KR20240019015A - Method for preparing chimeras of North American and European porcine reproductive and respiratory syndrome viruses - Google Patents

Abstract

The present invention protects against various PRRSVs by simultaneously expressing genetically different antigens of North American and European PRRSV using reverse genetics technology and provides significantly wider cross-immunity than existing live vaccine viruses. A method for producing a viral chimera is provided.

Description

Method for preparing chimeras of North American and European porcine reproductive and respiratory syndrome viruses {Method for preparing chimeras of North American and European porcine reproductive and respiratory syndrome viruses}

The present invention relates to a method for producing chimeric viruses, and more specifically, to a method for producing chimeras of North American and European porcine reproductive and respiratory syndrome viruses.

Porcine reproductive and respiratory syndrome virus (PRRSV) causes one of the most devastating diseases in the swine industry, resulting in significant economic losses. The virus causes complex respiratory syndrome in pigs of all ages and reproductive failure in sows (Nauwynck, HJ, et al., Transboundary and emerging diseases , 59, 50-54. 2012). The main clinical signs of PRRSV in sows often occur in the second trimester of pregnancy, and PRRSV infection is associated with high abortion rates (up to 40%) in the third trimester. Early farrowing and congenital piglet infections can also occur, which can increase pre-weaning mortality, and although clinical signs are often mild or absent in adult pigs, piglet mortality due to emergent highly pathogenic strain infections is low. It can range from 2% to 100% (Montaner-Tarbes, S., et al., Frontiers in Veterinary Science , 6, 38. 2019). Considering the high rate of reproductive failure and wasting syndrome caused by PRRSV infection, the virus contributes to annual productivity losses of $664 million in the United States (Holtkamp, DJ, et al., Journal of Swine Health and Production , 21, 72-84. 2013). PRRSV (order Nidovirales, family Arteriviridae, genus Arterivirus) is a mouse arteriole closely related to lactate dehydrogenase-elevating virus (LDV), which was introduced to North Carolina by infected wild boars from central Europe in 1912. It is believed to have originated from a mouse arterivirus (Plagemann, PG et al., Emerging Infectious Diseases , 9(8), 903-908. 2003). For nearly a century, the virus evolved independently in Europe and North America, forming two major genotypes, type 1 and type 2, respectively. This genotype is not limited to its continent of origin and is widespread worldwide, including Northeast Asia. To control these co-infections, vaccination with both type 1- and type 2-based modified live vaccines (MLVs) may be the best option, as bivalent PRRSV vaccines are not yet commercially available.

However, despite much research since the discovery of porcine reproductive and respiratory syndrome virus (PRRSV), effective prevention and management methods have not yet been developed.

The present invention is intended to solve several problems including the above problems, and uses reverse genetics technology to simultaneously express genetically different antigens of North American and European PRRSV, thereby protecting against various PRRSV and existing live toxins. The purpose is to provide a method for manufacturing chimeras of the North American and European porcine reproductive and respiratory syndrome viruses that can provide significantly broader cross-immunity than vaccine viruses. However, these tasks are illustrative and do not limit the scope of the present invention.

According to one aspect of the present invention, preparing a first genomic portion containing ORF2 to ORF4 and ORF6 but not ORF1ab from the European PRRSV strain genome;

Preparing a second genomic portion including ORF1ab from the North American PRRSV strain genome and including at least one ORF including ORF6 among ORF5 to ORF7;

Designing a sequence in which the first genome part is linked in frame to the second genome part, includes all ORFs of PRRSV, and overlaps ORF6 of the European RRRSV strain genome and the North American PRRSV strain genome:

Preparing a recombinant clone by inserting the designed hybrid genome cDNA into a framework vector;

Transfecting the recombinant clone into host cells and culturing them to proliferate the transfected cells; and

A method for producing infectious chimeric strains of North American and European porcine reproductive and respiratory syndrome viruses is provided, including the step of recovering the chimeric strains from the transfected cells.

According to the method for producing chimeras of the North American and European porcine reproductive and respiratory syndrome viruses of the present invention as described above, a chimeric virus that simultaneously expresses antigens of two genetically very different genotypes (North American type, European type) can be produced. It provides cross-immunity against PRRSV and the European sheep genotype and can be used to manufacture a vaccine for the effective prevention and/or treatment of PRRS disease. Of course, the scope of the present invention is not limited by this effect.

Figure 1 schematically shows the method for producing chimeras of the North American and European porcine reproductive and respiratory syndrome viruses of the present invention. Figure 1 is a schematic diagram showing the structure of four chimeric virus clones (a) and the transcriptional regulatory sequence (TRS, SEQ ID NO. 2). (b).
Figure 2 is a graph showing the analysis results of the virus replication curve after processing the chimera of the present invention and the BP2017-2 and E38 parent strains in MARC-145 cells, and (a) is a graph showing the results of the analysis of chimeric virus production according to continuous passage. (b). An asterisk (*) indicates a significant difference ( p < 0.05) between the chimera and the parent strain.
Figure 3 is a graph showing the results of analyzing the change in copy number of the viral genome in the serum of inoculated pigs over time. The asterisk (*) indicates significant difference ( p < 0.05) between the BP2017-2 group and the E38 and chimera groups. NC, negative control.
Figure 4a is a graph showing the results of analyzing the neutralizing activity of the chimera and parent strain against infection with several PRRSV strains. Asterisks (*) and daggers (†) indicate significant differences ( p < 0.05).
Figure 4b is a diagram classifying the phylogenetic tree of the experimental strain (indicated in a red box) used in the present invention and other representative strains. The tree was generated using a distance-based neighbor joining method using MEGA 11.
Figure 5 is a diagram showing the transcriptional regulatory sequence (TRS)6 inserted between the BP2017-2 genome and the genome of E38 for the construction of the chimeric PRRSV clone of the present invention.

Definition of Terms:

“Porcine Reproductive and Respiratory Syndrome Virus (PRRSV)” used in this document is a virus belonging to the genus Arterivirus, family Arteriviridae, and order Nidovirales, and has a positive-sense single stranded RNA (+ssRNA) genome. It is reported to be approximately 15.4 kb in size and to have 9 ORFs. About 80% of the genome is ORF1a and ORF1b, which encode non-structural proteins (NSP), and the remaining 20% are glycosylated structural proteins GP2, GP3, GP4, GP5, and non-glycosylated membranes. It consists of an ORF encoding the M) protein, and the nucleocapsid (N) protein. The minor structural proteins GP2, GP3, and GP4 form a heterotrimer and act when the virus invades into host cells, and the major structural proteins GP5 and M form a heterodimer to increase the virus' infectiousness. It acts to increase.

“ORF (open reading frame)” used in this document is a protein-coding part where a viral gene is present. ORFs are generally found in the RNA or DNA base sequence of a virus, and the viral RNA or DNA base sequence is divided into units consisting of three bases called codons. ORF is a continuous sequence of codons and is a region that can code for one or more proteins. Viruses often consist of a single RNA molecule or smaller fragment, which may contain one or more ORFs. ORFs are very important for virus survival, and their use can improve understanding of the virus life cycle and replication mechanism, and also play an important role in the development of virus vaccines.

Detailed Description of the Invention:

According to one aspect of the present invention, preparing a first genomic portion containing ORF2 to ORF4 and ORF6 but not ORF1ab from the European PRRSV strain genome;

Preparing a second genomic portion including ORF1ab from the North American PRRSV strain genome and including at least one ORF including ORF6 among ORF5 to ORF7;

Designing a sequence in which the first genome part is connected to the second genome part in frame, includes all ORFs of PRRSV, and overlaps ORF6 of the European RRRSV strain genome and the North American PRRSV strain genome;

Preparing a recombinant clone by inserting the designed hybrid genome cDNA into a framework vector;

Transfecting the recombinant clone into host cells and culturing them to proliferate the transfected cells; and

A method for producing infectious chimeric strains of North American and European porcine reproductive and respiratory syndrome viruses is provided, including the step of recovering the chimeric strains from the transfected cells.

In the above production method, a transcriptional regulatory sequence (TRS) shown in SEQ ID NO: 2 may be additionally included, and the transcriptional regulatory sequence (TRS) may be inserted between the first and second genomic parts.

In the above production method, the chimeric strain may be a strain deposited with accession number KCTC 15431BP and the North American strain may be a BP2017-2 strain deposited with accession number KCTC 13393BP.

In the above production method, the European strain may be an E38 strain having a genomic nucleic acid consisting of the nucleotide sequence shown in SEQ ID NO: 1, the first genomic portion (European type) may be composed of ORF2 to ORF6, and the second The genomic portion (North American type) may include ORF1ab, ORF6, and ORF7.

As used herein, the term “chimeric virus” refers to an avirulent virus capable of eliciting an immune response in a target mammal without causing clinical signs of PRRS disease, and also refers to infection with an attenuated virus and an attenuated virus. This may mean a lower incidence of clinical signs in untreated animals, or a reduction in the severity of signs compared to “control” animals infected with non-attenuated PRRS virus. In this context, the term “reduced/reduced” means a reduction of at least 10%, preferably 25%, more preferably 50%, and most preferably 100% or more compared to the control group as previously defined.

As used herein, a “vaccine composition” may be a PRRS chimeric virus or any immunogenic fragment or fraction thereof, preferably an attenuated PRRS chimeric virus, such as the PRRS chimeric virus of the invention above. This triggers the host's “immunological response” to be a cellular and/or antibody-mediated immune response against PRRSV. Preferably, the vaccine composition is capable of conferring preventive immunity against PRRSV infection and clinical signs associated therewith.

As used herein, “immune response” refers to any cell- and/or antibody-mediated immune response to the chimeric virus or vaccine administered to an animal receiving the PRRSV chimeric virus of the present invention, or a vaccine composition comprising the same. means. Also, as used herein, “immune response” includes, but is not limited to, one or more of the following effects: antibodies, B cells, and antibodies specifically induced against the antigen or antigens contained in the composition or vaccine. , production or activation of helper T cells, suppressor T cells and/or cytotoxic T cells and/or γδ T cells. It is desirable for the host to exhibit a therapeutic or prophylactic immunological response such that resistance to new infections is improved and/or the clinical severity of the disease is reduced compared to a control group that has not received the immunogenic composition or vaccine. Such prevention may be evidenced by a reduction in the frequency or severity of symptoms associated with host infection, including the absence of symptoms up to and including the above-mentioned host infections.

As used herein, the terms “pigs,” “pig,” and “pig” may be used interchangeably. “Vaccinate” also means administering the PRRSV chimeric virus described herein or a vaccine comprising the same prior to exposure to PRRS disease. In addition, “prevention” or “prevention” means a reduction in the clinical occurrence frequency, severity or frequency of signs of PRRS as a result of administration of the PRRSV virus of the present invention or a vaccine composition containing it. The reduction in severity or frequency is a result of comparison with an animal or group of animals that did not receive the PRRSV chimeric virus of the present invention or a vaccine composition containing the same. The animal may preferably be a pig.

The present invention provides a chimeric strain of the porcine reproductive and respiratory syndrome (PRRS) virus, which possesses the ORF1, ORF6, and ORF7 regions of the North American porcine reproductive and respiratory syndrome virus (PRRSV) and at the same time, the European porcine reproductive and respiratory syndrome virus (PRRSV). ) may include ORF2, ORF3, ORF4, ORF5, and ORF6 regions.

The ORF1, ORF6, and ORF7 sequences of the PRRSV chimeric strain of the present invention may be from the BP2017-2 strain, a type of North American PRRSV, and the ORF2, ORF3, ORF4, ORF5, and ORF6 regions may be from the E38 strain, a type of European PRRSV. .

For antigen expression of the PRRSV chimeric strain provided in the present invention, the presence of TRS (Transcriptional Regulatory Signal) present at an appropriate position in the gene may be important. In order for the E38 gene of European PRRSV to be expressed on the genomic backbone of North American PRRSV BP2017-2 strain, appropriate TRS insertion may be important.

In the present invention, the sequence of the restriction enzyme Afe I and part of the TRS 6 sequence of BP2017-2 were inserted into the termination point of the ORF1b sequence of the BP2017-2 strain, and the E38 ORF2 was inserted immediately thereafter. The same sequence was inserted after E38 ORF6 and is connected to ORF6 of BP2017-2. The PRRSV chimeric strain can express the non-structural protein of BP2017-2 and simultaneously express part of the structural protein of BP2017-2 and part of the structural protein of E38. The PRRSV chimeric strain of the present invention has the infectious power to proliferate in MARC 145 cells and has the infectious power to induce an antibody response when inoculated into pigs.

The present invention also provides a pharmaceutical composition for preventing or treating porcine reproductive and respiratory syndrome, comprising an attenuated PRRSV mutant strain and/or subcultured progeny of the mutant strain.

The porcine reproductive and respiratory syndrome may be caused by the European (type 1) or North American (type 2) porcine reproductive and respiratory syndrome virus. The subcultured progeny may be 1 to 80 passages, 1 to 70 passages, 1 to 60 passages, 1 to 50 passages, 1 to 40 passages, 1 to 30 passages, 1 to 20 passages, or 1 to 10 passages of the virus mutant strain. It may contain cultured progeny viruses.

The composition for preventing or treating porcine reproductive and respiratory syndrome of the present invention may contain additional ingredients known to those skilled in the art, and may further include appropriate carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.

Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, These include cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil. When formulating the composition, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations are prepared by mixing the composition with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. It is prepared. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, Withepsol, Macrogol, Tween 61, cacao, laurin, glycerogeratin, etc. can be used.

The preferred dosage of the composition of the present invention varies depending on the individual's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art. For example, for a desirable effect, the composition of the present invention can be administered in an amount of 0.0001 to 1,000 mg/kg (body weight) per day. The composition may be administered once a day, or may be administered several times.

The pharmaceutical composition according to an embodiment of the present invention may be a vaccine composition. The vaccine may be a live vaccine and/or a killed vaccine, and specifically, the attenuated PRRS chimeric virus described herein may be a modified live vaccine containing one or more of the above-described virus strains in a viable state in a pharmaceutically acceptable carrier. . Additionally, inactivated viruses can also be used to produce killed vaccines.

The vaccine may contain an appropriate concentration of PRRSV mutants in consideration of the weight, age, dietary stage, and/or immunity of the administration subject within the scope of PRRS prevention. For example, the dosage of the virus variant in the vaccine composition is in the range of TCID ₅₀ 2 to 6, or TCID ₅₀ 3 to 4, but may vary depending on the type of individual, and is not limited thereto.

The vaccine composition of the present invention can be administered to pigs, and the pigs may be pigs in one or more growth stages selected from the group consisting of weaning stage, growing stage, and fattening stage. The pigs in the weaning period refer to pigs from 7 days or more, 14 days or more, or 21 days or more until they reach a body weight of 30 kg, the growing period refers to the period when the pig weighs 30 to 50 kg, and the fattening period refers to the growing period. It may mean a later period. The pig may be a swine and/or a wild boar, and may be of any breed, but for example, one or more species selected from the group consisting of landrace, Yorkshire, Duroc, Berkshire, and Korean native pigs, 2 There may be more than one species, three or more species, four or more species, or five or more species, and includes all pigs born from crossbreeding between the above species.

The vaccine may further include one or more selected from the group consisting of a carrier, diluent, excipient, and adjuvant. Pharmaceutically acceptable carriers are not particularly limited in type, but may include any solvent, dispersion medium, coating, stabilizer, preservative, antibacterial and antifungal agent, isotonic agent, absorption delay agent, etc.

Vaccine compositions comprising the infectious chimeric strains of the invention may be administered orally, parenterally, subcutaneously, intramuscularly, intradermally, sublingually, transdermally, rectally, transmucosally, superficially via inhalation, buccal administration, or a combination thereof. there is.

The infectious chimeric strain of the present invention or a vaccine composition containing the same may be administered through injection, inhalation, or transplantation, but are not limited thereto. Depending on the desired duration and effectiveness of vaccination or treatment, the attenuated PRRSV mutant strain or a vaccine composition comprising the same may be administered once or multiple times, and also intermittently, for example, in the same amount or different doses every day for several days, weeks, or months. You can. Injections may be administered in the desired amount, by subcutaneous or intranasal spray, or alternatively, continuous infusion.

The pharmaceutical composition of the present invention may be provided in the form of a kit for preventing or treating porcine reproductive and respiratory syndrome. The kit comprises a container, preferably a vaccine composition containing the attenuated PRRS chimeric virus of the invention, a pharmaceutically acceptable carrier, an adjuvant, and an agent for reducing the clinical signs or effects of PRRS infection, preferably the frequency or severity of PRRS. Instructions for use may be included for administering the immunogenic composition to an animal in need thereof. Kits may also include means for injection and/or other forms of administration. Additionally, the kit may include a solvent. The attenuated vaccine can be lyophilized and reconstituted with a solvent to form a solution for injection and/or inhalation. The solvent may be water, saline, buffer, or reinforcing solvent. The kit may include a separate container containing the attenuated virus, solvent, and/or pharmaceutically acceptable carrier. Instructions for use may be labels and/or printed materials affixed to one or more containers.

Currently, the prevalence of type 1 and type 2 PRRSV infections is high in the swine industry, and from an epidemiological point of view, there is no clear global dominance between the two genotypes. Possible options for controlling the two virus types are immunization with a bivalent vaccine or co-immunization with a monovalent vaccine. However, co-infection of two PRRSV types can alter immunogenicity, so an alternative approach is needed (Park, C., et al., Research in Veterinary Science, 103, 193-200. 2015). According to a recent report, a chimeric virus composed of antigens from PRRSV strains can induce broad immunity against the parent strain (Park, C., et al., Veterinary Microbiology , 256, 109048. 2021). In theory, the generation of type 1 and type 2 chimeric PRRSV could provide a solution. To date, there have been no reports of natural type 1 and type 2 chimeric viruses, suggesting that they may need to be produced using laboratory techniques. In the present study, we were able to recover chimeric PRRSV composed of type 1 and type 2 structural proteins. Chimeric viruses were produced only in cells transfected with clones designed to simultaneously express two types of PRRSV M protein (ORF6).

It has been reported that the viral envelope of PRRSV contains a set of eight structural proteins, including one small non-glycosylated protein and seven glycosylated proteins (GP2a-b, GP3, GP4, GP5, GP5a, M and N) (Huang, C., et al., Virus Research , 202, 101-111. 2015). In addition, nsp2, encoded by ORF 1a, was recently found to be integrated within the viral envelope of several isoforms (Kappes, MA, et al., Journal of Virology , 87, 13456-13465. 2013 ). Surprisingly, integration into the envelope of all structural proteins is affected by the absence of either protein. This is because the proteins interact with each other and assemble into virions as a multimeric complex (Dokland, T. Virus Research, 154(1-2), 86-97. 2010). In virions, the major envelope proteins GP5 and M exist as a heterodimeric complex linked by disulfide bonds (Wissink, EHJ, et al., Journal of Virology , 79(19), 12495-12506. 2005). Because the GP5-M complex of the E38 strain is required to encapsulate a nucleocapsid composed of BP2017-2 viral RNA and the N protein, the successful rescue of the chimeric virus may be related to the interaction between the GP5-M heterodimer and the N protein. . Although the interaction between the endodomain of the M protein and the N protein has not been fully characterized, the fact that co-expression of both types of PRRSV M protein is essential to obtain a viable chimeric virus suggests that the BP2017-2 M protein This suggests that N proteins of the same genotype can be recognized. Additionally, the inability to recover viable virus for the clone containing the E38 GP5, M, and N proteins (clone 1) suggests that the sequence type of the backbone must match the N protein type. How the type 1 GP5 and type 2 M proteins of successfully rescued chimeric viruses further interact is still unclear, and the combination of genes essential for chimeric virus rescue remains complex. To complete the replication cycle, the PRRSV RNA-dependent RNA polymerase must transcribe six sub-genomic RNAs, which are then translated into structural proteins that are important for the survival of the virus. To recover the chimeric virus, BP2017-2 polymerase must recognize TRS within the structural protein-coding region of E38. Type 1 and type 2 PRRSV share a common TRS sequence (TTAACC), but there are significant differences (21-42%) in the sequences surrounding the TRS between the two genotypes (Allende, R., et al., Journal of General Virology, 80, 307-315. 1999).

The present invention showed for the first time that type 2 PRRSV polymerase can recognize type 1 PRRSV TRS and translate its protein to generate a chimeric virus. The replication curves showed that the chimeric virus had a significantly lower replication capacity in MARC-145 cells than the parent virus, and the titer of the chimeric virus was 10-100 times lower than that of the parent virus. However, replication capacity was restored through serial passages, indicating adaptation through mutation.

We assessed neutralizing antibody levels to assess the degree of cross-immunity provided by the chimeric virus. The results showed that the chimeric virus displayed a high level of inhibitory activity against type 1 PRRSV infection, with similar percentage inhibition as the parent virus E38, regardless of the field strain tested. However, sera from pigs inoculated with the chimeric virus provided only partial protection against type 2 PRRSV infection, similar to the parent virus BP2017-2. Overall, the results were biased toward high efficacy against type 1 PRRSV because most of the major structural proteins of the chimeric virus were type 1 PRRSV, even though type 2 PRRSV NSP2, M, and N proteins were displayed on the envelope. Additional studies are needed to identify combinations of type 1 and type 2 structural proteins with optimal neutralizing antibody levels against type 2 PRRSV. Nonetheless, the chimeric virus elicited a higher range of neutralizing antibodies that inhibited infection by both genotype variants better than the parent virus. The concept of a chimeric virus carrying PRRSV antigens from both genotypes represents a possible approach to extend cross-immunity to both genotypes in endemic situations. In conclusion, the present inventors successfully generated type 1 and type 2 PRRSV chimeric viruses. Co-expression of M proteins from both genotypes was important for recovery of viable virus. The chimeric virus induces neutralizing antibodies against several field viruses belonging to both genotypes, showing potential as a vaccine candidate. The protective efficacy of the chimeric virus against dual infection by both genotypes of virulent PRRSV can be evaluated and used as a live vaccine candidate in the future.

Specifically, PRRSV (order Nidovirales, family Arteriviridae, genus Arterivirus) is closely related to lactate dehydrogenase-elevating virus (LDV), which was introduced to North Carolina by infected wild boars from central Europe in 1912. It is believed to have originated from mouse arterivirus (Plagemann, PG et al., Emerging Infectious Diseases, 9(8), 903-908. 2003). For nearly a century, the virus evolved independently in Europe and North America, forming two major genotypes, type 1 and type 2, respectively. PRRS virus is highly variable due to the nature of RNA viruses, so there are large genetic differences among PRRS viruses. PRRS virus is largely divided into North American and European types. Type 1 (Lelystad virus, LV), which represents the European type, and Type 2, which represents the Northern American strain ATCC VR2332 (the genome sequence of VR2332 is registered in GenBank) (see number AY150564). The estimated genome sequence homology between the two genotypes ranges from 55% to 63% for non-structural proteins and 58% to 79% for structural proteins (Meng, XJ, et al., Journal of General Virology, 76, 3181 -3188. 1995). These genotypes are not limited to their continent of origin and are widespread worldwide, including Northeast Asia (Jiang, Y., et al., Frontiers in Microbiology , 11, 618. 2020). In the domestic pig farming industry, co-infection with two PRRSV genotypes is frequently reported, and about 22.9% of farms infected pigs with both genotypes positive (Lee, JA, et al., Infection, Genetics and Evolution , 40 , 288-294. 2016). To control these co-infections, vaccination with both type 1- and type 2-based modified live vaccines (MLVs) may be the best option, as bivalent PRRSV vaccines are not yet commercially available. However, the effectiveness of simultaneous vaccination is controversial. One study reported that simultaneous vaccination in pigs provided a similar level of protection as a single vaccination (Kristensen, CS, et al., Vaccine, 36, 227-236. 2018). However, in another study, simultaneous vaccination not only provided low protection against respiratory disease caused by type 1 PRRSV in a dual challenge model, but also significantly reduced the efficacy of type 1-based MLVs, possibly due to interference between the inoculated MLVs ( Park, C., et al., Research in Veterinary Science , 103, 193-200. 2015). PRRSV MLV efficacy may reportedly be affected by infection. For example, concurrent porcine virus infection can alter PRRSV MLV replication in immunized piglets. Possible interference between vaccine strains suggests limitations in current vaccination strategies to protect against prevalent co-infection with type 1 and type 2 PRRSV.

It is known that there is up to 40% genetic difference between the North American and European porcine reproductive and respiratory syndrome viruses, so they do not provide cross-protection. There have even been reports of cases where cross-protection does not occur even between mutant strains belonging to the same type. As a result, standard mutant-based vaccines have been produced for each type of virus, but they do not effectively prevent PRRS due to low cross-protection ability. To overcome this, various attempts are being made to produce vaccines with effective safety, immunogenicity, and protective properties. Due to these limitations, despite the fact that a lot of effort has been invested to develop preventive measures against the porcine reproductive and respiratory syndrome virus (PRRSV), which is the cause of porcine reproductive and respiratory syndrome (PRRS), which causes enormous damage to the livestock industry, for about 30 years since the discovery of this virus. Effective prevention and management methods have not yet been developed.

Various vaccines, including inactivated vaccines and live attenuated vaccines, have been developed to control porcine reproductive and respiratory syndrome virus (PRRSV), but only attenuated vaccines with guaranteed infectivity were found to induce a satisfactory level of protective effect. However, as seen earlier, because porcine reproductive and respiratory syndrome virus (PRRSV) exists in great genetic diversity, cross-immunity between various viruses is absent, making it difficult to protect against various porcine reproductive and respiratory syndrome viruses (PRRSV) with a single vaccine. difficult. In particular, the current vaccine is a monovalent vaccine composed solely of a single, attenuated North American or European strain, and has the disadvantage of being poor in its ability to provide cross-immunity to field strains that are genetically/antigenically different from each other.

Currently, this virus is being detected in most pig farms in Korea, and it is reported that both North American and European types exist simultaneously in approximately 30% of cases. In reality, vaccines are the only means to combat infection by the above viruses, but existing vaccines are known to provide limited efficacy for each genotype. Therefore, a new vaccine is needed that will provide sufficient immunity to the North American and European porcine reproductive and respiratory syndrome viruses that are prevalent nationwide. The present invention prepared a novel chimeric vaccine candidate against porcine reproductive and respiratory syndrome virus (PRRSV) genotypes 1 and 2, which induced neutralizing antibodies against both genotypes. For the purpose of developing chimeric vaccine strains to respond to both types above, the present inventors used reverse genetics on chimeric types 1 and 2 porcine reproductive and respiratory syndrome virus (PRRSV) for the first time. Rescued. Four chimeric infectious clones were designed based on the genomic sequences of structural proteins. However, only clones carrying ORF6 and the transcriptional regulatory sequence (TRS) of type 2 PRRSV and type 1 ORF6 produced viable recombinant viruses, suggesting that co-expression of ORF6 from both parent viruses was not effective for type 1 and type 2 PRRSV. This suggests that it is essential for recovery of chimeric PRRSV. The chimeric virus showed a significantly lower replication ability than the parent strain in vitro , which was improved by serial passage. In vivo , groups of pigs were inoculated with the chimeric virus, one of the parent strains, or PBS, and the chimeric virus replicated in pig tissue and was detected in serum 7 days after inoculation. Serum neutralization tests showed that pigs inoculated with the chimeric virus induced neutralizing antibodies that inhibited infection with both genotype strains to a greater extent than the parental virus. In conclusion, since there is currently no approved commercial bivalent vaccine against type 1 and type 2 PRRSV co-infection, the chimeric virus of the present invention may be a strong vaccine candidate.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but can be implemented in various different forms. The examples below make the disclosure of the present invention complete, and provide those of ordinary skill in the art with the scope of the invention. It is provided to provide complete information.

viruses and cells

The present inventors selected Korean type 2 PRRSV isolate BP2017-2 (GenBank accession No. MK330996, accession number KCTC 13393BP) as the chimeric virus backbone. The viral non-structural protein-coding sequences ORF1a and ORF1ab were used in all infectious clones. E38 (GenBank accession No. KT033457, SEQ ID NO. 1), a Korean type 1 PRRSV isolate, was also used, and the structural proteins (ORF2-ORF7) of strain E38 were used for the chimeric virus. Four species, including two type 1 strains SNU090485 (GenBank accession no. JN315686) and SNU100057 (GenBank accession no. JN411262) and two type 2 PRRSV strains SNU090851 (GenBank no. JN315685) and LMY (GenBank no. DQ473474). of PRRSV field isolates were used in serum neutralization tests. As a result of virus sequence analysis, backbone viruses BP2017-2 and LMY were clustered in lineage 5, a subgroup of type 2 genotype, while SNU090851 was assigned to lineage 1. In the present invention, all type 1 strains were classified as subtype 1. BP2017-2 ORF5 showed 91% and 85.5% nucleotide sequence homology with LMY and SNUVR090851, respectively. E38 ORF5 showed 92.2% and 91.7% nucleotide sequence homology to strains SNU090485 and SNU100057, respectively. MARC-145 cells were used for virus propagation, transfection of infectious clones, and virus recovery. The cells were maintained in appropriate media as previously described (Park, C., et al., Virology , 540, 172-183. 2020).

Design of Chimera Clones

Full-length PRRSV cDNA was assembled from six fragments containing the genome of BP2017-2. Each of the fragments was identified using restriction enzymes. For cloning, an Afe I restriction site (AGCGCT, SEQ ID NO: 3) was inserted between the end of ORF1ab and the beginning of ORF2. All fragments containing the full-length BP2017-2 genome were synthesized de novo (BIONEER Co., South Korea). The first fragment contains the cytomegalovirus promoter and hammerhead ribozyme sequences. The hepatitis delta virus ribozyme sequence was located after the 3' UTR of the last fragment. All fragments were ligated using shared restriction sites to generate a full-length BP2017-2 cDNA clone (Figure 1A). The fragment containing the structural protein coding region and 3′ UTR of the original infectious clone was removed by digestion with Afe </em>I and Not</em> I and replaced with one of four versions of the same region of E38 as described below. Four fragments containing ORFS2-7 of the E38 genome were newly synthesized. The fragment was designed to determine structural proteins essential for the survival of the chimeric virus within the E38 and BP2017-2 genomes. The composition of ORFs 6 and 7 was different in all four versions. Full-length chimeric cDNA clones were generated by linking fragments using shared Afe I and Not I restriction sites. All assembled infectious clones had identical 5' UTR and 3' UTR sequences as the BP2017-2 strain. The assembled full-length cDNA clone was confirmed by genome sequencing. The infectious clone is shown in Figure 1A. The composition of the designed infectious clones is summarized in Table 1 below.

Construction of infectious clones infection clone Organization of the genome collect ORF1a/lab ORF2-ORF5 ORF6 ORF7 Original BP2017-2 BP2017-2 BP2017-2 BP2017-2 Yes Version1 BP2017-2 E38 E38 E38 No Version2 BP2017-2 E38 E38 BP2017-2 No Version3 BP2017-2 E38 BP2017-2 BP2017-2 No Version4 BP2017-2 E38 E38+BP2017-2 BP2017-2 Yes

Recovery of chimeric viruses

Each full-length cDNA clone was transfected into MARC-145 cells as described above (Park, C., et al., Virology , 540, 172-183. 2020). Cell culture supernatants were collected 10 days after transfection and used to infect MARC-145 cells. Immunofluorescence assay (IFA) using PRRSV-specific anti-N protein antibody (SR-30; Rural Technologies Inc., Brookings, SD, USA) at 4 days post infection (dpi) to confirm virus rescue. carried out. A third serial passage was performed to further confirm recovery of the chimeric virus. The successfully recovered virus was passed five times, and then the culture supernatant was collected. The structural gene region (ORF2-7), which is distinct from the backbone virus BP2017-2, was amplified with specific primers, and the amplified PCR product was sequenced to confirm genetic stability. .

In vitro replication kinetics of chimeric viruses

The in vitro replication ability of the recovered chimeric virus was evaluated in MARC-145 cells. The cells were infected with either the parental virus or the chimeric virus (passage 7) at a multiplicity of infection (MOI) of 0.01. Culture media from infected cells were then used for virus titration at 0, 1, 2, 3, 4, and 5 dpi. Viruses harvested at each time point were assessed via IFA in MARC-145 cells and quantified as 50% tissue culture infectious dose (TCID ₅₀ )/mL. All in vitro experiments were performed in triplicate as previously described. Production of chimeric viruses was assessed at passages 3, 7, 10, 15, and 20. MARC-145 cells were infected with supernatants from subcultures at an MOI of 0.01. Viral titers were assessed via IFA in MARC-145 cells at 7 dpi.

animal testing

Animal experiments were performed to evaluate the pathogenicity and immunogenicity of the chimeric virus recovered from infected pigs. Sixteen commercial, crossbred, 3-week-old pigs were randomly assigned to four groups (4 pigs per group). All pigs were confirmed negative for PRRSV, PCV2, Mycoplasma hyopneumoniae , Salmonella , and Haemophilus parasuis by PCR and enzyme-linked immunosorbent assay (ELISA) (antibodies to PRRSV were detected using the IDEXX PRRS X3 Ab kit). . Three groups were inoculated intramuscularly with 2 mL of culture (10 ⁴ TCID ₅₀ /mL) containing the parental virus (BP2017-2 or E38) or chimeric virus (passage 7). PBS was administered as a negative control. During the 28-day experimental period, the physical condition of each pig was monitored and a clinical score (0 [normal] to 6 [severe respiratory distress and abdominal breathing]) was determined to assess virus-induced respiratory symptoms (Halbur, PG, et al . al., Veterinary Pathology , 32, 648-660. 1995). Rectal temperature was measured daily up to 14 dpi and autopsies were performed at 28 dpi to evaluate histopathological lesions due to viral infection. For necropsy, four pigs from each group were euthanized by intravenous injection of pentobarbital sodium. The methods used in this invention were approved by QIA's Institutional Animal Care and Use Committee.

Quantification of viral nucleic acids

Serum samples were collected at 0, 7, 14, 21, and 28 dpi, and viral RNA was extracted from the samples using the QIAamp viral RNA Minikit (Qiagen, France) as described above (Park, C., et al., Veterinary Microbiology, 172, 432-442. 2014). Real-time RT-PCR was performed to quantify PRRSV levels in samples. Levels of BP2017-2 were calculated using specific primer sets described above, while levels of E38 and chimeric viruses were determined using primers designed to detect E38 ORF7 (SEQ ID NOs: 4 and 5). After obtaining the standard curve, test amplification was performed and melting curves of the amplified product were analyzed to confirm the specificity of the PCR analysis based on samples with a cycle threshold (Ct) of less than 35 (Chung, WB, et al ., Journal of Virological Methods , 124, 11-19. 2005). Information on the primers used for the quantification is summarized in Table 2 below.

Primer sequence information 5'-->3' sequence number E38 ORF7 F CCAGTCAGTCAATCAACTGTGC 4 E38 ORF7 R GATTGAAAGCCGTCTGGAT 5

Serology

Serum samples collected at 28 dpi were tested for the presence of neutralizing antibodies against Korean field isolates (SNU090851, LMY, SNU100057, and SNU090485). An ELISA-based serum neutralization test was performed to evaluate infection inhibition against field isolates as described above (Park, C., et al., Veterinary Microbiology , 256, 109048. 2021). Briefly, MARC-145 cells were seeded in ⁹⁶ -well plates at 5 Four-fold diluted serum was mixed with an equal amount of test virus (BP2017-2, LMY, SNU090851, E38, SNU090485, or SNU100057) at 10 ³ TCID _50/100 μL and incubated at 37°C for 1 hour. Negative controls contain only MARC-145 cells without serum or virus, while positive controls contain MARC-145 cells infected with virus without serum. The cells were washed with PBS and cultured for 24 hours. The cells were fixed and washed in 4% formaldehyde, and permeabilization was increased with 0.1% Triton X-100 (Sigma-Aldrich, St. Louis, MO) in PBS. After fixation, the cells were incubated with SR-30 antibody and secondary HRP-conjugated goat-anti-mouse IgG (H+L) (Bethyl Laboratories) and the inhibition rate was calculated. After reaction with TMB peroxidase substrate, color development was measured at 450 nm. The percent infection inhibition of each dilution was calculated and compared to the positive control after subtracting the background absorbance of the negative control.

Pathology and Immunohistochemistry

The histopathology of lung lesions was scored with reference to previous literature (Halbur, PG, et al., Veterinary Pathology , 32, 648-660. 1995). The severity of pneumonia caused by PRRSV was estimated based on the thickness of the interstitium where macrophages and lymphocytes infiltrate in response to virus replication. Lesions in each lung tissue were scored as follows: 0, no lesion; 1, mild interstitial pneumonia; 2, moderate multifocal interstitial pneumonia; 3, moderate metastatic interstitial pneumonia; and 4, severe interstitial pneumonia. Each section was examined in a blinded manner. Immunohistochemistry for PRRSV was performed using the SR30 antibody and samples were analyzed morphometrically. To calculate PRRSV antigen-positive signal, serial tissue sections were analyzed using NIH ImageJ software version 1.43. Ten fields were randomly selected and the number of positive cells per unit area (0.95 mm ² ) was determined.

statistical analysis

Statistical analyzes were performed using GraphPad Prism version 8.4.3 and SPSS version 16.0. Continuous data (viremia, inhibition rate, and PRRSV antigen-positive cell count) were compared using student's t -test or one-way analysis of variance with Tukey's adjustment. Lung microscopy scores were compared using the non-parametric Mann-Whitney U test. All data were expressed as mean ± standard deviation, and statistical significance was set at p < 0.05.

Example 1: Construction of chimeric PRRSV clones

According to one embodiment of the present invention, the BP2017-2 genome was used as the backbone of four chimeric infectious clones in which part of the structural gene region was replaced with an equivalent part of the E38 genome. For clone 1, the genome consisted of the untranslated and non-structural protein coding region of BP2017-2 along with the entire structural protein-coding region of E38 (ORF2-7). The structural regions of the different infectious clones are as follows: ORF2-6 of E38 and ORF7 of BP2017-2 in clone 2; ORF2-5 from E38 and ORF6 and 7 from BP2017-2 in clone 3; Clone 4 contained ORF6 from both parent viruses along with ORF2-6 from E38 and ORF6 and 7 from BP2017-2 (Figure 1A). To improve the viability of the chimeric virus, all chimeric infectious clones contained an additional 40 nucleotides of the partial BP2017-2 ORF5 sequence, including the transcriptional regulatory sequence (TRS)6 between the end of ORF1ab and the start of ORF2a. This sequence was inserted to induce stable transcription of the sub-genomic RNA of the E38 ORF (Figure 5). Infectious clones 2, 3, and 4 contained the same TRS6 sequence preceding the BP2017-2 ORF to initiate transcription of downstream genes (Figure 1B).

Example 2: Recovery of chimeric virus

The present inventors transfected the chimeric clone into MARC-145 cells according to the protocol with reference to prior literature (Park, C., et al., Virology , 540, 172-183. 2020). However, PRRSV-specific cytopathic effects (CPE), such as aggregation and apoptosis, were not observed in cells transfected with clones 1, 2, and 3, whereas CPE was observed in cells transfected with BP2017-2 and clone 4. IFA confirmed the presence of PRRSV antigen in CPE, and its appearance was reproduced after serial passage of the recovered virus. Failure to recover clones 1, 2 and 3 was confirmed using three consecutive blind passages of MARC-145 cells. No viral genes were detected in the culture supernatant of the final subculture by RT-PCR.

Example 3: Virus replication ability

To evaluate replication ability in vitro, the present inventors inoculated the recovered chimeric virus into MARC-145 cells and compared it with the parent viruses BP2017-2 and E38. As a result, the virus titer of BP2017-2 was estimated to be 10 ^3.8 TCID ₅₀ /mL at 1 dpi and reached a peak of 10 ^6.9 TCID ₅₀ /mL at 5 dpi. The titer of E38 increased from 10 ^2.7 TCID ₅₀ /mL at 1 dpi to 10 ^5.8 TCID ₅₀ /mL at 4 dpi and decreased to 10 ^5.6 TCID ₅₀ /mL at 5 dpi. The chimeric virus collected at passage 7 showed a replication curve similar to BP2017-2 during the experimental period. The estimated viral titer was 10 ^1.8 TCID ₅₀ /mL at 1 dpi and reached a peak of 10 ^4.7 TCID ₅₀ /mL at 5 dpi. However, the titer of the chimeric virus was significantly ( p < 0.05) lower (up to 100-fold) than that of the parent virus throughout the experiment ( Fig. 2A ). The production of chimeric virus in MARC-145 cells increased with serial passages and the estimated virus titer was 10 ^3.7 TCID ₅₀ /mL at passage 3, but reached 10 ^5.8 TCID ₅₀ /mL at passage 20. Culture medium was collected at 5 dpi and viral titer was estimated to be TCID ₅₀ /mL (Figure 2B).

Example 4: Clinical evaluation of chimeric clonal infection

Respiratory scores and rectal temperatures of all experimental pigs, including the group infected with the virus of the present invention, remained normal throughout the study. Some pigs in the group infected with the parent virus (T01 and T02) showed low or mild clinical signs such as sneezing and coughing with moderate dyspnea during the 7 days of infection, whereas some pigs in the virus-infected group (T01, T02, and T03) and the negative control group (T04) There was no significant difference between the two. Average daily body weight gain (ADWG) was assessed to determine the effect of infection on growth performance. There was no significant difference in ADWG between the virus infection groups (T01, T02, and T03) and the negative control group (T04) throughout the experiment (see Table 3). The animal experiment design and results are summarized in Table 3 below.

Animal experiment design and results group T01 T02 T03 T04 inoculation BP2017-2 E38 chimera PBS ADWG
(dpi) 28 373.2±47 343.7±13 351.7±25 370.5±36 Prevalence of PRRSV-viremia (dpi) 7 4/4 4/4 4/4 0/4 14 4/4 4/4 4/4 0/4 21 4/4 3/4 3/4 0/4 28 4/4 0/4 2/4 0/4 Prevalence 7 0/4 0/4 0/4 0/4 Anti-PRRSV IgG 14 4/4 4/4 4/4 0/4 Ab-positive 21 4/4 4/4 4/4 0/4 (dpi) 28 4/4 4/4 4/4 0/4 lung lesions 0.66 ± 0.6 0.25 ± 0.31 0.08 ± 0.16 0.25 ± 0.16 score PRRSV antigen 2.91 ± 2.25 1±0.9 1.75 ± 1.03 0

Example 5: Serum viral RNA titers

The viral genes of the present invention were detected at 7-14 dpi in the sera of all virus-infected pigs in groups T01, T02 and T03. However, one pig each in groups T02 and T03 was confirmed serum PRRSV negative by RT-PCR at 21 dpi. Four pigs from T02 and two pigs from T03 also tested negative for PRRSV genome in serum at 28 dpi. In contrast, the viral genome was detected in serum collected from all pigs in the T01 group throughout the experiment (Table 3). The genome copy number of the T01 group (5.6±0.8, 5.5±0.7, and 4.9±0.9 at 7, 14, and 21 dpi, respectively) was significantly higher than that of the T02 group (4.1±0.3, 4.2±0.2, and 2.7±0.9 at 7, 14, and 21 dpi, respectively). 1.8) and were significantly higher ( p <0.05) than those of the T03 group (3.7±0.3, 3.9±0.5, and 2.5±1.7 at 7, 14, and 21 dpi, respectively). PRRSV RNA was not detected in the negative control (T04) at any time point (Figure 3).

Example 6: Histopathology of lung lesions in PRRSV infected pigs

Microscopic lung lesions resulting from PRRSV infection were evaluated after autopsy. There was no significant difference in mean microscopic lung lesion scores between viral infection groups (T01, 0.66 ± 0.6; T02, 0.25 ± 0.31; and T03, 0.08 ± 0.16). Additionally, the lesion scores of the three virus-infected groups were not significantly different from those of the negative control group (T04, 0.25±0.16; Table 3). When immunohistochemistry was applied to the lungs of virus-infected mice, PRRSV antigen was hardly detected. Only a few PRRSV antigen-positive cells were detected in the T01 (2.91 ± 2.25), T02 (1 ± 0.9), and T03 (1.75 ± 1.03) groups, whereas no PRRSV antigen-positive cells were detected in the tissues of the T04 negative control group. The mean score of PRRSV antigen-positive cells per unit area of the lung was not significantly different between groups (Table 3).

Example 7: Neutralizing Antibody Levels

All virus-inoculated pigs seroconverted at 14 dpi. There was no significant difference in the mean ELISA s/p ratio between vaccination groups throughout the experiment. However, the neutralizing activity against infection by field strains, measured as inhibition rate, was significantly different between groups ( p < 0.05). Sera from pigs infected with type 2 PRRSV (T01 and T03) were more effective than sera from pigs infected with E38 (T02) in an ELISA-based neutralization assay using MARC-145 cells. ) showed significantly (p < 0.05) higher virus neutralizing activity against infection (Figure 4A). For the chimeric virus group (T03), the average infection inhibition rate was 38.7 ± 13.1% for LMY, 23.7 ± 10.3% for SNU090851, and 58.7 ± 11.8% for BP2017-2. However, the inhibitory activity against BP2017-2 infection in the chimera group (T03) was significantly lower (58.7 ± 11.8%) than the BP2017-2 group (T01; 81.2 ± 6.2%). In contrast, in an ELISA-based neutralization assay using MARC-145 cells, sera from pigs infected with the E38 and chimeric viruses (T02 and T03, respectively) were more sensitive to type 1 PRRSV (SNU090485, SNU100057) than from pigs infected with BP2017-2 (T01). and E38) showed significantly (p < 0.05) higher virus neutralizing activity against infection (Figures 4A and 4B). The average infection inhibition rate of the chimeric virus group (T03) was 77 ± 11.1% for SNU090485, 71 ± 16.4% for SNU100057, and 95.5 ± 4% for E38. The chimeric group (T03) did not differ significantly from the E38 group (T02) in terms of neutralizing activity against infection by the above three field strains. In addition, ORF5 sequence homology was between 91.7% and 98.6% between type 1 PRRSV strains, 84.2% and 91% between type 2 PRRSV strains, and between 58.4% and 61% between type 1 and type 2 PRRSV strains. The results of analyzing the sequence homology of ORF5 among PRRSV are summarized in Table 4 below.

ORF5 sequence homology between PRRSV strains
strain Sequence homology (%) L.M.Y. SNUVR090851 BP2017-2 SNUVR090485 SNUVR100057 SNUVR090851 84.2 BP2017-2 91 85.5 SNUVR090485 60.3 59 61 SNUVR100057 60.1 58.7 61 98.6 E38 60 58.4 60.6 92.2 91.7

In conclusion, the present inventors developed a chimeric virus by combining the genomes of type 1 and type 2 PRRSV. Successful recovery of the vaccine candidate and evaluation of its efficacy through innovative reverse genetics technology showed that pigs inoculated with the chimeric virus exhibited stronger immunological responses, showing greater immunity against multiple PRRSV isolates than pigs inoculated with either of the parent viruses. Since it has been shown to produce neutralizing antibodies that provide protection, it can be used as a vaccine candidate to suppress porcine reproductive and respiratory syndrome virus infection.

The present invention has been described with reference to the above-described embodiments, but this is merely illustrative, and those skilled in the art will understand that various modifications and equivalent other embodiments are possible therefrom. Therefore, the true scope of technical protection of the present invention should be determined by the technical spirit of the attached patent claims.

Name of depository organization: Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC)

Accession number: KCTC15431BP

Trust date: 20230508

Claims (8)

Preparing a first genomic portion containing ORF2 to ORF4 and ORF6 but not ORF1ab from the European PRRSV strain genome;
Preparing a second genomic portion including ORF1ab from the North American PRRSV strain genome and including at least one ORF including ORF6 among ORF5 to ORF7;
Designing a sequence in which the first genome part is connected to the second genome part in frame, includes all ORFs of PRRSV, and overlaps ORF6 of the European RRRSV strain genome and the North American PRRSV strain genome;
Preparing a recombinant clone by inserting the designed hybrid genome cDNA into a framework vector;
Transfecting the recombinant clone into host cells and then culturing them to proliferate the transfected cells; and
A method for producing an infectious chimeric strain of North American and European porcine reproductive and respiratory syndrome virus, comprising the step of recovering the chimeric strain from the transfected cells. According to paragraph 1,
A production method, further comprising a transcriptional regulatory sequence (TRS) shown in SEQ ID NO: 2. According to paragraph 2,
The production method wherein the transcription regulatory sequence (TRS) is inserted between the first genomic part and the second genomic part. According to paragraph 1,
The chimeric strain is a strain deposited under the deposit number KCTC 15431BP. According to paragraph 1,
The North American strain is a BP2017-2 strain deposited with deposit number KCTC 13393BP. According to paragraph 1,
The European strain is an E38 strain having a genomic nucleic acid consisting of the nucleotide sequence shown in SEQ ID NO: 1. According to paragraph 1,
The first genomic portion is composed of ORF2 to ORF6. According to paragraph 1,
The production method wherein the second genomic portion includes ORF1ab, ORF6, and ORF7.