TW201817444A - Multivalent vaccines against major swine viral diseases - Google Patents

Abstract

The present invention relates to the field of vaccines. More specifically, the present invention relates to a multivalent vaccine against major swine viral diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies viral vector.

Description

Multivalent vaccine against major swine virus diseases

The invention relates to the field of vaccines. More specifically, the present invention relates to multivalent vaccines against major swine virus diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies virus vector.

Publications and other materials used herein to clarify the background of the invention or to provide other details about practice are incorporated by reference and are grouped separately in a bibliography for convenience. Pseudorabies virus (PRV), which belongs to the subfamily α-herpesvirus of the Herpesviridae family, is a pathogen of Aujeszky's disease. PRV is very common in developing countries and causes significant economic losses in the pig industry. Live attenuated PRV vaccines have played a key role in preventing and eradicating PRV (Pomeranz et al., 2005). The PRV Bartha-K61 is an attenuated PRV vaccine strain in which part of the gE and gl genes have been deleted (Klupp et al., 2012; Dong et al., 2014). Moreover, several previous reports have described excellent vaccine vectors for live attenuated PRV Bartha-K61 lines that display heterologous antigen genes (Nie et al., 2011; Li et al., 2008; Song et al., 2007; Xu et al., 2004; Jiang Et al., 2007). Therefore, a live attenuated PRV Bartha-K61 vaccine strain was used as a vector to express multiple antigenic genes for major porcine virus diseases. Porcine Circovirus (PCV) (a member of the Circoviridae family) is a single-stranded circular DNA genome. PCV2 is the main cause of infected multi-system wasting syndrome (PMWS) in infected pigs. The infection is characterized by diarrhea, reduced weight gain, sudden death, enlarged lymph nodes, respiratory distress, and multinucleated giant cell formation (Liu et al., 2005). ORF2 is one of the major open reading frames in the PCV2 gene. It encodes a cap protein, which is an immunodominant viral protein that can be used as an ideal target for vaccine development in pigs. Classical swine fever (CSF) virus is a highly infectious and economically important viral disease that affects domestic and wild pigs. CSF virus (CSFV) is a sense single-stranded RNA virus and is a member of the pestivirus genus within the Flaviviridae family. Envelope glycoprotein E2 contains 4 antigenic domains and it can induce protective immunity against CSFV in pig populations. Therefore, E2 glycoproteins are potential candidates for CSFV vaccine design (Zhang et al., 2014). C-strain-based, fully inactivated vaccines are effective and provide complete protection against 3 CSFV populations, but cannot provide discrimination between infected and vaccinated animals (Zhang et al., 2014). Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) is classified into the Arteriviridae family of the order Nidovirales. It is a mantle-enveloped positive-stranded RNA virus that causes PRRS. Infection with PRRSV can cause late abortion in sows, mass reproduction disorders, and respiratory disorders in piglets. The PRRSV genome consists of 9 open reading frames that encode 7 structural proteins and 14 non-structural proteins. Among them, glycoprotein (GP) 5 is the major envelope protein encoded by ORF5. It is one of the key immunogenic proteins of PRRSV, which is essential for virus assembly, infectivity, and induction of neutralizing antibodies. ORF5 is one of the most variable regions of the PRRSV genome and has been widely used to study the molecular epidemiology of PRRSV. GP5 is also a leading target in vaccine development against PRRSV infection (Li et al., 2012). The currently available vaccines and vaccination programs are complex and it is difficult to immunize against all four diseases individually, resulting in multiple injections and multiple boosters. Therefore, the development of multivalent vaccines against the four diseases will be time consuming and cost effective, and more effective vaccines can also be produced.

The invention relates to the field of vaccines. More specifically, the present invention relates to multivalent vaccines against major swine virus diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies virus vector. The present invention illustrates the use of established live attenuated pseudorabies (PRV) vaccine strains (eg, Bartha-K61 strain) as vaccine vectors to express multiple immunogens of major porcine virus diseases from PCV2, CSF, and PRRSV. The PRV genome is approximately 140 kb and consists of: a unique long (UL) region, a unique short (US) region, a large inverted repeat, an internal repeat (IR), and a terminal repeat (TR). One half of the genome is considered a non-essential region, such as protein kinase (PK), thymidine kinase (TK), gE, gG, and gl, thereby allowing foreign genes to be modified or inserted without affecting viral replication. Moreover, its well-documented safety and protective efficacy profile of the PRV Bartha-K61 vaccine strain has been successfully used to control Oysky disease for decades. According to the present invention, a tetravalent PRV vaccine against PRRSV, PCV2, CSF and PRV and a trivalent PRV vaccine against PCV2, CSF and PRV have been generated. Therefore, in one aspect, the present invention provides a quadrivalent PRV vaccine against PRRSV, PCV2, CSF, and PRV. According to this aspect, a nucleic acid construct is prepared, which includes a gene of PRRSV, a gene of PCV2, and a gene of CSF. In some embodiments, the PRRSV gene is the PRRSV ORF5 gene. In some embodiments, the PRRSV ORF5 gene line is derived from the highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1). In some embodiments, the PCV2 gene is the PCV2 ORF2 gene. In some embodiments, the PCV2 gene line is derived from the PCV2 Indonesia strain (genotype 2B) (PCV2 TLL-Indo, gene bank accession number KX130941). In some embodiments, the CFS gene is the CFS E2 gene. In some embodiments, the CFS E2 gene is derived from the newly emerged genotype 2.1 of the CSF Indonesia strain (CSF TLL-Indo, GenBank Accession No. KX130940). In some embodiments, each gene is operably linked to a promoter that is active in mammalian cells. According to the present invention, any suitable promoter that is active in mammalian cells can be used. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter is the CMV immediate early (CMV ie) promoter. In some embodiments, the promoter is an elongation factor 1 alpha (EF1 alpha) promoter. In some embodiments, each gene is operably linked to a terminator sequence operable in a mammalian cell. According to the present invention, any suitable terminator that is active in mammalian cells can be used. In some embodiments, the terminator sequence is a bovine growth hormone polyadenylation (BGH polyA) sequence. In some embodiments, the terminator sequence is a SV40 virus polyadenylation (SV40 polyA) sequence. In some embodiments, a nucleic acid construct is provided that includes a PRRSV gene, a PCV2 gene, and a CSF gene as set forth herein. In some embodiments, the nucleic acid construct further comprises a promoter and / or a terminator as set forth herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is the PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises a nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments a PRV strain is provided, wherein the PRV strain is modified to contain a nucleic acid construct as set forth herein. In some embodiments, the modified PRV is a modified PRV Bartha-K61 strain. In some embodiments, the nucleic acid constructs in the modified PRV strain are stable and free of mutations or deletions after passage of 5 generations in porcine kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell line is ATCC® CCL-33 ™ cells obtained from the American Type Culture Collection. In some embodiments, a cell line is provided that is transfected with a nucleic acid construct as described herein in a manner suitable for the production of a virus useful in a tetravalent vaccine. In some embodiments, the nucleic acid constructs described herein are inserted into the PRV strains described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is a PK-15 cell as described herein. In another aspect, the invention provides a trivalent PRV vaccine against PCV2, CSF and PRV. According to this aspect, a nucleic acid construct is prepared, which includes a gene of PCV2 and a gene of CSF. In some embodiments, the PCV2 gene and the CSF gene line are as set forth herein. In some embodiments, each gene is operably linked to a promoter that is active in mammalian cells. In some embodiments, the promoter is as set forth herein. In some embodiments, each gene is operably linked to a terminator sequence operable in a mammalian cell. In some embodiments, the terminator sequence is as set forth herein. In some embodiments, a nucleic acid construct is provided that includes a PCV2 gene and a CSF gene as set forth herein. In some embodiments, the nucleic acid construct further comprises a promoter and / or a terminator as set forth herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is the PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises a nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments a PRV strain is provided, wherein the PRV strain is modified to contain a nucleic acid construct as set forth herein. In some embodiments, the modified PRV strain is as set forth herein. In some embodiments, the nucleic acid constructs in the modified PRV strain are stable and free of mutations or deletions after passage of 5 generations in porcine kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell line is as set forth herein. In some embodiments, a cell line is provided that is transfected with a nucleic acid construct as described herein in a manner suitable for the production of a virus useful in a trivalent vaccine. In some embodiments, the nucleic acid constructs described herein are inserted into the PRV strains described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is a PK-15 cell as described herein. The invention also provides a kit for immunizing an individual with a recombinant PRV as set forth herein. The kit contains the recombinant PRVs described herein, pharmaceutically acceptable carriers, applicators, and explanatory materials on their use. The invention also provides a method of use. In one embodiment, the invention provides a method of eliciting a protective immune response in an individual (e.g., a pig) comprising administering to the individual a prophylactic, therapeutic, or immune effective amount of a recombinant PRV as set forth herein. In another embodiment, the invention provides a method for preventing an individual from developing PRV, PRRSV, PCV2 and CSF or PRV, PCV2 and CSF, comprising administering to the individual a prophylactic, therapeutic or immune effective amount of a recombinant PRV as set forth herein .

The invention relates to the field of vaccines. More specifically, the present invention relates to multivalent vaccines against major swine virus diseases. In one embodiment, the multivalent vaccine is a recombinant pseudorabies virus vector. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The term "expression" in relation to a gene sequence refers to the transcription of the gene and (if necessary) the translation of the resulting mRNA transcript to protein. Therefore, as will be clear from the context, the expression of a protein coding sequence is derived from the transcription and translation of the coding sequence. As used herein, "gene" refers to a nucleic acid sequence that encompasses the coding region of a gene product. In the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell, "introduced" means "transfected" or "transformed" or "transduced" and includes a reference to the inclusion of a nucleic acid fragment into a yeast or fungus In a cell, where a nucleic acid fragment can be incorporated into the cell's genome (e.g., chromosomal, plastid, or mitochondrial DNA), transformed into an autonomous replicon or transiently expressed (e.g., transfected mRNA). "Operable linkage" or "operably linked" or "operatively linked", as used herein, is understood to mean, for example, that the regulatory elements are arranged in sequence in such a way that each regulatory element can achieve its function in the recombinant expression of the nucleic acid And desired nucleic acids and (if necessary) other regulatory elements (e.g., terminators) to produce the desired product. This does not require a direct connection in the chemical sense. Genetic control sequences (e.g., enhancer sequences) can also exert their effect on target sequences from slightly distant locations or actually from other DNA molecules (cis or trans localization). A preferred arrangement is one in which the nucleic acid sequence to be expressed recombinantly is positioned downstream of the sequence used as a promoter such that the two sequences are covalently bonded to each other. Regulatory or control sequences can be located on either the 5 'side of the nucleotide sequence or the 3' side of the nucleotide sequence, as is well known in the art. The terms "polynucleotide", "nucleic acid" and "nucleic acid molecule" are used interchangeably herein and refer to a polymer of nucleotides, which polymers may be nucleotides and / or nucleosides (including DNA , RNA and its derivatives) natural or synthetic linear and sequential arrays. It includes chromosomal DNA, self-replicating plastids, infectious polymers of DNA or RNA, and DNA or RNA that performs major structural functions. Unless otherwise indicated, nucleic acids or polynucleotides are written from left to right in a 5 'to 3' orientation. Nucleotides are mentioned with their recognized single letter code. Number ranges include numbers that define the range. The terms "polypeptide", "peptide" and "protein" are used interchangeably herein and refer to polymers of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogues of the corresponding natural amino acid, as well as natural amino acid polymers. Amino acids may be mentioned in their well-known three-letter or single-letter symbols. The amino acid sequences are written from left to right in the amine to carboxy orientation, respectively. Number ranges include numbers that define the range. "Promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. A "promoter active in mammalian cells" is a promoter capable of controlling transcription in mammalian cells, whether or not they are derived from mammalian cells. "Recombinant" refers to an artificial combination of two originally separated sequence segments (for example) obtained by chemical synthesis or by manipulation of isolated nucleic acid segments by genetic engineering techniques. "Recombinant" also includes references to cells or vectors modified by the introduction of heterologous nucleic acids or cells derived from such modified cells, but does not cover the use of natural events (e.g., spontaneous mutation, natural transformation / transformation). (Transduction / translocation) altered cells or vectors, such as those that appear without intentional human intervention. "Recombinant DNA construct" refers to a combination of nucleic acid fragments that are not normally found together in nature. Thus, a recombinant DNA construct may contain regulatory sequences and coding sequences of different origins, or regulatory sequences and coding sequences of the same origin but arranged in a manner different from that commonly found in nature. The terms "recombinant DNA construct" and "recombinant construct" are used interchangeably herein. In several embodiments described herein, recombinant DNA constructs can also be considered as "over-expressing DNA constructs." The term "nucleic acid construct" is also used interchangeably with "recombinant DNA construct". `` Regulatory sequence '' means a nucleoside located upstream of a coding sequence (5 'non-coding sequence), within or downstream of a coding sequence (3' non-coding sequence) and affecting the transcription, RNA processing or stability or translation of the relevant coding sequence Acid sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein. Sequence alignment and percent identity calculations can be determined using a number of comparison methods designed to detect homologous sequences, including, but not limited to, the LASERGENE® bioinformatics computing suite (DNASTAR ® Inc., Madison, WI). Unless otherwise stated, multiple alignments of the sequences provided herein are performed using the Clustal V alignment method (Higgins and Sharp (1989) CABIOS. 5: 151-153) using default parameters (gap penalty = 10, gap length penalty) = 10) to implement. The default parameters for using the Clustal V method to align and calculate the percent identity of protein sequences are KTUPLE = 1, gap penalty = 3, window = 5, and reserved diagonal = 5. For nucleic acids, these parameters are KTUPLE = 2, gap penalty = 5, window = 4, and reserved diagonal = 4. After aligning the sequences, use the Clustal V program to obtain the "percent consistency" and "differentiation" values by looking at the "sequence distance" table on the same program; unless otherwise stated, the consistency provided and claimed in this article Sex percentage and divergence are calculated in this way. Alternatively, useClustal W Comparison method.Clustal W Comparison methods (explained by Higgins and Sharp, CABIOS. 5: 151-153 (1989); Higgins, DG et al., Comput. Appl. Biosci. 8: 189-191 (1992)) can be found in LASERGENE® Bioinformatics MegAlign ™ v6.1 program of the calculation software group (DNASTAR® Inc., Madison, Wis.). The default parameters for multiple alignments correspond to gap penalty = 10, gap length penalty = 0.2, delayed divergence sequence = 30%, DNA conversion weight = 0.5, protein weight matrix = Gonnet Series, DNA weight matrix = IUB. For comparison by comparison, the default parameters are comparison = slow-accurate, gap penalty = 10.0, gap length = 0.10, protein weighting matrix = Gonnet 250 and DNA weighting matrix = IUB. useClustal W After the programs compare the sequences, you can get the "Percent Consistency" and "Diversity" values by looking at the "Sequence Distance" table in the same program. The term "under stringent conditions" means that two sequences hybridize under moderate or highly stringent conditions. More specifically, moderately stringent conditions can easily be determined by those skilled in the art, for example, based on the length of the DNA. The basic conditions are by Sambrook et al.Molecular Cloning: A Laboratory Manual , 3rd Edition, Chapters 6 and 7, as stated in Cold Spring Harbor Laboratory Press, 2001, and includes the use of a prewash solution (5 × SSC, 0.5% SDS, 1.0 mM EDTA ( pH 8,0)), about 50% formamidine, 2 × SSC to 6 × SSC, hybridization conditions at about 40 ° -50 ° C (or other similar hybridization solutions, such as Stark solution, at about 50% formam Washing conditions in amines at about 42 ° C) and, for example, about 40 ° C to 60 ° C, 0.5 × SSC -6 × SSC, 0.1% SDS. Preferably, moderately stringent conditions include hybridization (and washing) at about 50 ° C and 6 × SSC. Highly stringent conditions can also be easily determined by those skilled in the art, for example, based on the length of the DNA. Generally, these conditions include hybridization and / or washing at higher temperatures and / or lower salt concentrations compared to moderately stringent conditions (e.g., hybridization at about 65 ° C, 6 × SSC to 0.2 × SSC, (Best 6 × SSC, better 2 × SSC, best 0.2 × SSC). For example, highly stringent conditions may include hybridization as defined above and washing at about 65 ° C-68 ° C, 0.2 × SSC, 0.1% SDS. In hybridization and washing buffer, SSPE (1 × SSPE system 0.15 M NaCl, 10 mM NaH₂ PO₄ And 1.25 mM EDTA, pH 7.4) instead of SSC (1 × SSC line 0.15 M NaCl and 15 mM sodium citrate); washing was performed for 15 minutes after completion of hybridization. Commercial hybrid kits can also be used, which use non-radioactive substances as probes. Specific examples include hybridization using ECL direct labeling and detection systems (Amersham). Stringent conditions include, for example, the use of a hybridization buffer supplemented with 5% (w / v) blocking reagent and 0.5 M NaCl included in the kit for hybridization at 42 ° C for 4 hours, and 0.4% at 55 ° C Wash twice in 20 minutes in SDS, 0.5 × SSC and once in 5 minutes in 2 × SSC at room temperature. The term "substantially homologous" or "substantially homologous" as used herein with respect to a nucleic acid sequence includes a nucleotide sequence that hybridizes under stringent conditions to the mentioned SEQ ID NO: or a portion or complement thereof, which is These are the following: anti-parallel alignment is allowed between two sequences, and then the two sequences can form hydrogen bonds with corresponding bases on opposite strands under stringent conditions to form a stringent stringent (including High stringency) conditions are sufficient for double-stranded molecules to be detected using methods well known in the art. A substantially homologous sequence may have about 70% to about 80% sequence identity, or more preferably about 80% to about 85% sequence identity, with a reference nucleotide sequence or complement thereof as listed in the Sequence Listing, or Optimally about 90% to about 95% sequence identity, up to about 99% sequence identity. Alternatively, substantially homologous sequences include those that hybridize to target regions of plant gene introns under stringent conditions. For stringent conditions, see the description herein and also see U.S. Patent Nos. 8,455,716 and 8,536,403. "PRRSV ORF5 gene" or "ORF5 gene" refers to the ORF5 gene derived from the highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1). In some embodiments, the ORF5 gene has the sequence listed in nucleotides 1041-1643 of SEQ ID NO: 1. In other embodiments, based on the Clustal V or Clustal W alignment method, when compared to nucleotides 1041-1643 of SEQ ID NO: 1, the ORF5 gene has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. "PCV ORF2 gene" or "ORF2 gene" refers to the ORF2 gene derived from PCV2 Indonesia strain (genotype 2B) (PCV2 TLL-Indo, gene bank accession number KX130941). In some embodiments, the ORF2 gene has the sequence listed in nucleotides 3063-3767 of SEQ ID NO: 1. In other embodiments, based on the Clustal V or Clustal W alignment method, the ORF2 gene has at least 85%, 86%, 87%, 88%, 89% when compared to nucleotides 3063-3767 of SEQ ID NO: 1. %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. "CSF E2 gene" or "E2 gene" refers to the E2 gene of the newly emerged subgenotype 2.1 (CSF TLL-Indo, GenBank Accession No. KX130940) derived from the CSF Indonesia strain. In some embodiments, the E2 gene has the sequence listed in nucleotides 4729-5916 of SEQ ID NO: 1. In other embodiments, based on the Clustal V or Clustal W alignment method, the E2 gene has at least 85%, 86%, 87%, 88%, 89% when compared to nucleotides 4729-5916 of SEQ ID NO: 1. %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In one aspect, the invention provides a quadrivalent PRV vaccine against PRRSV, PCV2, CSF, and PRV. According to this aspect, a nucleic acid construct is prepared, which includes a gene of PRRSV, a gene of PCV2, and a gene of CSF. In some embodiments, the PRRSV gene is the PRRSV ORF5 gene. In some embodiments, the PRRSV ORF5 gene line is derived from the highly pathogenic PRRSV Chinese strain (HP-HRRSV-JXA1). In some embodiments, the ORF5 gene has a nucleotide sequence set forth herein. In some embodiments, the PCV2 gene is the PCV2 ORF2 gene. In some embodiments, the PCV2 gene line is derived from the PCV2 Indonesia strain (genotype 2B). In some embodiments, the ORF2 gene has a nucleotide sequence set forth herein. In some embodiments, the CFS gene is the CFS E2 gene. In some embodiments, the CFS E2 gene line is derived from the newly emerged subgenotype 2.1 of the CSF Indonesia strain. In some embodiments, the E2 gene has a nucleotide sequence set forth herein. In some embodiments, each gene is operably linked to a promoter that is active in mammalian cells. According to the present invention, any suitable promoter that is active in mammalian cells can be used. In some embodiments, the promoter is a cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter is the CMV immediate early (CMV ie) promoter. In some embodiments, the CMV ie promoter has the sequence listed in nucleotides 445-1034 of SEQ ID NO: 1. In some embodiments, based on the Clustal V or Clustal W alignment method, the CMV promoter has at least 85%, 86%, 87%, 88%, when compared to nucleotides 445-1034 of SEQ ID NO: 1, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the promoter is an elongation factor 1 alpha (EF1 alpha) promoter. In some embodiments, the EF1α promoter has the sequence listed in nucleotides 1869-3056 of SEQ ID NO: 1. In some embodiments, based on Clustal V or Clustal W alignment methods, when compared to nucleotides 1869-3056 of SEQ ID NO: 1, the EF1α promoter has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, each gene is operably linked to a terminator sequence operable in a mammalian cell. According to the present invention, any suitable terminator that is active in mammalian cells can be used. In some embodiments, the terminator sequence is a bovine growth hormone polyadenylation (BGH polyA) sequence. In some embodiments, the BGH polyA sequence has the sequence listed in nucleotides 1644-1868 of SEQ ID NO: 1. In some embodiments, based on Clustal V or Clustal W alignment methods, when compared to nucleotides 1644-1868 of SEQ ID NO: 1, the BGH polyA sequence has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the terminator sequence is a SV40 virus polyadenylation (SV40 polyA) sequence. In some embodiments, the SV40 polyA sequence has the sequence listed in nucleotides 5925-6192 of SEQ ID NO: 1. In some embodiments, based on the Clustal V or Clustal W alignment method, the SV40 polyA sequence has at least 85%, 86%, 87%, 88%, when compared to nucleotides 5925-6192 of SEQ ID NO: 1, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, a nucleic acid construct is provided that includes a PRRSV gene, a PCV2 gene, and a CSF gene as set forth herein. In some embodiments, the nucleic acid construct further comprises a promoter and / or a terminator as set forth herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is the PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises a nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments a PRV strain is provided, wherein the PRV strain is modified to contain a nucleic acid construct as set forth herein. In some embodiments, the modified PRV is a modified PRV Bartha-K61 strain. In some embodiments, the nucleic acid constructs in the modified PRV strain are stable and free of mutations or deletions after passage of 5 generations in porcine kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell line is ATCC® CCL-33 ™ cells obtained from the American Type Culture Collection. In some embodiments, a cell line is provided that is transfected with a nucleic acid construct as described herein in a manner suitable for the production of a virus useful in a tetravalent vaccine. In some embodiments, the nucleic acid constructs described herein are inserted into the PRV strains described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is a PK-15 cell as described herein. In another aspect, the invention provides a trivalent PRV vaccine against PCV2, CSF and PRV. According to this aspect, a nucleic acid construct is prepared, which includes a gene of PCV2 and a gene of CSF. In some embodiments, the PCV2 gene and the CSF gene line are as set forth herein. In some embodiments, each gene is operably linked to a promoter that is active in mammalian cells. In some embodiments, the promoter is as set forth herein. In some embodiments, each gene is operably linked to a terminator sequence operable in a mammalian cell. In some embodiments, the terminator sequence is as set forth herein. In some embodiments, a nucleic acid construct is provided that includes a PCV2 gene and a CSF gene as set forth herein. In some embodiments, the nucleic acid construct further comprises a promoter and / or a terminator as set forth herein. In some embodiments, the nucleic acid construct further comprises a gG sequence of PRV. In some embodiments, the PRV is the PRV Bartha-K61 strain. In some embodiments, the nucleic acid construct comprises a nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments a PRV strain is provided, wherein the PRV strain is modified to contain a nucleic acid construct as set forth herein. In some embodiments, the modified PRV strain is as set forth herein. In some embodiments, the nucleic acid constructs in the modified PRV strain are stable and free of mutations or deletions after passage of 5 generations in porcine kidney 15 (PK-15) cells. In some embodiments, the PK-15 cell line is as set forth herein. In some embodiments, a cell line is provided that is transfected with a nucleic acid construct as described herein in a manner suitable for the production of a virus useful in a trivalent vaccine. In some embodiments, the nucleic acid constructs described herein are inserted into the PRV strains described herein by homologous recombination in a transfected cell line. In some embodiments, the cell line is a PK-15 cell as described herein. When preparing a nucleic acid construct, multiple DNA fragments can be manipulated to provide the DNA sequence in an appropriate orientation and, if necessary, in an appropriate reading frame. To this end, adaptors or linkers may be used to join the DNA fragments, or other manipulations may be involved to provide convenient restriction sites, remove excess DNA, remove restriction sites or the like. For this purpose, it may involve in vitro mutagenesis, primer repair, restriction, annealing, re-substitution (e.g., conversion and transversion). The nucleic acids of the invention can also be synthesized completely or partially by methods known in the art, especially when it is desired to provide plant-preferred sequences. Thus, all or a portion of the nucleic acids of the invention can be synthesized using codons preferred by the host of choice. Species-preferred codons can be determined, for example, from the most commonly used codons in proteins expressed in a particular host species. Other modifications of the nucleotide sequence can produce mutants with slightly altered activity. Tetravalent recombinant PRV or trivalent recombinant TRV lines are prepared by transfection of a suitable cell line, such as the PK-15 cell line described herein. In some embodiments, the cell line is transfected with a nucleic acid construct and PRV nucleocapsid DNA as set forth herein. In some embodiments, the PRV nucleocapsid DNA is modified to contain a nucleic acid construct for expressing red fluorescent protein (RFP). The tetravalent recombinant PRV or trivalent recombinant TRV is passaged in PK-15 cells for several generations to ensure that there are no mutations or deletions in the viral nucleic acid of the stable recombinant virus. In some embodiments, passage 5 is sufficient to produce a stable recombinant virus. After preparation, the recombinant TRV virus can be replicated in a suitable cell line. In some embodiments, the cell line is a PK-15 cell line (cell) as set forth herein. In some embodiments, the cell line (cell) is a young hamster kidney 21 (BHK21) cell line. In some embodiments, the BHK21 cell line is BHK21 (pure line 13). In some embodiments, the BHK21 (pure line 13) cell line ATCC® CCL-10^TM It can also be purchased from the American Strain Preservation Center. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and Pseudorabies Virus (PRV) are the main causes of infectious reproductive disorders in pigs and cause significant losses to the pig industry worldwide. In addition, PCV2 and classical swine fever cause devastating diseases and have a serious impact on animal welfare and economy in many Asian countries. The development of a multivalent vaccine approach could potentially reduce vaccine administration to a single dose schedule covering all four viruses, which greatly helps protect pigs from the status of the four diseases. Select live attenuated PRV Bartha-K61 as the carrier for multivalent vaccine development. The genome structure and genetic background of PRV Bartha-K61 strain are relatively well defined, and the reported amplification and stable performance of foreign genes will not affect the stability of the virus itself (Boldogkoi, Nogradi, 2003). As explained herein, the four-valent PRVs expressing PCV2-ORF2, CSF-E2 and PRRSV-ORF5 and the three-valent PRVs expressing PCV2-ORF2 and CSF-E2 were cloned into the PRV Bartha K-61 vaccine strain gG locus. Replication analysis and stability tests revealed that recombinant PRV (trivalent or tetravalent PRV) is as effective and stable and replicates in vitro as PRV Bartha K-61. This demonstration does not insert foreign genes into the PK and gG loci of PRV. Will affect PRV replication. In addition, immunogenicity studies in mouse experiments have shown that tetravalent PRV induces a large number of serum-specific humoral antibodies against PCV2-ORF2, CSF-E2, and PRRSV-ORF5 antigens. Similarly, trivalent PRV induces anti-PCV2-ORF2 and CSF-E2 serum-specific humoral antibody. These results indicate a novel way to develop a polyvalent immune gene from a major porcine virus in PRV Bartha K-61 to develop a multivalent vaccine against PCV2, CSF or PRRSV and including pseudorabies. The recombinant pseudorabies virus vector of the present invention comprising ORF2 of PCV2, E2 of CSF and ORF5 of PRRSV can effectively induce antibodies against all four diseases, which allows cost-effective mass production in a single preparation. According to the present invention, both trivalent and tetravalent recombinant vaccines were stable after 5 consecutive passages in the PK15 / BHK21 cell line. Insertion of two or three genes in a single insertion site is extremely stable and shows neither genetic instability nor transcriptional modification by the inserted gene. According to the present invention, it has been found that inserting multiple genes into a single insertion site of the gG locus of PRV-Bartha does not affect the virus titer. The invention also provides a method of use. In one embodiment, the invention provides a method of eliciting a protective immune response in an individual (e.g., a pig) comprising administering to the individual a prophylactic, therapeutic, or immune effective amount of a recombinant PRV as set forth herein. In another embodiment, the invention provides a method for preventing an individual from developing PRV, PRRSV, PCV2 and CSF or PRV, PCV2 and CSF, comprising administering to the individual a prophylactic, therapeutic or immune effective amount of a recombinant PRV as set forth herein . As used herein, "administration" means delivery using any of a variety of methods and delivery systems known to those skilled in the art. Administration can be performed, for example, intraperitoneally, intracerebrally, intravenously, orally, transmucosally, subcutaneously, percutaneously, intradermally, intramuscularly, topically, parenterally, via implantation, intrathecally, intralymphally, Intralesional, pericardial or epidural. The agent or composition can also be administered in the form of an aerosol, for example for pulmonary and / or intranasal delivery. The administering may be performed, for example, once, multiple times, and / or over one or more extended periods. Priming a protective immune response in an individual can be achieved, for example, by administering a single dose of the vaccine to the individual, followed by one or more subsequent administrations of the vaccine after a suitable period of time. A suitable period of time between administration of the vaccine can be easily determined by those skilled in the art, and is usually about several weeks to several months. However, the invention is not limited to any particular method, route or frequency of administration. A "prophylactically effective dose" or "immunologically effective dose" is any vaccine that induces an immune response in an individual that protects the individual from infection with the virus or the condition when administered to an individual that is susceptible to the virus or is susceptible to the disease the amount. "Protecting" an individual means reducing the likelihood that the individual will be infected with the virus or reducing the likelihood of the individual's disease to occur at least 2 times, preferably at least 10 times. For example, if an individual has a 1% chance of contracting the virus, a two-fold reduction in the individual's chance of contracting the virus will give the individual a 0.5% chance of contracting the virus. Optimally, the "prophylactically effective dose" induces an immune response in the individual that completely prevents the individual from becoming infected with the virus or completely prevents the onset of the individual's condition. Certain embodiments of any of the immunological and therapeutic methods of the invention may further comprise administering at least one adjuvant to the individual. "Adjuvant" shall mean any agent suitable for enhancing the immunogenicity of an antigen and enhancing the immune response of an individual. Numerous adjuvants (including particulate adjuvants) and methods of combining adjuvants and antigens suitable for use with both protein-based and nucleic acid-based vaccines are well known to those skilled in the art. Adjuvants suitable for use with protein immunization include, but are not limited to, alum, Freund's complete adjuvant (FCA), fluorine incomplete adjuvant (FIA), alum adjuvants, saponin-based adjuvants Agents (for example, Quil A and QS-21) and the like. It should be understood that when the virus strains described herein are used to elicit a protective immune response in an individual or to prevent an individual from suffering from a virus-related disease, it is a composition that additionally comprises one or more physiologically or pharmaceutically acceptable carriers Form is administered to the individual. Pharmaceutically acceptable carriers are well known to those skilled in the art and include (but are not limited to) 0.01 M-0.1 M and preferably 0.05 M phosphate buffered saline, phosphate buffered saline (PBS) or 0.9% saline One or more. These carriers also include aqueous or non-aqueous solutions, suspensions and emulsions. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, saline and buffered media. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (eg, olive oil), and injectable organic esters (eg, ethyl oleate). Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution, and non-volatile oil. Intravenous vehicles include fluid and nutritional supplements, electrolyte supplements (e.g., based on Ringer's dextrose), and the like. The solid composition may include a non-toxic solid carrier such as glucose, sucrose, mannitol, sorbitol, lactose, starch, magnesium stearate, cellulose or a cellulose derivative, sodium carbonate, and magnesium carbonate. For administration, for example, in the form of an aerosol for pulmonary and / or intranasal delivery, it is preferred to administer the agent or composition with a non-toxic surfactant (e.g., an ester or partial ester of a C6 to C22 fatty acid or a natural glyceride and Propellant). Additional carriers such as lecithin can be included to facilitate intranasal delivery. Pharmaceutically acceptable carriers may further contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, preservatives, and other additives, such as antimicrobials, antioxidants, and chelating agents, which increase the shelf life of the active ingredients and / or Effectiveness. As is well known in the art, the compositions of the present invention can be formulated to provide rapid, sustained or delayed release of the active ingredient after administration to an individual. The invention also provides a kit for immunizing an individual with a recombinant PRV as set forth herein. The kit contains the recombinant PRVs described herein, pharmaceutically acceptable carriers, applicators, and explanatory materials on their use. The invention includes other embodiments of sets known to those skilled in the art. The instructions can provide any information that can be used to guide the administration of a stable cold-adapted temperature-sensitive virus strain or its inactive form as described herein. The invention provides vaccine technology related to the virus strains described herein. In one embodiment, the virus strains described herein are used in a method of manufacturing a vaccine. In another embodiment, the nucleic acid building systems described herein are used in a method of manufacturing a vaccine. In another embodiment, the virus strains described herein are used in vaccine development. In another embodiment, the nucleic acid building systems described herein are used in vaccine development. Unless otherwise indicated, the practice of this invention employs conventional chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture, and transgenic biology techniques, which are known to those skilled in the art . See, e.g., Maniatis et al., 1982,Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook et al., 1989,Molecular Cloning , 2nd edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Sambrook and Russell, 2001,Molecular Cloning , 3rd Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); Ausubel et al., 1992,Current Protocols in Molecular Biology (John Wiley & Sons, including regular updates); Glover, 1985,DNA Cloning (IRL Press, Oxford); Russell, 1984,Molecular biology of plants: a laboratory course manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Anand,Techniques for the Analysis of Complex Genomes (Academic Press, New York, 1992); Guthrie and Fink,Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Harlow and Lane, 1988,Antibodies , (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York);Nucleic Acid Hybridization (Edited by B. D. Hames and S. J. Higgins, 1984);Transcription And Translation (Edited by B. D. Hames and S. J. Higgins, 1984);Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987);Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal,A Practical Guide To Molecular Cloning (1984); ThesisMethods In Enzymology (Academic Press, Inc., N.Y.);Methods In Enzymology , Vols. 154 and 155 (edited by Wu et al.),Immunochemical Methods In Cell And Molecular Biology (Edited by Mayer and Walker, Academic Press, London, 1987);Handbook Of Experimental Immunology , Volumes I-IV (edited by D. M. Weir and C. C. Blackwell, 1986); Riott,Essential Immunology , 6th edition, Blackwell Scientific Publications, Oxford, 1988; Fire et al.,RNA Interference Technology: From Basic Science to Drug Development , Cambridge University Press, Cambridge, 2005; Schippers,RNA Interference in Practice , Wiley-VCH, 2005; Engelke,RNA Interference (RNAi): The Nuts & Bolts of siRNA Technology , DNA Press, 2003; Gott,RNA Interference, Editing, and Modification: Methods and Protocols (Methods in Molecular Biology) , Human Press, Totowa, NJ, 2004; Sohail,Gene Silencing by RNA Interference: Technology and Application , CRC, 2004. Examples The invention is illustrated by reference to the following examples, which are provided by way of illustration and are not intended to limit the invention in any way. Utilize standard techniques that are well known in the industry or those specifically described below. Example 1 methodChoice of immunogen : Based on phylogenetic analysis of epidemic strains, the ORF2 gene from PCV2 Indonesia strain (genotype 2B) (PCV2 TLL-Indo, gene bank accession number KX130941) was selected. In addition, PCV2 genotype 2B is a highly dominant genotype in pig populations (Opriessnig et al., 2013). The E2 gene was selected from the newly emerged subgenotype 2.1 of the CSF Indonesia strain (CSF TLL-Indo, gene bank accession number KX130940). The ORF5 gene was selected from the HP-PRRSV (highly pathogenic PRRSV-JXA1) Chinese strain, which is highly similar to the currently prevalent PRRSV strain (Yin et al., 2012; Jantafong et al., 2015).Construction of Recombinant Transfer Plastids and Synthetic Genes : The ORF2 gene from the PCV2 strain and the E2 from the CSF strain were amplified and individually cloned into XhoI / ApaI and HindIII / BamHI restriction sites of the intermediate pcDNA3.1 + vector (Invitrogen), respectively. A synthetic gene (ORF5-BGH-EF1α) containing a combination of ORF5 of PRRSV strain, bovine growth hormone (BGH) sequence and elongation factor 1α promoter (EF1α) sequence (Genscript, USA) was synthesized. One such synthetic gene has the sequence shown in SEQ ID NO: 3. BglII and AgeI restriction sites were included. For the construction of the quadrivalent rPRV vaccine, the BglII / AgeI restriction of the ORP5-BGH-EF1 fragment was cloned into the transfer plastid pUC-gG-MCS (Figure 1) (courtesy of Prof. Enquist, Princeton University, USA) Site. pUC-gG-MCS is a pUC57 plastid inserted with a synthetic construct consisting of the gG locus of PRV Bartha. Using primer AgeI-ORF2 F: 5’- CTGACCGGT ATGACGTATCCAAGGAGGCG-3 '(SEQ ID NO: 4; underlined is the AgeI site) and ORF2-R-XhoI: 5’-CGGCTCGAG CCATAGAGCCCACCGCATC-3 '(SEQ ID NO: 5; XhoI site underlined) Amplifies the ORF2-BGH fragment from pcDNA3.1 + and selects it for transfer to pUC-gG-MCS (Figure 1). AgeI / XhoI restriction sites. Similarly, using the primer SalI-CMV + E2-F: 5'-CGCGTCGAC GTTGACATTGATTATTGAC-3 ’(SEQ ID NO: 6; SalI site underlined) and NotI-E2-R: 5’-TAAAGCGGCCG CACCAGCGGCGAGTG TTCTG-3 '(SEQ ID NO: 7; NotI site underlined) Amplifies the CMV-E2 fragment from pcDNA3.1 + and selects it for transfer to pUC-gG-MCS (Figure 1) In the SalI / NotI restriction site. The recombinant transfer plastid pUC-gG-ORF5-ORF2-E2 was verified by PCR and sequencing. The sequence of the nucleic acid comprising gG-CMV-ORF5-BGH-EF1-orf2-BGH-CMV-E2-SV40-gG is listed in SEQ ID NO: 1. For the construction of trivalent rPRV vaccine, use primer AgeI-ORF2 F: 5’-CTGACCGGT ATCACGTATCCA AGGAGGCG-3 ’(SEQ ID NO: 4; underlined is the AgeI site) and ORF2-R-XhoI: 5’-CGGCTCGAG CCATAGAGCCCACCGCATC-3 '(SEQ ID NO: 5; XhoI site underlined) Amplifies the ORF2-BGH fragment from pcDNA3.1 + and selects it for transfer to pUC-gG-MCS (Figure 1). AgeI / XhoI restriction sites. Using primer SalI-EF1 F PCR: 5’-GCGTCGAC CGTGAGGCTCCGGT 3 ’(SEQ ID NO: 8; SalI site underlined) and NotI-E2-R: 5’-TAAAGCGGCCGC ACCAGCGGCGAGTTGTTCTG 3 '(SEQ ID NO: 7; NotI site underlined) The synthetic EF1α promoter and the amplified E2 fragment were separately cloned to the SalI / NotI restriction of the transfer plastid pUC-gG-MCS (Figure 1) Site. The recombinant transfer plastid pUC-gG-ORF2-E2 was verified by PCR and sequencing. The sequence of the nucleic acid comprising gG-CMV-ORF2-BGH-EF1-E2-SV40-gG is listed in SEQ ID NO: 2.Quadrivalent and trivalent restructuring PRV Generation : PRV Bartha's nucleocapsid DNA expressing red fluorescent protein (RFP) was linearized by EcoRI enzyme (courtesy of Prof. Enquist, Princeton University, USA) for recombination. The plastids pUC-gG-ORF5-ORF2-E2 or pUC-gG-ORF2-E2 were digested with HindIII to release the constructs for assembly. In short, PK-15 cells were⁶ Cells / well were seeded in 6-well plates. Using Lipofectamine 2000, 3 ug of digested construct DNA gG-ORF5-ORF2-E2 (quaternary PRV vaccine) or gG-ORF2-E2 (trivalent PRV vaccine) and 5 ug of linearized PRV-RFP nucleocapsid The DNA was co-transfected into PK-15 cells. After the cytopathic effect occurred, the transfected offspring were plated in PK-15 cells for plaque purification.Plaque analysis : Self-diluting the transfection supernatant containing the recombinant virus (after freezing-thawing) 10^-1 Titration to 10^-6 With PK-15 cell culture at 37 ° C and supplied with 5% CO₂ Incubate together for 1 hour. The supernatant was removed and replaced with a 1% agarose overlay. After 48 hours, virus plaques that do not show a fluorescent signal were selected. After 3 to 4 rounds of plaque purification, the selected plaques were passaged in PK-15 cells and the recombinant virus was sequenced to confirm the presence of the introduced genes (ORF2, E2 and ORF5) and the absence of mutations.Performance analysis by indirect immunofluorescence analysis : Analysis of trivalent or tetravalent rPRV-infected cells by immunofluorescence staining using CSF-E2-specific multiple strains or PCV2-ORF2-specific monoclonal antibodies. In short, at 37 ° C and 5% CO₂ The PK15 cells were infected with trivalent or tetravalent rPRV for 36 h. After fixation, cells were infiltrated with 0.1% Triton X-100 and incubated with anti-E2 or anti-ORF2 antibodies for 1 h at 37 ° C. Cells were then incubated with FITC-conjugated rabbit anti-mouse antibody (DAKO Cytomation, Copenhagen, Denmark). The fluorescence signal was detected with an inverted fluorescence microscope (Olympus, Essex, UK) and the image was captured by a digital imaging system (Nikon, Tokyo, Japan).Reorganization PRV Vaccine PK15 and BHK21 Kinetics of replication in cell lines : To study virus replication in different cell lines, PK15 or BHK21 cells were infected with PRV-Bartha or trivalent rPRV or tetravalent rPRV at a MOI of 5. After 1 h at 37 ° C, the cells were washed twice with phosphate buffered saline (PBS) and 1 mL of medium containing 2% FBS was added. The plates were incubated at 37 ° C for 24 h and 48 h. At these time points, cells were lysed by three freezing and thawing cycles, and virus-containing supernatants were stored at -80 ° C. Viral titrations were performed on PK15 cells in triplicate, with each cell type and time point repeated three times. Reed and Muench methods (Reed and Muench, 1938) were used to calculate virus titer and expressed it as 50% tissue culture infection dose / volume (TCID₅₀ / mL).Reorganization PRV Genetic stability of vaccine constructs : Passage the recombinant PRV vaccine construct in PK15 cells up to 5 times in a row. After 5 consecutive passages, trivalent rPRV or tetravalent rPRV vaccine constructs were verified by PCR and sequencing to confirm the absence of mutations or deletions.Study of Immunogenicity in a Mouse Model : Use 10 on day 0 and 21⁶ TCID₅₀ Attenuated PRV Bartha (negative control), bivalent rPRV (PRV and ORF2), trivalent rPRV (PRV, ORF2 and E2), tetravalent (PRV, ORF2, E2 and ORF5) and PBS control Female BALB / c mice (n = 8 / group) to seven weeks of age were vaccinated. Sera were collected on days 20 and 42. The immunogenicity of recombinant vaccine constructs was evaluated on the 20th and 42th days by indirect ELISA based on serum PRV-specific antibody titers, PCV2-ORF2, CSF-E2 and PRRSV-ORF5 specific antibody titers.By indirect ELISA Measurement of specific antibody titers : Serum-specific antibody titers against PRV, PCV2-ORF2, CSF-E2 and PRRSV-ORF5 antigens were tested by indirect ELISA. Briefly, a microtiter well ELISA is coated with purified PRV virus antigen or PCV2-ORF2 or CSF-E2 or PRRSV-ORF5 antigen in a coating buffer (0.1 mol / liter carbonate-bicarbonate, pH 9.6). board. Serum samples (diluted 1:10) were serially diluted twice in 3% skim milk powder in PBS containing 0.05% Tween 20, and added to the plate in triplicate. After washing three times with PBS-T, horseradish peroxidase (HRP) -conjugated goat anti-mouse immunoglobulin (DAKO) diluted 1000-fold was added to each well. The reaction was caused by a 100 ml TMB substrate (3, 3 ', 5, 5'-tetramethylbenzidine) and the reaction was terminated by 50 ml of 2 M H2SO4. The optical density at 450 nm was measured using a microplate absorbance reader (Tecan, Switzerland). Example 2 Construction and Characterization of a Recombinant PRV Vaccine The linear transfer plastid (pUC-gG-quaternary / pUC-gG-trivalent) cassette was integrated into PRV Bartha DNA by homologous recombination to generate PCV2-ORF2 and CSF-E2 A recombinant trivalent PRV vector (trivalent PRV-ORF2-E2) and a quadrivalent PRV vector (tetravalent PRV-ORF5-ORF2-E2) expressing PCV2-ORP2, CSF-E2, and PRRSV-ORF5 (Figure 1). After transfection, the resulting recombinants were plaque-purified by selecting non-red fluorescent plaques on PK15 cells. Re-screening of positive recombinants. After 3-4 plaque purifications, the positive recombinants were analyzed by sequencing and titrated in PK15 cells. In addition, immunofluorescence analysis of individual ORF2 or E2-specific antibodies demonstrated the effective performance of ORF2 or E2 proteins by a single PRV vector (Figures 2A and 2B). In contrast, no fluorescent cells were observed for the PRV negative control. Moreover, the stability test revealed that the recombinant vaccine (tetravalent rPRV or trivalent rPRV) was stable after 5 consecutive passages in PK15 cells without mutations or deletions. Example 3 Replication in PK15 and BHK21 Cells To investigate whether the insertion or expression of an exogenous transgene in the gG locus affects the replication properties, the recombinant PRV vaccine constructs (trivalent rPRV, tetravalent rPRV) and parents were compared in PK15 and BHK21 cells. One-step growth kinetics of PRV Bartha strain. Viral titers of both trivalent and tetravalent PRV vaccine constructs showed 10 in PK15 cells and BHK21 cells, respectively⁸ TCID₅₀ And 10^8.3 TCID₅₀ And copy the potency with PRV-Bartha (TCID₅₀ 10^8.5-8.7 The parent strains are comparable. Example 4: Immunogenicity study in a mouse model The results showed that mice immunized with a tetravalent PRV vaccine showed serum-specific antibody contents against PRV, E2, ORF2, and PRRSV. In addition, mice vaccinated with the trivalent PRV vaccine induced serum-specific antibody contents against PRV, ORF2, and E2 antigens (Figure 3). Antibody titer results showed that mice immunized with bivalent rPRV (ORF2) showed an antibody titer of> 260 against PCV2-ORF2 antigen. In addition, mice immunized with trivalent PRV and tetravalent PRV vaccines showed antibody titers of 240 and 180 against ORF2 antigen, respectively. In addition, both trivalent and tetravalent PRV vaccines showed antibody titers of> 256 against classical swine fever E2 glycoprotein (Figure 4). Unless otherwise indicated herein or the context is clearly contradictory, the terms "a (" a "and" an ")" and "the" and similar indicators are used in the context of the present invention (especially in the context of the scope of patent application below). Both should be understood to cover both the singular and the plural. Unless otherwise noted, the terms "including," "having," "including," and "containing" are to be construed as open-ended terms (ie, meaning "including but not limited to"). Unless otherwise indicated herein, the enumeration of numerical ranges herein is intended as a shorthand method for individually referring to each individual value falling within this range, and each individual value is incorporated into this specification as if individually enumerated herein. Unless otherwise indicated herein or otherwise clearly contradicted by context, all methods set forth herein may be implemented in any suitable order. The use of any and all examples or example language (eg, "such as") provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention. Embodiments of the invention are described herein, including the best mode known to the inventors for carrying out the invention. Those skilled in the art will immediately understand the variations of their embodiments after reading the foregoing description. The inventor expects those skilled in the art to adopt these variations as necessary, and the inventor expects that the present invention may be practiced in a manner different from that specifically set forth herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. In addition, unless otherwise indicated herein or otherwise clearly contradicted by context, any combination of the above elements is encompassed by the present invention in all possible variations thereof. Bibliography Dong B, Zarlenga DS, Ren X (2014). An overview of live attenuated recombinant pseudorabies viruses for use as novel vaccines. J Immunol Res 214: 824630. Jantafong T, Sangtong P, Saenglub W et al. (2015). Genetics diversity of porcine reproductive and respiratory syndrome virus in Thailand and Southeast Asia from 2008 to 2013. Vet Microbiol. 176 (3-4): 229-38. Jiang Y, Fang L, Xiao S. et al. (2007). Immunogenicity and protective The efficacy of recombinant pseudorabies virus expressing the two major membrane-associated proteins of porcine reproductive and respiratory syndrome virus. Vaccine, 25, No. 3, 547-560. Klingbeil K, Lange E, Teifke JP, Mettenleiter TC, Fuchs W. (2014 ). Immunization of pigs. With an attenuated pseudorabies virus recombinant expressing the hemagglutinin of pandemic swine origin H1N1 influenza A virus. J Gen Virol, vol. 95, 948-959. Klupp BG, Lominiczi B, Visser N et al. (2012). Mutations affecting the UL21 gene contribute to avirulence of pseudorabies virus v accine strain Bartha. Virol 212: 466-473. Li G, Shi N, Suo S, Cui J, Zarlenga D, Ren X. (2012). Vaccination of mice with ORF5 plasmid DNA of PRRSV; enhanced effects by co-immunizing with porcine IL-15. Immunol Invest. 41 (3): 231-48. Li X, Liu R, Tang H, Jin M, Chen H, Qian P. (2008). Induction of protective immunity in swine by immunization with live attenuated Recombinant pseudorabies virus expressing the capsid precursor encoding regions of foot-and-mouth disease virus. Vaccine, Volume 26, Issue 22, 2714-2722. Liu, J., Chen, I. and Kwang, J. (2005). Characterization of a previously unidentified viral protein in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis. J. Virol. 79: 8262-8274. Nie H, Fang R, Xiong BQ. Et al. (2011). Immunogenicity and protective efficacy of two recombinant pseudorabies viruses expressing Toxoplasma gondii SAG1 and MIC3 proteins. Vet Parasitol, Vol. 181, Issues 2-4, 215-221. Opriessnig T, O'Neill K, Gerber PF, de Castro AM et al. ( 201 3). A PCV2 vaccine based on genotype 2b is more effective than a 2a-based vaccine to protect against PCV2b or combined PCV2a / 2b viremia in pigs with concurrent PCV2, PRRSV and PPV infection. Vaccine. 31 (3): 487-94 PomeranZ, LE, Reynolds, AE and Hengartner, CJ (2005). Molecular biology of pseudorabies virus: impact on neurovirology and veterinary medicine. Microbiol Mol Biol Rev 69, 462-500. Qiu HJ, Tian ZJ, Tong GZ, etc., (2005). Protective immunity induced by a recombinant pseudorabies virus expressing the GP5 of porcine reproductive and respiratory syndrome virus in piglets. Vet Immunol Immunopathol, Volume 106, Issue 3-4, 309-319. Reed, LJ. Muench, H A (1938). Simple method of estimating fifty percent endpoints. Am. J. Epidemiol. 27,493-497. Song Y, Jin M_, Zhang S et al. (2007). Generation and immunogenicity of a recombinant pseudorabies virus expressing cap protein of porcine circovirus type 2. Vet Microbiol, Vol. 119, No. 2-4, 97-104. Xu G, Xu X, Li Z Et al. (2004). Construction of recombinant pseudorabies virus expressing NS1 protein of Japanese encephalitis (SA14-14-2) virus and its safety and immunogenicity. Vaccine, Vol. 22, No. 15-16, 1846-1853. Yin G, Gao L, Shu X, Yang G, Guo S, Li W. (2012). Genetic diversity of the ORF5 gene of porcine reproductive and respiratory syndrome virus isolates in southwest China from 2007 to 2009. PLoS One. 7 (3): e33756 Zhang H, Li X, Peng G, Tang C, Zhu S, Qian S, Xu J, Qian P. (2014). GlycoproteinE2 of classical swine fever virus expressed by baculovirus induces the protective immune responses in rabbits. Vaccine, 32 (49 ): 6607-13.

FIG. 1 shows a strategy for constructing an rPRV according to an embodiment of the present invention. Pseudorabies virus (the PRV) genome: the unique long region (U _L), the internal repeat (IR), the unique short region (of Us) and terminal repeats (TR). The four-valent PRV showed PRRSV-ORF5, PCV2-ORF2, and CSF-E2; the three-valent PRV showed PCV2-ORF2, CSF-E2. Abbreviations: N-gG = N (amino) terminus of glycoprotein G; C-gG = carboxy terminus of glycoprotein; PK = protein kinase; CMV ie = immediate early promoter of human cytomegalovirus; EF1α promoter = extension Factor 1 alpha promoter; terminator SV40 polyA, bovine growth hormone polyadenylation (BGH polyA). Figures 2A and 2B show immunofluorescence analysis of PK15 cells infected with a multivalent vaccine. Figure 2A: 36 hours of PK15 infected with bivalent PRV (ORF2-PRV) or trivalent PRV (ORF2-E2-PRV) or tetravalent PRV (ORF5-ORF2-E2-PRV) at 37 ° C and 5% CO ₂ Immunofluorescence analysis of cells. Anti-ORF2 (mouse hyperimmune serum) signal was observed in all constructs. Figure 2B: Immunofluorescence analysis of PK15 cells infected with trivalent PRV (ORF2-E2-PRV) or tetravalent PRV (ORP5-ORF2-E2-PRV) for 36 h at 37 ° C and 5% CO ₂ . Anti-E2 (mouse hyperimmune serum) signal was observed in all constructs. Figure 3 shows groups of mice immunized with trivalent or tetravalent PRV vaccines on days 0 and 21 (n = 8 / group). Sera were collected on days 20 and 42. The results showed serum PRV / CSF / PCV2 / PRRSV-specific IgG antibody levels determined by indirect ELISA on days 20 and 42. Figure 4 shows groups of mice immunized with trivalent or tetravalent PRV vaccines on days 0 and 21 (n = 8 / group). Sera were collected on days 20 and 42. The results showed serum PCV2-ORF2 or CSF-E2-specific antibody titers on day 42 (21 days after the second immunization).

Claims (32)

A nucleic acid construct comprising: a pseudorabies virus (PRV) gG gene inserted therein: (a) a promoter active in mammalian cells operably linked to a porcine circular virus (PCV2) ORF2 gene, The porcine circovirus (PCV2) ORF2 gene is operably linked to a terminator that is active in mammalian cells, and (b) is operably linked to the classical swine fever (CSF) virus E2 gene that is active in mammalian cells As a promoter, the classical swine fever (CSF) virus E2 gene is operably linked to a terminator that is active in mammalian cells. The nucleic acid construct of claim 1, wherein each promoter line that is active in mammalian cells is a cytomegalovirus (CMV) immediate early (ie) promoter or an elongation factor 1 alpha (EF1 alpha) promoter. The nucleic acid construct of claim 1 or 2, wherein each terminator that is active in mammalian cells is a bovine growth hormone (BGH) polyadenylation sequence (polyA) or simian virus 40 (SV40) polyA. The nucleic acid construct of claim 1 or 2, wherein the PCV2 ORF2 gene has the sequence listed in nucleotides 3063-3767 of SEQ ID NO: 1, and the CSF E2 gene has the nucleotide of SEQ ID NO: 1 4729-5916. The nucleic acid construct of claim 1 or 2, wherein the nucleic acid construct has a nucleotide sequence as set forth in SEQ ID NO: 2. A vector comprising a nucleic acid construct according to any one of claims 1 to 5. A mammalian cell line transfected with a nucleic acid construct according to any one of claims 1 to 5 and a linearized PRV nucleocapsid nucleic acid. The mammalian cell line of claim 7, which is a PK-15 cell line. The mammalian cell line of claim 7 or 8, wherein the PRV is PRV Bartha-K61. A trivalent recombinant PRV comprising a nucleic acid construct according to any one of claims 1 to 5. The reorganized PRV of claim 10, wherein the PRV is PRV Bartha-K61. A vaccine comprising a recombinant PRV as claimed in claim 10 or 11 and a physiologically acceptable carrier. A use of a recombinant PRV as claimed in claim 10 or 11 for the manufacture of a medicament that elicits a protective immune response in an individual. A use of a recombinant PRV as claimed in claim 10 or 11 for the manufacture of a medicament for the prevention of PRV, PCV2 and CSF in an individual. A use of a recombinant PRV as claimed in claim 10 or 11 for vaccine development. The recombinant PRV of claim 10 or 11 is used for vaccine development. A nucleic acid construct comprising: a pseudorabies virus (PRV) gG gene inserted therein: (a) an active promoter in mammalian cells operably linked to the porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 gene , The porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 gene is operably linked to a terminator that is active in mammalian cells, (b) the mammalian cell is operably linked to the porcine circular virus (PCV2) ORF2 gene An active promoter, the porcine circular virus (PCV2) ORF2 gene is operably linked to a terminator that is active in mammalian cells; and (c) is operably linked to the classical swine fever (CSF) virus E2 gene A promoter that is active in mammalian cells, the classical swine fever (CSF) virus E2 gene is operably linked to a terminator that is active in mammalian cells. The nucleic acid construct of claim 17, wherein each promoter line that is active in mammalian cells is a cytomegalovirus (CMV) immediate early (ie) promoter or an elongation factor 1 alpha (EF1 alpha) promoter. The nucleic acid construct of claim 17 or 18, wherein each terminator that is active in mammalian cells is a bovine growth hormone (BGH) polyadenylation sequence (polyA) or simian virus 40 (SV40) polyA. The nucleic acid construct of claim 17 or 18, wherein the PCV2 ORF2 gene has the sequence listed in nucleotides 3063-3767 of SEQ ID NO: 1, and the CSF E2 gene has nucleotide 4729 of SEQ ID NO: 1 -5916 and the PRRSV ORF5 has the sequence listed in nucleotides 1041-1643 of SEQ ID NO: 1. The nucleic acid construct of claim 17 or 18, wherein the nucleic acid construct has the nucleotide sequence set forth in SEQ ID NO: 1. A vector comprising a nucleic acid construct according to any one of claims 17 to 21. A mammalian cell line transfected with a nucleic acid construct according to any one of claims 17 to 21 and a linearized PRV nucleocapsid nucleic acid. The mammalian cell line of claim 23, which is a PK-15 cell line. The mammalian cell line of claim 23 or 24, wherein the PRV is PRV Bartha-K61. A tetravalent recombinant PRV comprising a nucleic acid construct according to any one of claims 17 to 21. The restructured PRV of claim 26, wherein the PRV is PRV Bartha-K61. A vaccine comprising a recombinant PRV as claimed in claim 26 or 27 and a physiologically acceptable carrier. A use of a recombinant PRV as claimed in claim 26 or 27 for the manufacture of a medicament that elicits a protective immune response in an individual. A use of a recombinant PRV as claimed in any one of claims 26 or 27 for the manufacture of a medicament for the prevention of PRV, PRRSV, PCV2 and CSF in an individual. A use of a recombinant PRV as claimed in claim 26 or 27 for vaccine development. A recombinant PRV as claimed in item 26 or 27, which is used for vaccine development.