KR102335864B1 - Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same - Google Patents

Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same Download PDF

Info

Publication number
KR102335864B1
KR102335864B1 KR1020190145389A KR20190145389A KR102335864B1 KR 102335864 B1 KR102335864 B1 KR 102335864B1 KR 1020190145389 A KR1020190145389 A KR 1020190145389A KR 20190145389 A KR20190145389 A KR 20190145389A KR 102335864 B1 KR102335864 B1 KR 102335864B1
Authority
KR
South Korea
Prior art keywords
substituted
virus
lmy
chimeric virus
nsp1
Prior art date
Application number
KR1020190145389A
Other languages
Korean (ko)
Other versions
KR20200081225A (en
Inventor
조선희
박창훈
백종혁
차상호
강석진
유수화
조인수
Original Assignee
주식회사 바이오포아
대한민국(농림축산식품부 농림축산검역본부장)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오포아, 대한민국(농림축산식품부 농림축산검역본부장) filed Critical 주식회사 바이오포아
Priority to PCT/KR2019/017319 priority Critical patent/WO2020138761A1/en
Priority to CN201980093073.0A priority patent/CN113544140A/en
Publication of KR20200081225A publication Critical patent/KR20200081225A/en
Application granted granted Critical
Publication of KR102335864B1 publication Critical patent/KR102335864B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5254Virus avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/10011Arteriviridae
    • C12N2770/10034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/10011Arteriviridae
    • C12N2770/10051Methods of production or purification of viral material

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Communicable Diseases (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 백신으로 사용할 수 있는 돼지생식기 및 호흡기 증후군(PRRS) 바이러스의 키메라 바이러스에 관한 것이다. 본 발명의 PRRSV 키메라 바이러스는 모균주보다 약독화되어 있어 병원성이 낮고 안정성이 높으면서, 중화항체의 분비를 향상시켜 PRRS 질환의 효과적인 예방 및 치료용 백신으로 사용할 수 있다. The present invention relates to a chimeric virus of porcine reproductive and respiratory syndrome (PRRS) virus that can be used as a vaccine. The PRRSV chimeric virus of the present invention is attenuated compared to the parent strain, so it has low pathogenicity and high stability, and improves the secretion of neutralizing antibodies, so that it can be used as a vaccine for effective prevention and treatment of PRRS disease.

Description

돼지 생식기 및 호흡기 증후군 바이러스의 키메라 바이러스 및 이를 이용한 백신{Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same}Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same

본 발명은 백신으로 사용할 수 있는 돼지 생식기 및 호흡기 증후군 바이러스(PRRSV)의 키메라 바이러스에 관한 것으로, 본 발명의 키메라 바이러스는 모균주에 비해 병원성이 낮고 안전성이 높다. 본 발명의 PRRSV 키메라 바이러스는 교차면역과 관련된 중화항체의 분비를 향상시키며, 돼지 생식기 및 호흡기 증후군을 효과적으로 방어할 수 있는 백신을 제공할 수 있다.The present invention relates to a chimeric virus of porcine reproductive and respiratory syndrome virus (PRRSV) that can be used as a vaccine, and the chimeric virus of the present invention has low pathogenicity and high safety compared to the parent strain. The PRRSV chimeric virus of the present invention improves the secretion of neutralizing antibodies related to cross-immunity, and can provide a vaccine capable of effectively protecting against porcine reproductive and respiratory syndromes.

돼지 생식기 및 호흡기 증후군(Porcine Reproductive and Respiratory Syndrome, 이하 PRRS)은 돼지 써코바이러스 감염증 및 구제역과 함께 국내 양돈산업에 가장 큰 피해를 주는 전염병에 해당한다. PRRS는 임신한 암퇘지의 생식 불능, 유산이나 조산, 사산의 번식장애를 유발하며, 젖먹이 돼지와 비육돈에게 재채기, 발열 등의 호흡기 증상을 유발한다. 일반적으로 바이러스에 이환된 이후 세균 등의 2차 감염에 의해 심한 호흡기 증상을 야기하지만, 만성적으로 감염된 경우에는 특징적인 임상 증상 없이 증체량 감소 및 폐사율의 증가를 나타나게 된다.Porcine Reproductive and Respiratory Syndrome (PRRS), along with swine circovirus infection and foot-and-mouth disease, is an infectious disease that causes the greatest damage to the domestic pig industry. PRRS causes impotence, miscarriage, premature birth, and stillbirth in pregnant sows, and causes respiratory symptoms such as sneezing and fever in suckling pigs and finisher pigs. In general, after being infected with a virus, severe respiratory symptoms are caused by secondary infection such as bacteria, but in the case of chronic infection, a decrease in weight gain and an increase in mortality are shown without characteristic clinical symptoms.

이 바이러스 질환은 미국에서 1987년에 최초로 발견되었고, 이어서 유럽에서 발견되었으며, 1990년대 초에 아시아에서 동정되었다. 지금까지, PRRS는 양돈국가에서 풍토병의 특징을 가지며 세계적으로 확산되어, 매년 막대한 경제적 손실을 일으켰다. This viral disease was first discovered in 1987 in the United States, then in Europe, and was identified in Asia in the early 1990s. So far, PRRS has spread worldwide with the characteristics of endemic disease in pig countries, causing huge economic losses every year.

PRRS의 원인이 되는 병원체는 Arterivirus 속, Arteriviridae 과, Nidovirales 목에 속하는 PRRS 바이러스이다. PRRS 바이러스는 positive-sense single stranded RNA genome을 갖고 있으며, 크기는 약 15.4 kilobase이다. PRRS 바이러스의 genome은 9개의 ORF를 갖고 있다(Conzelmann et al., 1993; Meulenberg et al., 1993). 그 중 비구조단백질(Non Structural Protein, NSP)을 코딩하는 ORF1a 및 ORF1b가 바이러스 지놈의 약 80%를 차지하고 있다(Bautista et al., 2002; Meulenberg et al., 1993; Snijder and Meulenberg, 1998, 2001). 상기 비구조단백질 중 NSP1-alpha, NSP-1 beta, NSP2 내지 NSP8은 ORF1a에, NSP9 내지 NSP12는 ORF1b에 위치하는 것으로 알려져 있다. 글리코실화된 구조 단백질인 GP2, GP3, GP4, GP5와, 비글리코실화된 막(Membrane, M) 단백질, 뉴클레오캡시드 (N) 단백질은 나머지 20%를 차지하는 ORF2-7에 의하여 코딩된다. minor 구조단백질인 GP2, GP3, GP4가 heterotrimer를 형성하여 바이러스가 숙주 세포 내로 침입할 때 작용하며, major 구조단백질인 GP5, M은 heterodimer를 형성하여 바이러스의 감염력을 높여주는 작용을 한다.The pathogen causing PRRS is a PRRS virus belonging to the genus Arterivirus, the family Arteriviridae, and the order Nidovirales. PRRS virus has a positive-sense single-stranded RNA genome and is approximately 15.4 kilobases in size. The genome of PRRS virus has 9 ORFs (Conzelmann et al., 1993; Meulenberg et al., 1993). Among them, ORF1a and ORF1b encoding non-structural proteins (NSP) occupies about 80% of the viral genome (Bautista et al., 2002; Meulenberg et al., 1993; Snijder and Meulenberg, 1998, 2001). . Among the non-structural proteins, NSP1-alpha, NSP-1 beta, NSP2 to NSP8 are known to be located in ORF1a, and NSP9 to NSP12 are known to be located in ORF1b. Glycosylated structural proteins GP2, GP3, GP4, GP5, aglycosylated membrane (Membrane, M) protein, and nucleocapsid (N) protein are encoded by ORF2-7, which accounts for the remaining 20%. The minor structural proteins, GP2, GP3, and GP4, form heterotrimers and act when the virus invades the host cell.

PRRS 바이러스는 RNA 바이러스의 특성상 변이가 심하여 바이러스 간에 차이가 많이 난다. PRRS 바이러스는 크게 북미형과 유럽형으로 나뉜다. 유럽형을 대표하는 타입 I형(Lelystad virus, LV) 및 북미형 바이러스주(Northern American strain) ATCC VR2332를 대표하는 타입 II 형(VR2332의 게놈 서열은 GenBank 등록번호 AY150564 참조)(Murtaugh et al., Arch Virol. 1995; 140:1451-1460) 이 있다. PRRS viruses are highly mutated due to the nature of RNA viruses, and there are many differences between viruses. PRRS virus is largely divided into North American type and European type. Type I (Lelystad virus, LV) representing the European type and type II representing the Northern American strain ATCC VR2332 (for the genomic sequence of VR2332, refer to GenBank Accession No. AY150564) (Murtaugh et al., Arch Virol. 1995; 140:1451-1460).

북미형과 유럽형 간에는 최대 40%까지 유전자 차이가 존재하여 서로 교차 방어가 되지 않는 것으로 알려져 있다. 또한 같은 타입에 속하는 변이주 간에도 교차 방어가 되지 않는 경우가 많다(Meng, X. J. et al., 2000). 이로 인해, 각각에 대해 표준 변이주 기반의 백신은 제작되어 있지만 교차 방어능이 좋지 못하기 때문에 PRRS를 효과적으로 예방하지 못하고 있는 실정이다. 이를 극복하기 위하여 안전성, 면역원성, 및 방어능을 효과적으로 갖춘 백신을 제작하기 위한 다양한 시도가 이루어지고 있다.It is known that there is a genetic difference of up to 40% between the North American type and the European type, so that there is no cross-protection against each other. Also, cross-protection between mutants belonging to the same type is often not possible (Meng, X. J. et al., 2000). For this reason, although standard mutant-based vaccines have been prepared for each, it is not possible to effectively prevent PRRS because the cross-protection ability is not good. In order to overcome this, various attempts have been made to produce a vaccine having effectively safety, immunogenicity, and protective ability.

이 같은 질병의 심각성 때문에 돼지 생식기 호흡기 증후군(PRRS)의 원인체인 돼지생식기호흡기증후군 바이러스(PRRSV)를 발견한 이후, 약 20년 동안 이 바이러스에 대한 예방법을 개발하기 위하여 많은 노력이 투자되었음에도 아직까지 효과적인 예방법 및 관리법이 개발되지 않은 실정이다. 돼지생식기호흡기증후군 바이러스(PRRSV) 제어를 위해 불활화 백신과 약독화 생백신 등 다양한 백신이 개발되었으나, 오직 감염성이 확보된 약독화 백신만이 만족스러운 수준의 방어 효과를 유도하는 것으로 밝혀졌다. 하지만, 돼지생식기호흡기증후군 바이러스(PRRSV)가 유전적으로 매우 다양하게 존재하기 때문에 다양한 바이러스 종류간의 교차면역이 부재하여 하나의 백신으로 다양한 돼지생식기호흡기증후군 바이러스(PRRSV)를 방어하기는 어렵다. 또한 현재 약독화 백신은 다른 동물 종의 세포 주에서 100~200 계대 이상의 연속 계대를 통해서만 생산이 가능하므로 개발 기간이 길고 효능과 안전성의 보장이 어려운 문제가 있다. 이로 인해 각각에 대해 표준 변이주 기반의 백신은 제작되어 있지만 교차 방어능이 좋지 못하기 때문에 PRRS를 효과적으로 예방하지 못하고 있는 실정이다. Due to the severity of the disease, since the discovery of the porcine reproductive and respiratory syndrome virus (PRRSV), which is the cause of porcine reproductive and respiratory syndrome (PRRS), for about 20 years, much effort has been invested to develop a preventive method for this virus, but it is still effective Prevention and management methods have not been developed. Various vaccines, such as inactivated vaccines and live attenuated vaccines, have been developed to control porcine reproductive and respiratory syndrome virus (PRRSV), but only attenuated vaccines with secured infectivity have been found to induce a satisfactory level of protective effect. However, since the porcine reproductive and respiratory syndrome virus (PRRSV) is genetically very diverse, cross-immunity between various virus types is absent, so it is difficult to protect against various porcine reproductive and respiratory syndrome viruses (PRRSV) with one vaccine. In addition, the current attenuated vaccine can only be produced through successive passages of 100 to 200 or more in cell lines of other animal species, so there is a problem that the development period is long and it is difficult to guarantee efficacy and safety. For this reason, standard mutant-based vaccines have been prepared for each, but PRRS cannot be effectively prevented because the cross-protection ability is not good.

이를 극복하기 위하여 안전성, 면역원성, 및 방어능을 효과적으로 갖춘 백신을 제작하기 위한 다양한 시도가 이루어지고 있다(출원번호 제10-2011-7004020호, 발명의 명칭: 고병원성 돼지 생식기 및 호흡기 증후군(HP PRRS)에 대한 백신).In order to overcome this, various attempts have been made to produce a vaccine having safety, immunogenicity, and protective ability effectively (Application No. 10-2011-7004020, Title of the Invention: Highly pathogenic porcine reproductive and respiratory syndrome (HP PRRS) ) against vaccines).

본 발명은 병원성이 낮고 안정성이 높으며, 중화항체의 분비를 향상시킨 돼지 생식기 및 호흡기 증후군 바이러스(PRRSV)의 키메라 바이러스, 이를 포함하는 백신, 및 이의 제조방법에 관한 것이다. The present invention relates to a chimeric virus of porcine reproductive and respiratory syndrome virus (PRRSV) having low pathogenicity and high stability and improved secretion of neutralizing antibody, a vaccine comprising the same, and a method for manufacturing the same.

일 예에서, 상기 키메라 바이러스는In one example, the chimeric virus is

(1) 수탁번호 KCTC 13394BP의 LMY ver2 변이주에서 유래한 ORF1a 및 ORF1b의 핵산 서열 또는 이와 기능적 동등성을 유지하면서 상기 핵산 서열과 70% 이상 서열 상동성을 갖는 핵산 서열, 및 (1) the nucleic acid sequence of ORF1a and ORF1b derived from the LMY ver2 mutant of accession number KCTC 13394BP, or a nucleic acid sequence having at least 70% sequence homology with the nucleic acid sequence while maintaining functional equivalent thereto, and

(2) 수탁번호 KCTC 13393BP를 갖는 BP2017-2 분리주의 ORF2 내지 ORF7 부위의 핵산 서열 또는 이와 기능적 동등성을 유지하면서 상기 핵산 서열과 70% 이상 서열 상동성을 갖는 핵산 서열(2) the nucleic acid sequence of the ORF2 to ORF7 region of the BP2017-2 isolate having accession number KCTC 13393BP or a nucleic acid sequence having at least 70% sequence homology with the nucleic acid sequence while maintaining functional equivalent thereto

을 포함하는 것일 수 있다.may include.

본 발명은 백신으로 사용할 수 있는 돼지생식기 및 호흡기 증후군(PRRS) 바이러스의 키메라 바이러스에 관한 것이다. 본 발명의 PRRSV 키메라 바이러스는 모균주보다 약독화되어 있어 병원성이 낮고 안정성이 높으며, 교차면역이 가능한 중화항체의 분비를 향상시킴으로써 돼지의 면역력을 현저히 증진시킨다. 이에, PRRS 질환의 효과적인 예방 및 치료용 백신으로 사용할 수 있다. The present invention relates to a chimeric virus of porcine reproductive and respiratory syndrome (PRRS) virus that can be used as a vaccine. The PRRSV chimeric virus of the present invention is attenuated compared to the parent strain, so it has low pathogenicity and high stability, and remarkably enhances immunity of pigs by enhancing the secretion of neutralizing antibodies capable of cross-immunity. Therefore, it can be used as a vaccine for effective prevention and treatment of PRRS disease.

이하, 본 발명을 더욱 자세히 설명한다. Hereinafter, the present invention will be described in more detail.

본 명세서에 사용된 "약독화된 바이러스"는 PRRS 질환의 임상 징후를 유발하지 않고 표적 포유동물에서 면역반응을 유발할 수 있는 무독성 바이러스를 의미하기도 하고, 또한 약독화된 바이러스로 감염되고 약독화된 바이러스를 투여받지 못한 동물에서 임상 징후의 발생빈도를 낮추거나, 징후의 중증도가 비-약독화된 PRRS 바이러스로 감염된 "대조군" 동물에 비해 감소된 것을 의미하기도 한다. 이러한 상황에서, "감소/감소된"이란 용어는 앞에서 정의한 대조군에 비해 적어도 10%, 바람직하게는 25%, 더욱 바람직하게는 50%, 가장 바람직하게는 100% 이상의 감소를 의미한다.As used herein, "attenuated virus" also refers to a non-virulent virus capable of eliciting an immune response in a target mammal without causing clinical signs of PRRS disease, and is also an attenuated virus infected with the attenuated virus. It may also mean a reduced incidence of clinical signs in animals not treated with or a reduced severity of signs compared to "control" animals infected with non-attenuated PRRS virus. In this context, the term "reduced/reduced" means a reduction of at least 10%, preferably 25%, more preferably 50% and most preferably at least 100% compared to the control as defined above.

본 명세서에 사용된 "백신 조성물"은 PRRS 키메라 바이러스 또는 이의 임의의 면역원성 단편 또는 분획, 바람직하게는 약독화된 PRRS 키메라 바이러스, 예컨대 상기 본 발명의 PRRS 키메라 바이러스일 수 있다. 이는 숙주의 "면역학적 반응"을 PRRSV에 대한 세포 및/또는 항체 매개의 면역 반응으로 유발한다. 백신 조성물은 PRRSV 감염 및 이와 관련된 임상 징후들에 대해 예방 면역을 부여할 수 있는 것이 바람직하다.A “vaccine composition” as used herein may be a PRRS chimeric virus or any immunogenic fragment or fraction thereof, preferably an attenuated PRRS chimeric virus, such as the PRRS chimeric virus of the present invention. It elicits an "immunological response" of the host as a cellular and/or antibody-mediated immune response to PRRSV. Preferably, the vaccine composition is capable of conferring prophylactic immunity against PRRSV infection and clinical signs associated therewith.

본 명세서에 사용된 "면역 반응"은 상기 본 발명의 PRRSV 키메라 바이러스, 또는 이를 포함하는 백신 조성물을 투여받은 동물에게 투여된 키메라 바이러스 또는 백신에 대한 임의의 세포- 및/또는 항체-매개의 면역 반응을 의미한다. 보통, "면역 반응"은 다음과 같은 효과 중 하나 이상을 포함하지만, 이에 국한되는 것은 아니다: 당해 조성물 또는 백신에 포함된 항원 또는 항원들에 대해 특이적으로 유도된 항체, B 세포, 헬퍼 T 세포, 억제인자 T 세포 및/또는 세포독성 T 세포 및/또는 γδ T 세포의 생산 또는 활성화. 숙주는 면역원성 조성물이나 백신을 투여받지 않은 대조군에 비해 새로운 감염에 대한 내성이 향상되고/되거나 질환의 임상 중증도가 감소되도록 치료적 또는 예방적 면역학적 반응을 나타내는 것이 바람직하다. 이러한 예방은 최대 전술한 숙주 감염과 관련된 증상들의 결여 및 이를 비롯하여 빈도 또는 중증도의 감소에 의해 증명될 것이다.As used herein, “immune response” refers to any cell- and/or antibody-mediated immune response to the PRRSV chimeric virus of the present invention, or a chimeric virus or vaccine administered to an animal receiving the vaccine composition comprising the same. means Usually, "immune response" includes, but is not limited to, one or more of the following effects: antibodies, B cells, helper T cells directed specifically against an antigen or antigens included in the composition or vaccine. , production or activation of suppressor T cells and/or cytotoxic T cells and/or γδ T cells. The host preferably exhibits a therapeutic or prophylactic immunological response such that resistance to new infections is improved and/or the clinical severity of the disease is reduced compared to controls not administered with the immunogenic composition or vaccine. Such prophylaxis will be evidenced by a reduction in frequency or severity, including the absence of and, at most, the symptoms associated with the aforementioned host infection.

본 명세서에 사용된 "돼지들", "돼지" 및 "새끼돼지"는 호환 사용될 수 있다.As used herein, “pigs”, “pig” and “pig” may be used interchangeably.

"백신을 접종하다"는 PRRS 질환에 노출되기 전에 본 명세서에 기술된 PRRSV 키메라 바이러스 또는 이를 포함하는 백신을 투여하는 것을 의미한다."Vaccinate" means administering the PRRSV chimeric virus described herein or a vaccine comprising the same prior to exposure to PRRS disease.

"예방하다" 또는 "예방"은 본 발명의 PRRSV 바이러스 또는 이를 포함하는 백신조성물을 투여받은 결과로서, PRRS의 임상의 발생 빈도, 징후의 중증도 또는 빈도가 감소하는 것을 의미한다. 중증도 또는 빈도의 감소는 본 발명의 PRRSV 키메라 바이러스 또는 이를 포함하는 백신조성물을 투여받지 않은 동물 또는 동물 그룹과 비교한 결과이다. 상기 동물은 바람직하게는 돼지일 수 있다."Prevent" or "prevention" means a decrease in the clinical incidence, severity or frequency of PRRS as a result of administration of the PRRSV virus of the present invention or a vaccine composition comprising the same. The reduction in severity or frequency is a result of comparison with an animal or group of animals not administered with the PRRSV chimeric virus of the present invention or a vaccine composition comprising the same. The animal may preferably be a pig.

본 명세서의 염기 서열은 편의를 위해 DNA 뉴클레오타이드를 기준으로 기재되었으며, 폴리뉴클레오타이드의 종류가 RNA인 경우에는 염기서열 내 모든 또는 일부 티민(Thymine, T)이 우라실(Uracil, U)로 치환된 서열을 의미한다. The nucleotide sequence of the present specification is described based on DNA nucleotides for convenience, and when the type of polynucleotide is RNA, all or part of the thymine (Thymine, T) in the nucleotide sequence is substituted with uracil (Uracil, U). it means.

본 명세서에서 특정 염기서열 및/또는 아미노산 "서열로 구성되는"은 상기 서열을 포함하는, 상기 서열을 필수적으로 포함하는, 및/또는 상기 서열로 이루어지는을 모두 포함하며, 필요에 따라 적절히 치환하여 사용될 수 있다.In the present specification, a specific base sequence and/or amino acid "consisting of a sequence" includes all of the sequence including the sequence, essentially including the sequence, and/or consisting of the sequence, and may be appropriately substituted if necessary. can

본 발명은 돼지에 영향을 미치는 바이러스 질환인 돼지 생식기 및 호흡기 증후군(PRRSV)에 대해 약독화된 키메라 바이러스를 제공한다. The present invention provides an attenuated chimeric virus for porcine reproductive and respiratory syndrome (PRRSV), a viral disease affecting pigs.

상기 목적을 달성하기 위해, 본 발명은 구조식 1의 구조를 포함하는 폴리뉴클레오타이드를 제공한다:In order to achieve the above object, the present invention provides a polynucleotide comprising the structure of Structural Formula 1:

[구조식 1][Structural Formula 1]

5'-[X]-[Y]-3'5'-[X]-[Y]-3'

상기 식에서, [X]는 수탁번호 KCTC 13394BP를 갖는 LMY ver2 변이주의 NSP1 유전자 (NSP1-alpha 유전자 및 NSP1-beta 유전자)의 핵산 서열 또는 상기 핵산 서열과 동등한 기능이 유지되는 범위 내에서 70% 이상의 서열 상동성을 갖는 핵산 서열을 포함하며, 예를 들어 LMY ver2 변이주의 NSP1 유전자의 핵산 서열 또는 상기 핵산 서열과 동등한 기능이 유지되는 범위 내에서 70% 이상의 서열 상동성을 갖는 핵산 서열을 포함하는, 수탁번호 13394BP를 갖는 LMY ver2 변이주의 ORF1a 및 ORF1b 부위의 유전자의 핵산 서열 또는 상기 ORF1a 및 ORF1b 부위의 유전자의 핵산 서열과 70% 이상의 서열 상동성을 갖는 핵산 서열이며, 상기 [Y]는 수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 ORF2 내지 ORF7 부위의 유전자 핵산 서열 또는 상기 핵산 서열과 동등한 기능이 유지되는 범위 내에서 70% 이상의 서열 상동성을 갖는 핵산 서열이다. 본 명세서에 사용된 바로서, 상기 "동등한 기능"은 목적하는 기능과 질적(활성) 및/또는 양적(수준)으로 동일 또는 유사한 기능을 의미할 수 있다. 예를 들어, 상기 유전자가 암호화하는 단백질의 아미노산 서열이 야생형 유전자가 암호화하는 단백질의 아미노산 서열과 동일한 것일 수 있다.In the above formula, [X] is the nucleic acid sequence of the NSP1 gene (NSP1-alpha gene and NSP1-beta gene) of the LMY ver2 mutant having accession number KCTC 13394BP, or 70% or more of the sequence within the range in which the function equivalent to the nucleic acid sequence is maintained. Containing a nucleic acid sequence having homology, for example, the nucleic acid sequence of the NSP1 gene of the LMY ver2 mutant or a nucleic acid sequence having 70% or more sequence homology within the range in which an equivalent function to the nucleic acid sequence is maintained. The nucleic acid sequence of the nucleic acid sequence of the ORF1a and ORF1b regions of the LMY ver2 mutant having No. 13394BP or the nucleic acid sequence of the ORF1a and ORF1b regions is a nucleic acid sequence having at least 70% sequence homology, wherein [Y] is accession number KCTC 13393BP It is a nucleic acid sequence having at least 70% sequence homology within the range in which the gene nucleic acid sequence of the ORF2 to ORF7 region of a BP2017-2 mutant having a function or equivalent function to the nucleic acid sequence is maintained. As used herein, the "equivalent function" may mean a function that is the same or similar in quality (activity) and/or quantity (level) to a desired function. For example, the amino acid sequence of the protein encoded by the gene may be identical to the amino acid sequence of the protein encoded by the wild-type gene.

일 예에서, 상기 [X]는 서열번호 11의 염기서열로 이루어지는 NSP1 유전자의 핵산 서열에서, 상기 NSP1 유전자에 의해 암호화되는 NSP1 단백질의 아미노산 서열이 동일하게 유지되는 범위 내에서 발생하는 모든 종류의 점 돌연변이 (침묵 돌연변이)를 포함할 수 있으며, 예를 들어 NSP1 유전자의 CBP 수치를 낮추기 위한 목적 범위에서 자유롭게 선택되어 사용될 수 있다.In one example, in the nucleic acid sequence of the NSP1 gene consisting of the nucleotide sequence of SEQ ID NO: 11, [X] is all kinds of points occurring within the range in which the amino acid sequence of the NSP1 protein encoded by the NSP1 gene remains the same. It may include a mutation (silent mutation), for example, it may be freely selected and used within the target range for lowering the CBP level of the NSP1 gene.

예를 들어, 상기 [X]는 서열번호 11의 염기서열로 이루어지는 NSP1 유전자의 핵산 서열에서, 222번 위치, 225번 위치, 237번 위치, 240번 위치, 252번 위치, 306번 위치, 309번 위치, 312번 위치, 315번 위치, 324번 위치, 327번 위치, 330번 위치, 333번 위치, 336번 위치, 339번 위치, 342번 위치, 345번 위치, 357번 위치, 363번 위치, 366번 위치, 378번 위치, 379번 위치, 381번 위치, 393번 위치, 396번 위치, 543번 위치, 546번 위치, 549번 위치, 555번 위치, 558번 위치, 561번 위치, 573번 위치, 579번 위치, 582번 위치, 588번 위치, 612번 위치, 618번 위치, 621번 위치, 627번 위치, 633번 위치, 639번 위치, 654번 위치, 673번 위치, 675번 위치, 678번 위치, 681번 위치, 684번 위치, 705번 위치, 708번 위치, 729번 위치, 735번 위치, 738번 위치, 741번 위치, 744번 위치, 747번 위치, 771번 위치, 786번 위치, 789번 위치, 792번 위치, 810번 위치, 825번 위치, 828번 위치, 838번 위치, 840번 위치, 846번 위치, 849번 위치, 858번 위치, 867번 위치, 879번 위치, 882번 위치, 885번 위치, 891번 위치, 900번 위치, 903번 위치, 906번 위치, 924번 위치, 936번 위치, 939번 위치, 948번 위치, 954번 위치, 963번 위치, 966번 위치, 1026번 위치, 1029번 위치, 1038번 위치, 1047번 위치, 1053번 위치, 1066번 위치, 1068번 위치, 1086번 위치, 및 1110번 위치로 이루어지는 군에서 선택되는 하나 이상, 25 이상, 66 이상, 80 이상 또는 91개 전체 위치의 염기가 치환된 변이일 수 있다.For example, in the nucleic acid sequence of the NSP1 gene consisting of the nucleotide sequence of SEQ ID NO: 11, [X] is position 222, position 225, position 237, position 240, position 252, position 306, position 309 Location, location 312, location 315, location 324, location 327, location 330, location 333, location 336, location 339, location 342, location 345, location 357, location 363, Position 366, Position 378, Position 379, Position 381, Position 393, Position 396, Position 543, Position 546, Position 549, Position 555, Position 558, Position 561, Position 573 Location, location 579, location 582, location 588, location 612, location 618, location 621, location 627, location 633, location 639, location 654, location 673, location 675, Position 678, Position 681, Position 684, Position 705, Position 708, Position 729, Position 735, Position 738, Position 741, Position 744, Position 747, Position 771, Position 786 location, location 789, location 792, location 810, location 825, location 828, location 838, location 840, location 846, location 849, location 858, location 867, location 879, Position 882, Position 885, Position 891, Position 900, Position 903, Position 906, Position 924, Position 936, Position 939, Position 948, Position 954, Position 963, Position 966 one or more, 25 or more selected from the group consisting of position, position 1026, position 1029, position 1038, position 1047, position 1053, position 1066, position 1068, position 1086, and position 1110; It may be a mutation in which bases at all 66 or more, 80 or more or 91 positions are substituted.

일 예에서, 상기 [X]는 서열번호 11의 염기서열로 이루어지는 NSP1 유전자의 핵산 서열에서, 222번 위치의 G가 C로 치환된 변이, 225번 위치의 C가 A로 치환된 변이, 237번 위치의 T가 C로 치환된 변이, 240번 위치의 A가 T로 치환된 변이, 252번 위치의 T가 C로 치환된 변이, 306번 위치의 A가 C로 치환된 변이, 309번 위치의 T가 C로 치환된 변이, 312번 위치의 G가 A로 치환된 변이, 315번 위치의 C가 A로 치환된 변이, 324번 위치의 T가 C로 치환된 변이, 327번 위치의 C가 G로 치환된 변이, 330번 위치의 G가 A로 치환된 변이, 333번 위치의 C가 T로 치환된 변이, 336번 위치의 C가 G로 치환된 변이, 339번 위치의 T가 C로 치환된 변이, 342번 위치의 A가 T로 치환된 변이, 345번 위치의 T가 A로 치환된 변이, 357번 위치의 A가 G로 치환된 변이, 363번 위치의 T가 A로 치환된 변이, 366번 위치의 T가 C로 치환된 변이, 378번 위치의 C가 T로 치환된 변이, 379번 위치의 C가 A로 치환된 변이, 381번 위치의 C가 G로 치환된 변이, 393번 위치의 T가 C로 치환된 변이, 396번 위치의 T가 A로 치환된 변이, 543번 위치의 T가 C로 치환된 변이, 546번 위치의 T가 C로 치환된 변이, 549번 위치의 C가 A로 치환된 변이, 555번 위치의 T가 C로 치환된 변이, 558번 위치의 T가 C로 치환된 변이, 561번 위치의 T가 A로 치환된 변이, 573번 위치의 C가 T로 치환된 변이, 579번 위치의 T가 C로 치환된 변이, 582번 위치의 G가 T로 치환된 변이, 588번 위치의 T가 C로 치환된 변이, 612번 위치의 T가 C로 치환된 변이, 618번 위치의 G가 C로 치환된 변이, 621번 위치의 T가 C로 치환된 변이, 627번 위치의 A가 T로 치환된 변이, 633번 위치의 T가 C로 치환된 변이, 639번 위치의 T가 G로 치환된 변이, 654번 위치의 C가 T로 치환된 변이, 673번 위치의 C가 T로 치환된 변이, 675번 위치의 C가 A로 치환된 변이, 678번 위치의 C가 T로 치환된 변이, 681번 위치의 C가 G로 치환된 변이, 684번 위치의 C가 G로 치환된 변이, 705번 위치의 G가 C로 치환된 변이, 708번 위치의 C가 T로 치환된 변이, 729번 위치의 A가 C로 치환된 변이, 735번 위치의 T가 C로 치환된 변이, 738번 위치의 G가 T로 치환된 변이, 741번 위치의 T가 C로 치환된 변이, 744번 위치의 T가 C로 치환된 변이, 747번 위치의 T가 A로 치환된 변이, 771번 위치의 T가 C로 치환된 변이, 786번 위치의 T가 C로 치환된 변이, 789번 위치의 C가 T로 치환된 변이, 792번 위치의 T가 G로 치환된 변이, 810번 위치의 C가 T로 치환된 변이, 825번 위치의 T가 C로 치환된 변이, 828번 위치의 C가 T로 치환된 변이, 838번 위치의 T가 C로 치환된 변이, 840번 위치의 G가 C로 치환된 변이, 846번 위치의 C가 G로 치환된 변이, 849번 위치의 G가 A로 치환된 변이, 858번 위치의 A가 G로 치환된 변이, 867번 위치의 T가 C로 치환된 변이, 879번 위치의 T가 C로 치환된 변이, 882번 위치의 C가 G로 치환된 변이, 885번 위치의 C가 T로 치환된 변이, 891번 위치의 C가 T로 치환된 변이, 900번 위치의 T가 C로 치환된 변이, 903번 위치의 C가 A로 치환된 변이, 906번 위치의 T가 C로 치환된 변이, 924번 위치의 G가 T로 치환된 변이, 936번 위치의 T가 C로 치환된 변이, 939번 위치의 T가 C로 치환된 변이, 948번 위치의 A가 C로 치환된 변이, 954번 위치의 A가 C로 치환된 변이, 963번 위치의 A가 T로 치환된 변이, 966번 위치의 T가 C로 치환된 변이, 1026번 위치의 A가 G로 치환된 변이, 1029번 위치의 G가 C로 치환된 변이, 1038번 위치의 C가 T로 치환된 변이, 1047번 위치의 T가 C로 치환된 변이, 1053번 위치의 T가 C로 치환된 변이, 1066번 위치의 A가 C로 치환된 변이, 1068번 위치의 A가 C로 치환된 변이, 1086번 위치의 C가 T로 치환된 변이, 및 1110번 위치의 T가 C로 치환된 변이로 이루어진 군에서 선택된 1 이상, 25 이상, 66 이상, 80 이상, 또는 상기 91개 변이 모두를 포함할 수 있다. In one example, the [X] is, in the nucleic acid sequence of the NSP1 gene consisting of the nucleotide sequence of SEQ ID NO: 11, a mutation in which G at position 222 is substituted with C, a mutation in which C at position 225 is substituted with A, 237 A mutation in which T at position C is substituted, A at position 240 is substituted with T, T at position 252 is substituted with C, A at position 306 is substituted with C, A mutation at position 309 is T is substituted with C, G at position 312 is substituted with A, C at position 315 is substituted with A, T at position 324 is substituted with C, C at position 327 is A mutation substituted with G, a mutation in which G at position 330 is substituted with A, a mutation in which C at position 333 is substituted with T, a mutation in which C at position 336 is substituted with G, T at position 339 is C A substituted mutation, a mutation in which A at position 342 is substituted with T, a mutation in which T at position 345 is substituted with A, a mutation where A at position 357 is substituted with G, T at position 363 is substituted with A mutation, T at position 366 is substituted with C, C at position 378 is substituted with T, C at position 379 is substituted with A, C at position 381 is substituted with G, T at position 393 is substituted with C, T at position 396 is substituted with A, T at position 543 is substituted with C, T at position 546 is substituted with C, 549 A mutation in which C at position A is substituted, T at position 555 is substituted with C, T at position 558 is substituted with C, T at position 561 is substituted with A, C is substituted with T, T at position 579 is substituted with C, G at position 582 is substituted with T, T at position 588 is substituted with C, T at position 612 is A mutation in which C is substituted, G at position 618 is substituted with C, T at position 621 is substituted with C, A is substituted in position 627 with T, T at position 633 is substituted with C substituted mutation, mutation in which T at position 639 is substituted with G, 65 C at position 4 is substituted with T, C at position 673 is substituted with T, C at position 675 is substituted with A, C at position 678 is substituted with T, 681 A mutation in which C at position G is substituted, C at position 684 is substituted with G, G at position 705 is substituted with C, C at position 708 is substituted with T, and a mutation at position 729 A is substituted with C, T at position 735 is substituted with C, G at position 738 is substituted with T, T at position 741 is substituted with C, T at position 744 is A mutation substituted with C, T at position 747 is substituted with A, T at position 771 is substituted with C, T at position 786 is substituted with C, C at position 789 is T Substituted mutation, T at position 792 is substituted with G, C at position 810 is substituted with T, T at position 825 is substituted with C, C at position 828 is substituted with T mutation, mutation in which T at position 838 is substituted with C, G at position 840 is substituted with C, C at position 846 is substituted with G, G at position 849 is substituted with A mutation, A mutation at position 858 is substituted with G, T at position 867 is substituted with C, T at position 879 is substituted with C, C at position 882 is substituted with G, 885 A mutation in which C at position C is substituted with T, C at position 891 is substituted with T, T at position 900 is substituted with C, C at position 903 is substituted with A, and at position 906 T is substituted with C, G at position 924 is substituted with T, T at position 936 is substituted with C, T at position 939 is substituted with C, A at position 948 is mutation substituted with C, mutation where A at position 954 is substituted with C, mutation where A at position 963 is substituted with T, mutation where T at position 966 is substituted with C, A at position 1026 is substituted with G substituted mutation, mutation in which G at position 1029 is substituted with C, C at position 1038 is substituted with T, T at position 1047 is substituted with C, T at position 1053 is substituted with C, A at position 1066 is substituted with C, A at position 1068 is C 1 or more, 25 or more, 66 or more, 80 or more, or 91 selected from the group consisting of mutations in which C at position 1086 is substituted with T, and mutations in which T at position 1110 is substituted with C It can contain all mutations.

예컨대, 상기 [X]는 수탁번호 13394BP를 갖는 LMY ver2 변이주의 NSP1 유전자(서열번호 12) 및/또는 NSP1-beta (서열번호 1; 서열번호 12의 5 ' 말단 609개 염기 부위)의 핵산 서열, 또는 상기 핵산서열과 동등한 기능을 유지하는 범위 내에서 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열일 수 있다.For example, the [X] is the nucleic acid sequence of the NSP1 gene (SEQ ID NO: 12) and/or NSP1-beta (SEQ ID NO: 1; 609 bases at the 5' end of SEQ ID NO: 12) of the LMY ver2 mutant having accession number 13394BP, or 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99 % or greater, or 99.5% or greater sequence homology.

또한, 상기 [Y]는 수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 ORF2 내지 ORF7 부위의 유전자 핵산 서열 또는 상기 서열과 동등한 기능을 유지하는 범위 내에서 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열일 수 있다.In addition, the [Y] is 70% or more, 75% or more, 80% or more, within the range of maintaining the same function as the gene nucleic acid sequence or the sequence of the ORF2 to ORF7 region of the BP2017-2 mutant strain having accession number KCTC 13393BP, It may be a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology.

본 발명의 일 예에 따르면, 상기 구조식 1의 [Y]의 3'말단에 [A]n을 추가로 포함할 수 있다. 상기 n은 염기 A를 포함하는 뉴클레오타이드의 개수로, 10 내지 100의 정수일 수 있다. 바람직하게는 10 내지 80, 10 내지 70, 10 내지 60, 10 내지 50, 10 내지 40, 10 내지 30, 15 내지 80, 15 내지 70, 15 내지 60, 15 내지 50, 15 내지 40, 15 내지 30, 20 내지 30, 20 내지 26의 정수일 수 있다.According to an embodiment of the present invention, [A]n may be further included at the 3' end of [Y] of Structural Formula 1 above. Wherein n is the number of nucleotides including the base A, and may be an integer from 10 to 100. Preferably 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 15 to 80, 15 to 70, 15 to 60, 15 to 50, 15 to 40, 15 to 30 , 20 to 30, may be an integer of 20 to 26.

상기 폴리뉴클레오타이드는 RNA, 상기 RNA의 역전사체 (DNA), 또는 이들의 조합일 수 있다. 상기 폴리뉴클레오타이드는 PRRSV 키메라 바이러스의 지놈(genome)으로서의 기능을 가질 수 있다.The polynucleotide may be RNA, a reverse transcript (DNA) of the RNA, or a combination thereof. The polynucleotide may have a function as a genome of the PRRSV chimeric virus.

이에, 본 발명의 다른 예는 상기 구조식 1의 구조를 갖는 폴리뉴클레오타이드를 포함하는 돼지 생식기 호흡기 증후군 바이러스(PRRSV)의 키메라 바이러스를 제공한다. 상기 PRRSV 키메라 바이러스의 지놈은 DNA 또는 RNA일 수 있으며, 바람직하게는 RNA일 수 있다. Accordingly, another example of the present invention provides a chimeric virus of porcine reproductive and respiratory syndrome virus (PRRSV) comprising a polynucleotide having the structure of Structural Formula 1 above. The genome of the PRRSV chimeric virus may be DNA or RNA, preferably RNA.

상기 [X]는 수탁번호 13394BP를 갖는 LMY ver2 변이주의 NSP1-beta를 포함하는, NSP1 유전자 부위에 해당하는 것으로, 상기 LMY ver2 변이주의 지놈을 제한효소 AscI과 PacI 로 처리하여 얻어지는 유전자 단편일 수 있으며, 예컨대, 서열번호 1 및/또는 서열번호 12의 핵산 서열, 또는 상기 염기 서열과 동등한 기능을 유지하는 범위 내에서 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열을 포함하는 것일 수 있다. The [X] corresponds to the NSP1 gene region, including NSP1-beta of the LMY ver2 mutant having accession number 13394BP, and may be a gene fragment obtained by treating the genome of the LMY ver2 mutant with restriction enzymes AscI and PacI, , For example, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, within a range that maintains the function equivalent to the nucleic acid sequence of SEQ ID NO: 1 and/or SEQ ID NO: 12, or the nucleotide sequence. % or more, 96% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more of a nucleic acid sequence having sequence homology.

상기 [Y]는 수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 ORF2 내지 ORF7 부위에 해당하는 것으로, BP2017-2 변이주의 지놈을 제한효소 AscI 와 PacI 로 처리하여 얻어지는 유전자 단편일 수 있으며, 예컨대, 서열번호 2의 핵산 서열 또는 상기 서열과 동등한 기능을 유지하는 범위 내에서 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열 을 포함하는 것일 수 있다.The [Y] corresponds to the ORF2 to ORF7 region of the BP2017-2 mutant having accession number KCTC 13393BP, and may be a gene fragment obtained by treating the genome of the BP2017-2 mutant with restriction enzymes AscI and PacI, for example, the sequence 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98 % or more, 99% or more, or may include a nucleic acid sequence having sequence homology of 99.5% or more.

일 예에서, 상기 구조식 1은 서열번호 4의 핵산서열 또는 상기 핵산 서열과 동등한 기능을 유지하는 범위 내에서 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열을 포함하는 것일 수 있다. 예컨대, 서열번호 4의 핵산서열일 수 있다.In one example, Structural Formula 1 is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more within a range that maintains the function equivalent to the nucleic acid sequence of SEQ ID NO: 4 or the nucleic acid sequence. , 96% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more of a nucleic acid sequence having sequence homology. For example, it may be the nucleic acid sequence of SEQ ID NO: 4.

하기 표 1에서, LMY ver2의 NSP1 유전자의 염기서열 중 굵은 글씨료 표시된 부분은 NSP1-beta 부위를 의미한다.In Table 1 below, the boldfaced portion in the nucleotide sequence of the NSP1 gene of LMY ver2 means the NSP1-beta region.

균주 유래strain derived 염기서열(5' > 3')base sequence (5' > 3') 서열번호SEQ ID NO: LMY ver2의NSP1NSP1 of LMY ver2 ATGTCTGGGATACTTGATCGGTGCACGTGTACCCCCAATGCCAGGGTGTTTATGGCGGAGGGCCAAGTTTACTGCACACGATGTCTCAGTGCACGGTCTCTCCTTCCCCTGAATCTCCAAGTTTCTGAGCTCGGGGTGCTGGGCCTATTCTACAGGCCCGAAGAGCCACTCCGGTGGACGTTGCCACGTGCATTCCCCACTGTTGAGTGCTCCCCCGCCGGCGCATGCTGGCTTTCCGCTATCTTTCCAATCGCACGAATGACCAGTGGAAACCTAAACTTCCAACAAAGAATGGTACGGGTCGCCGCCGAAATATACAGAGTCGGGCAACTTACGCCCGCTGTATTGAAGGCTCTGCAAGTATACGAGCGGGGTTGTAGGTGGTATCCCATCGTAGGACCTGTCCCTGGAGTGGCCGTTTTCGCCAACTCCCTGCATGTGAGTGATAGACCTTTCCCGGGAGCAACTCACGTATTAACCAACCTGCCACTCCCGCAGAGACCCAAGCCTGAGGACTTTTGCCCCTTCGAGTGTGCTATGGCCGCCGTATACGACGTCGGACATGGCGCCGTTATGTACGTTGCCGACGAGAGAGTCTCCTGGGCCCCTCGCGGCGGCGACGAAGTTAGATTCGAAACGGTCCCACAGGAGCTTAAGTCGGTTGCGAACCAATTATGTACGTCGTTCCCACCCCACCACGTAGTCGATATGTCTAAGTTCGCCTTTACCGCCCCCGGTTGCGGCGTATCTATGCGGGTCGAACGTCAATACGGCTGTCTCCCCGCCGATACGGTCCCCGAAGGCAACTGTTGGTGGAGCTTGTTCGATTCGCTCCCACTCGAAGTGCAAGGCAAAGAGATTCGCCACGCTAACCAATTCGGGTATCAGACTAAGCATGGCGTATCCGGTAAGTACCTACAGCGTAGGCTGCAAATCAACGGTCTCCGCGCAGTCGCTGACCCTAACGGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACTGGCCGAAGAACCTAGTTACCCCGGGTTCGAGGACCTCCTCCGCATAAGGGTTGAGTCTAATACGTCACCATTGGCTAACAAGGACGAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGC ATGTCTGGGATACTTGATCGGTGCACGTGTACCCCCAATGCCAGGGTGTTTATGGCGGAGGGCCAAGTTTACTGCACACGATGTCTCAGTGCACGGTCTCTCCTTCCCCTGAATCTCCAAGTTTCTGAGCTCGGGGTGCTGGGCCTATTCTACAGGCCCGAAGAGCCACTCCGGTGGACGTTGCCACGTGCATTCCCCACTGTTGAGTGCTCCCCCGCCGGCGCATGCTGGCTTTCCGCTATCTTTCCAATCGCACGAATGACCAGTGGAAACCTAAACTTCCAACAAAGAATGGTACGGGTCGCCGCCGAAATATACAGAGTCGGGCAACTTACGCCCGCTGTATTGAAGGCTCTGCAAGTATACGAGCGGGGTTGTAGGTGGTATCCCATCGTAGGACCTGTCCCTGGAGTGGCCGTTTTCGCCAACTCCCTGCATGTGAGTGATAGACCTTTCCCGGGAGCAACTCACGTATTAACCAACCTGCCACTCCCGCAGAGACCCAAGCCTGAGGACTTTTGCCCCTTCGAGTGTGCTATGGCCGCCGTATACGACGTCGGACATGGCGCCGTTATGTACGTTGCCGACGAGAGAGTCTCCTGGGCCCCTCGCGGCGGCGACGAAGTTAGATTCGAAACGGTCCCACAGGAGCTTAAGTCGGTTGCGAACCAATTATGTACGTCGTTCCCACCCCACCACGTAGTCGATATGTCTAAGTTCGCCTTTACCGCCCCCGGTTGCGGCGTATCTATGCGGGTCGAACGTCAATACGGCTGTCTCCCCGCCGATACGGTCCCCGAAGGCAACTGTTGGTGGAGCTTGTTCGATTCGCTCCCACTCGAAGTGCAAGGCAAAGAGATTCGCCACGCTAACCAATTCGGGTATCAGACTAAGCATGGCGTATCCGGTAAGTACCTACAGCGTAGGCTGCAAATCAACGGTCTCCGCGCAGTCGCTGACCCTAACGGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACTGGCCGAAGAACCTAGTTACCCCGGGTTCGAGGACCTCCTCCGCATAAGGGTTGAGTCTAATACGTCACCATTGGCTAACAAGGACGAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGC 1212 BP2017-2의ORF2-ORF7ORF2-ORF7 of BP2017-2 ATGAAATGGGGTCCATGCAAAGCCTTTTTTACAAAATTGGCCAACTTTTTGTGGATGCTTTCACGGAGTTCTTGGTGTCCATTGTTGATATCATTATATTTTTGGCCATTTTGTTTGGCTTCACCATCGCCGGTTGGCTGGTGGTCTTTTGCATCAGATTGGTTTGCTCCGCGATACTCCGTACGCGCCCTGCCATTCACTCTGAGCAATTACAGAAGATCTTATGAGGCCTTTCTTTCCCAGTGCCAAGTGGACATTCCCACCTGGGGAACTAAACATCCTTTGGGGATGCTTTGGCACCATAAGGTGTCAACCCTGATTGATGAAATGGTGTCGCGTCGAATGTACCGCATCATGGAAAAAGCAGGGCAGGCTGCCTGGAAACAGGTGGTGAGCGAGGCTACGCTGTCTCGCATTAGTAGTTTGGATGTGGTGGCTCATTTTCAGCATCTAGCCGCCATTGAAGCCGAGACCTGTAAATATTTGGCCTCCCGGCTGCCCATGCTACACAACCTGCGCATGACAGGTTCAAATGTAACCATAGTGTATAATAGCACTTTGAATCAGGTGTTTGCTATTTTTCCAACCCCTGGTTCCCGGCCAAAGCTTCATGATTTTCAGCAATGGTTAATAGCTGTACATTCCTCCATATTTTCCTCTGTTGCAGCTTCTTGTACTCTTTTTGTTGTGCTGTGGTTGCGGGTTCCAATACTACGTACTGTTTTTGGTTTCCGCTGGTTAGGGGCAATTTTTCTTTCGAACTCACAGTGAATTACACGGTGTGTCCACCTTGCCTCACCCGGCAAGCAGCCACAGAGATCTACGAACCCGGTAGGTCTCTTTGGTGCAGGATAGGGTATGACCGATGTGAGGAGGATGATCATGACGAGCTAGGGTTTATGGTACCGCCTGGCCTCTCCAGCGAAGGCCACTTGACTAGTGTTTACGCCTGGTTGGCGTTCTTGTCCTTCAGCTACACGGCCCAGTTCCATCCCGAGATATTCGGGATAGGGAATGTGAGTCGAGTTTATGTTGACATCAAACATCAACTCATCTGCGCCGAACATGACGGGCAGAACACCACCTTGCCTCGTCATGACAACATTTCAGCCGTGTTTCAGACCTATTACCAACATCAAGTCGACGGCGGCAATTGGTTTCACCTAGAATGGCTTCGTCCCTTCTTTTCCTCGTGGTTGGTTTTAAATGTCTCTTGGTTTCTCAGGCGTTCGCCTGCAAACCATGTTTCAGTTCGAGTCTTGCAGATATTAAGACCAACACCACCGCAGCGGCAAGCTTTGCTGTCCTCCAAGACATCAGTTGCCTTAGGCATCGCGACTCGGCCTCTGAGGCGATTCGCAAAATCCCTCAGTGCCGTACGGCGATAGGGACACCCGTGTATGTTACCATCACAGCCAATGTGACAGATGAGAATTATTTACATTCTTCTGATCTCCTCATGCTTTCTTCTTGCCTTTTCTATGCTTCTGAGATGAGTGAAAAGGGATTTAAGGTGGTATTTGGCAATGTGTCAGGCATCGTGGCTGTGTGTGTCAATTTTACCAGCTACGTCCAACATGTCAAGGAGTTTACCCAACGCTCCCTGGTGGTCGACCATGTGCGGTTGCTCCATTTCATGACACCTGAGACCATGAGGTGGGCAACTGTTTTAGCCTGTCTTTTTGCCATTCTGTTGGCAATTTGAATGTTTAAGTATGTTGGAGAAATGCTTGACCGCGGGCTGTTGCTCGCAATTGCTTTCTTTGTGGTGTATCGTGCCGTTCTGTTTTGCTGTGCTCGCCAACGCCAGCAACGACAGCAGCTCCCATCTACAGCTGATTTACAACTTGACGCTATGTGAGCTGAATGGCACAGATTGGCTAGCTAACAAATTTGATTGGGCAGTGGAGAGTTTTGTCATCTTTCCCGTTTTGACTCACATTGTCTCCTATGGTGCCCTCACTACCAGCCATTTCCTTGACACAGTCGCTTTAGTCACTGTGTCTACCGCCGGGTTTGTTCACGGGCGGTATGTCCTAAGTAGCATCTACGCGGTCTGTGCCCTGGCTGCGTTGACTTGCTTCGTCATTAGGTTTGCAAAGAATTGCATGTCCTGGCGCTACGCGTGTACCAGATATACCAACTTTCTTCTGGACACTAAGGGCGGACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAAAAGGGGCAAAGTTGAGGTCGAAGGTCATCTGATCGACCTCAAAAGAGTTGTGCTTGATGGTTCCGTGGCAACCCCTATAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCTTAGATGACTTCTGTCATGATAGCACGGCTCCAGAAAAGGTGCTTTTGGCGTTTTCTATTACCTACACGCCAGTGATGATATATGCCCTAAAGGTGAGTCGCGGCCGACTGCTAGGGCTTCTGCACCTTTTGATCTTCCTGAATTGTGCTTTCACCTTCGGGTACATGACTTTCGCGCACTTTCAGAGTACAAATAAGGTCGCGCTCACTATGGGAGCAGTAGTTGCACTCCTTTGGGGGGTGTACTCAGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGTTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTTGAAAGTGCCGCAGGCTTTCATCCGATTGCGGCAAATGATAACCACGCATTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACATTGGTGCCCGGGTTAAAAAGCCTCGTGTTGGGTGGCAGAAAAGCTGTTAAACAGGGAGTGGTAAACCTTGTCAAATATGCCAAATAACAACGGCAAGCAGCAGAAGAGAAAGAAGGGGGATGGCCAGCCAGTCAATCAGCTGTGCCAGATGCTGGGTAAGATCATCGCTCAGCAAAACCAGTCCAGAGGCAAGGGACCGGGAAAGAAAAATAAGAAGAAAAACCCGGAGAAGCCCCATTTTCCTCTAGCGACTGAAGATGATGTCAGACATCACTTTACCCCTAGTGAGCGGCAATTGTGTCTGTCGTCAATCCAGACCGCCTTTAATCAAGGCGCTGGGACTTGCACCCTGTCAGATTCAGGGAGGATAAGTTACACTGTGGAGTTTAGTTTGCCTACGCATCATACTGTGCGCCTGATCCGCGTCACAGCATCACCCTCAGCATGAATGAAATGGGGTCCATGCAAAGCCTTTTTTACAAAATTGGCCAACTTTTTGTGGATGCTTTCACGGAGTTCTTGGTGTCCATTGTTGATATCATTATATTTTTGGCCATTTTGTTTGGCTTCACCATCGCCGGTTGGCTGGTGGTCTTTTGCATCAGATTGGTTTGCTCCGCGATACTCCGTACGCGCCCTGCCATTCACTCTGAGCAATTACAGAAGATCTTATGAGGCCTTTCTTTCCCAGTGCCAAGTGGACATTCCCACCTGGGGAACTAAACATCCTTTGGGGATGCTTTGGCACCATAAGGTGTCAACCCTGATTGATGAAATGGTGTCGCGTCGAATGTACCGCATCATGGAAAAAGCAGGGCAGGCTGCCTGGAAACAGGTGGTGAGCGAGGCTACGCTGTCTCGCATTAGTAGTTTGGATGTGGTGGCTCATTTTCAGCATCTAGCCGCCATTGAAGCCGAGACCTGTAAATATTTGGCCTCCCGGCTGCCCATGCTACACAACCTGCGCATGACAGGTTCAAATGTAACCATAGTGTATAATAGCACTTTGAATCAGGTGTTTGCTATTTTTCCAACCCCTGGTTCCCGGCCAAAGCTTCATGATTTTCAGCAATGGTTAATAGCTGTACATTCCTCCATATTTTCCTCTGTTGCAGCTTCTTGTACTCTTTTTGTTGTGCTGTGGTTGCGGGTTCCAATACTACGTACTGTTTTTGGTTTCCGCTGGTTAGGGGCAATTTTTCTTTCGAACTCACAGTGAATTACACGGTGTGTCCACCTTGCCTCACCCGGCAAGCAGCCACAGAGATCTACGAACCCGGTAGGTCTCTTTGGTGCAGGATAGGGTATGACCGATGTGAGGAGGATGATCATGACGAGCTAGGGTTTATGGTACCGCCTGGCCTCTCCAGCGAAGGCCACTTGACTAGTGTTTACGCCTGGTTGGCGTTCTTGTCCTTCAGCTACACGGCCCAGTTCCATCCCGAGAT ATTCGGGATAGGGAATGTGAGTCGAGTTTATGTTGACATCAAACATCAACTCATCTGCGCCGAACATGACGGGCAGAACACCACCTTGCCTCGTCATGACAACATTTCAGCCGTGTTTCAGACCTATTACCAACATCAAGTCGACGGCGGCAATTGGTTTCACCTAGAATGGCTTCGTCCCTTCTTTTCCTCGTGGTTGGTTTTAAATGTCTCTTGGTTTCTCAGGCGTTCGCCTGCAAACCATGTTTCAGTTCGAGTCTTGCAGATATTAAGACCAACACCACCGCAGCGGCAAGCTTTGCTGTCCTCCAAGACATCAGTTGCCTTAGGCATCGCGACTCGGCCTCTGAGGCGATTCGCAAAATCCCTCAGTGCCGTACGGCGATAGGGACACCCGTGTATGTTACCATCACAGCCAATGTGACAGATGAGAATTATTTACATTCTTCTGATCTCCTCATGCTTTCTTCTTGCCTTTTCTATGCTTCTGAGATGAGTGAAAAGGGATTTAAGGTGGTATTTGGCAATGTGTCAGGCATCGTGGCTGTGTGTGTCAATTTTACCAGCTACGTCCAACATGTCAAGGAGTTTACCCAACGCTCCCTGGTGGTCGACCATGTGCGGTTGCTCCATTTCATGACACCTGAGACCATGAGGTGGGCAACTGTTTTAGCCTGTCTTTTTGCCATTCTGTTGGCAATTTGAATGTTTAAGTATGTTGGAGAAATGCTTGACCGCGGGCTGTTGCTCGCAATTGCTTTCTTTGTGGTGTATCGTGCCGTTCTGTTTTGCTGTGCTCGCCAACGCCAGCAACGACAGCAGCTCCCATCTACAGCTGATTTACAACTTGACGCTATGTGAGCTGAATGGCACAGATTGGCTAGCTAACAAATTTGATTGGGCAGTGGAGAGTTTTGTCATCTTTCCCGTTTTGACTCACATTGTCTCCTATGGTGCCCTCACTACCAGCCATTTCCTTGACACAGTCGCTTTAGTCACT GTGTCTACCGCCGGGTTTGTTCACGGGCGGTATGTCCTAAGTAGCATCTACGCGGTCTGTGCCCTGGCTGCGTTGACTTGCTTCGTCATTAGGTTTGCAAAGAATTGCATGTCCTGGCGCTACGCGTGTACCAGATATACCAACTTTCTTCTGGACACTAAGGGCGGACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAAAAGGGGCAAAGTTGAGGTCGAAGGTCATCTGATCGACCTCAAAAGAGTTGTGCTTGATGGTTCCGTGGCAACCCCTATAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCTTAGATGACTTCTGTCATGATAGCACGGCTCCAGAAAAGGTGCTTTTGGCGTTTTCTATTACCTACACGCCAGTGATGATATATGCCCTAAAGGTGAGTCGCGGCCGACTGCTAGGGCTTCTGCACCTTTTGATCTTCCTGAATTGTGCTTTCACCTTCGGGTACATGACTTTCGCGCACTTTCAGAGTACAAATAAGGTCGCGCTCACTATGGGAGCAGTAGTTGCACTCCTTTGGGGGGTGTACTCAGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGTTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTTGAAAGTGCCGCAGGCTTTCATCCGATTGCGGCAAATGATAACCACGCATTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACATTGGTGCCCGGGTTAAAAAGCCTCGTGTTGGGTGGCAGAAAAGCTGTTAAACAGGGAGTGGTAAACCTTGTCAAATATGCCAAATAACAACGGCAAGCAGCAGAAGAGAAAGAAGGGGGATGGCCAGCCAGTCAATCAGCTGTGCCAGATGCTGGGTAAGATCATCGCTCAGCAAAACCAGTCCAGAGGCAAGGGACCGGGAAAGAAAAATAAGAAGAAAAACCCGGAGAAGCCCCATTTTCCTCTAGCGACTGAAGATG ATGTCAGACATCACTTTACCCCTAGTGAGCGGCAATTGTGTCTGTCGTCAATCCAGACCGCCTTTAATCAAGGCGCTGGGACTTGCACCCTGTCAGATTCAGGGAGGATAAGTTACACTGTGGAGTTTAGTTTGCCTACGCATCATACTGTGCGCCTGATCCGCGTCACAGCATCACCCTCAGCATGA 22 [A]n[A]n AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 33

Figure 112019116651150-pat00001
Figure 112019116651150-pat00001

Figure 112019116651150-pat00002
Figure 112019116651150-pat00002

Figure 112019116651150-pat00003
Figure 112019116651150-pat00003

Figure 112019116651150-pat00004
Figure 112019116651150-pat00004

Figure 112019116651150-pat00005
Figure 112019116651150-pat00005

Figure 112019116651150-pat00006
Figure 112019116651150-pat00006

Figure 112019116651150-pat00007
Figure 112019116651150-pat00007

(상기 표에서, 본 명세서에서 제공되는 폴리뉴클레오타이드(RNA)는 서열번호 1 내지 4에 제시된 서열 중 T가 U로 치환된 핵산 서열을 포함하는 것일 수 있다.)(In the table above, the polynucleotide (RNA) provided herein may include a nucleic acid sequence in which T is substituted with U among the sequences shown in SEQ ID NOs: 1 to 4.)

본 발명은 구조식 1의 폴리뉴클레오타이드를 지놈으로 포함하는 PRRSV 키메라 바이러스를 제공한다. 상기 PRRSV 키메라 바이러스는 1 내지 80계대, 1 내지 70계대, 1 내지 60계대, 1 내지 50 계대, 1 내지 40 계대, 1 내지 30 계대, 1 내지 20 계대, 또는 1 내지 10 계대 배양된 자손 바이러스를 포함하는 것일 수 있다. The present invention provides a PRRSV chimeric virus comprising the polynucleotide of Structural Formula 1 as a genome. The PRRSV chimeric virus is a cultured progeny virus of passages 1 to 80, passages 1 to 70, passages 1 to 60, passages 1 to 50, passages 1 to 40, passages 1 to 30, passages 1 to 20, or passages 1 to 10. may include.

[구조식 1][Structural Formula 1]

5'-[X]-[Y]-3'5'-[X]-[Y]-3'

상기 식에서, [X]는 수탁번호 13394BP를 갖는 LMY ver2 변이주의 NSP1 유전자 및/또는 NSP1-beta의 핵산 서열 또는 상기 핵산 서열과 70% 이상의 서열 상동성을 갖는 핵산 서열이며, 상기 [Y]는 수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 ORF2 내지 ORF7 부위의 유전자 핵산 서열 또는 상기 핵산 서열과 70% 이상의 서열 상동성을 갖는 핵산 서열이다.In the above formula, [X] is the nucleic acid sequence of the NSP1 gene and/or NSP1-beta of the LMY ver2 mutant having accession number 13394BP, or a nucleic acid sequence having at least 70% sequence homology with the nucleic acid sequence, and [Y] is the accession The gene nucleic acid sequence of the ORF2 to ORF7 regions of the BP2017-2 mutant strain having the number KCTC 13393BP or a nucleic acid sequence having at least 70% sequence homology with the nucleic acid sequence.

예컨대, 상기 [X]는 수탁번호 13394BP를 갖는 LMY ver2 변이주의 NSP1 유전자 및/또는 NSP1-beta의 핵산 서열 또는 상기 핵산 서열과 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열일 수 있다.For example, the [X] is 70% or more, 75% or more, 80% or more, 85% or more, 90% of the nucleic acid sequence or the nucleic acid sequence of the NSP1 gene and/or NSP1-beta of the LMY ver2 mutant having accession number 13394BP. It may be a nucleic acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology.

또한, 상기 [Y]는 수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 ORF2 내지 ORF7 부위의 유전자 핵산 서열 또는 상기 핵산 서열과 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열일 수 있다.In addition, the [Y] is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more of the nucleic acid sequence or the nucleic acid sequence of the ORF2 to ORF7 region of the BP2017-2 mutant having accession number KCTC 13393BP. , 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more sequence homology.

본 발명의 일 예에 따르면, 상기 구조식 1의 [Y]의 3'말단에 [A]n을 추가로 포함할 수 있다. 상기 n은 염기 A를 포함하는 뉴클레오타이드의 개수로, 10 내지 100의 정수일 수 있으며, 예컨대, 10 내지 80, 10 내지 70, 10 내지 60, 10 내지 50, 10 내지 40, 10 내지 30, 15 내지 80, 15 내지 70, 15 내지 60, 15 내지 50, 15 내지 40, 15 내지 30, 20 내지 30, 20 내지 26의 정수일 수 있다.According to an embodiment of the present invention, [A]n may be further included at the 3' end of [Y] of Structural Formula 1 above. n is the number of nucleotides including the base A, and may be an integer of 10 to 100, for example, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 15 to 80 , 15 to 70, 15 to 60, 15 to 50, 15 to 40, 15 to 30, 20 to 30, may be an integer of 20 to 26.

상기 폴리뉴클레오타이드는 RNA, 상기 RNA의 역전사체 (DNA), 또는 이들의 조합일 수 있다. 상기 폴리뉴클레오타이드는 PRRSV 키메라 바이러스의 지놈(genome)으로서의 기능을 가질 수 있다. 이에, 본 발명의 다른 예는 상기 구조식 1의 구조를 갖는 폴리뉴클레오타이드를 포함하는 돼지 생식기 호흡기 증후군 바이러스(PRRSV)의 키메라 바이러스를 제공한다. 상기 PRRSV 키메라 바이러스의 지놈은 DNA 또는 RNA일 수 있으며, 바람직하게는 RNA일 수 있다. The polynucleotide may be RNA, a reverse transcript (DNA) of the RNA, or a combination thereof. The polynucleotide may have a function as a genome of the PRRSV chimeric virus. Accordingly, another example of the present invention provides a chimeric virus of porcine reproductive and respiratory syndrome virus (PRRSV) comprising a polynucleotide having the structure of Structural Formula 1 above. The genome of the PRRSV chimeric virus may be DNA or RNA, preferably RNA.

상기 [X]는 수탁번호 13394BP를 갖는 LMY ver2 변이주의 NSP1-beta를 포함하는, NSP1 유전자 부위에 해당하는 것으로, 상기 LMY ver2 변이주의 지놈을 제한효소 AscI과 PacI 로 처리하여 얻어지는 유전자 단편일 수 있으며, 예컨대, 서열번호 1의 핵산 서열 또는 상기 핵산 서열과 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열을 포함하는 것일 수 있다. The [X] corresponds to the NSP1 gene region, including NSP1-beta of the LMY ver2 mutant having accession number 13394BP, and may be a gene fragment obtained by treating the genome of the LMY ver2 mutant with restriction enzymes AscI and PacI, , For example, the nucleic acid sequence of SEQ ID NO: 1 or 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, It may include a nucleic acid sequence having 99% or more, or 99.5% or more sequence homology.

상기 [Y]는 수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 ORF2 내지 ORF7 부위에 해당하는 것으로, BP2017-2 변이주의 지놈을 제한효소 AscI 와 PacI 로 처리하여 얻어지는 유전자 단편일 수 있으며, 예컨대, 서열번호 2의 핵산 서열 또는 상기 핵산 서열과 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열을 포함하는 것일 수 있다.The [Y] corresponds to the ORF2 to ORF7 region of the BP2017-2 mutant having accession number KCTC 13393BP, and may be a gene fragment obtained by treating the genome of the BP2017-2 mutant with restriction enzymes AscI and PacI, for example, the sequence 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, Or it may include a nucleic acid sequence having 99.5% or more sequence homology.

일 예에서, 상기 구조식 1은 서열번호 4의 핵산서열 또는 상기 핵산 서열과을 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 서열 상동성을 갖는 핵산 서열을 포함하는 것일 수 있다. 예컨대, 서열번호 4의 핵산서열일 수 있다.In one example, Structural Formula 1 is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more of the nucleic acid sequence of SEQ ID NO: 4 or the nucleic acid sequence , 98% or more, 99% or more, or 99.5% or more of a nucleic acid sequence having sequence homology. For example, it may be the nucleic acid sequence of SEQ ID NO: 4.

일 구체예는 지놈으로서 서열번호 4의 폴리뉴클레오타이드를 포함하는 핵산서열을 포함하는 상기 PRRSV 키메라 바이러스를 제공하며, 이를 LMY+BP2017라고 명명하였다. 상기 LMY+BP2017 바이러스는 수탁번호 KCTC 13675BP 을 갖는 바이러스일 수 있다.One embodiment provides the PRRSV chimeric virus comprising a nucleic acid sequence comprising a polynucleotide of SEQ ID NO: 4 as a genome, which was named LMY+BP2017. The LMY+BP2017 virus may be a virus having accession number KCTC 13675BP.

상기 LMY+BP2017 키메라 바이러스의 뼈대가 되는, LMY ver2 변이주는 LMY 모균주(Accession No. GenBank accession no.DQ473474.1.)의 서열번호 5의 Nonstructural protein 1 (NSP1)에 포함된 적어도 하나의 염기가 치환된 변이 NSP1-beta를 포함하는 PRRSV 변이주일 수 있다.At least one base contained in Nonstructural protein 1 (NSP1) of SEQ ID NO: 5 of the LMY parent strain (Accession No. GenBank accession no.DQ473474.1.) It may be a PRRSV mutant including a substituted mutant NSP1-beta.

상기 LMY 균주의 NSP1 및/또는 NSP1-beta를 암호화하는 유전자의 염기서열에서 치환되는 염기서열은 공지되어 있는 SAVE(Synthetic Attenuated Virus Engineering) 프로그램을 사용하여 선택된 것일 수 있으며, 바람직하게는, 본 발명자들이 개발한 SAVE 프로그램을 이용하여 선택한 것일 수 있다. 구체적으로, 모균주인 LMY 의 genome에서 유전적으로 안전성이 높은 NSP1 부위를 본 발명자들이 자체 개발한 SAVE 프로그램으로 분석하여 비교적 Codon Pair Bias (CPB)가 높은 곳을 나타난 염기 서열의 일부 또는 전체를 선택해 치환하여 Deoptimization 시킨 염기서열일 수 있다. 상기 Deoptimization시킨 염기 서열은, 서열번호 11의 염기서열로 이루어지는 LMY 균주의 NSP1 단백질을 암호화하는 유전자의 222번 위치의 G가 C로 치환된 변이, 225번 위치의 C가 A로 치환된 변이, 237번 위치의 T가 C로 치환된 변이, 240번 위치의 A가 T로 치환된 변이, 252번 위치의 T가 C로 치환된 변이, 306번 위치의 A가 C로 치환된 변이, 309번 위치의 T가 C로 치환된 변이, 312번 위치의 G가 A로 치환된 변이, 315번 위치의 C가 A로 치환된 변이, 324번 위치의 T가 C로 치환된 변이, 327번 위치의 C가 G로 치환된 변이, 330번 위치의 G가 A로 치환된 변이, 333번 위치의 C가 T로 치환된 변이, 336번 위치의 C가 G로 치환된 변이, 339번 위치의 T가 C로 치환된 변이, 342번 위치의 A가 T로 치환된 변이, 345번 위치의 T가 A로 치환된 변이, 357번 위치의 A가 G로 치환된 변이, 363번 위치의 T가 A로 치환된 변이, 366번 위치의 T가 C로 치환된 변이, 378번 위치의 C가 T로 치환된 변이, 379번 위치의 C가 A로 치환된 변이, 381번 위치의 C가 G로 치환된 변이, 393번 위치의 T가 C로 치환된 변이, 396번 위치의 T가 A로 치환된 변이, 543번 위치의 T가 C로 치환된 변이, 546번 위치의 T가 C로 치환된 변이, 549번 위치의 C가 A로 치환된 변이, 555번 위치의 T가 C로 치환된 변이, 558번 위치의 T가 C로 치환된 변이, 561번 위치의 T가 A로 치환된 변이, 573번 위치의 C가 T로 치환된 변이, 579번 위치의 T가 C로 치환된 변이, 582번 위치의 G가 T로 치환된 변이, 588번 위치의 T가 C로 치환된 변이, 612번 위치의 T가 C로 치환된 변이, 618번 위치의 G가 C로 치환된 변이, 621번 위치의 T가 C로 치환된 변이, 627번 위치의 A가 T로 치환된 변이, 633번 위치의 T가 C로 치환된 변이, 639번 위치의 T가 G로 치환된 변이, 654번 위치의 C가 T로 치환된 변이, 673번 위치의 C가 T로 치환된 변이, 675번 위치의 C가 A로 치환된 변이, 678번 위치의 C가 T로 치환된 변이, 681번 위치의 C가 G로 치환된 변이, 684번 위치의 C가 G로 치환된 변이, 705번 위치의 G가 C로 치환된 변이, 708번 위치의 C가 T로 치환된 변이, 729번 위치의 A가 C로 치환된 변이, 735번 위치의 T가 C로 치환된 변이, 738번 위치의 G가 T로 치환된 변이, 741번 위치의 T가 C로 치환된 변이, 744번 위치의 T가 C로 치환된 변이, 747번 위치의 T가 A로 치환된 변이, 771번 위치의 T가 C로 치환된 변이, 786번 위치의 T가 C로 치환된 변이, 789번 위치의 C가 T로 치환된 변이, 792번 위치의 T가 G로 치환된 변이, 810번 위치의 C가 T로 치환된 변이, 825번 위치의 T가 C로 치환된 변이, 828번 위치의 C가 T로 치환된 변이, 838번 위치의 T가 C로 치환된 변이, 840번 위치의 G가 C로 치환된 변이, 846번 위치의 C가 G로 치환된 변이, 849번 위치의 G가 A로 치환된 변이, 858번 위치의 A가 G로 치환된 변이, 867번 위치의 T가 C로 치환된 변이, 879번 위치의 T가 C로 치환된 변이, 882번 위치의 C가 G로 치환된 변이, 885번 위치의 C가 T로 치환된 변이, 891번 위치의 C가 T로 치환된 변이, 900번 위치의 T가 C로 치환된 변이, 903번 위치의 C가 A로 치환된 변이, 906번 위치의 T가 C로 치환된 변이, 924번 위치의 G가 T로 치환된 변이, 936번 위치의 T가 C로 치환된 변이, 939번 위치의 T가 C로 치환된 변이, 948번 위치의 A가 C로 치환된 변이, 954번 위치의 A가 C로 치환된 변이, 963번 위치의 A가 T로 치환된 변이, 966번 위치의 T가 C로 치환된 변이, 1026번 위치의 A가 G로 치환된 변이, 1029번 위치의 G가 C로 치환된 변이, 1038번 위치의 C가 T로 치환된 변이, 1047번 위치의 T가 C로 치환된 변이, 1053번 위치의 T가 C로 치환된 변이, 1066번 위치의 A가 C로 치환된 변이, 1068번 위치의 A가 C로 치환된 변이, 1086번 위치의 C가 T로 치환된 변이, 및 1110번 위치의 T가 C로 치환된 변이로 이루어진 군에서 선택된 1 이상, 25 이상, 66 이상, 80 이상, 또는 상기 91개 변이 모두를 포함하는 것일 수 있으나, 이에 제한되지 않는다. The nucleotide sequence substituted in the nucleotide sequence of the gene encoding NSP1 and/or NSP1-beta of the LMY strain may be selected using a known SAVE (Synthetic Attenuated Virus Engineering) program, and preferably, the present inventors It may be selected using the developed SAVE program. Specifically, in the genome of the parent strain LMY, the NSP1 region with high genetic safety was analyzed with the SAVE program developed by the present inventors, and part or all of the nucleotide sequence showing the relatively high Codon Pair Bias (CPB) was selected and replaced. It may be a deoptimized nucleotide sequence. The deoptimized nucleotide sequence is a mutation in which G at position 222 of the gene encoding the NSP1 protein of the LMY strain consisting of the nucleotide sequence of SEQ ID NO: 11 is substituted with C, C at position 225 is substituted with A, 237 A mutation in which T at position is substituted with C, A at position 240 is substituted with T, T at position 252 is substituted with C, A at position 306 is substituted with C, A mutation at position 309 of T is substituted with C, G at position 312 is substituted with A, C at position 315 is substituted with A, T at position 324 is substituted with C, C at position 327 is substituted with G, G at position 330 is substituted with A, C at position 333 is substituted with T, C at position 336 is substituted with G, T at position 339 is C A mutation at position 342 is substituted with T, T at position 345 is substituted with A, A at position 357 is substituted with G, T at position 363 is substituted with A mutation, T at position 366 is substituted with C, C at position 378 is substituted with T, C at position 379 is substituted with A, C at position 381 is substituted with G , T at position 393 is substituted with C, T at position 396 is substituted with A, T at position 543 is substituted with C, T at position 546 is substituted with C, 549 A mutation in which C at the position is substituted with A, a mutation in which T at position 555 is substituted with C, a mutation in which T at position 558 is substituted with C, a mutation where T at position 561 is substituted with A, and position 573 of C is substituted with T, T at position 579 is substituted with C, G at position 582 is substituted with T, T at position 588 is substituted with C, T at position 612 is substituted with C, G at position 618 is substituted with C, T at position 621 is substituted with C, A at position 627 is substituted with T, T at position 633 is C mutation substituted with , 63 T at position 9 is substituted with G, C at position 654 is substituted with T, C at position 673 is substituted with T, C at position 675 is substituted with A, 678 A mutation in which C at position C is substituted with T, C at position 681 is substituted with G, C at position 684 is substituted with G, G at position 705 is substituted with C, a mutation at position 708 C is substituted with T, A at position 729 is substituted with C, T at position 735 is substituted with C, G at position 738 is substituted with T, T at position 741 is A mutation in which C is substituted, T at position 744 is substituted with C, T at position 747 is substituted with A, T at position 771 is substituted with C, T at position 786 is C Substituted mutation, C at position 789 is substituted with T, T at position 792 is substituted with G, C at position 810 is substituted with T, T at position 825 is substituted with C mutation, mutation in which C at position 828 is substituted with T, T at position 838 is substituted with C, G at position 840 is substituted with C, C at position 846 is substituted with G, G at position 849 is substituted with A, A at position 858 is substituted with G, T at position 867 is substituted with C, T at position 879 is substituted with C, mutation at position 882 A mutation where C at position G is substituted, C at position 885 is substituted with T, C at position 891 is substituted with T, T at position 900 is substituted with C, a mutation at position 903 C is substituted with A, T at position 906 is substituted with C, G at position 924 is substituted with T, T at position 936 is substituted with C, T at position 939 is A mutation at position 948 is substituted with C, A at position 954 is substituted with C, A at position 963 is substituted with T, T at position 966 is C substituted mutation, mutation in which A at position 1026 is substituted with G, G at position 1029 is A mutation in which C is substituted, a mutation in which C at position 1038 is substituted with T, a mutation in which T at position 1047 is substituted with C, a mutation in which T at position 1053 is substituted with C, A at position 1066 is C 1 or more, 25 or more selected from the group consisting of a substituted mutation, a mutation in which A at position 1068 is substituted with C, a mutation in which C at position 1086 is substituted with T, and a mutation in which T at position 1110 is substituted with C , 66 or more, 80 or more, or may include all of the 91 mutations, but is not limited thereto.

상기 SAVE 프로그램을 사용해 바이러스 유전자 코돈이 쌍으로 배열 시 상호작용하여 생기는 편향성인, CPB를 컴퓨터 알고리즘을 이용해 수치화할 수 있으며, 바이러스의 증식성은 CPB 수치가 감소(deoptimization)되면 증식성이 감소하고, 약독화 되므로(Virus Attenuation by Genome-Scale Changes in Codon Pair Bias, Science, 2008, J. Robert Coleman et al.), CPB 수치가 높은 일부 염기서열을 CPB 수치가 낮은 염기서열로 치환하거나, 바람직하게는 Codon Pair Deoptimization 원리에 따라 침묵 돌연변이(silent mutation) 시켜 본 발명의 키메라 바이러스 제조에 사용되는 약독화된 LMY ver2 변이주를 제조할 수 있다. 상기 LMY ver2 변이주는 서열번호 6의 염기서열로 이루어진, NSP1-beta 단백질을 암호화하는 유전자, 또는 서열번호 12의 염기서열로 이루어진, NSP1 단백질을 암호화하는 유전자를 포함할 수 있다. using the above SAVE program CPB, which is a bias caused by interaction when viral gene codons are arranged in pairs, can be quantified using a computer algorithm. by Genome-Scale Changes in Codon Pair Bias, Science, 2008, J. Robert Coleman et al.), some nucleotide sequences with high CPB values are substituted with nucleotide sequences with low CPB values, or preferably according to the principle of Codon Pair Deoptimization The attenuated LMY ver2 mutant used in the production of the chimeric virus of the present invention can be prepared by silent mutation. The LMY ver2 mutant may include a gene encoding the NSP1-beta protein, consisting of the nucleotide sequence of SEQ ID NO: 6, or a gene encoding the NSP1 protein, consisting of the nucleotide sequence of SEQ ID NO: 12.

또한, 본 발명은 본 발명의 PRRSV 키메라 바이러스의 지놈를 포함하는 세포를 제공할 수 있다. 상기 세포는 상기 키메라 바이러스를 다량 제조하기 위해, 상기 키메라 바이러스의 지놈(DNA, RNA, 또는 이를 포함하는 벡터), 또는 상기 지놈을 포함하는 키메라 바이러스가 트랜스펙션되는 세포를 의미하며, 상기 목적 범위 내라면 세포의 종류를 특별히 한정하지는 않는다. In addition, the present invention may provide a cell comprising the genome of the PRRSV chimeric virus of the present invention. The cell means a cell transfected with the genome of the chimeric virus (DNA, RNA, or a vector including the same), or a chimeric virus including the genome, in order to produce a large amount of the chimeric virus, and the target range If it is me, the type of cell is not particularly limited.

본 발명의 일 예에 따르면, 상기 PRRSV의 키메라 바이러스 또는 이의 계대 배양된 자손을 포함하는 돼지 생식기 호흡기 증후군 바이러스 백신 조성물을 제공할 수 있다.According to one embodiment of the present invention, it is possible to provide a porcine reproductive and respiratory syndrome virus vaccine composition comprising the PRRSV chimeric virus or a subcultured progeny thereof.

상기 계대 배양된 자손은 1 내지 80계대, 1 내지 70계대, 1 내지 60계대, 1 내지 50 계대, 1 내지 40 계대, 1 내지 30 계대, 1 내지 20 계대, 또는 1 내지 10 계대 배양된 자손 바이러스를 포함하는 것일 수 있다.The passaged progeny include passages 1 to 80, passages 1 to 70, passages 1 to 60, passages 1 to 50, passages 1 to 40, passages 1 to 30, passages 1 to 20, or passages 1 to 10 of the progeny virus. may include.

본 발명의 일 예에 따르면, 상기 백신은 생백신 또는 사백신일 수 있으나, 생백신인 것이 바람직하다. 구체적으로, 본원에 기술된 약독화된 PRRS 키메라 바이러스는 약제학적으로 허용되는 담체에 전술한 하나 이상의 바이러스주를 생존 상태로 함유하는 변형 생백신일 수 있다. 또한, 또는 대안적으로, 불활성화된 바이러스를 사백신을 제조하는 데에도 사용할 수 있다. According to an embodiment of the present invention, the vaccine may be a live vaccine or a dead vaccine, but is preferably a live vaccine. Specifically, the attenuated PRRS chimeric virus described herein may be a live modified vaccine containing one or more of the aforementioned strains in a live state in a pharmaceutically acceptable carrier. Additionally, or alternatively, the inactivated virus may also be used to prepare a dead vaccine.

상기 백신은 담체, 희석제, 부형제, 및 어주번트(adhuvant)로 이루어진 군에서 선택되는 1 이상을 더 포함할 수 있다. 약제학적으로 허용되는 담체는 그 종류를 특별히 한정하지 않으나, 임의의 모든 용매, 분산 매질, 코팅, 안정제, 보존제, 항균제 및 항진균제, 등장제, 흡수지연제 등을 포함할 수 있다.The vaccine may further include one or more selected from the group consisting of a carrier, a diluent, an excipient, and an adjuvant. The pharmaceutically acceptable carrier is not particularly limited in its type, but may include any and all solvents, dispersion media, coatings, stabilizers, preservatives, antibacterial and antifungal agents, isotonic agents, absorption delaying agents, and the like.

한편, 백신 조성물에 포함된 본 발명의 약독화 키메라 바이러스의 유효량은 바이러스의 유효 용량이 투여된 동물에서 면역 반응을 유인하거나 유인할 수 있는 바이러스의 양일 수 있다. 유효한 양은 백신 성분 및 투여 스케줄에 의존적일 수 있다. 백신 조성물의 투여량은 TCID50 2 내지 6, 바람직하게는 3 내지 4, 범위이나, 개체의 종류에 따라 달라 질 수 있으며, 이에 제한되지 않는다.Meanwhile, the effective amount of the attenuated chimeric virus of the present invention contained in the vaccine composition may be an amount of virus that induces or can induce an immune response in an animal to which the effective dose of the virus is administered. An effective amount may depend on the vaccine component and dosing schedule. The dosage of the vaccine composition is in the range of TCID 50 2 to 6, preferably 3 to 4, but may vary depending on the type of individual, but is not limited thereto.

본 발명의 LMY-BP2017 키메라 바이러스의 지놈, 및 이를 포함하는 백신 조성물은 PRRS 질환의 영향으로부터 돼지를 예방하기 위해 사용될 수 있다. 또한, PRRS 키메라 바이러스의 면역원성 단편 또는 분획을 비롯한 서브유닛도 PRRS 질환의 영향으로부터 돼지를 예방하는데 사용될 수 있다. 본 발명의 약독화된 키메라 바이러스 또는 이를 포함하는 백신 조성물은 PRRS를 유발하는 PRRS 바이러스주에 돼지가 노출되기 전에 예방적으로 투여될 수 있고, 상기 바이러스주에 돼지가 노출됨과 동시에 돼지에 투여될 수 있고, 바이러스주에 표적 돼지가 노출된 후 치료적으로 투여될 수 있다. The genome of the LMY-BP2017 chimeric virus of the present invention, and a vaccine composition comprising the same, can be used to prevent pigs from the effects of PRRS disease. In addition, subunits, including immunogenic fragments or fractions of PRRS chimeric virus, can also be used to prevent pigs from the effects of PRRS disease. The attenuated chimeric virus of the present invention or a vaccine composition comprising the same may be administered prophylactically before pigs are exposed to a PRRS strain causing PRRS, and may be administered to pigs at the same time as pigs are exposed to the strain. and can be administered therapeutically after the target pig is exposed to the virus strain.

본 발명이 제공하는 백신 조성물은 돼지 생식기 호흡기 증후군(PRRS)의 예방, 예를 들어 북미형 PRRSV에 의해 발병하는 PRRS의 예방에 이용될 수 있다. 일 예에서 상기 북미형 PRRSV는 타입 II형 VR2332 바이러스 균주(strain)일 수 있다. The vaccine composition provided by the present invention can be used for prevention of porcine reproductive and respiratory syndrome (PRRS), for example, PRRS caused by North American type PRRSV. In one example, the North American type PRRSV may be a type II VR2332 virus strain.

본 발명의 약독화된 PRRSV 키메라 바이러스, 또는 이를 포함하는 백신 조성물은 경구, 비경구, 피하, 근육내, 피내, 설하, 경피, 직장, 경점막, 흡입을 통한 표면적, 협측 투여를 통해, 또는 이의 조합으로 투여될 수 있다. 또한, 약독화된 PRRS 키메라 바이러스는 약독화된 바이러스의 서방출을 허용할 수 있는 이식체 형태로 투여될 수 있다. The attenuated PRRSV chimeric virus of the present invention, or a vaccine composition comprising the same, is administered via oral, parenteral, subcutaneous, intramuscular, intradermal, sublingual, transdermal, rectal, transmucosal, surface area via inhalation, buccal administration, or its may be administered in combination. In addition, the attenuated PRRS chimeric virus can be administered in the form of an implant capable of allowing sustained release of the attenuated virus.

본 발명의 약독화된 PRRSV 키메라 바이러스 또는 이를 포함하는 백신 조성물은 주사, 흡입 또는 이식을 통해 투여될 수 있고, 주사가 특히 바람직하다. 백신접종 또는 치료의 원하는 기간 및 유효성에 따라 약독화된 PRRSV 키메라 바이러스 또는 이를 포함하는 백신 조성물은 1회 또는 여러 번, 또한 간헐적으로, 예컨대 수일, 수주 또는 수개월 동안 매일 다른 투여량으로 투여될 수 있다. 주사는 원하는 양으로 주사하거나 피하 혹은 비강에 분무하여 주입할 수 있다, 또는 대안적으로 연속 주입할 수 있다. The attenuated PRRSV chimeric virus of the present invention or a vaccine composition comprising the same can be administered via injection, inhalation or implantation, with injection being particularly preferred. Depending on the desired duration and effectiveness of vaccination or treatment, the attenuated PRRSV chimeric virus or vaccine composition comprising the same may be administered once or several times, and also intermittently, with different dosages daily, such as for days, weeks or months. . Injections may be given by injection in the desired amount or by subcutaneous or nasal spray, or alternatively, continuous infusion.

본 발명의 일 예에 따르면 상기 본 발명의 PRRSV 키메라 바이러스는 상기 키메라 바이러스와 이의 모균주(Accession No. GenBank accession no.DQ473474.1.)를 돼지의 폐 대식세포에 접종하고 측정한 바이러스의 TCID50의 값이, 모균주의 TCID50 값에 비해 0.01 배 내지 0.1배의 TCID50 값을 갖는 바이러스일 수 있다. 바람직하게는 상기 측정기간은 2일 후이며, 상기 TCID50 값은 0.05배 내지 0.1배 일 수 있다. 본 발명의 PRRSV 키메라 바이러스는 모균주 보다 낮은 TCID50 값을 가지며, 모균주보다 증식성이 감소되고 약독화 되어있다. According to one embodiment of the present invention, the PRRSV chimeric virus of the present invention is the TCID 50 of the virus measured by inoculating the chimeric virus and its parent strain (Accession No. GenBank accession no. DQ473474.1.) into porcine lung macrophages. The value of may be a virus having a TCID 50 value of 0.01 to 0.1 times compared to the TCID 50 value of the parent strain. Preferably, the measurement period is after 2 days, and the TCID 50 value may be 0.05 to 0.1 times. The PRRSV chimeric virus of the present invention has a lower TCID 50 value than that of the parent strain, and has reduced proliferation and attenuation than the parent strain.

또한, 본 발명의 PRRSV 키메라 바이러스와 이의 모균주(Accession No. GenBank accession no.DQ473474.1.)를 돼지에 접종하고 측정한 변이주의 중화 항체 함량이, 모균주의 2배 내지 8배, 바람직하게는 2배 내지 4배를 갖는 바이러스를 제공한다. 상기 측정기간은 적절하게는 28일 후인 것이 바람직하다. 중화항체라 함은 대표적인 북미형 PRRSV 균주인 VR2332에 대항하는 중화능력을 보유한 항체를 의미한다. 따라서, 본 발명의 약독화된 키메라 바이러스 또는, 이를 포함하는 백신조성물을 돼지에 접종할 경우, 돼지의 중화항체의 역가가 증가시키며 돼지의 면역인자의 발현을 증가시켜 PRRS에 대한 면역 효과를 현저히 상승시킬 수 있다.In addition, the neutralizing antibody content of the mutant measured by inoculating pigs with the PRRSV chimeric virus of the present invention and its parent strain (Accession No. GenBank accession no. DQ473474.1.) is 2 to 8 times the parent strain, preferably gives viruses with 2- to 4-fold. The measurement period is preferably after 28 days. The neutralizing antibody refers to an antibody having neutralizing ability against VR2332, a representative North American type PRRSV strain. Therefore, when the attenuated chimeric virus of the present invention or a vaccine composition comprising the same is inoculated into pigs, the titer of the neutralizing antibody of the pig increases and the immune effect against PRRS is significantly increased by increasing the expression of the immune factor in the pig. can do it

일 구체예에 따르면, 상기에서 기술한 본 발명의 PRRSV 키메라 바이러스 LMY+BP2017의 CPB수치는 LMY 모균주(Accession No. GenBank accession no.DQ473474.1.)보다 낮은 수치를 나타내며, 바람직하게는 -0.39 내지 0, 더욱 바람직하게는 -0.35 내지 -0.20, 적절하게는 -0.35 내지 -0.26, 예를 들어 -0.2393184052058128일 수 있다. CPB 수치가 -0.39 미만일 경우, 바이러스 작출에 어려움이 있으며, 0을 초과할 경우, 작출은 가능하나 증식성이 감소하지 않아 약독화 되지 않는다는 문제점이 있다. 따라서, 본 발명의 약독화된 LMY+BP2017 키메라 바이러스는 상기 CPB 수치를 갖는 것이 바람직하다.According to one embodiment, the CPB level of the PRRSV chimeric virus LMY+BP2017 of the present invention described above is lower than that of the LMY parent strain (Accession No. GenBank accession no.DQ473474.1.), preferably -0.39 to 0, more preferably -0.35 to -0.20, suitably -0.35 to -0.26, for example -0.2393184052058128. If the CPB level is less than -0.39, there is a difficulty in virus extraction, and when it exceeds 0, there is a problem that the production is possible but the proliferation is not reduced and thus attenuation is not performed. Therefore, the attenuated LMY+BP2017 chimeric virus of the present invention preferably has the above CPB level.

또한, 본 발명은 CpG, UpA 수치가 모균주(Accession No. GenBank accession no.DQ473474.1.) 의 1.0배 내지 3.0배를 갖는 LMY+BP2017 키메라 바이러스를 제공한다. CpG, UpA 비율의 변화는 deoptimization 과정에서 필연적으로 발생하는 결과로서, 진핵세포 유전자의 CpG, UpA의 수치를 증가시키면, cell stress를 유발하여 바이러스의 증식성이 감소되어 바이러스를 약독화 시킬 수 있다. 본 발명의 LMY+BP2017 키메라 바이러스는 모균주보다 높은 CpG, UpA 수치를 가지며, 바람직하게는 모균주의 1.0배 내지 3.0배 높은 수치를 갖고, 예를 들어 상기 본 발명의 약독화된 키메라 바이러스의 CpG는 1.1753, UpA 는 1.03 일 수 있다.In addition, the present invention provides an LMY+BP2017 chimeric virus having CpG and UpA levels 1.0 to 3.0 times that of the parent strain (Accession No. GenBank accession no. DQ473474.1.). Changes in the CpG and UpA ratios inevitably occur during the deoptimization process. Increasing the levels of CpG and UpA in eukaryotic genes can cause cell stress and decrease the proliferation of the virus, thereby weakening the virus. The LMY+BP2017 chimeric virus of the present invention has higher CpG and UpA levels than the parent strain, preferably 1.0 to 3.0 times higher than the parent strain, for example, the CpG of the attenuated chimeric virus of the present invention. may be 1.1753, UpA may be 1.03.

본 발명의 일 예에 따르면, 수탁번호 13394BP를 갖는 LMY ver2 변이주의 지놈을 제한효소 AscI과 PacI 로 처리하여 폴리뉴클레오타이드 절편을 제조하는 단계, 수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 지놈을 제한효소 AscI 와 PacI 로 처리하여 폴리뉴클레오타이드 절편을 제조하는 단계, 및 상기 LMY ver 2의 폴리뉴클레오타이드 절편과 BP2017-2의 폴리뉴클레오타이드 절편을 재조합하여 감염성 클론(infectious clone)을 제조하는 단계를 포함하는, 돼지 생식기 호흡기 증후군 바이러스의 키메라 바이러스를 생산하는 방법을 제공할 수 있다.According to an example of the present invention, the genome of the LMY ver2 mutant having accession number 13394BP is treated with restriction enzymes AscI and PacI to prepare a polynucleotide fragment, and the genome of the BP2017-2 mutant having accession number KCTC 13393BP is restricted with restriction enzymes A step of preparing a polynucleotide fragment by treatment with AscI and PacI, and recombination of the polynucleotide fragment of LMY ver 2 and the polynucleotide fragment of BP2017-2 to prepare an infectious clone (infectious clone), porcine reproductive system A method for producing a chimeric virus of respiratory syndrome virus may be provided.

상기 LMY ver2 변이주의 지놈을 제한효소 AscI과 PacI 로 처리하여 제조된 폴리뉴클레오타이드 절편은 NSP1-beta를 암호화하는 부위를 포함할 수 있다.The polynucleotide fragment prepared by treating the genome of the LMY ver2 mutant with restriction enzymes AscI and PacI may include a region encoding NSP1-beta.

상기 BP2017-2 변이주의 지놈을 제한효소 AscI 와 PacI 로 처리하여 제조된 폴리뉴클레오타이드 절편은 ORF2 내지 ORF7 부위를 포함할 수 있다.The polynucleotide fragment prepared by treating the genome of the BP2017-2 mutant with restriction enzymes AscI and PacI may include ORF2 to ORF7 regions.

상기 절편을 재조합하는 단계에서 리가아제(ligase)를 사용할 수 있으며, 상기 제조한 감염성 클론을 세포에 접종해 키메라 바이러스를 제조할 수 있다.In the step of recombination of the fragment, ligase may be used, and the prepared infectious clone may be inoculated into cells to prepare a chimeric virus.

상기 세포는 키메라 바이러스를 다량 제조하기 위해, 키메라 바이러스 DNA 또는 RNA, 또는 이를 포함하는 벡터, 감염성 클론, 키메라 바이러스가 트랜스펙션되는 세포를 의미하며, 세포의 종류를 특별히 한정하지는 않는다.The cell means a cell transfected with a chimeric virus DNA or RNA, or a vector including the same, an infectious clone, or a chimeric virus in order to produce a large amount of the chimeric virus, and the type of cell is not particularly limited.

또한, 본 발명의 일 실시예는 상기 백신 조성물을 포함하는, 돼지 생식기 호흡기 증후군의 예방 또는 치료용 조성물을 제공할 수 있다.In addition, an embodiment of the present invention may provide a composition for preventing or treating porcine reproductive and respiratory syndrome, including the vaccine composition.

바람직한 형태로서, 본 발명의 돼지 생식기 호흡기 증후군의 예방 또는 치료용 조성물은 당업자에게 공지된 추가 성분을 포함할 수 있고, 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다.In a preferred form, the composition for preventing or treating porcine reproductive and respiratory syndrome of the present invention may include additional components known to those skilled in the art, and may further include appropriate carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions. can

또한 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 당해 기술 분야에 알려진 적합한 제제는 문헌 (Remington's Pharmaceutical Science, 최근, Mack Publishing Company, Easton PA)에 개시되어 있는 것을 사용하는 것이 바람직하다In addition, according to a conventional method, it can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injection solutions. Suitable formulations known in the art are preferably those disclosed in Remington's Pharmaceutical Science, recently Mack Publishing Company, Easton PA.

본 발명의 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토오스, 덱스트로오스, 수크로오스, 소르비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시 벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등이 있다. 상기 조성물을 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘 카보네이트, 수크로오스, 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil. When formulating the composition, it is usually prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are mixed with at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. in the composition. is prepared In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, Witepsol, Macrogol, Tween 61, cacao butter, laurin fat, glycerogelatin, and the like can be used.

본 발명의 조성물의 바람직한 투여량은 개체의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 예를 들어, 바람직한 효과를 위해서, 본 발명의 조성물은 1일 0.0001 내지 1,000 mg/kg(체중)의 양으로 투여할 수 있다. 상기 조성물의 투여는 하루에 한번 투여할 수도 있고, 수 회 나누어 투여할 수도 있다.The preferred dosage of the composition of the present invention varies depending on the condition and weight of the individual, the degree of disease, the drug form, the route and duration of administration, but may be appropriately selected by those skilled in the art. For example, for a desirable effect, the composition of the present invention may be administered in an amount of 0.0001 to 1,000 mg/kg (body weight) per day. Administration of the composition may be administered once a day or divided into several administrations.

본 발명의 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있다.The composition of the present invention may be administered to an individual by various routes. All modes of administration are contemplated.

본 발명의 또 다른 일 예는, 본 발명의 백신 조성물을 돼지에 투여하는 단계를 포함하는, 돼지 생식기 호흡기 증후군을 예방 또는 치료하는 방법을 제공할 수 있다.Another embodiment of the present invention may provide a method for preventing or treating porcine reproductive and respiratory syndrome, comprising administering the vaccine composition of the present invention to a pig.

본 발명의 키메라 바이러스 지놈을 포함하는 백신 조성물을 돼지에 투여함으로써 PRRSV 항원에 대한 돼지의 면역 반응이 증강되도록 유도할 수 있으며, PRRSV 항원에 대한 돼지의 면역 반응이 증강되도록 유도해, 돼지 생식기 호흡기 증후군을 예방 또는 치료하는 방법을 제공할 수 있다. 바람직하게는 예방할 수 있다.By administering the vaccine composition comprising the chimeric virus genome of the present invention to a pig, the immune response of the pig to the PRRSV antigen can be induced to be enhanced, and the immune response of the pig to the PRRSV antigen can be induced to be enhanced, resulting in porcine reproductive and respiratory syndrome can provide a method for preventing or treating Preferably, it can be prevented.

구체적으로, 상기 방법은 조성물을 피하 주사, 정맥내 주사, 진피내 주사, 비경구 주사, 근육내 주사, 무침(needle free) 주사, 전기천공, 경구 전달, 비내 전달, 구비강(oronasal) 전달, 또는 그의 임의의 조합에 의해 투여할 수 있다.Specifically, the method comprises subcutaneous injection, intravenous injection, intradermal injection, parenteral injection, intramuscular injection, needle free injection, electroporation, oral delivery, intranasal delivery, oronasal delivery, or any combination thereof.

본 발명은 전술한 임의의 방법을 수행하기 위한 키트(kit)를 제공할 수 있다. 이 키트는 용기, 바람직하게는 본 발명의 약독화된 PRRS 키메라 바이러스를 함유하는 백신 조성물, 약제학적으로 허용되는 담체, 보강제 및 PRRS 감염의 임상 징후 또는 효과, 바람직하게는 PRRS의 빈도 또는 중증도를 경감시키도록 이를 필요로 하는 동물에게 상기 면역원성 조성물을 투여하기 위한 사용설명서를 포함할 수 있다. 키트는 또한 주사 수단 및/또는 다른 형태의 투여 수단을 포함할 수 있다. 또한, 키트는 용매를 포함할 수 있다. 약독화된 백신은 동결건조될 수 있고, 용매로 복원되어 주사 및/또는 흡입용 용액이 될 수 있다. 용매는 물, 생리식염수, 완충액 또는 보강 용매일 수 있다. 키트는 약독화된 바이러스, 용매 및/또는 약제학적으로 허용되는 담체를 함유하는 분리 용기를 포함할 수 있다. 사용설명서는 하나 이상의 용기에 부착된 라벨 및/또는 인쇄물일 수 있다.The present invention may provide a kit for performing any of the methods described above. The kit comprises a container, preferably a vaccine composition containing the attenuated PRRS chimeric virus of the present invention, a pharmaceutically acceptable carrier, adjuvant and clinical signs or effects of PRRS infection, preferably alleviating the frequency or severity of PRRS. Instructions for administering the immunogenic composition to an animal in need thereof may be included. The kit may also include means of injection and/or other forms of means of administration. The kit may also include a solvent. The attenuated vaccine may be lyophilized and reconstituted with a solvent to provide a solution for injection and/or inhalation. The solvent may be water, physiological saline, a buffer or an adjuvant solvent. The kit may comprise a separate container containing the attenuated virus, a solvent and/or a pharmaceutically acceptable carrier. Instructions for use may be labels and/or printed materials affixed to one or more containers.

본 발명에 따른 PRRSV 바이러스 키메라 바이러스는 돼지에 접종시 중화항체의분비량을 현저히 증가시킴으로써 PRRS 를 효과적으로 방어하는데 이용할 수 있으며, PRRS 치료용 백신으로 유용하게 사용할 수 있다. The PRRSV virus chimeric virus according to the present invention can be used to effectively protect PRRS by significantly increasing the secretion of neutralizing antibody when inoculated into pigs, and can be usefully used as a PRRS treatment vaccine.

도 1은 PRRS 바이러스의 일반적인 지놈 배열(genomic arrangement)을 나타낸다.
도 2는 LMY ver2 바이러스와 BP2017-2 바이러스의 클론의 일부를 각각 절단하고 연결하여 합성한 LMY+BP2017 키메라 바이러스의 지놈 배열을 나타낸 모식도이다.
도 3은 PRRSV LMY ver2 바이러스와 LMY+BP2017 키메라 바이러스의 계통수(Phylogenetic tree)를 나타낸다.
도 4는 PRRSV LMY ver2 바이러스와 LMY+BP2017 키메라 바이러스의 돼지폐포대식세포(Porcine Alveolar Macrophage cell; PAM cell) 에서의 증식성 차이를 나타낸다.
도 5는 돼지에 PRRSV LMY, LMY+BP2017 키메라 바이러스, PBS 접종 후 중화항체 분비 차이를 비교한 것이다.
1 shows a general genomic arrangement of a PRRS virus.
2 is a schematic diagram showing the genomic sequence of the LMY+BP2017 chimeric virus synthesized by cutting and linking some of the clones of the LMY ver2 virus and the BP2017-2 virus, respectively.
3 shows the phylogenetic tree of the PRRSV LMY ver2 virus and the LMY+BP2017 chimeric virus.
Figure 4 shows the difference in the proliferation of PRRSV LMY ver2 virus and LMY + BP2017 chimeric virus in porcine alveolar macrophage cells (PAM cells).
5 is a comparison of the difference in neutralizing antibody secretion after inoculation with PRRSV LMY, LMY+BP2017 chimeric virus, and PBS in pigs.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명이 하기 실시예에 의해 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the present invention is not limited by the following examples.

RNA는 쉽게 파괴되기 때문에 DNA로 바꾸어 모든 작업을 수행한 후에 이로부터 RNA를 합성하여 세포를 형질감염시켰다.RNA is easily destroyed, so after all the work was done by converting it into DNA, RNA was synthesized from it and cells were transfected.

실시예 1: 키메라 바이러스의 제조Example 1: Preparation of Chimeric Virus

1-1. 키메라 바이러스의 디자인1-1. design of chimeric virus

PRRS 키메라 바이러스는LMY 균주의 변이주의 비구조단백질(Non structural Protein 1, NSP1; 서열번호: 11) 부위 및 충남 공주시 남산리 남산농장에서 2017년에 분리된 BP2017-2의 ORF2, ORF3, ORF4, ORF5, ORF6, 및 ORF7 부위를 포함하도록 디자인하였다.The PRRS chimeric virus is a non-structural protein (NSP1; SEQ ID NO: 11) region of a mutant of the LMY strain and ORF2, ORF3, ORF4, ORF5, ORF6 of BP2017-2 isolated in 2017 from Namsan Farm, Namsan-ri, Gongju-si, Chungcheongnam-do , and an ORF7 site.

1-2. 약독화된 LMY 변이주 제조1-2. Preparation of attenuated LMY mutants

기존 검역본부에서 분리한 PRRS 균주인, LMY 균주(GenBank accession no.DQ473474.1.)를 사용해 NSP1 부위의 유전자의 염기서열 중 91개의 염기를 치환하여 LMY ver2변이주를 제조하였다. 상기 NSP1 부위의 유전자는 NSP1-alpha 부위에서 25개 염기가, NSP1-beta 부위에서 66개 염기가 치환되었다.Using the LMY strain (GenBank accession no.DQ473474.1.), which is a PRRS strain isolated from the existing quarantine headquarters, 91 bases in the nucleotide sequence of the NSP1 region were substituted to prepare an LMY ver2 mutant. In the gene of the NSP1 region, 25 bases were substituted in the NSP1-alpha region and 66 bases were substituted in the NSP1-beta region.

구체적으로, 상기 재조합 균주 LMY ver2는 일반적으로 알려진 SAVE(Synthetic Attenuated Virus Engineering) 프로그램 또는, 본 발명자들이 개발한 SAVE(Synthetic Attenuated Virus Engineering) 프로그램을 이용하여 Codon Pair Deoptimization 원리(표 3)에 따라 염기서열의 일부를 침묵 돌연변이(silent mutation) 시켜 제조하였다. 우선, SAVE 프로그램을 사용해 LMY 바이러스의 유전자 코돈이 쌍으로 배열시 상호작용하여 생기는 편향성인 CPB(codon pair base)값을 컴퓨터 알고리즘을 이용해 수치화하였다. CPB 수치는 LMY 바이러스 유전자의 일부 염기서열이 다른 염기서열로 치환될 시 변동되며, 바이러스의 증식성과 밀접한 관련이 있다. 바이러스의 증식성은 염기서열 치환을 통해 CPB 수치가 감소(deoptimization)되면, 증식성이 감소하고 약독화된다(Virus Attenuation by Genome-Scale Changes in Codon Pair Bias, Science, 2008, J. Robert Coleman et al.). 본 발명자들은 LNY 모균주의 genome에서 유전적으로 안정성이 높은 NSP1 부위(NSP1-alphe 및 NSP1-beta, 서열번호 11)를 선정하여 SAVE 프로그램으로 분석하였으며, CPB값이 비교적 높게 나타난 염기 부위 중 NSP1-alpha 부위에서 25개, NSP1-beta 부위에서 66개, 총 91개의 염기를 선택해 다른 염기로 치환하여 Deoptimization 시켜 LMY 바이러스 변이주를 제조하였다. 상기 방법으로 제조된 NSP1의 91개 염기서열이 돌연변이(서열번호 12)된 LMY 바이러스 변이주를 LMY ver2로 지칭하였으며, 염기서열을 아래 표 3에 나타냈다. 상기 LMY ver2는 수탁번호 13394BP를 갖는다.Specifically, the recombinant strain LMY ver2 is a nucleotide sequence according to the Codon Pair Deoptimization principle (Table 3) using a commonly known Synthetic Attenuated Virus Engineering (SAVE) program or a Synthetic Attenuated Virus Engineering (SAVE) program developed by the present inventors. A part of it was prepared by silent mutation. First, the SAVE program was used to quantify the CPB (codon pair base) value, a bias that occurs when the gene codons of the LMY virus interact in pairs, using a computer algorithm. The CPB level fluctuates when some nucleotide sequences of the LMY virus gene are substituted with other nucleotide sequences, and is closely related to the proliferation of the virus. When the CPB level is reduced (deoptimized) through nucleotide sequence substitution, the proliferation of the virus is reduced and attenuated (Virus Attenuation by Genome-Scale Changes in Codon Pair Bias, Science, 2008, J. Robert Coleman et al. ). The present inventors selected NSP1 sites (NSP1-alphe and NSP1-beta, SEQ ID NO: 11) with high genetic stability from the genome of the LNY parent strain and analyzed them with the SAVE program. Among the nucleotide sites with relatively high CPB values, NSP1-alpha LMY virus mutants were prepared by selecting 25 bases from the site and 66 from the NSP1-beta site, and substituted with other bases for a total of 91 bases, followed by deoptimization. The LMY virus mutant strain in which the 91 nucleotide sequence of NSP1 prepared by the above method was mutated (SEQ ID NO: 12) was referred to as LMY ver2, and the nucleotide sequence is shown in Table 3 below. The LMY ver2 has accession number 13394BP.

명칭designation 염기서열base sequence 서열번호SEQ ID NO: LMY의 NSP1 beta 유전자NSP1 beta gene in LMY GCTGCTGTCTACGATGTTGGTCATGGCGCCGTCATGTATGTGGCCGATGAGAGAGTCTCCTGGGCCCCTCGTGGCGGGGATGAAGTAAGATTTGAAACTGTCCCACAGGAGCTCAAGTCGGTTGCGAACCAACTCTGCACCTCCTTCCCACCCCACCACGTAGTGGACATGTCTAAGTTCGCCTTTACAGCCCCTGGGTGTGGTGTTTCTATGCGGGTCGAACGTCAATATGGCTGTCTCCCCGCTGACACTGTCCCCGAAGGCAACTGCTGGTGGAGCTTGTTTGACTCGCTCCCATTGGAAGTCCAGGGCAAAGAAATTCGCCATGCTAACCAATTTGGCTACCAGACCAAGCATGGTGTCTCTGGTAAGTACCTACAGCGGAGGCTGCAAATTAATGGTCTCCGAGCAGTAGCTGACCCAAATGGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACTAGCGGAAGAACCCAGTTACCCTGGGTTTGAGGACCTCCTCAGAATAAGGGTTGAGTCTAACACGTCACCATTGGCTAACAAGGATGAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGCGCTGCTGTCTACGATGTTGGTCATGGCGCCGTCATGTATGTGGCCGATGAGAGAGTCTCCTGGGCCCCTCGTGGCGGGGATGAAGTAAGATTTGAAACTGTCCCACAGGAGCTCAAGTCGGTTGCGAACCAACTCTGCACCTCCTTCCCACCCCACCACGTAGTGGACATGTCTAAGTTCGCCTTTACAGCCCCTGGGTGTGGTGTTTCTATGCGGGTCGAACGTCAATATGGCTGTCTCCCCGCTGACACTGTCCCCGAAGGCAACTGCTGGTGGAGCTTGTTTGACTCGCTCCCATTGGAAGTCCAGGGCAAAGAAATTCGCCATGCTAACCAATTTGGCTACCAGACCAAGCATGGTGTCTCTGGTAAGTACCTACAGCGGAGGCTGCAAATTAATGGTCTCCGAGCAGTAGCTGACCCAAATGGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACTAGCGGAAGAACCCAGTTACCCTGGGTTTGAGGACCTCCTCAGAATAAGGGTTGAGTCTAACACGTCACCATTGGCTAACAAGGATGAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGC 55 LMY ver2NSP1 beta 유전자LMY ver2NSP1 beta gene GC C GC C GT A TACGA C GT C GG A CATGGCGCCGT T ATGTA C GT T GCCGA C GAGAGAGTCTCCTGGGCCCCTCG C GGCGG C GA C GAAGT T AGATT C GAAAC G GTCCCACAGGAGCT T AAGTCGGTTGCGAACCAA T T A TG T AC G TC G TTCCCACCCCACCACGTAGT C GA T ATGTCTAAGTTCGCCTTTAC C GCCCC C GG T TG C GG C GT A TCTATGCGGGTCGAACGTCAATA C GGCTGTCTCCCCGC C GA T AC G GTCCCCGAAGGCAACTG T TGGTGGAGCTTGTT C GA T TCGCTCCCA C T C GAAGT G CA A GGCAAAGA G ATTCGCCA C GCTAACCAATT C GG G TA T CAGAC T AAGCATGG C GT A TC C GGTAAGTACCTACAGCG T AGGCTGCAAAT C AA C GGTCTCCG C GCAGT C GCTGACCC T AA C GGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACT G GC C GAAGAACC T AGTTACCC C GGGTT C GAGGACCTCCTC C G C ATAAGGGTTGAGTCTAA T ACGTCACCATTGGCTAACAAGGA C GAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGCGC C GC C GT A TACGA C GT C GG A CATGGCGCCGT T ATGTA C GT T GCCGA C GAGAGAGTCTCCTGGGCCCCTCG C GGCGG C GA C GAAGT T AGATT C GAAAC G GTCCCACAGGAGCT T AAGTCGGTTGCGAACCAA T T A TG T AC G TC G TTCCCACCCCACCACGTAGT C GA T ATGTCTAAGTTCGCCTTTAC C GCCCC C GG T TG C GG C GT A TCTATGCGGGTCGAACGTCAATA C GGCTGTCTCCCCGC C GA T AC G GTCCCCGAAGGCAACTG T TGGTGGAGCTTGTT C GA T TCGCTCCCA C T C GAAGT G CA A GGCAAAGA G ATTCGCCA C GCTAACCAATT C GG G TA T CAGAC T AAGCATGG C GT A TC C GGTAAGTACCTACAGCG AGGCTGCAAAT T AA C C C GGTCTCCG GCAGT GCTGACCC T C AA C C GC G GGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACT GAAGAACC T AGTTACCC GGGTT C C C G C GAGGACCTCCTC ATAAGGGTTGAGTCTAA T ACGTCACCATTGGCTAACAAGGA C GAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGC 66 LMY의 NSP1 유전자NSP1 gene in LMY ATGTCTGGGATACTTGATCGGTGCACGTGTACCCCCAATGCCAGGGTGTTTATGGCGGAGGGCCAAGTTTACTGCACACGATGTCTCAGTGCACGGTCTCTCCTTCCCCTGAATCTCCAAGTTTCTGAGCTCGGGGTGCTGGGCCTATTCTACAGGCCCGAAGAGCCACTCCGGTGGACGTTGCCACGTGCATTCCCCACTGTTGAGTGCTCCCCCGCCGGGGCCTGCTGGCTTTCTGCAATCTTTCCAATTGCACGAATGACCAGTGGAAACCTAAACTTCCAACAAAGAATGGTACGGGTCGCAGCTGAGATCTACAGAGTTGGCCAGCTCACCCCTGCAGTTTTGAAGGCTCTACAAGTTTATGAGCGGGGTTGCCGCTGGTATCCCATTGTTGGACCTGTCCCTGGAGTGGCCGTTTTCGCCAACTCCCTGCATGTGAGTGATAGACCTTTCCCGGGAGCAACTCACGTATTAACCAACCTGCCACTCCCGCAGAGACCCAAGCCTGAGGACTTTTGCCCCTTCGAGTGTGCTATGGCTGCTGTCTACGATGTTGGTCATGGCGCCGTCATGTATGTGGCCGATGAGAGAGTCTCCTGGGCCCCTCGTGGCGGGGATGAAGTAAGATTTGAAACTGTCCCACAGGAGCTCAAGTCGGTTGCGAACCAACTCTGCACCTCCTTCCCACCCCACCACGTAGTGGACATGTCTAAGTTCGCCTTTACAGCCCCTGGGTGTGGTGTTTCTATGCGGGTCGAACGTCAATATGGCTGTCTCCCCGCTGACACTGTCCCCGAAGGCAACTGCTGGTGGAGCTTGTTTGACTCGCTCCCATTGGAAGTCCAGGGCAAAGAAATTCGCCATGCTAACCAATTTGGCTACCAGACCAAGCATGGTGTCTCTGGTAAGTACCTACAGCGGAGGCTGCAAATTAATGGTCTCCGAGCAGTAGCTGACCCAAATGGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACTAGCGGAAGAACCCAGTTACCCTGGGTTTGAGGACCTCCTCAGAATAAGGGTTGAGTCTAACACGTCACCATTGGCTAACAAGGATGAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGCATGTCTGGGATACTTGATCGGTGCACGTGTACCCCCAATGCCAGGGTGTTTATGGCGGAGGGCCAAGTTTACTGCACACGATGTCTCAGTGCACGGTCTCTCCTTCCCCTGAATCTCCAAGTTTCTGAGCTCGGGGTGCTGGGCCTATTCTACAGGCCCGAAGAGCCACTCCGGTGGACGTTGCCACGTGCATTCCCCACTGTTGAGTGCTCCCCCGCCGGGGCCTGCTGGCTTTCTGCAATCTTTCCAATTGCACGAATGACCAGTGGAAACCTAAACTTCCAACAAAGAATGGTACGGGTCGCAGCTGAGATCTACAGAGTTGGCCAGCTCACCCCTGCAGTTTTGAAGGCTCTACAAGTTTATGAGCGGGGTTGCCGCTGGTATCCCATTGTTGGACCTGTCCCTGGAGTGGCCGTTTTCGCCAACTCCCTGCATGTGAGTGATAGACCTTTCCCGGGAGCAACTCACGTATTAACCAACCTGCCACTCCCGCAGAGACCCAAGCCTGAGGACTTTTGCCCCTTCGAGTGTGCTATGGCTGCTGTCTACGATGTTGGTCATGGCGCCGTCATGTATGTGGCCGATGAGAGAGTCTCCTGGGCCCCTCGTGGCGGGGATGAAGTAAGATTTGAAACTGTCCCACAGGAGCTCAAGTCGGTTGCGAACCAACTCTGCACCTCCTTCCCACCCCACCACGTAGTGGACATGTCTAAGTTCGCCTTTACAGCCCCTGGGTGTGGTGTTTCTATGCGGGTCGAACGTCAATATGGCTGTCTCCCCGCTGACACTGTCCCCGAAGGCAACTGCTGGTGGAGCTTGTTTGACTCGCTCCCATTGGAAGTCCAGGGCAAAGAAATTCGCCATGCTAACCAATTTGGCTACCAGACCAAGCATGGTGTCTCTGGTAAGTACCTACAGCGGAGGCTGCAAATTAATGGTCTCCGAGCAGTAGCTGACCCAAATGGACCTTTCGTCGTACAGTACTTCTCCGTCAAGG AGAGTGGATCCGCCACTTGAAACTAGCGGAAGAACCCAGTTACCCTGGGTTTGAGGACCTCCTCAGAATAAGGGTTGAGTCTAACACGTCACCATTGGCTAACAAGGATGAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGC 1111 LMY ver2 NSP1 유전자LMY ver2 NSP1 gene ATGTCTGGGATACTTGATCGGTGCACGTGTACCCCCAATGCCAGGGTGTTTATGGCGGAGGGCCAAGTTTACTGCACACGATGTCTCAGTGCACGGTCTCTCCTTCCCCTGAATCTCCAAGTTTCTGAGCTCGGGGTGCTGGGCCTATTCTACAGGCCCGAAGAGCCACTCCGGTGGACGTTGCCACGTGCATTCCCCACTGTTGAGTGCTCCCCCGCCGG C GC A TGCTGGCTTTC C GC T ATCTTTCCAAT C GCACGAATGACCAGTGGAAACCTAAACTTCCAACAAAGAATGGTACGGGTCGC C GC C GA A AT A TACAGAGT C GG G CA A CT T AC G CC C GC T GT A TTGAAGGCTCT G CAAGT A TA C GAGCGGGGTTG TA G G TGGTATCCCAT C GT A GGACCTGTCCCTGGAGTGGCCGTTTTCGCCAACTCCCTGCATGTGAGTGATAGACCTTTCCCGGGAGCAACTCACGTATTAACCAACCTGCCACTCCCGCAGAGACCCAAGCCTGAGGACTTTTGCCCCTTCGAGTGTGCTATGGC C GC C GT A TACGA C GT C GG A CATGGCGCCGT T ATGTA C GT T GCCGA C GAGAGAGTCTCCTGGGCCCCTCG C GGCGG C GA C GAAGT T AGATT C GAAAC G GTCCCACAGGAGCT T AAGTCGGTTGCGAACCAA TTA TG T AC G TC G TTCCCACCCCACCACGTAGT C GA T ATGTCTAAGTTCGCCTTTAC C GCCCC C GG T TG C GG C GT A TCTATGCGGGTCGAACGTCAATA C GGCTGTCTCCCCGC C GA T AC G GTCCCCGAAGGCAACTG T TGGTGGAGCTTGTT C GA T TCGCTCCCA C T C GAAGT G CA A GGCAAAGA G ATTCGCCA C GCTAACCAATT C GG G TA T CAGAC T AAGCATGG C GT A TC C GGTAAGTACCTACAGCG T AGGCTGCAAAT C AA C GGTCTCCG C GCAGT C GCTGACCC T AA C GGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACT G GC C GAAGAACC T AGTTACCC C GGGTT C GAGGACCTCCTC C G C ATAAGGGTTGAGTCTAA T ACGTCACCATTGGCTAACAAGGA C GAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGC ATGTCTGGGATACTTGATCGGTGCACGTGTACCCCCAATGCCAGGGTGTTTATGGCGGAGGGCCAAGTTTACTGCACACGATGTCTCAGTGCACGGTCTCTCCTTCCCCTGAATCTCCAAGTTTCTGAGCTCGGGGTGCTGGGCCTATTCTACAGGCCCGAAGAGCCACTCCGGTGGACGTTGCCACGTGCATTCCCCACTGTTGAGTGCTCCCCCGCCGG C GC A TGCTGGCTTTC C GC T ATCTTTCCAAT C GCACGAATGACCAGTGGAAACCTAAACTTCCAACAAAGAATGGTACGGGTCGC C GC C GA A AT A TACAGAGT C GG G CA A CT T AC G CC C GC T GT A TTGAAGGCTCT G CAAGT A TA C GAGCGGGGTTG TA G G TGGTATCCCAT C GT A GGACCTGTCCCTGGAGTGGCCGTTTTCGCCAACTCCCTGCATGTGAGTGATAGACCTTTCCCGGGAGCAACTCACGTATTAACCAACCTGCCACTCCCGCAGAGACCCAAGCCTGAGGACTTTTGCCCCTTCGAGTGTGCTATGGC C GC C GT A TACGA C GT C GG A CATGGCGCCGT T ATGTA C GT T GCCGA C GAGAGAGTCTCCTGGGCCCCTCG C GGCGG C GA C GAAGT T AGATT C GAAAC G GTCCCACAGGAGCT T AAGTCGGTTGCGAACCAA TTA TG T AC G TC G TTCCCACCCCACCACGTAGT C GA T ATGTCTAAGTTCGCCTTTAC C GCCCC C GG T TG C GG C GT A TCTATGCGGGTCGAACGTCAATA C GGCTGTCTCCCCGC C GA T AC G GTCCCCGAAGGCAACTG T TGGTGGAGCTTGTT C GA T TCGCTCCCA C T C GAAGT G CA A GGCAAAGA G ATTCGCCA C G CTAACCAATT G C GG TA T CAGAC AAGCATGG T C GT A TC C GGTAAGTACCTACAGCG AGGCTGCAAAT T AA C C C GGTCTCCG GCAGT GCTGACCC T C AA C C GC G GGACCTTTCGTCGTACAGTACTTCTCCGTCAAGGAGAGTTGGATCCGCCACTTGAAACT GAAGAACC T AGTTACCC GGGTT C C C G C GAGGACCTCCTC ATAAGGGTTGAGTCTAA T ACGTCACCATTGGCTAACAAGGA C GAAAAAATTTTCCGGTTTGGCAGTCATAAGTGGTACGGC 1212

(상기 표 3에서, LMY ver2 NSP1 유전자의 핵산 서열 중 굵은 글씨와 밑줄로 표시한 부분은 LMY NSP1 유전자 또는 LMY NSP1-beta 유전자에서 변이가 일어난 염기부분이다.)(In Table 3, the bold and underlined parts of the nucleic acid sequence of the LMY ver2 NSP1 gene are the mutations in the LMY NSP1 gene or the LMY NSP1-beta gene.)

다음으로, LMY ver2 변이주의 약독화정도를 확인하기 위해, CPB 값을 측정하였다. LMY 모균주의 NSP1 CPB 값은 약 0.0139, NSP1-beta CBP 값은 약 0.016 정도로 측정되었으나, 본 발명의 LMY ver2 변이주의 CPB 값은 약 NSP1에서 -0.2393, NSP1-beta에서 약 -0.33 정도로 측정되었다. 이로부터 본 발명의 LMY ver2 변이주의 증식성이 기존 모균주보다 감소되어 있고, 약독화된 균주임을 알 수 있었다.Next, in order to confirm the degree of attenuation of the LMY ver2 mutant, the CPB value was measured. The NSP1 CPB value of the LMY parent strain was about 0.0139 and the NSP1-beta CBP value was about 0.016, but the CPB value of the LMY ver2 mutant of the present invention was about -0.2393 in NSP1 and about -0.33 in NSP1-beta. From this, it can be seen that the proliferation of the LMY ver2 mutant of the present invention is reduced compared to the existing parent strain, and it is an attenuated strain.

바이러스 균주virus strain NSP1 부위NSP1 site Codon Pare Deoptimization (CBP)Codon Pare Deoptimization (CBP) LMYLMY NSP1NSP1 0.013925166408970590.01392516640897059 LMY ver2LMY ver2 NSP1NSP1 -0.2393184052058128-0.2393184052058128 LMYLMY NSP1-betaNSP1-beta 0.0160792364081088660.016079236408108866 LMY ver2LMY ver2 NSP1-betaNSP1-beta -0.3377269630038442-0.3377269630038442

다음으로, LMY ver2의 감염성클론(infectious clone)을 제조하였다. Next, an infectious clone of LMY ver2 was prepared.

우선, LMY 균주의 전체 유전자 서열(GenBank accession no.DQ473474.1.)을 7개의 단편(Fragments)으로 나누어 각각 합성하였다. 상기 7개의 단편 중 단편 1이 NPS-1 부위이며, 상기 부위를 LMY 균주의 NSP1 부위의 유전자 염기서열 중 91개 염기가 치환된 DNA 단편(서열번호 12)으로 합성하였다. 합성된 단편 유전자는 순서대로 하기 표 5의 제한효소로 자른 뒤 ligase로 연결하여 하나의 감염성 클론(infectious clone)을 제조하였다.First, the entire gene sequence of the LMY strain (GenBank accession no. DQ473474.1.) was divided into 7 fragments and synthesized, respectively. Fragment 1 among the seven fragments was an NPS-1 site, and this site was synthesized as a DNA fragment (SEQ ID NO: 12) in which 91 bases were substituted in the gene sequence of the NSP1 site of the LMY strain. The synthesized fragment gene was sequentially cut with the restriction enzymes shown in Table 5 below and then linked with ligase to prepare one infectious clone.

단편snippet 제한효소restriction enzyme Tm (

Figure 112019116651150-pat00008
Tm (
Figure 112019116651150-pat00008
완충액buffer 제한효소 인식부위restriction enzyme recognition site 1One AsiSIAsiSI 3737 CutSmartCutSmart GCGATCGCGCGATCGC XhoIXhoI 3737 CutSmartCutSmart CTCGAGCTCGAG 22 XhoIXhoI 3737 NEB3.1NEB3.1 CTCGAGCTCGAG MluIMluI 3737 NEB3.1NEB3.1 ACGCGTACGCGT 33 MluIMluI 3737 NEB3.1NEB3.1 ACGCGTACGCGT NsiINsiI 3737 NEB3.1NEB3.1 ATGCATATGCAT 44 NsiINsiI 3737 CutSmartCutSmart ATGCATATGCAT SpeISpeI 3737 CutSmartCutSmart ACTAGTACTAGT 55 SpeISpeI 3737 CutSmartCutSmart ACTAGTACTAGT AscIAscI 3737 CutSmartCutSmart GGCGCGCCGGCGCGCC 66 AscIAscI 3737 CutSmartCutSmart GGCGCGCCGGCGCGCC AfeI (blunt)AfeI (blunt) 3737 CutSmartCutSmart AGCGCTAGCGCT 77 AfeI (blunt)AfeI (blunt) 3737 CutSmartCutSmart AGCGCTAGCGCT PacIPacI 3737 CutSmartCutSmart TTAATTAATTAATTAA

1-3. 키메라 바이러스 클론의 제작1-3. Construction of Chimeric Virus Clones

도 1의 모식도와 같이, PRRS 바이러스는 총 8개의 ORF, 즉 ORF1a, ORF1b, 및 ORF2 내지 7을 포함하고 있다.As shown in the schematic diagram of FIG. 1 , the PRRS virus includes a total of eight ORFs, namely ORF1a, ORF1b, and ORF2 to 7.

앞선 실시예 1-1에서 증폭한 LMY ver2 변이주의 전체 구조 유전자를 포함하는 지놈영역에서 ORF2 내지 ORF7의 부위를 제한효소인 AscI 및 PacI를 사용하여 절단하였다. 이어서, BP2017 균주의 지놈영역 중 LMY ver2 변이주의 ORF2 내지 ORF7의 부위에 대응하는 부분을 동일한 AscI 및 PacI 제한효소로 자른 후, 상기 LMY ver2 변이주의 ORF1a 및 ORF1b 영역과 BP2017 균주의 ORF2 내지 ORF7 영역에 해당하는 부위를 ligase로 연결하여 하나의 재조합 감염성 클론(infectious clone)을 제조하였으며, LMY+BP2017 로 명명하였다. 사용한 제한효소를 아래 표 6에 나타냈다.The regions of ORF2 to ORF7 were cut using restriction enzymes AscI and PacI in the genomic region including the entire structural gene of the LMY ver2 mutant amplified in Example 1-1 above. Subsequently, the portion corresponding to the regions of ORF2 to ORF7 of the LMY ver2 mutant in the genomic region of the BP2017 strain was cut with the same AscI and PacI restriction enzymes, and then in the ORF1a and ORF1b regions of the LMY ver2 mutant and the ORF2 to ORF7 regions of the BP2017 strain. A single recombinant infectious clone was prepared by linking the corresponding site with a ligase, and was named LMY+BP2017. The restriction enzymes used are shown in Table 6 below.

단편snippet 제한효소restriction enzyme Tm (℃)Tm (℃) 완충액buffer 제한효소 인식부위restriction enzyme recognition site 서열번호SEQ ID NO: ORF2~7ORF2~7 AscIAscI 3737 CutSmartCutSmart GGCGCGCCGGCGCGCC 77 PacIPacI 3737 CutSmartCutSmart TTAATTAATTAATTAA 88

상기 완성된 감염성 클론을 CMV 프로모터 및 앰피실린(ampicillin) 저항성 유전자를 탑재한 high copy vector에 삽입한 후, lipofectamine을 이용해 BHK cell(한국세포주은행)에 형질감염 하고, 최종적으로 본 발명의 LMY+BP2017 키메라 바이러스를 작출하였다.After inserting the completed infectious clone into a high copy vector loaded with the CMV promoter and ampicillin resistance gene, lipofectamine was used to transfect BHK cells (Korea Cell Line Bank), and finally LMY+BP2017 of the present invention A chimeric virus was constructed.

상기 LMY+BP2017 키메라 바이러스는 2018년 10월 24일자로 한국생명공학연구원 생물자원센터에 기탁하여 수탁번호 KCTC13675BP를 수여받았다.The LMY+BP2017 chimeric virus was deposited with the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center on October 24, 2018 and was given an accession number KCTC13675BP.

실시예 2. LMY+BP2017 키메라 바이러스의 CpG 및 UpA 수치 측정Example 2. Measurement of CpG and UpA levels of LMY+BP2017 chimeric virus

실시예 1에서 제조한 LMY+BP2017 키메라 바이러스의 증식성을 평가하기 위해, LMY+BP2017 키메라 바이러스의 NSP1 유전자 내 CpG, UpA의 비율과 모균주인 LMY의 NSP1 beta 유전자 내 CpG 및 UpA 수치를 측정하였다.In order to evaluate the proliferation of the LMY + BP2017 chimeric virus prepared in Example 1, the ratio of CpG and UpA in the NSP1 gene of the LMY + BP2017 chimeric virus and the CpG and UpA levels in the NSP1 beta gene of the parent strain LMY were measured. .

바이러스 유전자의 CpG, UpA 비율의 변화는 deoptimization 과정에서 필연적으로 발생하는 결과로, 유전자의 CpG, UpA의 수치가 증가되면, cell stress를 유발하여 바이러스의 증식성이 감소된다. LMY+BP2017 키메라 바이러스와 LMY 바이러스의 NSP1 beta 유전자 내 CpG, UpA의 비율을 SSE program (version 1.2)을 이용하여 측정하였으며, 그 결과를 아래 표 7에 나타냈다.Changes in the CpG and UpA ratios of viral genes inevitably occur during the deoptimization process. When the CpG and UpA levels of the genes are increased, cell stress is induced and the proliferation of the virus is reduced. The ratios of CpG and UpA in the NSP1 beta gene of the LMY+BP2017 chimeric virus and the LMY virus were measured using the SSE program (version 1.2), and the results are shown in Table 7 below.

구분division CpGCpG UpAUpA LMYLMY 0.63940.6394 0.70660.7066 LMY+BP2017 키메라LMY+BP2017 Chimera 1.17531.1753 1.031.03

표 7에 나타난 바와 같이, LMY+BP2017 키메라 바이러스의 CpG 및 UpA의 수치가 모균주 LMY와 대비해 상승함을 확인하였으며, 이로부터 LMY+BP2017 키메라 바이러스의 증식성이 LMY 모균주와 비교해 현저히 감소됨을 확인할 수 있었다.As shown in Table 7, it was confirmed that the levels of CpG and UpA of the LMY+BP2017 chimeric virus increased compared to the parent strain LMY, and from this, it was confirmed that the proliferation of the LMY+BP2017 chimeric virus was significantly reduced compared to the LMY parent strain. could

실시예 3. LMY+BP2017 키메라 균주의 동정Example 3. Identification of LMY+BP2017 chimeric strain

3-1. LMY+BP2017 키메라 균주의 동정3-1. Identification of LMY+BP2017 chimeric strains

실시예 1에서 합성한 LMY+BP2017 키메라 균주와 LMY균주(GenBank accession no.DQ473474.1.)의 NSP1 부위를 sequencing 하여 LMY+BP2017 키메라 균주를 동정하였다. The LMY+BP2017 chimeric strain synthesized in Example 1 and the NSP1 region of the LMY strain (GenBank accession no. DQ473474.1.) were sequenced to identify the LMY+BP2017 chimeric strain.

구체적으로 LMY 바이러스의 NSP1 부위를 포함해 1~1654nt까지 탐지 가능한 표 8의 프라이머 세트와 one step RT PCR 키트(Intron)를 이용해 PCR을 수행하였으며, 구체적으로, 45℃에서 30분, 95℃에서 5분간 initial RT 과정을 거친 후 94℃에서 30초, 61℃에서 30초 72℃에서 2분 동안 반응시켰으며, 이 과정을 38회 반복하였다. 다음으로 PCR결과 증폭산물을 sequencing 하여 각각 균주의 동정을 완료하였다.Specifically, PCR was performed using the primer set in Table 8 and the one-step RT PCR kit (Intron), which can detect from 1 to 1654 nt including the NSP1 site of the LMY virus. After the initial RT process for minutes, the reaction was carried out at 94°C for 30 seconds, 61°C for 30 seconds and 72°C for 2 minutes, and this process was repeated 38 times. Next, by sequencing the PCR amplification product, the identification of each strain was completed.

프라이머primer 염기서열(5'> 3')base sequence (5'> 3') 서열번호SEQ ID NO: Forward primerforward primer ATGACGTATAGGTGTTGGCTCTAATGACGTATAGGTGTTGGCTCTA 99 Reverse primerReverse primer CTGAGGATTTGGATGGCATTCTGAGGATTTGGATGGCATT 1010

3-2. 타 균주와의 상동성 비교 및 계통수3-2. Comparison of homology with other strains and phylogenetic tree

실시예 1에서 재조한 본 발명의 재조합 바이러스 균주 LMY ver2와 알려진 PRRS 바이러스 균주와의 유전적 차이를 확인하기 위해, bioedit program을 사용하여 각 균주의 NSP1 부위 sequence identity 측정하였으며, 상동성 비교 결과를 표 9에 나타냈다. In order to confirm the genetic difference between the recombinant virus strain LMY ver2 of the present invention reconstructed in Example 1 and the known PRRS virus strain, the sequence identity of the NSP1 region of each strain was measured using a bioedit program, and the homology comparison results are shown in the table. shown in 9.

바이러스 종류virus type 염기서열 상동성 (%)Sequence homology (%) NSP-1 alphaNSP-1 alpha NSP-1 betaNSP-1 beta NSP-1NSP-1 LMYLMY 95.395.3 92.492.4 9292 P129P129 90.790.7 80.180.1 84.284.2 DCDC 89.289.2 79.479.4 8383 JA142JA142 90.990.9 79.879.8 83.883.8 PL97-1PL97-1 92.492.4 8585 87.287.2 Henan-A14Henan-A14 88.388.3 78.378.3 82.182.1 VR 2332VR 2332 92.592.5 8585 87.287.2 KNU-12-KJ4KNU-12-KJ4 85.585.5 75.575.5 79.979.9 CA-2CA-2 88.888.8 77.977.9 82.382.3 VR 2385VR 2385 91.691.6 84.784.7 86.986.9

표 9에 나타난 바와 같이, 상동성 비교 결과 LMY+BP chimera바이러스가 여타의 PRRS 균주와는 다른 고유한 서열을 보유하고 있음을 알 수 있었다.As shown in Table 9, as a result of homology comparison, it was found that the LMY+BP chimera virus had a unique sequence different from that of other PRRS strains.

상동성 비교 결과를 바탕으로, bioedit program을 사용하여 계통수를 분석하였으며 Bootstrap을 1000회 반복하였다. 이를 바탕으로 대략적인 LMY+BP2017 키메라 바이러스와 LMY의 계통수(Phylogenetic tree) 를 작성하였으며, 이를 도 3에 나타냈다. 도 3의 계통수로부터, 본 바이러스의 계통을 알 수 있었다.Based on the homology comparison results, the phylogenetic tree was analyzed using the bioedit program, and Bootstrap was repeated 1000 times. Based on this, an approximate LMY+BP2017 chimeric virus and a phylogenetic tree of LMY were prepared, and this is shown in FIG. 3 . From the phylogenetic tree of Fig. 3, the phylogeny of the present virus was known.

3-3. 세포 계대 연구3-3. cell passage studies

실시예 1에서 제작한 LMY+BP2017 키메라 바이러스를 계대했을 때 변형된 부위가 언제까지 유지되는지를 확인하였다. PRRS 바이러스 수용성 세포주로 알려진 MARC-145 세포에서 본 발명의 LMY+BP2017 키메라 바이러스를 30회 계대 과정을 거쳐 안정화시켰으며, 10계대 마다 유전자 변이를 확인하기 위해 상기 실시예 3-1과 동일한 방법을 사용해 Sequencing 작업을 진행하였다. When the LMY + BP2017 chimeric virus prepared in Example 1 was passaged, it was confirmed how long the modified region was maintained. The LMY+BP2017 chimeric virus of the present invention was stabilized through 30 passages in MARC-145 cells known as a PRRS virus-soluble cell line, and the same method as in Example 3-1 was used to check the gene mutation every 10 passages Sequencing was performed.

Sequencing 확인결과, 30계대 안정화 이후에도 본 바이러스의 유전자 치환부위가 유지됨을 확인하였다. 하기 표 10에 각 계대수에 따른 염기 변이의 수 (nt change), 변이 위치 (mutataion site), 및 아미노산 변이 여부 (a.a change)를 나타내었다. As a result of sequencing, it was confirmed that the gene substitution site of this virus was maintained even after passage 30 stabilization. Table 10 below shows the number of nucleotide mutations (nt change), mutation sites (mutataion site), and whether or not amino acid mutations (a.a change) according to each number of passages.

계대수number of passages P1P1 P10P10 P20P20 P30P30 P40P40 nt changent change -- 1One 22 33 44 mutation sitemutation site -- NSP2(867nt, C>T)NSP2 (867nt, C>T) NSP2
(867nt, C>T)
ORF2a
(72nt, T>G)
NSP2
(867nt, C>T)
ORF2a
(72nt, T>G)
NSP2
(867nt, C>T)
ORF2a
(72nt, T>G)
(291nt, G>T)
NSP2
(867nt, C>T)
ORF2a
(72nt, T>G)
(291nt, G>T)
NSP2
(867nt, C>T)
(1718~2251nt deletion)
ORF2a
(72nt, T>G)
(291nt, G>T)
NSP2
(867nt, C>T)
(1718~2251nt deletion)
ORF2a
(72nt, T>G)
(291nt, G>T)
a.a changea.a change -- 0(Asp>Asp)0 (Asp>Asp) 0
(Asp>Asp)
(Ser>Ser)
0
(Asp>Asp)
(Ser>Ser)
1
(Asp>Asp)
(Ser>Ser)
(Met>Ile)
One
(Asp>Asp)
(Ser>Ser)
(Met>Ile)
2
(Asp>Asp)
(179aa deletion)
(Ser>Ser)
(Met>Ile)
2
(Asp>Asp)
(179aa deletion)
(Ser>Ser)
(Met>Ile)

상기 표 10에서 확인할 수 있는 바와 같이, 30회 이상 계대를 진행한 경우에도 ORF1a의 NSP1a 또는 NSP1b 유전자 상의 변이는 그대로 유지하였으며, NSP2 단백질 또는 ORF2a에서의 변이만이 확인되었다. 따라서 40회 계대가 이루어진 후에도 실시예 1에서 제작된 바이러스의 NSP1 단백질을 암호화하는 유전자의 변이가 유지됨을 확인하였다. As can be seen in Table 10, even when passages were performed more than 30 times, the mutation in the NSP1a or NSP1b gene of ORF1a was maintained as it was, and only the mutation in the NSP2 protein or ORF2a was confirmed. Therefore, it was confirmed that the mutation of the gene encoding the NSP1 protein of the virus prepared in Example 1 was maintained even after 40 passages.

실시예 4: LMY와 LMY+BP chimera의 증식성 비교Example 4: Comparison of proliferation of LMY and LMY + BP chimera

실시예 1에서 제조한 LMY+BP2017 키메라 바이러스의 증식성을 확인하기 위해, 돼지 폐 대식세포(PAM, Porcine Alveolar Macrophage)에서 LMY+BP2017 키메라 바이러스와 이의 모균주인 LMY를 접종한 이후, 작출되는 바이러스의 양을 TCID50으로 측정하여 확인하였다. In order to confirm the proliferation of the LMY + BP2017 chimeric virus prepared in Example 1, the LMY + BP2017 chimeric virus and its parent strain LMY in pig lung macrophages (PAM, Porcine Alveolar Macrophage) were inoculated, and then the virus produced was confirmed by measuring the amount of TCID 50.

구체적으로, RPMI 배지(10% FBS, 1% penicillin, streptomycin 포함) 2ml 가포함된 6 웰 플레이트에 PAM 세포를 웰당 2 X 106 cell/well의 비율로 분주하였다. 다음으로, LMY와 LMY+BP2017 키메라 바이러스를 각각 서로 다른 웰에 MOI 0.01의 비율로 접종하고 접종 1시간 후에 모든 상층액을 제거하였으며, 유지액 RPMI 배지(10% FBS, 1% penicillin, streptomycin 포함)를 2ml 분주하였다. 분주하고 2일이 지난 후, 각각의 웰의 상층액을 수거하여 TCID50(Tissue culture infective dose50)을 측정하였다. 이후 실험에서 사용되는 세포는 TCID50 측정 전날에 미리 96웰에 MARC-145 세포 2X105 cell/well을 DMEM 배지(10%(v/v) FBS, 1%(w/v) penicillin, streptomycin) 100ul와 함께 분주하여 부착시킨 것을 사용하였다. Specifically, PAM cells were seeded in a 6-well plate containing 2 ml of RPMI medium (including 10% FBS, 1% penicillin, and streptomycin) at a rate of 2 X 10 6 cells/well per well. Next, LMY and LMY+BP2017 chimeric viruses were inoculated into different wells at an MOI of 0.01, and all supernatant was removed 1 hour after inoculation, and maintenance solution RPMI medium (including 10% FBS, 1% penicillin, and streptomycin) 2ml was dispensed. Two days after dispensing, the supernatant of each well was collected and TCID 50 (Tissue culture infective dose 50 ) was measured. Cells used in subsequent experiments are MARC-145 cells 2X10 5 cells/well in 96 wells in advance on the day before TCID 50 measurement, DMEM medium (10% (v/v) FBS, 1% (w/v) penicillin, streptomycin) 100ul It was used to be dispensed with and attached.

접종할 바이러스는 다음과 같이 준비하였다. 앞서 수거한 상층액을 200uL씩 96 웰 플레이트의 맨 왼쪽 웰에 일렬로 분주하였으며, 나머지 웰에는 DMEM 배지(FBS, 항생제 무첨가)를 180㎕씩 분주하였다. 다음으로, 왼쪽에서부터 차례로 multi-pipet을 사용해 20㎕씩 채취하고 오른쪽 웰에 분주하면서 10진 희석하였다. Tip을 바꾸며 차례로 희석하고 마지막 12번째 웰은 음성 대조군으로 유지하였다. 준비된 바이러스 희석액을 MARC-145 cell이 부착된 plate에 접종하였다. 이때, MARC-145 cell의 배양액은 모두 제거하고 PBS 200㎕를 각 웰에 분주하고 버리기를 3회 반복하여 washing 과정을 수행하였다. 이후 준비된 바이러스 희석액을 웰당 100㎕씩 분주하여 접종하였으며, 접종 2시간 이후 접종액을 모두 제거하고 새로운 유지액(DMEM 배지, 10% FBS, 1% penicillin, streptomycin)을 100㎕ 분주하였다. The virus to be inoculated was prepared as follows. 200uL of the previously collected supernatant was dispensed in a row to the far left well of a 96-well plate, and 180ul of DMEM medium (FBS, antibiotic-free) was dispensed to the remaining wells. Next, 20 μl of each was collected using a multi-pipet sequentially from the left, and diluted by decimal while dispensing into the right well. The tip was changed sequentially, and the last well of the 12th well was maintained as a negative control. The prepared virus dilution was inoculated on a plate to which MARC-145 cells were attached. At this time, all of the culture medium of MARC-145 cells was removed, and 200 μl of PBS was dispensed into each well and discarded three times to perform a washing process. Then, 100 μl of the prepared virus dilution was dispensed per well and inoculated, after 2 hours of inoculation, all of the inoculum was removed and 100 μl of a fresh maintenance solution (DMEM medium, 10% FBS, 1% penicillin, streptomycin) was dispensed.

분주 후, 약 7일간 세포에서 CPE(Cytopathogenic effect)의 일종인 Clumping과 apoptosis의 발생여부를 확인하였으며, 최종적으로 CPE가 보이지 않은 웰의 바로 이전 희석배수를 기준으로 8개 바이러스 접종액 중 절반인 4개 웰이 CPE를 보일 수 있는 희석배수를 구하였다. 1ml를 기준으로 10을 곱해 최종 수치를 계산하였다.After dispensing, it was confirmed whether clumping and apoptosis, a type of CPE (Cytopathogenic effect), occurred in the cells for about 7 days. The dilution at which the dog wells exhibited CPE was determined. The final value was calculated by multiplying by 10 based on 1 ml.

LMY+BP2017 키메라 균주와 모균주 LMY 균주를 돼지 폐 대식세포(PAM cell)에 접종하고 1일 내지 2일이 지난 후 측정한 TCID50 값을 하기 표 10 및 도 4에 나타냈다. The TCID 50 values measured 1 to 2 days after inoculation of the LMY+BP2017 chimeric strain and the parent strain LMY strain into pig lung macrophages (PAM cells) are shown in Table 10 and FIG. 4 below.

바이러스 종류virus type 바이러스 접종일에 따른 TCID50 TCID 50 value according to virus inoculation date 1일1 day 2일2 days LMYLMY 5.25.2 7.37.3 LMY+BP2017LMY+BP2017 5.15.1 5.25.2

표 10 및 도 4에서 알 수 있는 바와 같이, 균주를 접종하고 바이러스가 본격적으로 작출되기 시작하는 2일에 측정한 TCID50의 값이 LMY+BP2017 키메라가 LMY 보다 100배 낮은 TCID50 값을 나타냈다. 이로부터 PRRS의 주요 감염 세포인 PAM(Porcine Alveolar Macrophage) cell에서 본 발명의 LMY+BP2017 키메라 바이러스는 증식성이 LMY에 비해 최소 10배 이상 감소함을 알 수 있었으며, 본 발명의 LMY+BP2017 키메라 바이러스가 모균주 LMY 보다 증식성이 감소되어 약독화 되어있음을 확인할 수 있었다. As can be seen from Table 10 and Figure 4, the value of TCID 50 measured on day 2, when the strain was inoculated and the virus started in earnest, LMY + BP2017 chimera showed a TCID 50 value 100 times lower than that of LMY. From this, it was found that the proliferative ability of the LMY+BP2017 chimeric virus of the present invention in PAM (Porcine Alveolar Macrophage) cells, which is the main infected cell of PRRS, was reduced at least 10-fold compared to LMY, and the LMY+BP2017 chimeric virus of the present invention It could be confirmed that the proliferative property was decreased compared to the parent strain LMY and thus attenuated.

실시예 4:Example 4: 중화항체 분비 양상 확인Confirmation of neutralizing antibody secretion pattern

본 발명의 키메라 바이러스를 접종한 이후, 중화항체 분비 양상을 확인하기 위하여, 3주령 돼지 12두를 4마리씩 3개의 그룹으로 나누어 각각 LMY(105 TCID50), LMY+BP2017 키메라 바이러스 (105 TCID50), PBS 를 2ml씩 접종하였다. 4주 후 각 그룹의 돼지의 정맥에서 혈액을 채혈하여 혈청을 2ml 분리하였으며, 혈청 내 중화항체의 양을 측정하였다.After inoculation with the chimeric virus of the present invention, in order to confirm the neutralizing antibody secretion pattern, 12 three-week-old pigs were divided into 3 groups of 4 pigs each LMY (10 5 TCID 50 ) , LMY+BP2017 chimeric virus (10 5 TCID) 50 ), and inoculated with 2ml of PBS. After 4 weeks, blood was collected from the veins of pigs in each group to separate 2 ml of serum, and the amount of neutralizing antibody in the serum was measured.

구체적으로 검사방법은 기존에 알려진 방법에 준하여 실시하였다. 모든 혈청 sample을 검사 시작 전에 45분 동안 56

Figure 112019116651150-pat00009
에서 heat inactivation시켰다. Inactivation되어 있는 혈청을 RPMI 1640 배지(10% FCS, 20mM L-glutamine, antibiotic-antimycotic mixture-100IU/ml penicillin, 100μg/ml streptomycin, 50μg/ml gentamycin, 0.25 mg/ml amphotericin B)에 넣고 2배씩 차례로 희석시켰다. 이어서 각각의 희석된 혈청을 100㎕씩 채취해, 미리 준비된 VR2332균주 200 TCID50/ml 100μl와 섞어 37
Figure 112019116651150-pat00010
에서 한 시간 동안 인큐베이션 시킨 후, 전날 미리 배양해 둔 monolayer 상태의 Marc-145 세포를 접종하였다. 이어서 37
Figure 112019116651150-pat00011
에서 한 시간 배앙한 후의 모든 접종액은 제거하였으며, 이를 RPMI 배양액 200㎕로 대체하였다. 이 후, 37
Figure 112019116651150-pat00012
에서 배양하면서 매일 cytopathic effect(CPE)를 확인하였으며, 5일 간 배양한 후 각 웰의 CPE를 확인하였다. CPE가 없는 well은 SDOW 17 항체를 이용한 염색을 통해 바이러스의 성장을 확인하였다. 중화항체 역가(titer)는 바이러스의 성장의 징후가 전혀 없는 가장 높은 희석배수의 역수를 산출해 측정하였으며, 측정결과를 아래 표 11 및 도 5에 나타냈다. Specifically, the inspection method was carried out according to the previously known method. All serum samples were taken for 45 minutes before starting the test.
Figure 112019116651150-pat00009
heat inactivation in Put the inactivated serum into RPMI 1640 medium (10% FCS, 20mM L-glutamine, antibiotic-antimycotic mixture-100IU/ml penicillin, 100μg/ml streptomycin, 50μg/ml gentamycin, 0.25 mg/ml amphotericin B), two times in turn. diluted. Then, 100 μl of each diluted serum was collected and mixed with pre-prepared VR2332 strain 200 TCID 50 /ml 100 μl 37
Figure 112019116651150-pat00010
After incubation for one hour in a cell, the monolayered Marc-145 cells cultured in advance the day before were inoculated. Then 37
Figure 112019116651150-pat00011
All inoculum was removed after culturing for one hour in the , and it was replaced with 200 μl of RPMI culture medium. After this, 37
Figure 112019116651150-pat00012
The cytopathic effect (CPE) was checked every day while culturing in the , and the CPE of each well was checked after culturing for 5 days. In wells without CPE, virus growth was confirmed by staining with SDOW 17 antibody. The neutralizing antibody titer was measured by calculating the reciprocal of the highest dilution factor with no signs of virus growth, and the measurement results are shown in Table 11 and FIG. 5 below.

접종 균주inoculated strain LMYLMY LMY+BP2017 chimeraLMY+BP2017 chimera PBS (대조군)PBS (control) 중화항체(Log2)Neutralizing antibody (Log 2 ) 2.752.75 4.754.75 00

표 11 및 도 5에 나타낸 바와 같이, LMY+BP2017 키메라 바이러스가 LMY 모균주에 비해 세포에서 유의적으로 높은 중화항체를 분비시킴을 확인할 수 있었다.As shown in Table 11 and FIG. 5, it was confirmed that the LMY+BP2017 chimeric virus secreted a significantly higher neutralizing antibody from the cells compared to the LMY parent strain.

한국생명공학연구원Korea Institute of Biotechnology and Biotechnology KCTC13393BPKCTC13393BP 2017111420171114 한국생명공학연구원Korea Institute of Biotechnology and Biotechnology KCTC13394BPKCTC13394BP 2017111420171114 한국생명공학연구원Korea Institute of Biotechnology and Biotechnology KCTC13675BPKCTC13675BP 2018102420181024

<110> BioPoA, Inc. REPUBLIC OF KOREA(Animal and Plant Quarantine Agency) <120> Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same <130> DPP20194622KR <150> KR 10-2018-0171306 <151> 2018-12-27 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 609 <212> DNA <213> Artificial Sequence <220> <223> LMY ver2 NSP1-beta <400> 1 gctgctgtct acgatgttgg tcatggcgcc gtcatgtatg tggccgatga gagagtctcc 60 tgggcccctc gcggcgggga cgaagttaga ttcgaaacgg tcccacagga gcttaagtcg 120 gttgcgaacc aactctgcac gtcgttccca ccccaccacg tagtcgatat gtctaagttc 180 gcctttaccg cccccggttg cggcgtatct atgcgggtcg aacgtcaata cggctgtctc 240 cccgccgata cggtccccga aggcaactgc tggtggagct tgttcgattc gctcccactc 300 gaagtgcaag gcaaagagat tcgccacgct aaccaattcg ggtatcagac taagcatggc 360 gtatccggta agtacctaca gcggaggctg caaattaacg gtctccgcgc agtcgctgac 420 cctaacggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 480 aaactagcgg aagaacctag ttaccccggg ttcgaggacc tcctccgcat aagggttgag 540 tctaacacgt caccattggc taacaaggac gaaaaaattt tccggtttgg cagtcataag 600 tggtacggc 609 <210> 2 <211> 3188 <212> DNA <213> Artificial Sequence <220> <223> BP2017-2 ORF2-ORF7 <400> 2 atgaaatggg gtccatgcaa agcctttttt acaaaattgg ccaacttttt gtggatgctt 60 tcacggagtt cttggtgtcc attgttgata tcattatatt tttggccatt ttgtttggct 120 tcaccatcgc cggttggctg gtggtctttt gcatcagatt ggtttgctcc gcgatactcc 180 gtacgcgccc tgccattcac tctgagcaat tacagaagat cttatgaggc ctttctttcc 240 cagtgccaag tggacattcc cacctgggga actaaacatc ctttggggat gctttggcac 300 cataaggtgt caaccctgat tgatgaaatg gtgtcgcgtc gaatgtaccg catcatggaa 360 aaagcagggc aggctgcctg gaaacaggtg gtgagcgagg ctacgctgtc tcgcattagt 420 agtttggatg tggtggctca ttttcagcat ctagccgcca ttgaagccga gacctgtaaa 480 tatttggcct cccggctgcc catgctacac aacctgcgca tgacaggttc aaatgtaacc 540 atagtgtata atagcacttt gaatcaggtg tttgctattt ttccaacccc tggttcccgg 600 ccaaagcttc atgattttca gcaatggtta atagctgtac attcctccat attttcctct 660 gttgcagctt cttgtactct ttttgttgtg ctgtggttgc gggttccaat actacgtact 720 gtttttggtt tccgctggtt aggggcaatt tttctttcga actcacagtg aattacacgg 780 tgtgtccacc ttgcctcacc cggcaagcag ccacagagat ctacgaaccc ggtaggtctc 840 tttggtgcag gatagggtat gaccgatgtg aggaggatga tcatgacgag ctagggttta 900 tggtaccgcc tggcctctcc agcgaaggcc acttgactag tgtttacgcc tggttggcgt 960 tcttgtcctt cagctacacg gcccagttcc atcccgagat attcgggata gggaatgtga 1020 gtcgagttta tgttgacatc aaacatcaac tcatctgcgc cgaacatgac gggcagaaca 1080 ccaccttgcc tcgtcatgac aacatttcag ccgtgtttca gacctattac caacatcaag 1140 tcgacggcgg caattggttt cacctagaat ggcttcgtcc cttcttttcc tcgtggttgg 1200 ttttaaatgt ctcttggttt ctcaggcgtt cgcctgcaaa ccatgtttca gttcgagtct 1260 tgcagatatt aagaccaaca ccaccgcagc ggcaagcttt gctgtcctcc aagacatcag 1320 ttgccttagg catcgcgact cggcctctga ggcgattcgc aaaatccctc agtgccgtac 1380 ggcgataggg acacccgtgt atgttaccat cacagccaat gtgacagatg agaattattt 1440 acattcttct gatctcctca tgctttcttc ttgccttttc tatgcttctg agatgagtga 1500 aaagggattt aaggtggtat ttggcaatgt gtcaggcatc gtggctgtgt gtgtcaattt 1560 taccagctac gtccaacatg tcaaggagtt tacccaacgc tccctggtgg tcgaccatgt 1620 gcggttgctc catttcatga cacctgagac catgaggtgg gcaactgttt tagcctgtct 1680 ttttgccatt ctgttggcaa tttgaatgtt taagtatgtt ggagaaatgc ttgaccgcgg 1740 gctgttgctc gcaattgctt tctttgtggt gtatcgtgcc gttctgtttt gctgtgctcg 1800 ccaacgccag caacgacagc agctcccatc tacagctgat ttacaacttg acgctatgtg 1860 agctgaatgg cacagattgg ctagctaaca aatttgattg ggcagtggag agttttgtca 1920 tctttcccgt tttgactcac attgtctcct atggtgccct cactaccagc catttccttg 1980 acacagtcgc tttagtcact gtgtctaccg ccgggtttgt tcacgggcgg tatgtcctaa 2040 gtagcatcta cgcggtctgt gccctggctg cgttgacttg cttcgtcatt aggtttgcaa 2100 agaattgcat gtcctggcgc tacgcgtgta ccagatatac caactttctt ctggacacta 2160 agggcggact ctatcgttgg cggtcgcctg tcatcataga gaaaaggggc aaagttgagg 2220 tcgaaggtca tctgatcgac ctcaaaagag ttgtgcttga tggttccgtg gcaaccccta 2280 taaccagagt ttcagcggaa caatggggtc gtccttagat gacttctgtc atgatagcac 2340 ggctccagaa aaggtgcttt tggcgttttc tattacctac acgccagtga tgatatatgc 2400 cctaaaggtg agtcgcggcc gactgctagg gcttctgcac cttttgatct tcctgaattg 2460 tgctttcacc ttcgggtaca tgactttcgc gcactttcag agtacaaata aggtcgcgct 2520 cactatggga gcagtagttg cactcctttg gggggtgtac tcagccatag aaacctggaa 2580 attcatcacc tccagatgcc gtttgtgctt gctaggccgc aagtacattc tggcccctgc 2640 ccaccacgtt gaaagtgccg caggctttca tccgattgcg gcaaatgata accacgcatt 2700 tgtcgtccgg cgtcccggct ccactacggt caacggcaca ttggtgcccg ggttaaaaag 2760 cctcgtgttg ggtggcagaa aagctgttaa acagggagtg gtaaaccttg tcaaatatgc 2820 caaataacaa cggcaagcag cagaagagaa agaaggggga tggccagcca gtcaatcagc 2880 tgtgccagat gctgggtaag atcatcgctc agcaaaacca gtccagaggc aagggaccgg 2940 gaaagaaaaa taagaagaaa aacccggaga agccccattt tcctctagcg actgaagatg 3000 atgtcagaca tcactttacc cctagtgagc ggcaattgtg tctgtcgtca atccagaccg 3060 cctttaatca aggcgctggg acttgcaccc tgtcagattc agggaggata agttacactg 3120 tggagtttag tttgcctacg catcatactg tgcgcctgat ccgcgtcaca gcatcaccct 3180 cagcatga 3188 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> [A]n <400> 3 aaaaaaaaaa aaaaaaaaaa aaaa 24 <210> 4 <211> 15443 <212> DNA <213> Artificial Sequence <220> <223> LMY-BP2017 chimeric virus sequence <400> 4 atgacgtata ggtgttggct ctatgccttg acatttgtat tgtcaggagc tgtgaccatt 60 ggcacagtcc aaaacttgct gcgcagaaac acccttctgc gacagcctcc ttcaggggag 120 cttggggtct atccctagca ccttgcttct ggagttgcac tgctttacgg tctctccacc 180 cctttaacca tgtctgggat acttgatcgg tgcacgtgta cccccaatgc cagggtgttt 240 atggcggagg gccaagttta ctgcacacga tgtctcagtg cacggtctct ccttcccctg 300 aatctccaag tttctgagct cggggtgctg ggcctattct acaggcccga agagccactc 360 cggtggacgt tgccacgtgc attccccact gttgagtgct cccccgccgg ggcctgctgg 420 ctttctgcaa tctttccaat tgcacgaatg accagtggaa acctaaactt ccaacaaaga 480 atggtacggg tcgcagctga gatctacaga gttggccagc tcacccctgc agttttgaag 540 gctctacaag tttatgagcg gggttgccgc tggtatccca ttgttggacc tgtccctgga 600 gtggccgttt tcgccaactc cctgcatgtg agtgatagac ctttcccggg agcaactcac 660 gtattaacca acctgccact cccgcagaga cccaagcctg aggacttttg ccccttcgag 720 tgtgctatgg ctgctgtcta cgatgttggt catggcgccg tcatgtatgt ggccgatgag 780 agagtctcct gggcccctcg cggcggggac gaagttagat tcgaaacggt cccacaggag 840 cttaagtcgg ttgcgaacca actctgcacg tcgttcccac cccaccacgt agtcgatatg 900 tctaagttcg cctttaccgc ccccggttgc ggcgtatcta tgcgggtcga acgtcaatac 960 ggctgtctcc ccgccgatac ggtccccgaa ggcaactgct ggtggagctt gttcgattcg 1020 ctcccactcg aagtgcaagg caaagagatt cgccacgcta accaattcgg gtatcagact 1080 aagcatggcg tatccggtaa gtacctacag cggaggctgc aaattaacgg tctccgcgca 1140 gtcgctgacc ctaacggacc tttcgtcgta cagtacttct ccgtcaagga gagttggatc 1200 cgccacttga aactagcgga agaacctagt taccccgggt tcgaggacct cctccgcata 1260 agggttgagt ctaacacgtc accattggct aacaaggacg aaaaaatttt ccggtttggc 1320 agtcataagt ggtacggcgc tggtaagaga gcaaggaaag cacgctctcg tgcgactaat 1380 acagtcgctg accgcgcttt gtccgttcgt gaaatctggc aggccaagga gcatgaggtt 1440 accggcgcca ataaggctga gcacctcaaa cactactccc cacctgccga agggaattgt 1500 ggttggcact gcatttccgc catcgtcaac cggatggtta attccaaatt tgaaaccacc 1560 cttcccgaaa gagtgagacc tccagatgac tgggctaccg acgaggatct tgcgaatgcc 1620 atccaaatcc tcagactccc tgcggcctta gacaggaacg gtgcttgtgc tagcgccaag 1680 tacgtactta agctggaagg tgagcattgg actgtcactg tgacccctgg gatgtcccct 1740 tctttgctcc ctcttgaatg tgttcagggc tgttgtgggc acaagggcgg tcttggttcc 1800 ccagacgcag tcgaggtctc cggatttgac cctgcctgcc ttgaccgtct ggctgaggtg 1860 atgcacctgc ctagcagtgc tatcccagcc gctctggccg aaatgtctgg tgattccgat 1920 cgttcggctt ctccggtcac caccgtgtgg actgtttcgc agttctttgc ccgtcacagc 1980 ggaggaaatc accctgacca agtgcgctta gggaaaatca tcagcctttg tcaggtgatt 2040 gaggactgct gctgttccca gaacaaaacc aaccgggtca ccccggagga ggttgcagca 2100 aagattgacc tgtacctccg cggtgcaaca aatcttgaag aatgcttggc caggctcgag 2160 aaagcgcgcc cgccacgggt aatcgacacc ttctttgatt gggacgttgt gctccctggg 2220 gttgaggcag caacccaaac gaccaagctg ccccaggtca accagtgtcg tgctctggtc 2280 cctgttgtga ctcaaaagtc cttggacaac aactcggtcc ccctgaccgc cttttcactg 2340 gctaactact actaccgcgc gcaaggtgac gaagtttgtc accgtgaaag acttaatgcc 2400 gtgctttcca agctggaaga ggttgtccga gaagagtacg ggctcatgcc taccgggcct 2460 ggcccacggc ccacattgcc acgcgggctc gacgaactca aagaccagat ggaggtggac 2520 ttgctgaaac tggctaacgc ccaggcgact tctgacatga tggcttgggc agtcgagcag 2580 gttgacctaa aaacttgggt caagaactac ccgcggtgga tgccaccacc tcctccgcca 2640 aaagttcggc ctcgaaaaac gaagcctgtc aagagcttgc cagagggaaa gcccgccccc 2700 gcccctcgca ggagggttgg gactggttgt ggcagcccga cttcattggg cgatgatgtt 2760 cttaacagtt gggaagattt ggctgttggc agcccctcgg gtctcccgac cccccctgag 2820 ccggcaacac cttcgagtga gccagtggtt gtgtcagcac cgcagtgcat cttcagaccg 2880 gcgacgccct tgagtgagcc gaccccaatt cccgcacccc gtgggactgc gtctcgacca 2940 gtgacacctt tgagcgagcc gatccctgtg cctgcaccgc ggcgtaaatt tcagcaggcg 3000 agaaagttga gttcggcggt ggtaattccg ccgtaccagg acgagcccct ggatttgtcc 3060 gcttcctcgc tgactgaata tgaagccctt cctctagcgc cgccgcaaag cgagggcgct 3120 ctaagagtgg aggggcatga agttgaggaa gccctgagtg aaatctcaga catgtcgggt 3180 ggcactaaac ctgcgcccgt atcatcaagc agctccttgt ccagcgtgag aatcacacgc 3240 ccaaaacact cagctcaagc catcatcgac tcggtcgggc cctgcagtgg gcatctccaa 3300 gaggtgaagg agatatgcct tagtgtcatg cgcgaggcat gtgatgcgac taagctcaat 3360 gaccccgcta cgcaggaatg gctctctcgc atgtgggatc gggtggacat gctgacttgg 3420 cgcaacacgt ctgcttacca gacgcttagc accttaggtg gctggtcaag gttcctccca 3480 aaattgatac ttgagacacc gccgccctac ccgtgtgagt ttgtgatgat gccttacacg 3540 cctgcacctt ccgtgggtgc ggagagcgac ctcaccattg gctcagttgc tactgaggat 3600 gttccacgca tccttgagaa catggagaat gtcggcgaga tgactaacca gggacccttg 3660 gccttctccg aggataaacc ggtggatgac caaccttccg aagacctccg gacatcgtcg 3720 caaggacctg acgggagcac atcagctccg tccgcagata cagctggcgc cggctcatcc 3780 accgatttgc cgtcttcagg cggcgtggat gcggacggag ggggaccgct tcgggcggta 3840 aaaagaaaaa ccgaacggct ctttgaccaa ctgagtcgtc aggtttttga cctcgtctcc 3900 catctcccta ttttcttctc acgcctcttc aaccctggcg gtggttactc tccgggtgat 3960 tggggttttg cagcttttac tctattgtgc ctctttttat gttacagtta cccagcattt 4020 ggcatcgttc ccctcttggg tgtattttct gggtcttctc ggcgcgtgcg aatgggggtt 4080 tttggctgct ggttggcttt tgctgttggt ctgttcaagc ctgtgtccga cccagtcggc 4140 gctgcttgtg agtttgactc gccagaatgc agaaacatcc ttcattcttt tgagcttctc 4200 aaaccttggg accctgttcg cagccttgtt gtgggccccg tcggtctcgg ttttgccatt 4260 cttggcaggc tactgggcgg ggcacgcagc atctggcact ttttgcttag gcttggcatt 4320 gttgcagact gtgtcttggc tggagcttat gtgctttctc aaggtaggtg caaaaagtgt 4380 tggggatctt gtataagaac cgctcctaat gaggtcgctt tcaacgtgtt tccttttacg 4440 cgtgcaacca ggtcgtcact tgttgacctt tgcgatcggt tttgtgcgcc gagaggcatg 4500 gaccccattt ttctcgccac tgggtggcgt ggatgctggg ccggtcggag ccccattgag 4560 caaccctctg aaaaacccat cgcgtttgcc caattggatg aaaagaagat tacggctagg 4620 actgtggtcg cccagcctta tgatcccaac caagccgtaa agtgcctgcg ggtattgcag 4680 gcgggagggg cgatggtggc tgaggcggtc ccaaaagtgg tcagggtttc cgctgttcca 4740 tttcgagccc ccttttttcc taccggagtg aaggttgacc ctgaatgtag agtagtggtt 4800 gaccctgaca ctttcactgc agctctccgg tctggttact ccaccacaaa cctcgtcctc 4860 ggtgtggggg actttgccca gctgaatgga ttaaaaatca ggcaaatttc taagccttca 4920 ggggggggcc cacatctcat ggctgccctg catgttgcct gctcgatgat tttgcacatg 4980 tttgctggga tttatgtgac tgcggtgggt tcttgcggca ccggcaccaa cgatccgtgg 5040 tgcgcaaacc catttgccgt ccctggctac ggacctggct ccctctgcac gtccagattg 5100 tgtatttccc agcacggcct taccctgccc ttgacagcac ttgtggcggg attcggcatc 5160 caggaaattg ccttagtcgc tttgatcttt gtttccatcg gaggcattgc tcataggttg 5220 agttgtaaag ctgacatgct gtgtgttttg cttgcaattg ccagctatgt ttgggtacct 5280 cttacctggt tactttgtgt ttttccttgc tggttgcgct ggttttcttt gcatcccctt 5340 accgtcctat ggttggtgtt tttcttgatt tctgtgaata tgccttcagg aatcttggcc 5400 atggtgttgt tagtttctct ttggcttctt ggtcgttata ctaatgtcgc cggtcttgtc 5460 actccctacg acattcatca ttacaccagt ggcccccgcg gtgttgccgc attggctact 5520 gcaccagatg gaacctactt agccgctgtt cgccgcgctg cgttgactgg ccgcaccatg 5580 ttgttcaccc cgtcccagct tgggtctctt cttgagggcg ctttcagaac tcgaaagccc 5640 tcactgaaca ccgtcaatgt ggtcgggtcc tccatgggct ctggcggggt gtttaccatt 5700 gacgggaaag tcaggtgcgt gactgccaca catgtcctta cgggtaactc agccagggtt 5760 tccggaaccg gcttcaatca aatgcttgac tttgacgtaa aaggggattt cgctatagcc 5820 gattgcccga attggcaagg ggctgccccc aaaacccaat tctgcgagga tggatggact 5880 ggccgtgcct attggctaac atcctctggc gtcgaacccg gcgtcattgg gaaaggattc 5940 gccttctgct tcaccgcgtg cggcgattcc gggtccccag tgatcaccga ggccggtgag 6000 cttgtcggtg ttcacacggg atcgaataaa caaggggggg gtattgtcac acgcccctca 6060 ggccagtttt gtaatgtggc acccatcaag ctgagcgaat taagtgaatt ctttgctggg 6120 cctaaggtcc cgctcggtga tgtgaaggtt ggcagccaca taatcaaaga cacaagcgag 6180 gtgccttcag atctttgtgc cttgcttgct gccaaacctg aactggaagg aggtctctcc 6240 accgtccaac ttctgtgtgt gtttttcctt ctgtggagaa tgatgggaca tgcctggacg 6300 cccttggttg ctgtgggttt ctttattttg aatgagattc tcccggccgt cctggtccgg 6360 agtattttct cctttggaat gtttgtgcta tcctggctca cgccatggtc tgcgcaagtt 6420 ctgatgatca ggctcctgac agcagctctt aacaggaata gatgttcact tgcctttttc 6480 agcctcggtg cagtgaccgg ttttgttgca gatcttgcgg ctactcaggg gcatccgttg 6540 caggcagtga tgaatttgag cacctatgca ttcctgcctc gggtaatggt tgtgacttca 6600 ccagtcccag tgatcgcgtg tggtgttgtg cacctactcg ccatcattct gtacctgttt 6660 aaataccgta gcctgcacca tatccttgtt ggcgatggag tgttctcttc ggccttcttc 6720 ctgcgatatt ttgccgaagg aaagttgagg gaaggggtgt cacaatcctg cggaatgaat 6780 catgagtctc tgactggtgc cctcgctatg agactcaatg acgaggactt ggatttcctc 6840 atgaaatgga ctgattttaa gtgcttcgtt tctgcgtcca acatgaggaa tgcagcgggt 6900 caatttatcg aggctgcata tgctaaagca cttagagttg aactggccca gttggtgcag 6960 gttgataagg ttcgaggtac tatggccaaa cttgaagctt ttgctgatac tgtggcacct 7020 caactctcgc ccggtgatat tgttgtcgct ctcggccaca cgcctgttgg cagtatcttc 7080 gacttaaagg ttggtagcac caagcatacc ctccaagcca ttgagaccag ggttcttgct 7140 gggtccaaaa tgaccgtggc gcgcgtcgtc gacccgaccc ccacgccccc acccgcgccc 7200 gtgcccatcc ccctcccacc gaaagttctg gagaatggcc ccaacgcttg gggggatgag 7260 gaccgtttga ataagaagaa aagacgcagg atggaagccc tcggcatcta tgttatgggc 7320 gggaaaaagt accagaaatt ttgggacaag aactccggtg atgtgtttta tgaggaggtc 7380 cataacaaca cagatgagtg ggagtgtctc acagttggcg accctgccga ctttgaccct 7440 gagaagggaa ccctgtgtgg acatgtcacc attgacaaca aggcttacca tgtttacacc 7500 tcctcatctg gtaagaagtt cttggttccc gtcaacccag agaacggaag agttcaatgg 7560 gaagctgcaa agctttccgt ggagcaggcc ctaggcatga tgaatgtcga cggcgaactg 7620 actgccaagg aactggagaa actgaaaaga ataattgaca aactccaggg cctgactaag 7680 gagcagtgtt taaactgcta gccgccagcg acttgacccg ctgtggtcgc ggcggcttgg 7740 ttgttactga gacagcggtg aaaatagtca aatttcacaa tcggactttc actctggggc 7800 ctgtgaattt aaaagtggcc agtgaggttg agctaaaaga tgcggttgag cacaaccaac 7860 acccggttgc gaggccgatc gatggtggag ttgtgctcct gcgttccgcg gttccctcgc 7920 ttatagacgt cttgatctcc ggtgctgaca catctcccaa gttacttgcc cttcacgggc 7980 cgggaaacac tgggatcgat ggcacgctct gggatttcga gtccgaagcc actaaagagg 8040 aagtcgcact cagtgcgcaa ataatacagg cttgtgacat taggcgtggc gacgctcctg 8100 aaattggtct cccttataag ctgtaccctg ttaggggcaa ccctgagcgg gtgaaaggag 8160 ttctgcagaa tacaaggttt ggagacatac cctacaaaac ccctagtgac accgggagcc 8220 cagtgcacgc ggctgcctgc cttacgccca acgccactcc tgtgactgat gggcgttccg 8280 tcttggctac aaccatgccc cccgggtttg agttatatgt accgaccata ccagcgtctg 8340 tccttgatta ccttgactct aggcctgact gccctaaaca gctgacagag cacggctgcg 8400 aagacgccgc actgaaagac ctctctaaat atgacttatc tacccaaggc tttgtcttac 8460 ctggggttct tcgccttgtg cggaaatacc tgtttgccca tgtaggtaaa tgtccacccg 8520 ttcatcggcc ttctatttac cccgctaaga attctatggc tggaataaat gggaacaggt 8580 tcccaaccaa agacatccag agcgttcctg aaatcgacgt tctgtgcgca caggctgtgc 8640 gggaaaactg gcaaactgtc accccttgta ctcttaagaa acagtattgc gggaagaaga 8700 agaccaggac catactcggc accaataact tcattgcact ggcccaccga gcagtgttga 8760 gtggtgtcac ccagggcttc atgaaaaagg cgttcaactc gcccatcgcc ctcggaaaga 8820 acaagttcaa ggagctacag actccggtcc tgggcaggtg ccttgaagct gacctcgcat 8880 cctgtgatcg atccacgcct gcaattgttc gctggtttgc tgccaacctt ctttatgaac 8940 ttgcctgtgc tgaagagtat ctaccgtcgt atgtgctgaa ctgctgccac gacttactag 9000 tcacgcagtc cggcgcagtg actaagagag gtggcctgtc gtctggcgac ccgatcacct 9060 ctgtgtctaa caccatttac agtttggtga tctatgcaca gcacatggtg cttagttact 9120 ttaaaagtgg tcacccccat ggccttctgt tcttacaaga ccagctaaag tttgaggaca 9180 tgctcaaggt tcaacccctg atcgtctatt cggacgatct cgtgctgtat gccgagtctc 9240 ccaccatgcc aaattatcac tggtgggttg agcatctgaa tttgatgctg gggtttcaga 9300 cggacccaaa aaaaacagca ataacagatt cgccatcatt tctgggctgt agaataatga 9360 atgggcgcca gctagtcccc aaccgtgaca ggatcctcgc ggccctcgcc tatcacatga 9420 aggcaagtaa tgtttctgaa tactatgcct cagcggctgc aatactcatg gacagctgtg 9480 cttgtttgga gtatgatcct gaatggtttg aagaacttgt agttggaata gcgcagtgcg 9540 cccgcaagga tggctacagc tttcccggca cgccgttctt catgtccatg tgggaaaaac 9600 tcaggtccaa ttatgagggg aagaagtcga gagtgtgcgg gtactgcggg gccccggccc 9660 cgtacgctac tgcctgtggc ctcgacgtct gcatctacca cacccacttc caccagcatt 9720 gtccagtcac aatctggtgt ggccatccag cgggttctgg ttcttgtagt gagtgcaaat 9780 cccctgtagg gaaaggcaca aaccctttag acgaggtgct ggaacaagtc ccgtataagc 9840 ccccacggac cgttatcatg catgtagagc agggtctcac cccccttgat ccaggtagat 9900 accaaactcg ccgcggatta gtttccgtta ggcgtggaat taggggaaat gaagttgaac 9960 taccagacgg tgattatgct agcaccgcct tgctccctac ctgcaaagag atcaacatgg 10020 tcgctgtcgc ttccaatgta ttgcgcagca ggttcatcat cggcccaccc ggtgcaggga 10080 aaacatactg gctccttcaa caggtccagg acggtgatgt tatttacaca ccaactcacc 10140 agaccatgct tgacatgatc agggctttgg ggacgtgccg gttcaacgtc ccggcaggca 10200 caacgctgca attccctgtc ccctcccgca ccggtccgtg ggttcgcatc ctggccggcg 10260 gttggtgtcc tggcaagaat tccttcctag atgaagcagc gtattgcaac caccttgatg 10320 ttttgaggct tcttagcaaa actaccctca cctgtctagg agacttcaag caactccacc 10380 cagtgggttt tgattctcat tgttatgttt ttgacatcat gcctcaaact caactgaaga 10440 ccatctggag gttcggacag aatatctgtg atgccatcca gccagattac agggacaagc 10500 tcatgtccat ggtcaacaca acccgtgtga cctacgtgga aagacctgtc aggtatgggc 10560 aggtcctcac cccctaccac agggaccgag aggacgacgc catcactatt gactccagtc 10620 aaggcgccac attcgatgtg gtcacattgc atttgcccac taaagattca ctcaacaggc 10680 aaagagccct tgttgccatc accagggcta gacacgctat ctttgtgtat gacccacaca 10740 ggcagctgca gagcttgttt gatcttcctg caaaaggcac acccgtcaac cttgcagtgc 10800 accgcgacgg gcagctgatc gtacttgata gaaataacaa agaatgcacg gttgctcagg 10860 ctctaggcaa cggggataaa ttcagggcca cagacaagcg tgttgcagat tcactccgcg 10920 ccatttgtgc tgatctagaa gggtcgagtt ctccgctccc caaggtcgca cacaacttgg 10980 ggttttattt ctcacctgac ttaacacaat ttgccaaact cccagtggaa cttgcacctc 11040 attggcccgt ggtgacaacc cagaacaatg aaaagtggcc agatcggctg gtcgccagcc 11100 ttcgccctat ccataaatac agccgcgcgt gcatcggtgc cggctatatg gtgggccctt 11160 cggtgtttct aggcactcct ggggtcgtat catactttct tacaaaattt gttaaaggcg 11220 aggctcaaat gcttccagaa acagtcttca gcaccggccg aattgaggtg gattgccggg 11280 aatatcttga cgatcgggag cgggaagttg ctgcatccct cccacacgcc tttattggcg 11340 acgtcaaagg caccaccgtt ggcggatgtc atcatgtcac ctccaggtac cttcctcgct 11400 tccttcccaa agagtcagtt gcggtagtcg gggtctcaag ccccgggaaa gccgcgaagg 11460 caatgtgcac actgacagat gtgtacctcc cagatcttga agcctatctc cacccggaga 11520 cccagtccag gtgctggaaa atgatgttgg acttcaaaga agttcgactg atggtctgga 11580 aagacaaaac ggcctatttc caacttgagg gtcgttattt cacctggtat cagctcgcta 11640 gttatgcctc gtacgtccgt gttcctgtca actccacggt gtacttggac ccctgcatgg 11700 gcccagccca ttgcaacaga cgagttgtcg ggtccactca gtggggagct gacctcgcaa 11760 tcacccccta tgattatggc gccaagatca ttttgtctag cgcatatcac ggtgaaatgc 11820 cccctgggta caagattctg gcgtgtgcgg agttctcatt ggatgacccg gtcagataca 11880 aacacacctg gggatttgag tcggatacag cgtacctgta cgagttcact ggaaatggtg 11940 aggattggga agattataat gatgcgtttc gtgcgcgcca gaaagggaaa atttataagg 12000 ccactgccac cagcttgaag ttttatttcc ctccgggccc tgtcgttgaa ccaactttgg 12060 gcctgaactg aaggcgcgcc atgaaatggg gtccatgcaa agcctttttt acaaaattgg 12120 ccaacttttt gtggatgctt tcacggagtt cttggtgtcc attgttgata tcattatatt 12180 tttggccatt ttgtttggct tcaccatcgc cggttggctg gtggtctttt gcatcagatt 12240 ggtttgctcc gcgatactcc gtacgcgccc tgccattcac tctgagcaat tacagaagat 12300 cttatgaggc ctttctttcc cagtgccaag tggacattcc cacctgggga actaaacatc 12360 ctttggggat gctttggcac cataaggtgt caaccctgat tgatgaaatg gtgtcgcgtc 12420 gaatgtaccg catcatggaa aaagcagggc aggctgcctg gaaacaggtg gtgagcgagg 12480 ctacgctgtc tcgcattagt agtttggatg tggtggctca ttttcagcat ctagccgcca 12540 ttgaagccga gacctgtaaa tatttggcct cccggctgcc catgctacac aacctgcgca 12600 tgacaggttc aaatgtaacc atagtgtata atagcacttt gaatcaggtg tttgctattt 12660 ttccaacccc tggttcccgg ccaaagcttc atgattttca gcaatggtta atagctgtac 12720 attcctccat attttcctct gttgcagctt cttgtactct ttttgttgtg ctgtggttgc 12780 gggttccaat actacgtact gtttttggtt tccgctggtt aggggcaatt tttctttcga 12840 actcacagtg aattacacgg tgtgtccacc ttgcctcacc cggcaagcag ccacagagat 12900 ctacgaaccc ggtaggtctc tttggtgcag gatagggtat gaccgatgtg aggaggatga 12960 tcatgacgag ctagggttta tggtaccgcc tggcctctcc agcgaaggcc acttgactag 13020 tgtttacgcc tggttggcgt tcttgtcctt cagctacacg gcccagttcc atcccgagat 13080 attcgggata gggaatgtga gtcgagttta tgttgacatc aaacatcaac tcatctgcgc 13140 cgaacatgac gggcagaaca ccaccttgcc tcgtcatgac aacatttcag ccgtgtttca 13200 gacctattac caacatcaag tcgacggcgg caattggttt cacctagaat ggcttcgtcc 13260 cttcttttcc tcgtggttgg ttttaaatgt ctcttggttt ctcaggcgtt cgcctgcaaa 13320 ccatgtttca gttcgagtct tgcagatatt aagaccaaca ccaccgcagc ggcaagcttt 13380 gctgtcctcc aagacatcag ttgccttagg catcgcgact cggcctctga ggcgattcgc 13440 aaaatccctc agtgccgtac ggcgataggg acacccgtgt atgttaccat cacagccaat 13500 gtgacagatg agaattattt acattcttct gatctcctca tgctttcttc ttgccttttc 13560 tatgcttctg agatgagtga aaagggattt aaggtggtat ttggcaatgt gtcaggcatc 13620 gtggctgtgt gtgtcaattt taccagctac gtccaacatg tcaaggagtt tacccaacgc 13680 tccctggtgg tcgaccatgt gcggttgctc catttcatga cacctgagac catgaggtgg 13740 gcaactgttt tagcctgtct ttttgccatt ctgttggcaa tttgaatgtt taagtatgtt 13800 ggagaaatgc ttgaccgcgg gctgttgctc gcaattgctt tctttgtggt gtatcgtgcc 13860 gttctgtttt gctgtgctcg ccaacgccag caacgacagc agctcccatc tacagctgat 13920 ttacaacttg acgctatgtg agctgaatgg cacagattgg ctagctaaca aatttgattg 13980 ggcagtggag agttttgtca tctttcccgt tttgactcac attgtctcct atggtgccct 14040 cactaccagc catttccttg acacagtcgc tttagtcact gtgtctaccg ccgggtttgt 14100 tcacgggcgg tatgtcctaa gtagcatcta cgcggtctgt gccctggctg cgttgacttg 14160 cttcgtcatt aggtttgcaa agaattgcat gtcctggcgc tacgcgtgta ccagatatac 14220 caactttctt ctggacacta agggcggact ctatcgttgg cggtcgcctg tcatcataga 14280 gaaaaggggc aaagttgagg tcgaaggtca tctgatcgac ctcaaaagag ttgtgcttga 14340 tggttccgtg gcaaccccta taaccagagt ttcagcggaa caatggggtc gtccttagat 14400 gacttctgtc atgatagcac ggctccagaa aaggtgcttt tggcgttttc tattacctac 14460 acgccagtga tgatatatgc cctaaaggtg agtcgcggcc gactgctagg gcttctgcac 14520 cttttgatct tcctgaattg tgctttcacc ttcgggtaca tgactttcgc gcactttcag 14580 agtacaaata aggtcgcgct cactatggga gcagtagttg cactcctttg gggggtgtac 14640 tcagccatag aaacctggaa attcatcacc tccagatgcc gtttgtgctt gctaggccgc 14700 aagtacattc tggcccctgc ccaccacgtt gaaagtgccg caggctttca tccgattgcg 14760 gcaaatgata accacgcatt tgtcgtccgg cgtcccggct ccactacggt caacggcaca 14820 ttggtgcccg ggttaaaaag cctcgtgttg ggtggcagaa aagctgttaa acagggagtg 14880 gtaaaccttg tcaaatatgc caaataacaa cggcaagcag cagaagagaa agaaggggga 14940 tggccagcca gtcaatcagc tgtgccagat gctgggtaag atcatcgctc agcaaaacca 15000 gtccagaggc aagggaccgg gaaagaaaaa taagaagaaa aacccggaga agccccattt 15060 tcctctagcg actgaagatg atgtcagaca tcactttacc cctagtgagc ggcaattgtg 15120 tctgtcgtca atccagaccg cctttaatca aggcgctggg acttgcaccc tgtcagattc 15180 agggaggata agttacactg tggagtttag tttgcctacg catcatactg tgcgcctgat 15240 ccgcgtcaca gcatcaccct cagcatgatg ggctggcatt cttgaggcat ctcagtgttt 15300 gaattggaag aatgtgtggt gaatggcact gattgacatt gtgcctctaa gtcacctatt 15360 caattagggc gaccgtgtgg gggtgagatt taattggcga gaaccatgcg gccgaaatta 15420 aaaaaaaaaa aaaaaaaaaa aaa 15443 <210> 5 <211> 609 <212> DNA <213> Artificial Sequence <220> <223> LMY NSP1 beta sequence <400> 5 gctgctgtct acgatgttgg tcatggcgcc gtcatgtatg tggccgatga gagagtctcc 60 tgggcccctc gtggcgggga tgaagtaaga tttgaaactg tcccacagga gctcaagtcg 120 gttgcgaacc aactctgcac ctccttccca ccccaccacg tagtggacat gtctaagttc 180 gcctttacag cccctgggtg tggtgtttct atgcgggtcg aacgtcaata tggctgtctc 240 cccgctgaca ctgtccccga aggcaactgc tggtggagct tgtttgactc gctcccattg 300 gaagtccagg gcaaagaaat tcgccatgct aaccaatttg gctaccagac caagcatggt 360 gtctctggta agtacctaca gcggaggctg caaattaatg gtctccgagc agtagctgac 420 ccaaatggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 480 aaactagcgg aagaacccag ttaccctggg tttgaggacc tcctcagaat aagggttgag 540 tctaacacgt caccattggc taacaaggat gaaaaaattt tccggtttgg cagtcataag 600 tggtacggc 609 <210> 6 <211> 609 <212> DNA <213> Artificial Sequence <220> <223> LMY ver2 NSP1 beta sequence <400> 6 gccgccgtat acgacgtcgg acatggcgcc gttatgtacg ttgccgacga gagagtctcc 60 tgggcccctc gcggcggcga cgaagttaga ttcgaaacgg tcccacagga gcttaagtcg 120 gttgcgaacc aattatgtac gtcgttccca ccccaccacg tagtcgatat gtctaagttc 180 gcctttaccg cccccggttg cggcgtatct atgcgggtcg aacgtcaata cggctgtctc 240 cccgccgata cggtccccga aggcaactgt tggtggagct tgttcgattc gctcccactc 300 gaagtgcaag gcaaagagat tcgccacgct aaccaattcg ggtatcagac taagcatggc 360 gtatccggta agtacctaca gcgtaggctg caaatcaacg gtctccgcgc agtcgctgac 420 cctaacggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 480 aaactggccg aagaacctag ttaccccggg ttcgaggacc tcctccgcat aagggttgag 540 tctaatacgt caccattggc taacaaggac gaaaaaattt tccggtttgg cagtcataag 600 tggtacggc 609 <210> 7 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> AscI restriction enzyme recognition site <400> 7 ggcgcgcc 8 <210> 8 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> PacI restriction enzyme recognition site <400> 8 ttaattaa 8 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PCR forward primer for LMY DNA amplification <400> 9 atgacgtata ggtgttggct cta 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR reverse primer for LMY DNA amplification <400> 10 ctgaggattt ggatggcatt 20 <210> 11 <211> 1149 <212> DNA <213> Artificial Sequence <220> <223> LMY NSP1 gene <400> 11 atgtctggga tacttgatcg gtgcacgtgt acccccaatg ccagggtgtt tatggcggag 60 ggccaagttt actgcacacg atgtctcagt gcacggtctc tccttcccct gaatctccaa 120 gtttctgagc tcggggtgct gggcctattc tacaggcccg aagagccact ccggtggacg 180 ttgccacgtg cattccccac tgttgagtgc tcccccgccg gggcctgctg gctttctgca 240 atctttccaa ttgcacgaat gaccagtgga aacctaaact tccaacaaag aatggtacgg 300 gtcgcagctg agatctacag agttggccag ctcacccctg cagttttgaa ggctctacaa 360 gtttatgagc ggggttgccg ctggtatccc attgttggac ctgtccctgg agtggccgtt 420 ttcgccaact ccctgcatgt gagtgataga cctttcccgg gagcaactca cgtattaacc 480 aacctgccac tcccgcagag acccaagcct gaggactttt gccccttcga gtgtgctatg 540 gctgctgtct acgatgttgg tcatggcgcc gtcatgtatg tggccgatga gagagtctcc 600 tgggcccctc gtggcgggga tgaagtaaga tttgaaactg tcccacagga gctcaagtcg 660 gttgcgaacc aactctgcac ctccttccca ccccaccacg tagtggacat gtctaagttc 720 gcctttacag cccctgggtg tggtgtttct atgcgggtcg aacgtcaata tggctgtctc 780 cccgctgaca ctgtccccga aggcaactgc tggtggagct tgtttgactc gctcccattg 840 gaagtccagg gcaaagaaat tcgccatgct aaccaatttg gctaccagac caagcatggt 900 gtctctggta agtacctaca gcggaggctg caaattaatg gtctccgagc agtagctgac 960 ccaaatggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 1020 aaactagcgg aagaacccag ttaccctggg tttgaggacc tcctcagaat aagggttgag 1080 tctaacacgt caccattggc taacaaggat gaaaaaattt tccggtttgg cagtcataag 1140 tggtacggc 1149 <210> 12 <211> 1149 <212> DNA <213> Artificial Sequence <220> <223> LMY ver2 NSP1 gene <400> 12 atgtctggga tacttgatcg gtgcacgtgt acccccaatg ccagggtgtt tatggcggag 60 ggccaagttt actgcacacg atgtctcagt gcacggtctc tccttcccct gaatctccaa 120 gtttctgagc tcggggtgct gggcctattc tacaggcccg aagagccact ccggtggacg 180 ttgccacgtg cattccccac tgttgagtgc tcccccgccg gcgcatgctg gctttccgct 240 atctttccaa tcgcacgaat gaccagtgga aacctaaact tccaacaaag aatggtacgg 300 gtcgccgccg aaatatacag agtcgggcaa cttacgcccg ctgtattgaa ggctctgcaa 360 gtatacgagc ggggttgtag gtggtatccc atcgtaggac ctgtccctgg agtggccgtt 420 ttcgccaact ccctgcatgt gagtgataga cctttcccgg gagcaactca cgtattaacc 480 aacctgccac tcccgcagag acccaagcct gaggactttt gccccttcga gtgtgctatg 540 gccgccgtat acgacgtcgg acatggcgcc gttatgtacg ttgccgacga gagagtctcc 600 tgggcccctc gcggcggcga cgaagttaga ttcgaaacgg tcccacagga gcttaagtcg 660 gttgcgaacc aattatgtac gtcgttccca ccccaccacg tagtcgatat gtctaagttc 720 gcctttaccg cccccggttg cggcgtatct atgcgggtcg aacgtcaata cggctgtctc 780 cccgccgata cggtccccga aggcaactgt tggtggagct tgttcgattc gctcccactc 840 gaagtgcaag gcaaagagat tcgccacgct aaccaattcg ggtatcagac taagcatggc 900 gtatccggta agtacctaca gcgtaggctg caaatcaacg gtctccgcgc agtcgctgac 960 cctaacggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 1020 aaactggccg aagaacctag ttaccccggg ttcgaggacc tcctccgcat aagggttgag 1080 tctaatacgt caccattggc taacaaggac gaaaaaattt tccggtttgg cagtcataag 1140 tggtacggc 1149 <110> BioPoA, Inc. REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same <130> DPP20194622KR <150> KR 10-2018-0171306 <151> 2018-12-27 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 609 <212> DNA <213> Artificial Sequence <220> <223> LMY ver2 NSP1-beta <400> 1 gctgctgtct acgatgttgg tcatggcgcc gtcatgtatg tggccgatga gagagtctcc 60 tgggcccctc gcggcgggga cgaagttaga ttcgaaacgg tcccacagga gcttaagtcg 120 gttgcgaacc aactctgcac gtcgttccca ccccaccacg tagtcgatat gtctaagttc 180 gcctttaccg cccccggttg cggcgtatct atgcgggtcg aacgtcaata cggctgtctc 240 cccgccgata cggtccccga aggcaactgc tggtggagct tgttcgattc gctcccactc 300 gaagtgcaag gcaaagagat tcgccacgct aaccaattcg ggtatcagac taagcatggc 360 gtatccggta agtacctaca gcggaggctg caaattaacg gtctccgcgc agtcgctgac 420 cctaacggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 480 aaactagcgg aagaacctag ttaccccggg ttcgaggacc tcctccgcat aagggttgag 540 tctaacacgt caccattggc taacaaggac gaaaaaattt tccggtttgg cagtcataag 600 tggtacggc 609 <210> 2 <211> 3188 <212> DNA <213> Artificial Sequence <220> <223> BP2017-2 ORF2-ORF7 <400> 2 atgaaatggg gtccatgcaa agcctttttt acaaaattgg ccaacttttt gtggatgctt 60 tcacggagtt cttggtgtcc attgttgata tcattatatt tttggccatt ttgtttggct 120 tcaccatcgc cggttggctg gtggtctttt gcatcagatt ggtttgctcc gcgatactcc 180 gtacgcgccc tgccattcac tctgagcaat tacagaagat cttatgaggc ctttctttcc 240 cagtgccaag tggacattcc cacctgggga actaaacatc ctttggggat gctttggcac 300 cataaggtgt caaccctgat tgatgaaatg gtgtcgcgtc gaatgtaccg catcatggaa 360 aaagcagggc aggctgcctg gaaacaggtg gtgagcgagg ctacgctgtc tcgcattagt 420 agtttggatg tggtggctca ttttcagcat ctagccgcca ttgaagccga gacctgtaaa 480 tatttggcct cccggctgcc catgctacac aacctgcgca tgacaggttc aaatgtaacc 540 atagtgtata atagcacttt gaatcaggtg tttgctattt ttccaacccc tggttcccgg 600 ccaaagcttc atgattttca gcaatggtta atagctgtac attcctccat attttcctct 660 gttgcagctt cttgtactct ttttgttgtg ctgtggttgc gggttccaat actacgtact 720 gtttttggtt tccgctggtt aggggcaatt tttctttcga actcacagtg aattacacgg 780 tgtgtccacc ttgcctcacc cggcaagcag ccacagagat ctacgaaccc ggtaggtctc 840 tttggtgcag gatagggtat gaccgatgtg aggaggatga tcatgacgag ctagggttta 900 tggtaccgcc tggcctctcc agcgaaggcc acttgactag tgtttacgcc tggttggcgt 960 tcttgtcctt cagctacacg gcccagttcc atcccgagat attcgggata gggaatgtga 1020 gtcgagttta tgttgacatc aaacatcaac tcatctgcgc cgaacatgac gggcagaaca 1080 ccaccttgcc tcgtcatgac aacatttcag ccgtgtttca gacctattac caacatcaag 1140 tcgacggcgg caattggttt cacctagaat ggcttcgtcc cttcttttcc tcgtggttgg 1200 ttttaaatgt ctcttggttt ctcaggcgtt cgcctgcaaa ccatgtttca gttcgagtct 1260 tgcagatatt aagaccaaca ccaccgcagc ggcaagcttt gctgtcctcc aagacatcag 1320 ttgccttagg catcgcgact cggcctctga ggcgattcgc aaaatccctc agtgccgtac 1380 ggcgataggg acacccgtgt atgttaccat cacagccaat gtgacagatg agaattattt 1440 acattcttct gatctcctca tgctttcttc ttgccttttc tatgcttctg agatgagtga 1500 aaagggattt aaggtggtat ttggcaatgt gtcaggcatc gtggctgtgt gtgtcaattt 1560 taccagctac gtccaacatg tcaaggagtt tacccaacgc tccctggtgg tcgaccatgt 1620 gcggttgctc catttcatga cacctgagac catgaggtgg gcaactgttt tagcctgtct 1680 ttttgccatt ctgttggcaa tttgaatgtt taagtatgtt ggagaaatgc ttgaccgcgg 1740 gctgttgctc gcaattgctt tctttgtggt gtatcgtgcc gttctgtttt gctgtgctcg 1800 ccaacgccag caacgacagc agctcccatc tacagctgat ttacaacttg acgctatgtg 1860 agctgaatgg cacagattgg ctagctaaca aatttgattg ggcagtggag agttttgtca 1920 tctttcccgt tttgactcac attgtctcct atggtgccct cactaccagc catttccttg 1980 acacagtcgc tttagtcact gtgtctaccg ccgggtttgt tcaggggcgg tatgtcctaa 2040 gtagcatcta cgcggtctgt gccctggctg cgttgacttg cttcgtcatt aggtttgcaa 2100 agaattgcat gtcctggcgc tacgcgtgta ccagatatac caactttctt ctggacacta 2160 agggcggact ctatcgttgg cggtcgcctg tcatcataga gaaaaggggc aaagttgagg 2220 tcgaaggtca tctgatcgac ctcaaaagag ttgtgcttga tggttccgtg gcaaccccta 2280 taaccagagt ttcagcggaa caatggggtc gtccttagat gacttctgtc atgatagcac 2340 ggctccagaa aaggtgcttt tggcgttttc tattacctac acgccagtga tgatatatgc 2400 cctaaaggtg agtcgcggcc gactgctagg gcttctgcac cttttgatct tcctgaattg 2460 tgctttcacc ttcgggtaca tgactttcgc gcactttcag agtacaaata aggtcgcgct 2520 cactatggga gcagtagttg cactcctttg gggggtgtac tcagccatag aaacctggaa 2580 attcatcacc tccagatgcc gtttgtgctt gctaggccgc aagtacattc tggcccctgc 2640 ccaccacgtt gaaagtgccg caggctttca tccgattgcg gcaaatgata accacgcatt 2700 tgtcgtccgg cgtcccggct ccactacggt caacggcaca ttggtgcccg ggttaaaaag 2760 cctcgtgttg ggtggcagaa aagctgttaa acagggagtg gtaaaccttg tcaaatatgc 2820 caaataacaa cggcaagcag cagaagagaa agaaggggga tggccagcca gtcaatcagc 2880 tgtgccagat gctgggtaag atcatcgctc agcaaaacca gtccagaggc aagggaccgg 2940 gaaagaaaaa taagaagaaa aacccggaga agccccattt tcctctagcg actgaagatg 3000 atgtcagaca tcactttacc cctagtgagc ggcaattgtg tctgtcgtca atccagaccg 3060 cctttaatca aggcgctggg acttgcaccc tgtcagattc agggaggata agttacactg 3120 tggagtttag tttgcctacg catcatactg tgcgcctgat ccgcgtcaca gcatcaccct 3180 cagcatga 3188 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> [A]n <400> 3 aaaaaaaaaa aaaaaaaaaa aaaa 24 <210> 4 <211> 15443 <212> DNA <213> Artificial Sequence <220> <223> LMY-BP2017 chimeric virus sequence <400> 4 atgacgtata ggtgttggct ctatgccttg acatttgtat tgtcaggagc tgtgaccatt 60 ggcacagtcc aaaacttgct gcgcagaaac acccttctgc gacagcctcc ttcaggggag 120 cttggggtct atccctagca ccttgcttct ggagttgcac tgctttacgg tctctccacc 180 cctttaacca tgtctgggat acttgatcgg tgcacgtgta cccccaatgc cagggtgttt 240 atggcggagg gccaagttta ctgcacacga tgtctcagtg cacggtctct ccttcccctg 300 aatctccaag tttctgagct cggggtgctg ggcctattct acaggcccga agagccactc 360 cggtggacgt tgccacgtgc attccccact gttgagtgct cccccgccgg ggcctgctgg 420 ctttctgcaa tctttccaat tgcacgaatg accagtggaa acctaaactt ccaacaaaga 480 atggtacggg tcgcagctga gatctacaga gttggccagc tcacccctgc agttttgaag 540 gctctacaag tttatgagcg gggttgccgc tggtatccca ttgttggacc tgtccctgga 600 gtggccgttt tcgccaactc cctgcatgtg agtgatagac ctttcccggg agcaactcac 660 gtattaacca acctgccact cccgcagaga cccaagcctg aggacttttg ccccttcgag 720 tgtgctatgg ctgctgtcta cgatgttggt catggcgccg tcatgtatgt ggccgatgag 780 agagtctcct gggcccctcg cggcggggac gaagttagat tcgaaacggt cccacaggag 840 cttaagtcgg ttgcgaacca actctgcacg tcgttcccac cccaccacgt agtcgatatg 900 tctaagttcg cctttaccgc ccccggttgc ggcgtatcta tgcgggtcga acgtcaatac 960 ggctgtctcc ccgccgatac ggtccccgaa ggcaactgct ggtggagctt gttcgattcg 1020 ctcccactcg aagtgcaagg caaagagatt cgccacgcta accaattcgg gtatcagact 1080 aagcatggcg tatccggtaa gtacctacag cggaggctgc aaattaacgg tctccgcgca 1140 gtcgctgacc ctaacggacc tttcgtcgta cagtacttct ccgtcaagga gagttggatc 1200 cgccacttga aactagcgga agaacctagt taccccgggt tcgaggacct cctccgcata 1260 agggttgagt ctaacacgtc accattggct aacaaggacg aaaaaatttt ccggtttggc 1320 agtcataagt ggtacggcgc tggtaagaga gcaaggaaag cacgctctcg tgcgactaat 1380 acagtcgctg accgcgcttt gtccgttcgt gaaatctggc aggccaagga gcatgaggtt 1440 accggcgcca ataaggctga gcacctcaaa cactactccc cacctgccga agggaattgt 1500 ggttggcact gcatttccgc catcgtcaac cggatggtta attccaaatt tgaaaccacc 1560 cttcccgaaa gagtgagacc tccagatgac tgggctaccg acgaggatct tgcgaatgcc 1620 atccaaatcc tcagactccc tgcggcctta gacaggaacg gtgcttgtgc tagcgccaag 1680 tacgtactta agctggaagg tgagcattgg actgtcactg tgacccctgg gatgtcccct 1740 tctttgctcc ctcttgaatg tgttcagggc tgttgtgggc acaagggcgg tcttggttcc 1800 ccagacgcag tcgaggtctc cggatttgac cctgcctgcc ttgaccgtct ggctgaggtg 1860 atgcacctgc ctagcagtgc tatcccagcc gctctggccg aaatgtctgg tgattccgat 1920 cgttcggctt ctccggtcac caccgtgtgg actgtttcgc agttctttgc ccgtcacagc 1980 ggaggaaatc accctgacca agtgcgctta gggaaaatca tcagcctttg tcaggtgatt 2040 gaggactgct gctgttccca gaacaaaacc aaccgggtca ccccggagga ggttgcagca 2100 aagattgacc tgtacctccg cggtgcaaca aatcttgaag aatgcttggc caggctcgag 2160 aaagcgcgcc cgccacgggt aatcgacacc ttctttgatt gggacgttgt gctccctggg 2220 gttgaggcag caacccaaac gaccaagctg ccccaggtca accagtgtcg tgctctggtc 2280 cctgttgtga ctcaaaagtc cttggacaac aactcggtcc ccctgaccgc cttttcactg 2340 gctaactact actaccgcgc gcaaggtgac gaagtttgtc accgtgaaag acttaatgcc 2400 gtgctttcca agctggaaga ggttgtccga gaagagtacg ggctcatgcc taccgggcct 2460 ggcccacggc ccacattgcc acgcgggctc gacgaactca aagaccagat ggaggtggac 2520 ttgctgaaac tggctaacgc ccaggcgact tctgacatga tggcttgggc agtcgagcag 2580 gttgacctaa aaacttgggt caagaactac ccgcggtgga tgccaccacc tcctccgcca 2640 aaagttcggc ctcgaaaaac gaagcctgtc aagagcttgc cagagggaaa gcccgccccc 2700 gcccctcgca ggagggttgg gactggttgt ggcagcccga cttcattggg cgatgatgtt 2760 cttaacagtt gggaagattt ggctgttggc agcccctcgg gtctcccgac cccccctgag 2820 ccggcaacac cttcgagtga gccagtggtt gtgtcagcac cgcagtgcat cttcagaccg 2880 gcgacgccct tgagtgagcc gaccccaatt cccgcacccc gtgggactgc gtctcgacca 2940 gtgacacctt tgagcgagcc gatccctgtg cctgcaccgc ggcgtaaatt tcagcaggcg 3000 agaaagttga gttcggcggt ggtaattccg ccgtaccagg acgagcccct ggatttgtcc 3060 gcttcctcgc tgactgaata tgaagccctt cctctagcgc cgccgcaaag cgagggcgct 3120 ctaagagtgg aggggcatga agttgaggaa gccctgagtg aaatctcaga catgtcgggt 3180 ggcactaaac ctgcgcccgt atcatcaagc agctccttgt ccagcgtgag aatcacacgc 3240 ccaaaacact cagctcaagc catcatcgac tcggtcgggc cctgcagtgg gcatctccaa 3300 gaggtgaagg agatatgcct tagtgtcatg cgcgaggcat gtgatgcgac taagctcaat 3360 gaccccgcta cgcaggaatg gctctctcgc atgtgggatc gggtggacat gctgacttgg 3420 cgcaacacgt ctgcttacca gacgcttagc accttaggtg gctggtcaag gttcctccca 3480 aaattgatac ttgagacacc gccgccctac ccgtgtgagt ttgtgatgat gccttacacg 3540 cctgcacctt ccgtgggtgc ggagagcgac ctcaccattg gctcagttgc tactgaggat 3600 gttccacgca tccttgagaa catggagaat gtcggcgaga tgactaacca gggacccttg 3660 gccttctccg aggataaacc ggtggatgac caaccttccg aagacctccg gacatcgtcg 3720 caaggacctg acgggagcac atcagctccg tccgcagata cagctggcgc cggctcatcc 3780 accgatttgc cgtcttcagg cggcgtggat gcggacggag ggggaccgct tcgggcggta 3840 aaaagaaaaa ccgaacggct ctttgaccaa ctgagtcgtc aggtttttga cctcgtctcc 3900 catctcccta ttttcttctc acgcctcttc aaccctggcg gtggttactc tccgggtgat 3960 tggggttttg cagcttttac tctattgtgc ctctttttat gttacagtta cccagcattt 4020 ggcatcgttc ccctcttggg tgtattttct gggtcttctc ggcgcgtgcg aatgggggtt 4080 tttggctgct ggttggcttt tgctgttggt ctgttcaagc ctgtgtccga cccagtcggc 4140 gctgcttgtg agtttgactc gccagaatgc agaaacatcc ttcattcttt tgagcttctc 4200 aaaccttggg accctgttcg cagccttgtt gtgggccccg tcggtctcgg ttttgccatt 4260 cttggcaggc tactgggcgg ggcacgcagc atctggcact ttttgcttag gcttggcatt 4320 gttgcagact gtgtcttggc tggagcttat gtgctttctc aaggtaggtg caaaaagtgt 4380 tggggatctt gtataagaac cgctcctaat gaggtcgctt tcaacgtgtt tccttttacg 4440 cgtgcaacca ggtcgtcact tgttgacctt tgcgatcggt tttgtgcgcc gagaggcatg 4500 gaccccattt ttctcgccac tgggtggcgt ggatgctggg ccggtcggag ccccattgag 4560 caaccctctg aaaaacccat cgcgtttgcc caattggatg aaaagaagat tacggctagg 4620 actgtggtcg cccagcctta tgatcccaac caagccgtaa agtgcctgcg ggtattgcag 4680 gcgggagggg cgatggtggc tgaggcggtc ccaaaagtgg tcagggtttc cgctgttcca 4740 tttcgagccc ccttttttcc taccggagtg aaggttgacc ctgaatgtag agtagtggtt 4800 gaccctgaca ctttcactgc agctctccgg tctggttact ccaccacaaa cctcgtcctc 4860 ggtgtggggg actttgccca gctgaatgga ttaaaaatca ggcaaatttc taagccttca 4920 ggggggggcc cacatctcat ggctgccctg catgttgcct gctcgatgat tttgcacatg 4980 tttgctggga tttatgtgac tgcggtgggt tcttgcggca ccggcaccaa cgatccgtgg 5040 tgcgcaaacc catttgccgt ccctggctac ggacctggct ccctctgcac gtccagattg 5100 tgtatttccc agcacggcct taccctgccc ttgacagcac ttgtggcggg attcggcatc 5160 caggaaattg ccttagtcgc tttgatcttt gtttccatcg gaggcattgc tcataggttg 5220 agttgtaaag ctgacatgct gtgtgttttg cttgcaattg ccagctatgt ttgggtacct 5280 cttacctggt tactttgtgt ttttccttgc tggttgcgct ggttttcttt gcatcccctt 5340 accgtcctat ggttggtgtt tttcttgatt tctgtgaata tgccttcagg aatcttggcc 5400 atggtgttgt tagtttctct ttggcttctt ggtcgttata ctaatgtcgc cggtcttgtc 5460 actccctacg acatcatca ttacaccagt ggccccgcg gtgttgccgc attggctact 5520 gcaccagatg gaacctactt agccgctgtt cgccgcgctg cgttgactgg ccgcaccatg 5580 ttgttcaccc cgtcccagct tgggtctctt cttgagggcg ctttcagaac tcgaaagccc 5640 tcactgaaca ccgtcaatgt ggtcgggtcc tccatgggct ctggcggggt gtttaccatt 5700 gacgggaaag tcaggtgcgt gactgccaca catgtcctta cgggtaactc agccagggtt 5760 tccggaaccg gcttcaatca aatgcttgac tttgacgtaa aaggggattt cgctatagcc 5820 gattgcccga attggcaagg ggctgccccc aaaacccaat tctgcgagga tggatggact 5880 ggccgtgcct attggctaac atcctctggc gtcgaacccg gcgtcattgg gaaaggattc 5940 gccttctgct tcaccgcgtg cggcgattcc gggtccccag tgatcaccga ggccggtgag 6000 cttgtcggtg ttcacacggg atcgaataaa caaggggggg gtattgtcac acgcccctca 6060 ggccagtttt gtaatgtggc acccatcaag ctgagcgaat taagtgaatt ctttgctggg 6120 cctaaggtcc cgctcggtga tgtgaaggtt ggcagccaca taatcaaaga cacaagcgag 6180 gtgccttcag atctttgtgc cttgcttgct gccaaacctg aactggaagg aggtctctcc 6240 accgtccaac ttctgtgtgt gtttttcctt ctgtggagaa tgatgggaca tgcctggacg 6300 cccttggttg ctgtgggttt ctttattttg aatgagattc tcccggccgt cctggtccgg 6360 agtattttct cctttggaat gtttgtgcta tcctggctca cgccatggtc tgcgcaagtt 6420 ctgatgatca ggctcctgac agcagctctt aacaggaata gatgttcact tgcctttttc 6480 agcctcggtg cagtgaccgg ttttgttgca gatcttgcgg ctactcaggg gcatccgttg 6540 caggcagtga tgaatttgag cacctatgca ttcctgcctc gggtaatggt tgtgacttca 6600 ccagtcccag tgatcgcgtg tggtgttgtg cacctactcg ccatcattct gtacctgttt 6660 aaataccgta gcctgcacca tatccttgtt ggcgatggag tgttctcttc ggccttcttc 6720 ctgcgatatt ttgccgaagg aaagttgagg gaaggggtgt cacaatcctg cggaatgaat 6780 catgagtctc tgactggtgc cctcgctatg agactcaatg acgaggactt ggatttcctc 6840 atgaaatgga ctgattttaa gtgcttcgtt tctgcgtcca acatgaggaa tgcagcgggt 6900 caatttatcg aggctgcata tgctaaagca cttagagttg aactggccca gttggtgcag 6960 gttgataagg ttcgaggtac tatggccaaa cttgaagctt ttgctgatac tgtggcacct 7020 caactctcgc ccggtgatat tgttgtcgct ctcggccaca cgcctgttgg cagtatcttc 7080 gacttaaagg ttggtagcac caagcatacc ctccaagcca ttgagaccag ggttcttgct 7140 gggtccaaaa tgaccgtggc gcgcgtcgtc gacccgaccc ccacgccccc acccgcgccc 7200 gtgcccatcc ccctcccacc gaaagttctg gagaatggcc ccaacgcttg gggggatgag 7260 gaccgtttga ataagaagaa aagacgcagg atggaagccc tcggcatcta tgttatgggc 7320 gggaaaaagt accagaaatt ttgggacaag aactccggtg atgtgtttta tgaggaggtc 7380 cataacaaca cagatgagtg ggagtgtctc acagttggcg accctgccga ctttgaccct 7440 gagaagggaa ccctgtgtgg acatgtcacc attgacaaca aggcttacca tgtttacacc 7500 tcctcatctg gtaagaagtt cttggttccc gtcaacccag agaacggaag agttcaatgg 7560 gaagctgcaa agctttccgt ggagcaggcc ctaggcatga tgaatgtcga cggcgaactg 7620 actgccaagg aactggagaa actgaaaaga ataattgaca aactccaggg cctgactaag 7680 gagcagtgtt taaactgcta gccgccagcg acttgacccg ctgtggtcgc ggcggcttgg 7740 ttgttactga gacagcggtg aaaatagtca aatttcacaa tcggactttc actctggggc 7800 ctgtgaattt aaaagtggcc agtgaggttg agctaaaaga tgcggttgag cacaaccaac 7860 acccggttgc gaggccgatc gatggtggag ttgtgctcct gcgttccgcg gttccctcgc 7920 ttatagacgt cttgatctcc ggtgctgaca catctcccaa gttacttgcc cttcaggggc 7980 cgggaaacac tgggatcgat ggcacgctct gggatttcga gtccgaagcc actaaagagg 8040 aagtcgcact cagtgcgcaa ataatacagg cttgtgacat taggcgtggc gacgctcctg 8100 aaattggtct cccttataag ctgtaccctg ttaggggcaa ccctgagcgg gtgaaaggag 8160 ttctgcagaa tacaaggttt ggagacatac cctacaaaac ccctagtgac accgggagcc 8220 cagtgcacgc ggctgcctgc cttacgccca acgccactcc tgtgactgat gggcgttccg 8280 tcttggctac aaccatgccc cccgggtttg agttatatgt accgaccata ccagcgtctg 8340 tccttgatta ccttgactct aggcctgact gccctaaaca gctgacagag cacggctgcg 8400 aagacgccgc actgaaagac ctctctaaat atgacttatc tacccaaggc tttgtcttac 8460 ctggggttct tcgccttgtg cggaaatacc tgtttgccca tgtaggtaaa tgtccacccg 8520 ttcatcggcc ttctatttac cccgctaaga attctatggc tggaataaat gggaacaggt 8580 tcccaaccaa agacatccag agcgttcctg aaatcgacgt tctgtgcgca caggctgtgc 8640 gggaaaactg gcaaactgtc accccttgta ctcttaagaa acagtattgc gggaagaaga 8700 agaccaggac catactcggc accaataact tcattgcact ggcccaccga gcagtgttga 8760 gtggtgtcac ccagggcttc atgaaaaagg cgttcaactc gcccatcgcc ctcggaaaga 8820 acaagttcaa ggagctacag actccggtcc tgggcaggtg ccttgaagct gacctcgcat 8880 cctgtgatcg atccacgcct gcaattgttc gctggtttgc tgccaacctt ctttatgaac 8940 ttgcctgtgc tgaagagtat ctaccgtcgt atgtgctgaa ctgctgccac gacttactag 9000 tcacgcagtc cggcgcagtg actaagagag gtggcctgtc gtctggcgac ccgatcacct 9060 ctgtgtctaa caccatttac agtttggtga tctatgcaca gcacatggtg cttagttact 9120 ttaaaagtgg tcacccccat ggccttctgt tcttacaaga ccagctaaag tttgaggaca 9180 tgctcaaggt tcaacccctg atcgtctatt cggacgatct cgtgctgtat gccgagtctc 9240 ccaccatgcc aaattatcac tggtgggttg agcatctgaa tttgatgctg gggtttcaga 9300 cggacccaaa aaaaacagca ataacagatt cgccatcatt tctgggctgt agaataatga 9360 atgggcgcca gctagtcccc aaccgtgaca ggatcctcgc ggccctcgcc tatcacatga 9420 aggcaagtaa tgtttctgaa tactatgcct cagcggctgc aatactcatg gacagctgtg 9480 cttgtttgga gtatgatcct gaatggtttg aagaacttgt agttggaata gcgcagtgcg 9540 cccgcaagga tggctacagc tttcccggca cgccgttctt catgtccatg tgggaaaaac 9600 tcaggtccaa ttatgagggg aagaagtcga gagtgtgcgg gtactgcggg gccccggccc 9660 cgtacgctac tgcctgtggc ctcgacgtct gcatctacca cacccacttc caccagcatt 9720 gtccagtcac aatctggtgt ggccatccag cgggttctgg ttcttgtagt gagtgcaaat 9780 cccctgtagg gaaaggcaca aaccctttag acgaggtgct ggaacaagtc ccgtataagc 9840 ccccacggac cgttatcatg catgtagagc agggtctcac cccccttgat ccaggtagat 9900 accaaactcg ccgcggatta gtttccgtta ggcgtggaat taggggaaat gaagttgaac 9960 taccagacgg tgattatgct agcaccgcct tgctccctac ctgcaaagag atcaacatgg 10020 tcgctgtcgc ttccaatgta ttgcgcagca ggttcatcat cggcccaccc ggtgcaggga 10080 aaacatactg gctccttcaa caggtccagg acggtgatgt tatttacaca ccaactcacc 10140 agaccatgct tgacatgatc agggctttgg ggacgtgccg gttcaacgtc ccggcaggca 10200 caacgctgca attccctgtc ccctcccgca ccggtccgtg ggttcgcatc ctggccggcg 10260 gttggtgtcc tggcaagaat tccttcctag atgaagcagc gtattgcaac caccttgatg 10320 ttttgaggct tcttagcaaa actaccctca cctgtctagg agacttcaag caactccacc 10380 cagtgggttt tgattctcat tgttatgttt ttgacatcat gcctcaaact caactgaaga 10440 ccatctggag gttcggacag aatatctgtg atgccatcca gccagattac agggacaagc 10500 tcatgtccat ggtcaacaca acccgtgtga cctacgtgga aagacctgtc aggtatgggc 10560 aggtcctcac cccctaccac agggaccgag aggacgacgc catcactatt gactccagtc 10620 aaggcgccac attcgatgtg gtcacattgc atttgcccac taaagattca ctcaacaggc 10680 aaagagccct tgttgccatc accagggcta gacacgctat ctttgtgtat gacccacaca 10740 ggcagctgca gagcttgttt gatcttcctg caaaaggcac acccgtcaac cttgcagtgc 10800 accgcgacgg gcagctgatc gtacttgata gaaataacaa agaatgcacg gttgctcagg 10860 ctctaggcaa cggggataaa ttcagggcca cagacaagcg tgttgcagat tcactccgcg 10920 ccatttgtgc tgatctagaa gggtcgagtt ctccgctccc caaggtcgca cacaacttgg 10980 ggttttattt ctcacctgac ttaacacaat ttgccaaact cccagtggaa cttgcacctc 11040 attggcccgt ggtgacaacc cagaacaatg aaaagtggcc agatcggctg gtcgccagcc 11100 ttcgccctat ccataaatac agccgcgcgt gcatcggtgc cggctatatg gtgggccctt 11160 cggtgtttct aggcactcct ggggtcgtat catactttct tacaaaattt gttaaaggcg 11220 aggctcaaat gcttccagaa acagtcttca gcaccggccg aattgaggtg gattgccggg 11280 aatatcttga cgatcgggag cgggaagttg ctgcatccct cccacacgcc tttattggcg 11340 acgtcaaagg caccaccgtt ggcggatgtc atcatgtcac ctccaggtac cttcctcgct 11400 tccttcccaa agagtcagtt gcggtagtcg gggtctcaag ccccgggaaa gccgcgaagg 11460 caatgtgcac actgacagat gtgtacctcc cagatcttga agcctatctc cacccggaga 11520 cccagtccag gtgctggaaa atgatgttgg acttcaaaga agttcgactg atggtctgga 11580 aagacaaaac ggcctatttc caacttgagg gtcgttattt cacctggtat cagctcgcta 11640 gttatgcctc gtacgtccgt gttcctgtca actccacggt gtacttggac ccctgcatgg 11700 gcccagccca ttgcaacaga cgagttgtcg ggtccactca gtggggagct gacctcgcaa 11760 tcacccccta tgattatggc gccaagatca ttttgtctag cgcatatcac ggtgaaatgc 11820 cccctgggta caagatctg gcgtgtgcgg agttctcatt ggatgacccg gtcagataca 11880 aacacacctg gggatttgag tcggatacag cgtacctgta cgagttcact ggaaatggtg 11940 aggattggga agattataat gatgcgtttc gtgcgcgcca gaaagggaaa atttataagg 12000 ccactgccac cagcttgaag ttttatttcc ctccgggccc tgtcgttgaa ccaactttgg 12060 gcctgaactg aaggcgcgcc atgaaatggg gtccatgcaa agcctttttt acaaaattgg 12120 ccaacttttt gtggatgctt tcacggagtt cttggtgtcc attgttgata tcattatatt 12180 tttggccatt ttgtttggct tcaccatcgc cggttggctg gtggtctttt gcatcagatt 12240 ggtttgctcc gcgatactcc gtacgcgccc tgccattcac tctgagcaat tacagaagat 12300 cttatgaggc ctttctttcc cagtgccaag tggacattcc cacctgggga actaaacatc 12360 ctttggggat gctttggcac cataaggtgt caaccctgat tgatgaaatg gtgtcgcgtc 12420 gaatgtaccg catcatggaa aaagcagggc aggctgcctg gaaacaggtg gtgagcgagg 12480 ctacgctgtc tcgcattagt agtttggatg tggtggctca ttttcagcat ctagccgcca 12540 ttgaagccga gacctgtaaa tatttggcct cccggctgcc catgctacac aacctgcgca 12600 tgacaggttc aaatgtaacc atagtgtata atagcacttt gaatcaggtg tttgctattt 12660 ttccaacccc tggttcccgg ccaaagcttc atgattttca gcaatggtta atagctgtac 12720 attcctccat attttcctct gttgcagctt cttgtactct ttttgttgtg ctgtggttgc 12780 gggttccaat actacgtact gtttttggtt tccgctggtt aggggcaatt tttctttcga 12840 actcacagtg aattacacgg tgtgtccacc ttgcctcacc cggcaagcag ccacagagat 12900 ctacgaaccc ggtaggtctc tttggtgcag gatagggtat gaccgatgtg aggaggatga 12960 tcatgacgag ctagggttta tggtaccgcc tggcctctcc agcgaaggcc acttgactag 13020 tgtttacgcc tggttggcgt tcttgtcctt cagctacacg gcccagttcc atcccgagat 13080 attcgggata gggaatgtga gtcgagttta tgttgacatc aaacatcaac tcatctgcgc 13140 cgaacatgac gggcagaaca ccaccttgcc tcgtcatgac aacatttcag ccgtgtttca 13200 gacctattac caacatcaag tcgacggcgg caattggttt cacctagaat ggcttcgtcc 13260 cttcttttcc tcgtggttgg ttttaaatgt ctcttggttt ctcaggcgtt cgcctgcaaa 13320 ccatgtttca gttcgagtct tgcagatatt aagaccaaca ccaccgcagc ggcaagcttt 13380 gctgtcctcc aagacatcag ttgccttagg catcgcgact cggcctctga ggcgattcgc 13440 aaaatccctc agtgccgtac ggcgataggg acacccgtgt atgttaccat cacagccaat 13500 gtgacagatg agaattattt acattcttct gatctcctca tgctttcttc ttgccttttc 13560 tatgcttctg agatgagtga aaagggattt aaggtggtat ttggcaatgt gtcaggcatc 13620 gtggctgtgt gtgtcaattt taccagctac gtccaacatg tcaaggagtt tacccaacgc 13680 tccctggtgg tcgaccatgt gcggttgctc catttcatga cacctgagac catgaggtgg 13740 gcaactgttt tagcctgtct ttttgccatt ctgttggcaa tttgaatgtt taagtatgtt 13800 ggagaaatgc ttgaccgcgg gctgttgctc gcaattgctt tctttgtggt gtatcgtgcc 13860 gttctgtttt gctgtgctcg ccaacgccag caacgacagc agctcccatc tacagctgat 13920 ttacaacttg acgctatgtg agctgaatgg cacagattgg ctagctaaca aatttgattg 13980 ggcagtggag agttttgtca tctttcccgt tttgactcac attgtctcct atggtgccct 14040 cactaccagc catttccttg acacagtcgc tttagtcact gtgtctaccg ccgggtttgt 14100 tcaggggcgg tatgtcctaa gtagcatcta cgcggtctgt gccctggctg cgttgacttg 14160 cttcgtcatt aggtttgcaa agaattgcat gtcctggcgc tacgcgtgta ccagatatac 14220 caactttctt ctggacacta agggcggact ctatcgttgg cggtcgcctg tcatcataga 14280 gaaaaggggc aaagttgagg tcgaaggtca tctgatcgac ctcaaaagag ttgtgcttga 14340 tggttccgtg gcaaccccta taaccagagt ttcagcggaa caatggggtc gtccttagat 14400 gacttctgtc atgatagcac ggctccagaa aaggtgcttt tggcgttttc tattacctac 14460 acgccagtga tgatatatgc cctaaaggtg agtcgcggcc gactgctagg gcttctgcac 14520 cttttgatct tcctgaattg tgctttcacc ttcgggtaca tgactttcgc gcactttcag 14580 agtacaaata aggtcgcgct cactatggga gcagtagttg cactcctttg gggggtgtac 14640 tcagccatag aaacctggaa attcatcacc tccagatgcc gtttgtgctt gctaggccgc 14700 aagtacattc tggcccctgc ccaccacgtt gaaagtgccg caggctttca tccgattgcg 14760 gcaaatgata accacgcatt tgtcgtccgg cgtcccggct ccactacggt caacggcaca 14820 ttggtgcccg ggttaaaaag cctcgtgttg ggtggcagaa aagctgttaa acagggagtg 14880 gtaaaccttg tcaaatatgc caaataacaa cggcaagcag cagaagagaa agaaggggga 14940 tggccagcca gtcaatcagc tgtgccagat gctgggtaag atcatcgctc agcaaaacca 15000 gtccagaggc aagggaccgg gaaagaaaaa taagaagaaa aacccggaga agccccattt 15060 tcctctagcg actgaagatg atgtcagaca tcactttacc cctagtgagc ggcaattgtg 15120 tctgtcgtca atccagaccg cctttaatca aggcgctggg acttgcaccc tgtcagattc 15180 agggaggata agttacactg tggagtttag tttgcctacg catcatactg tgcgcctgat 15240 ccgcgtcaca gcatcaccct cagcatgatg ggctggcatt cttgaggcat ctcagtgttt 15300 gaattggaag aatgtgtggt gaatggcact gattgacatt gtgcctctaa gtcacctatt 15360 caattagggc gaccgtgtgg gggtgagatt taattggcga gaaccatgcg gccgaaatta 15420 aaaaaaaaaa aaaaaaaaaa aaa 15443 <210> 5 <211> 609 <212> DNA <213> Artificial Sequence <220> <223> LMY NSP1 beta sequence <400> 5 gctgctgtct acgatgttgg tcatggcgcc gtcatgtatg tggccgatga gagagtctcc 60 tgggcccctc gtggcgggga tgaagtaaga tttgaaactg tcccacagga gctcaagtcg 120 gttgcgaacc aactctgcac ctccttccca ccccaccacg tagtggacat gtctaagttc 180 gcctttacag cccctgggtg tggtgtttct atgcgggtcg aacgtcaata tggctgtctc 240 cccgctgaca ctgtccccga aggcaactgc tggtggagct tgtttgactc gctcccattg 300 gaagtccagg gcaaagaaat tcgccatgct aaccaatttg gctaccagac caagcatggt 360 gtctctggta agtacctaca gcggaggctg caaattaatg gtctccgagc agtagctgac 420 ccaaatggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 480 aaactagcgg aagaacccag ttaccctggg tttgaggacc tcctcagaat aagggttgag 540 tctaacacgt caccattggc taacaaggat gaaaaaattt tccggtttgg cagtcataag 600 tggtacggc 609 <210> 6 <211> 609 <212> DNA <213> Artificial Sequence <220> <223> LMY ver2 NSP1 beta sequence <400> 6 gccgccgtat acgacgtcgg acatggcgcc gttatgtacg ttgccgacga gagagtctcc 60 tgggcccctc gcggcggcga cgaagttaga ttcgaaacgg tcccacagga gcttaagtcg 120 gttgcgaacc aattatgtac gtcgttccca ccccaccacg tagtcgatat gtctaagttc 180 gcctttaccg cccccggttg cggcgtatct atgcgggtcg aacgtcaata cggctgtctc 240 cccgccgata cggtccccga aggcaactgt tggtggagct tgttcgattc gctcccactc 300 gaagtgcaag gcaaagagat tcgccacgct aaccaattcg ggtatcagac taagcatggc 360 gtatccggta agtacctaca gcgtaggctg caaatcaacg gtctccgcgc agtcgctgac 420 cctaacggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 480 aaactggccg aagaacctag ttaccccggg ttcgaggacc tcctccgcat aagggttgag 540 tctaatacgt caccattggc taacaaggac gaaaaaattt tccggtttgg cagtcataag 600 tggtacggc 609 <210> 7 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> AscI restriction enzyme recognition site <400> 7 ggcgcgcc 8 <210> 8 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> PacI restriction enzyme recognition site <400> 8 ttaattaa 8 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PCR forward primer for LMY DNA amplification <400> 9 atgacgtata ggtgttggct cta 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR reverse primer for LMY DNA amplification <400> 10 ctgaggattt ggatggcatt 20 <210> 11 <211> 1149 <212> DNA <213> Artificial Sequence <220> <223> LMY NSP1 gene <400> 11 atgtctggga tacttgatcg gtgcacgtgt acccccaatg ccagggtgtt tatggcggag 60 ggccaagttt actgcacacg atgtctcagt gcacggtctc tccttcccct gaatctccaa 120 gtttctgagc tcggggtgct gggcctattc tacaggcccg aagagccact ccggtggacg 180 ttgccacgtg cattccccac tgttgagtgc tcccccgccg gggcctgctg gctttctgca 240 atctttccaa ttgcacgaat gaccagtgga aacctaaact tccaacaaag aatggtacgg 300 gtcgcagctg agatctacag agttggccag ctcacccctg cagttttgaa ggctctacaa 360 gtttatgagc ggggttgccg ctggtatccc attgttggac ctgtccctgg agtggccgtt 420 ttcgccaact ccctgcatgt gagtgataga cctttcccgg gagcaactca cgtattaacc 480 aacctgccac tcccgcagag acccaagcct gaggactttt gccccttcga gtgtgctatg 540 gctgctgtct acgatgttgg tcatggcgcc gtcatgtatg tggccgatga gagagtctcc 600 tgggcccctc gtggcgggga tgaagtaaga tttgaaactg tcccacagga gctcaagtcg 660 gttgcgaacc aactctgcac ctccttccca ccccaccacg tagtggacat gtctaagttc 720 gcctttacag cccctgggtg tggtgtttct atgcgggtcg aacgtcaata tggctgtctc 780 cccgctgaca ctgtccccga aggcaactgc tggtggagct tgtttgactc gctcccattg 840 gaagtccagg gcaaagaaat tcgccatgct aaccaatttg gctaccagac caagcatggt 900 gtctctggta agtacctaca gcggaggctg caaattaatg gtctccgagc agtagctgac 960 ccaaatggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 1020 aaactagcgg aagaacccag ttaccctggg tttgaggacc tcctcagaat aagggttgag 1080 tctaacacgt caccattggc taacaaggat gaaaaaattt tccggtttgg cagtcataag 1140 tggtacggc 1149 <210> 12 <211> 1149 <212> DNA <213> Artificial Sequence <220> <223> LMY ver2 NSP1 gene <400> 12 atgtctggga tacttgatcg gtgcacgtgt acccccaatg ccagggtgtt tatggcggag 60 ggccaagttt actgcacacg atgtctcagt gcacggtctc tccttcccct gaatctccaa 120 gtttctgagc tcggggtgct gggcctattc tacaggcccg aagagccact ccggtggacg 180 ttgccacgtg cattccccac tgttgagtgc tcccccgccg gcgcatgctg gctttccgct 240 atctttccaa tcgcacgaat gaccagtgga aacctaaact tccaacaaag aatggtacgg 300 gtcgccgccg aaatatacag agtcgggcaa cttacgcccg ctgtattgaa ggctctgcaa 360 gtatacgagc ggggttgtag gtggtatccc atcgtaggac ctgtccctgg agtggccgtt 420 ttcgccaact ccctgcatgt gagtgataga cctttcccgg gagcaactca cgtattaacc 480 aacctgccac tcccgcagag acccaagcct gaggactttt gccccttcga gtgtgctatg 540 gccgccgtat acgacgtcgg acatggcgcc gttatgtacg ttgccgacga gagagtctcc 600 tgggcccctc gcggcggcga cgaagttaga ttcgaaacgg tcccacagga gcttaagtcg 660 gttgcgaacc aattatgtac gtcgttccca ccccaccacg tagtcgatat gtctaagttc 720 gcctttaccg cccccggttg cggcgtatct atgcgggtcg aacgtcaata cggctgtctc 780 cccgccgata cggtccccga aggcaactgt tggtggagct tgttcgattc gctcccactc 840 gaagtgcaag gcaaagagat tcgccacgct aaccaattcg ggtatcagac taagcatggc 900 gtatccggta agtacctaca gcgtaggctg caaatcaacg gtctccgcgc agtcgctgac 960 cctaacggac ctttcgtcgt acagtacttc tccgtcaagg agagttggat ccgccacttg 1020 aaactggccg aagaacctag ttaccccggg ttcgaggacc tcctccgcat aagggttgag 1080 tctaatacgt caccattggc taacaaggac gaaaaaattt tccggtttgg cagtcataag 1140 tggtacggc 1149

Claims (22)

구조식 1의 구조로 구성된 폴리뉴클레오타이드로서, 돼지 생식기 호흡기 증후군 바이러스(PRRSV)의 키메라 바이러스의 유전체인, 폴리뉴클레오타이드:
[구조식 1]
5'-[X]-[Y]-3'
상기 [X]는 수탁번호 KCTC 13394BP를 갖는 LMY ver2 변이주의 지놈을 제한효소 AscI와 PacI로 처리하여 얻어지고 NSP1 유전자를 포함하는 유전자 단편이고,
상기 [Y]는 수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 지놈을 제한효소 AscI와 PacI로 처리하여 얻어지고 ORF2 내지 ORF7 부위를 포함하는 유전자 단편임.
A polynucleotide consisting of the structure of Structural Formula 1, wherein the polynucleotide is a genome of a chimeric virus of porcine reproductive and respiratory syndrome virus (PRRSV):
[Structural Formula 1]
5'-[X]-[Y]-3'
The [X] is a gene fragment obtained by treating the genome of the LMY ver2 mutant having accession number KCTC 13394BP with restriction enzymes AscI and PacI and including the NSP1 gene,
The [Y] is a gene fragment obtained by treating the genome of the BP2017-2 mutant with accession number KCTC 13393BP with restriction enzymes AscI and PacI and including ORF2 to ORF7 sites.
제1항에 있어서, 상기 구조식 1의 [Y]의 3'말단에 [A]n을 추가로 포함하고,
상기 n은 염기 아데닌(Adenine, A)의 뉴클레오타이드의 개수로, 1 내지 100의 정수인, 폴리뉴클레오타이드.
The method according to claim 1, further comprising [A]n at the 3' end of [Y] of Structural Formula 1,
Wherein n is the number of nucleotides of the base adenine (Adenine, A), an integer of 1 to 100, polynucleotides.
제1항에 있어서, 상기 PRRSV 키메라 바이러스의 폴리뉴클레오타이드는 DNA 또는 RNA인 것인, 폴리뉴클레오타이드.The polynucleotide according to claim 1, wherein the polynucleotide of the PRRSV chimeric virus is DNA or RNA. 삭제delete 삭제delete 제1항에 있어서, 상기 [X]는, 서열번호 11의 염기서열로 이루어지는 NSP1 유전자의 핵산 서열에서, 222번 위치, 225번 위치, 237번 위치, 240번 위치, 252번 위치, 306번 위치, 309번 위치, 312번 위치, 315번 위치, 324번 위치, 327번 위치, 330번 위치, 333번 위치, 336번 위치, 339번 위치, 342번 위치, 345번 위치, 357번 위치, 363번 위치, 366번 위치, 378번 위치, 379번 위치, 381번 위치, 393번 위치, 396번 위치, 543번 위치, 546번 위치, 549번 위치, 555번 위치, 558번 위치, 561번 위치, 573번 위치, 579번 위치, 582번 위치, 588번 위치, 612번 위치, 618번 위치, 621번 위치, 627번 위치, 633번 위치, 639번 위치, 654번 위치, 673번 위치, 675번 위치, 678번 위치, 681번 위치, 684번 위치, 705번 위치, 708번 위치, 729번 위치, 735번 위치, 738번 위치, 741번 위치, 744번 위치, 747번 위치, 771번 위치, 786번 위치, 789번 위치, 792번 위치, 810번 위치, 825번 위치, 828번 위치, 838번 위치, 840번 위치, 846번 위치, 849번 위치, 858번 위치, 867번 위치, 879번 위치, 882번 위치, 885번 위치, 891번 위치, 900번 위치, 903번 위치, 906번 위치, 924번 위치, 936번 위치, 939번 위치, 948번 위치, 954번 위치, 963번 위치, 966번 위치, 1026번 위치, 1029번 위치, 1038번 위치, 1047번 위치, 1053번 위치, 1066번 위치, 1068번 위치, 1086번 위치, 및 1110번 위치의 염기가 치환된 변이 NSP1 유전자를 포함하는 것인, 폴리뉴클레오타이드.The method of claim 1, wherein [X], in the nucleic acid sequence of the NSP1 gene consisting of the nucleotide sequence of SEQ ID NO: 11, position 222, position 225, position 237, position 240, position 252, position 306 , 309, 312, 315, 324, 327, 330, 333, 336, 339, 342, 345, 357, 363 Position 366, Position 378, Position 379, Position 381, Position 393, Position 396, Position 543, Position 546, Position 549, Position 555, Position 558, Position 561 , Position 573, Position 579, Position 582, Position 588, Position 612, Position 618, Position 621, Position 627, Position 633, Position 639, Position 654, Position 673, 675 Position 678, Position 681, Position 684, Position 705, Position 708, Position 729, Position 735, Position 738, Position 741, Position 744, Position 747, Position 771 , 786, 789, 792, 810, 825, 828, 838, 840, 846, 849, 858, 867, 879 Position 882, Position 885, Position 891, Position 900, Position 903, Position 906, Position 924, Position 936, Position 939, Position 948, Position 954, Position 963 , position 966, position 1026, position 1029, position 1038, position 1047, position 1053, position 1066, position 1068, position 1086, and mutant NSP1 gene in which the bases of positions 1110 are substituted comprising, a polynucleotide. 제6항에 있어서, 상기 변이 NSP1 유전자는 서열번호 12의 핵산 서열을 갖는 핵산 서열로 표시되는 것인, 폴리뉴클레오타이드.The polynucleotide of claim 6, wherein the mutant NSP1 gene is represented by a nucleic acid sequence having the nucleic acid sequence of SEQ ID NO: 12. 제1항에 있어서, 상기 [Y]는 서열번호 2의 핵산 서열로 표시되는 것인, 폴리뉴클레오타이드.The polynucleotide of claim 1, wherein [Y] is represented by the nucleic acid sequence of SEQ ID NO: 2. 제1항에 있어서, 상기 구조식 1은 서열번호 4의 핵산 서열로 표시되는 것인, 폴리뉴클레오타이드.The polynucleotide according to claim 1, wherein Structural Formula 1 is represented by the nucleic acid sequence of SEQ ID NO: 4. 제1항 내지 제3항 및 제6항 내지 제9항 중 어느 한 항의 폴리뉴클레오타이드를 지놈으로 포함하는 PRRSV 키메라 바이러스.A PRRSV chimeric virus comprising the polynucleotide of any one of claims 1 to 3 and 6 to 9 as a genome. 제10항에 있어서, 상기 키메라 바이러스는 수탁번호 KCTC13675BP를 갖는 것인, 바이러스.The virus of claim 10, wherein the chimeric virus has accession number KCTC13675BP. 제10항의 PRRSV의 키메라 바이러스 또는 이의 계대 배양된 자손을 포함하는 돼지 생식기 호흡기 증후군 바이러스 백신 조성물.A porcine reproductive and respiratory syndrome virus vaccine composition comprising the chimeric virus of claim 10 or a subcultured progeny thereof. 제12항에 있어서, 상기 키메라 바이러스는 수탁번호 KCTC13675BP를 갖는 것인, 백신 조성물.The vaccine composition of claim 12, wherein the chimeric virus has accession number KCTC13675BP. 제12항에 있어서, 상기 백신은 생백신인, 백신 조성물.The vaccine composition of claim 12 , wherein the vaccine is a live vaccine. 제12항에 있어서, 상기 백신은 담체, 희석제, 부형제, 및 어주번트(adhuvant)로 이루어진 군에서 선택되는 1 이상을 더 포함하는 것인, 백신 조성물.The vaccine composition of claim 12, wherein the vaccine further comprises one or more selected from the group consisting of carriers, diluents, excipients, and adjuvants. 제12항에 있어서, 상기 백신 조성물과 Accession No. GenBank accession no.DQ473474.1.를 가지는 이의 모균주를 돼지의 폐 대식세포에 접종한 후, 측정한 상기 키메라 바이러스의 TCID50의 값이, 모균주의 TCID50 값에 비해 0.01 배 내지 0.1배의 TCID50 값을 갖는 것인, 백신 조성물.13. The method of claim 12, wherein the vaccine composition and Accession No. After inoculation of the parent strain having GenBank accession no. DQ473474.1. into pig lung macrophages, the TCID 50 value of the chimeric virus measured is 0.01 to 0.1 times higher than the TCID 50 value of the parent strain. A vaccine composition having a TCID 50 value. 제12항에 있어서, 상기 백신 조성물과 Accession No. GenBank accession no.DQ473474.1.를 가지는 이의 모균주를 돼지에 접종한 후, 측정한 상기 키메라 바이러스의 중화항체 값이, 모균주의 중화항체 값에 비해 2배 내지 8배인 것인, 백신 조성물. 13. The method of claim 12, wherein the vaccine composition and Accession No. A vaccine composition, wherein the neutralizing antibody value of the chimeric virus measured after inoculating a pig with its parent strain having GenBank accession no. DQ473474.1. is 2 to 8 times that of the neutralizing antibody value of the parent strain. 수탁번호 13394BP를 갖는 LMY ver2 변이주의 지놈을 제한효소 AscI 와 PacI 로 처리하여 NSP1 단백질을 암호화하는 부위를 포함하는 폴리뉴클레오타이드 절편을 제조하는 단계;
수탁번호 KCTC 13393BP를 갖는 BP2017-2 변이주의 지놈을 제한효소 AscI 와 PacI 로 처리하여 ORF2 내지 ORF7 부위를 포함하는 폴리뉴클레오타이드 절편을 제조하는 단계; 및
상기 LMY ver 2의 폴리뉴클레오타이드 절편과 BP2017-2의 폴리뉴클레오타이드 절편을 재조합하여 감염성 클론(infectious clone)을 제조하는 단계를 포함하는, 돼지 생식기 호흡기 증후군 바이러스의 키메라 바이러스를 생산하는 방법.
Preparing a polynucleotide fragment including a region encoding the NSP1 protein by treating the genome of the LMY ver2 mutant having accession number 13394BP with restriction enzymes AscI and PacI;
Preparing a polynucleotide fragment including ORF2 to ORF7 sites by treating the genome of the BP2017-2 mutant with accession number KCTC 13393BP with restriction enzymes AscI and PacI; and
A method for producing a chimeric virus of porcine reproductive and respiratory syndrome virus, comprising the step of recombination of the polynucleotide fragment of LMY ver 2 and the polynucleotide fragment of BP2017-2 to prepare an infectious clone.
제18항에 있어서, 상기 NSP1 단백질은 서열번호 12의 염기서열로 이루어지는, 키메라 바이러스를 생산하는 방법.The method of claim 18, wherein the NSP1 protein consists of the nucleotide sequence of SEQ ID NO: 12. 제18항에 있어서, 상기 ORF2 내지 ORF7 부위는 서열번호 2의 염기서열로 이루어지는, 키메라 바이러스를 생산하는 방법.19. The method of claim 18, wherein the ORF2 to ORF7 region consists of the nucleotide sequence of SEQ ID NO: 2, the method for producing a chimeric virus. 제12항의 백신 조성물을 포함하는, 돼지 생식기 호흡기 증후군의 예방 또는 치료용 약학적 조성물.A pharmaceutical composition for preventing or treating porcine reproductive and respiratory syndrome, comprising the vaccine composition of claim 12. 제12항의 백신 조성물을 돼지에 투여하는 단계를 포함하는, 돼지 생식기 호흡기 증후군을 예방 또는 치료하는 방법.A method for preventing or treating porcine reproductive and respiratory syndrome, comprising administering the vaccine composition of claim 12 to a pig.
KR1020190145389A 2018-12-27 2019-11-13 Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same KR102335864B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/KR2019/017319 WO2020138761A1 (en) 2018-12-27 2019-12-09 Chimeric virus of porcine reproductive and respiratory syndrome virus, and vaccine using same
CN201980093073.0A CN113544140A (en) 2018-12-27 2019-12-09 Chimeric virus of porcine reproductive and respiratory syndrome virus and vaccine using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180171306 2018-12-27
KR1020180171306 2018-12-27

Publications (2)

Publication Number Publication Date
KR20200081225A KR20200081225A (en) 2020-07-07
KR102335864B1 true KR102335864B1 (en) 2021-12-06

Family

ID=71603047

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190145389A KR102335864B1 (en) 2018-12-27 2019-11-13 Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same

Country Status (2)

Country Link
KR (1) KR102335864B1 (en)
CN (1) CN113544140A (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023128051A1 (en) * 2021-12-30 2023-07-06 주식회사 바이오포아 Chimeric virus expressing porcine productive and respiratory syndrome virus-derived peptide and vaccine composition comprising same
CN116036253B (en) * 2022-11-24 2023-12-26 畜科生物工程有限公司 Live vaccine for porcine reproductive and respiratory syndrome and preparation method thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101933931B1 (en) * 2017-12-27 2018-12-31 주식회사 바이오포아 Mutant strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same
KR101933932B1 (en) * 2017-12-27 2018-12-31 주식회사 바이오포아 Mutant strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009506129A (en) * 2005-08-30 2009-02-12 ボード・オブ・リージエンツ・オブ・ザ・ユニバーシテイ・オブ・ネブラスカ Methods and compositions for vaccination of animals with PRRSV antigens having improved immunogenicity
KR20150045873A (en) * 2013-10-19 2015-04-29 건국대학교 산학협력단 Chimeric strain of Porcine Reproductive and Respiratory Syndrome Virus
JP6886291B2 (en) * 2013-12-20 2021-06-16 ベーリンガー インゲルハイム フェトメディカ ゲーエムベーハーBoehringer Ingelheim Vetmedica GmbH PRRS virus mutants, European PRRS virus cDNA clones and their use
CN104250638B (en) * 2014-04-03 2017-01-25 普莱柯生物工程股份有限公司 Porcine reproductive and respiratory syndrome virus attenuated strain, vaccine composition and preparation method and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101933931B1 (en) * 2017-12-27 2018-12-31 주식회사 바이오포아 Mutant strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same
KR101933932B1 (en) * 2017-12-27 2018-12-31 주식회사 바이오포아 Mutant strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same

Also Published As

Publication number Publication date
CN113544140A (en) 2021-10-22
KR20200081225A (en) 2020-07-07

Similar Documents

Publication Publication Date Title
US11911454B2 (en) Effective vaccination against porcine reproductive and respiratory syndrome (PRRS) virus prior to weaning
KR101653177B1 (en) Vaccine against highly pathogenic porcine reproductive and respiratory syndrome (HP PRRS)
EP2637688B1 (en) North american porcine reproductive and respiratory syndrome (prrs) virus and uses thereof
EP2929018A1 (en) Porcine reproductive and respiratory syndrome virus compositions and uses thereof
KR102335864B1 (en) Chimeric strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same
KR102193460B1 (en) Vaccine composition for preventing porcine reproductive and respiratory syndrome and preventing method thereof
KR101933932B1 (en) Mutant strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same
WO2020138761A1 (en) Chimeric virus of porcine reproductive and respiratory syndrome virus, and vaccine using same
KR101933931B1 (en) Mutant strain of porcine reproductive and respiratory syndrome virus and antiviral vaccines including the same
RU2781446C1 (en) Chimeric porcine reproductive and respiratory syndrome virus and vaccine using said virus
EP4098741A1 (en) Mutant strain of european porcine reproductive and respiratory syndrome virus and vaccine composition comprising same
KR102402645B1 (en) Chimeric strain of European porcine reproductive and respiratory syndrome virus and antiviral vaccines comprising the same
KR102276341B1 (en) Method for producing European porcine reproductive and respiratory syndrome virus and use thereof
KR20240019014A (en) Chimeric strains of North American and European porcine reproductive and respiratory syndrome viruses
KR20240019015A (en) Method for preparing chimeras of North American and European porcine reproductive and respiratory syndrome viruses

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant