misc_feature

<222> (5917)..(5924)

<223> NotI restriction site

<220>

<221> misc_feature

<222> (5925)..(6192)

<223> SV40 polyA sequence

<220>

<221> misc_feature

<222> (6193)..(6613)

<223> PRV gG sequence

<220>

<221> misc_feature

<222> (6614)..(6619)

<223> HindIII restriction site

<400> 1

<210> 2

<211> 5119

<212>DNA

<213> Artificial sequence

<220>

<223> Nucleic acid containing porcine viral disease sequences

<220>

<221> misc_feature

<222> (1)..(6)

<223> HindIII restriction site

<220>

<221> misc_feature

<222> (7)..(438)

<223> PRV gG sequence

<220>

<221> misc_feature

<222> (439)..(444)

<223> PstI restriction site

<220>

<221> misc_feature

<222> (445)..(1047)

<223> CMV ie promoter sequence

<220>

<221> misc_feature

<222> (1048)..(1053)

<223> AgeI restriction site

<220>

<221> misc_feature

<222> (1054)..(1764)

<223> PCV ORF2 sequence

<220>

<221> misc_feature

<222> (1790)..(2014)

<223> BGH polyA sequence

<220>

<221> misc_feature

<222> (2015)..(2020)

<223> XhoI restriction site

<220>

<221> misc_feature

<222> (2029)..(2034)

<223> SalI restriction site

<220>

<221> misc_feature

<222> (2035)..(3222)

<223> EF1-1a promoter sequence

<220>

<221> misc_feature

<222> (3229)..(4416)

<223> CSF E2 sequence

<220>

<221> misc_feature

<222> (4417)..(4424)

<223> NotI restriction site

<220>

<221> misc_feature

<222> (4425)..(4692)

<223> SV40 polyA sequence

<220>

<221> misc_feature

<222> (4693)..(5113)

<223> PRV gG sequence

<220>

<221> misc_feature

<222> (5114)..(5119)

<223> HindIII restriction site

<400> 2

<210> 3

<211> 2028

<212>DNA

<213> Artificial sequence

<220>

<223> Nucleic acid containing synthetic porcine viral disease sequences

<220>

<221> misc_feature

<222> (1)..(6)

<223> BglII restriction site

<220>

<221> misc_feature

<222> (7)..(609)

<223> PRRSV ORF5 sequence

<220>

<221> misc_feature

<222> (610)..(834)

<223> BGH poly A sequence

<220>

<221> misc_feature

<222> (835)..(2022)

<223> EF1-1a promoter sequence

<220>

<221> misc_feature

<222> (2023)..(2028)

<223> AgeI restriction site

<400> 3

<210> 4

<211> 29

<212>DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<220>

<221> misc_feature

<222> (4)..(9)

<223> AgeI restriction site

<400> 4

<210> 5

<211> 28

<212>DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<220>

<221> misc_feature

<222> (4)..(9)

<223> XhoI restriction site

<400> 5

<210> 6

<211> 28

<212>DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<220>

<221> misc_feature

<222> (4)..(9)

<223> SalI restriction site

<400> 6

<210> 7

<211> 32

<212>DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<220>

<221> misc_feature

<222> (5)..(12)

<223> NotI restriction site

<400> 7

<210> 8

<211> 22

<212>DNA

<213> Artificial sequence

<220>

<223> oligonucleotide primer

<220>

<221> misc_feature

<222> (3)..(8)

<223> SaII restriction site

<400> 8

Claims (34)

A nucleic acid construct comprising: a pseudorabies virus (PRV) gG gene inserted therein: (a) an active first promoter in mammalian cells operably linked to the porcine circovirus (PCV2) ORF2 gene The porcine circovirus (PCV2) ORF2 gene is operably linked to a first terminator active in mammalian cells, and (b) is operably linked to the classical swine fever (CSF) virus E2 gene in mammals A second promoter active in cells, the classical swine fever (CSF) virus E2 gene operably linked to a second terminator active in mammalian cells, wherein the first promoter active in mammalian cells promoter and the second promoter active in mammalian cells are different, and wherein the first terminator active in mammalian cells and the second terminator active in mammalian cells are different. The nucleic acid construct as claimed in claim 1, wherein the first promoter active in mammalian cells is one of the cytomegalovirus (CMV) immediate early (ie) promoter and the elongation factor 1 alpha (EF1 alpha) promoter , and the second promoter active in mammalian cells is the other of the CMV ie promoter and the EF1α promoter. The nucleic acid construct as claimed in claim 1 or 2, wherein the active first terminator in mammalian cells is one of bovine growth hormone (BGH) polyadenylation sequence (polyA) and simian virus 40 (SV40) polyA One, and the second terminator active in mammalian cells is The other of BGH polyA and SV40 polyA. The nucleic acid construct of claim 1 or 2, wherein the PCV2 ORF2 gene has the sequence listed in nucleotides 3063-3767 of SEQ ID NO: 1, and the CSF E2 gene has the nucleotides of SEQ ID NO: 1 Sequences listed in 4729-5916. The nucleic acid construct according to claim 1 or 2, wherein the nucleic acid construct has the nucleotide sequence listed in SEQ ID NO:2. A vector comprising the nucleic acid construct according to any one of claims 1 to 5. A mammalian cell line transfected with the nucleic acid construct according to any one of claims 1 to 5 and the linearized PRV nucleocapsid nucleic acid. The mammalian cell line as claimed in item 7, which is a PK-15 cell line. The mammalian cell line according to claim 7 or 8, wherein the PRV is PRV Bartha-K61. A trivalent recombinant PRV comprising the nucleic acid construct according to any one of claims 1-5. The trivalent recombinant PRV according to claim 10, wherein the PRV is PRV Bartha-K61. A vaccine comprising the trivalent recombinant PRV as claimed in claim 10 or 11 and physiologically acceptable carrier. A use of the trivalent recombinant PRV according to claim 10 or 11, which is used for the manufacture of medicines that induce protective immune responses against PRV, PCV and CSF viruses in pigs. A use of the trivalent recombinant PRV according to claim 10 or 11, which is used for the manufacture of medicines for preventing pigs from being infected by PRV, PCV and CSF viruses. A use of the trivalent recombinant PRV according to claim 10 or 11, which is used for vaccine research and development and manufacture. The trivalent recombinant PRV according to claim 10 or 11, which is used for vaccine research and development. A nucleic acid construct comprising: a pseudorabies virus (PRV) gG gene inserted therein: (a) the first active in mammalian cells operably linked to the porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 gene; a promoter, the porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 gene operably linked to a first terminator active in mammalian cells, (b) operably linked to the porcine circovirus (PCV2) ORF2 gene A second promoter active in mammalian cells, the porcine circovirus (PCV2) ORF2 gene operably linked to a second terminator active in mammalian cells; and (c) operably linked to a classical porcine The E2 Gene of Pestigo Virus (CSF) Virus in Mammalian Cells An active third promoter, the classical swine fever (CSF) virus E2 gene is operably linked to an active third terminator in mammalian cells, wherein the first active promoter in mammalian cells and The second promoter active in mammalian cells is different, wherein the second promoter active in mammalian cells and the third promoter active in mammalian cells are different , wherein the first terminator active in mammalian cells and the second terminator active in mammalian cells are different, and wherein the second terminator active in mammalian cells and The third terminator that is active in mammalian cells is a different one. The nucleic acid construct as claimed in claim 17, wherein the active first promoter in mammalian cells is one of the cytomegalovirus (CMV) immediate early (ie) promoter and the elongation factor 1 alpha (EF1 alpha) promoter , and the second promoter active in mammalian cells is the other of the CMV ie promoter and the EF1α promoter. The nucleic acid construct according to claim 18, wherein the first and third promoters active in mammalian cells are the same. The nucleic acid construct according to any one of claims 17 to 19, wherein the active first terminator in mammalian cells is bovine growth hormone (BGH) polyadenylation sequence (polyA) and simian virus 40 (SV40 ) polyA, and the second terminator active in mammalian cells is the other of BGH polyA and SV40 polyA. The nucleic acid construct according to claim 20, wherein the first and third terminators active in mammalian cells are the same. The nucleic acid construct according to any one of claims 17 to 19, wherein the PCV2 ORF2 gene has the sequence listed in nucleotides 3063-3767 of SEQ ID NO: 1, and the CSF E2 gene has the sequence of SEQ ID NO: 1 The sequence set forth in nucleotides 4729-5916 and the PRRSV ORF5 has the sequence set forth in nucleotides 1041-1643 of SEQ ID NO:1. The nucleic acid construct according to any one of claims 17 to 19, wherein the nucleic acid construct has the nucleotide sequence set forth in SEQ ID NO:1. A vector comprising the nucleic acid construct according to any one of claims 17-23. A mammalian cell line transfected with the nucleic acid construct according to any one of claims 17 to 23 and the linearized PRV nucleocapsid nucleic acid. The mammalian cell line as claimed in item 25, which is a PK-15 cell line. The mammalian cell line according to claim 25 or 26, wherein the PRV is PRV Bartha-K61. A tetravalent recombinant PRV comprising the nucleic acid construct according to any one of claims 17-23. The tetravalent recombinant PRV according to claim 28, wherein the PRV is PRV Bartha-K61. A vaccine comprising the tetravalent recombinant PRV according to claim 28 or 29 and a physiologically acceptable carrier. A use of the tetravalent recombinant PRV according to claim 28 or 29, which is used for the manufacture of medicines that induce protective immune responses against PRV, PRRSV, PCV and CSF viruses in pigs. A use of the quadrivalent recombinant PRV according to claim 28 or 29, which is used for the manufacture of medicines for preventing pigs from being infected by PRV, PRRSV, PCV and CSF viruses. A use of the tetravalent recombinant PRV according to claim 28 or 29, which is used for vaccine research and development and production. Such as the tetravalent recombinant PRV of claim 28 or 29, which is used for vaccine research and development.