KR20180039211A - Method for improving the resistance to the drought stress using pepper E3 ligase CaDSR1 in plants - Google Patents

Abstract

The present invention relates to a method for improving resistance to drought stress of a plant using a pepper-derived new capsicum annum drought sensitive ring finger protein 1 (CaDSR1) gene/protein. The present invention identifies the CaDSR1 gene which is a negative regulatory factor for the drought stress and identifies an effect of improving the resistance to the drought stress in a transgenic plant in which the protein is silenced by functioning the CaDSR1 protein as a negative regulator of ABA signal transmission, thereby being used for the improvement of crops which mankind uses through the regulation of gene expression and, especially being expected to be useful for improving the productivity of the plant.

Description

[0001] The present invention relates to a method for enhancing dry stress resistance of plants using pepper E3 ligase CaDSR1,

The present invention relates to a novel CaDSR1 ( Capsicum annuum Drought Sensitive RING finger protein 1) gene / protein derived from pepper, and a method for enhancing dry stress resistance of the plant using the same.

Water shortage in plants is one of the harmful environmental stressors, caused by drying, high salinity and cold, resulting in significant grain yield reduction. In order to survive in this water-poor environment, plants have evolved several defense mechanisms to minimize water loss due to vaporization in pores and maximize water uptake from root tips. Although the physiological and molecular mechanisms of plants in water-poor environments have been extensively studied, defense mechanisms in plant water-deficient environments are caused by complex and precise processes, and although they have not yet been clearly elucidated, the plant hormone abscisic acid ABA) is known to occur under drying conditions.

ABA is a major plant hormone for protecting plants against abiotic stress, especially dry stress, and is known to play a very important role in plant growth and development. ABA functions to help plants adapt to dry conditions by promoting pore closure, inducing defensive genes, and accumulating various defensive metabolites, while at the same time elevating genes by ABA biosynthesis and biosynthesis . 9-cis-epoxycarotenoid dioxygenases (NCED) are the major enzymes involved in ABA synthesis, and the expression of the NCED gene is expressed by osmotic stresses including dryness, high salt, and low temperature. The NCED gene is a positive regulator of ABA biosynthesis and biological stress tolerance. Mutations overexpressing the NCED gene showed an increase in ABA levels and increased tolerance to dry and high salt in several higher plants. On the other hand, the NCED3 non-marker mutation showed a phenotypic decrease in tolerance to dry stress, with a lower ABA level. However, the precise molecular action due to increased ABA biosynthesis has not been fully elucidated.

In the signaling pathway, specific genes are regulated by interactions between cis-acting elements and transcription factors. Transcription factors have various properties such as nuclear transfer, transcriptional activation or inhibition essential for the expression of the target gene, and DNA-binding to the targeted region of the target gene. These transcription factors are associated with adaptation to the stress environment, such as drying, high salt and temperature changes. Several transcription factors, including the type of cis-acting elements, including ERF, MYB, RAV or bZIP, are affected by the adaptive response of the plant and deletion or overexpression mutations show resistance or susceptibility to other stressors. Studies on bZIP factors in plants have suggested that bZIP factors regulate a variety of biological processes such as seed maturation, aging, adaptive responses to environmental stress, and the bZIP factor in plant adaptation responses to abiotic stress (Blanco & Judelson 2005, Lee et al. 2006, Pitzschke et al. 2009).

An alternative approach to adaptation to abiotic stress in plants is post-translational modification, a fast and effective mechanism to reduce impact. One type of post-translational modification, ubiquitination, is associated with various cellular processes and stress responses in plant development. In ubiquitin adducts, the substrate protein undergoes protein hydrolysis by 26S proteasome and the three enzymes -ubiquitin (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin ligase (E3). Among these enzymes, the E3 ligase determines the specificity and constitutes the target protein. More than 1400 E3 ligands have been found through genomic sequencing in Arabidopsis.

The present inventors investigated the relationship between the dry stress response through the regulation of the ABA signaling pathway and found that CaSR1 ( Capsicum annuum Drought Sensitive RING finger protein 1) gene was identified. When the gene was silenced, it was confirmed that the dry stress resistance of the plant was enhanced, thereby completing the present invention.

Accordingly, an object of the present invention is to provide a cosmetic composition containing CaDSR1 ( Capsicum annuum Drought Sensitive RING finger protein 1) gene and protein, and a composition and a method for inhibiting the protein to improve the dry stress resistance of the plant.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to accomplish the object of the present invention as described above, the present invention provides a method for producing a negative regulator protein (CaSR1) comprising a nucleotide sequence of SEQ ID NO: 1 encoding a negative regulator protein against dry stress, Lt; / RTI >

In addition, the present invention provides a composition for enhancing dry stress resistance of a plant, comprising an expression or activity inhibitor of CaDSR1 protein as an active ingredient.

In one embodiment of the present invention, the CaDSRl protein is characterized in that it is composed of the amino acid sequence shown in SEQ ID NO: 2.

The present invention also provides a recombinant VIGS (Virus Induced Gene Silencing) vector comprising an ORF (open reading frame) of a gene encoding a CaDSR1 protein.

In addition, the present invention provides a method for promoting dryness resistance of a plant, comprising the step of silencing a CaSR1 (Capsicum annuum Drought Sensitive RING finger protein 1) gene by transforming a plant with the vector.

The present invention identified a novel CaDSR1 gene encoding a negative regulatory factor protein for dry stress and CaDSR1 protein functioned as a negative regulator of ABA signal transduction and confirmed the effect of enhancing dry stress resistance in the transgenic plant in which the protein was silenced Bar, the CaDSR1 gene It can be used for the improvement of crops available to mankind through the regulation of expression, and it is expected to be useful for improving the productivity of plants.

FIG. 1 shows the results of cell-free digestion analysis of CaDILZ1. Fig. 1 (a) shows the results of the cell-free digestion analysis of CaDILZ1, and the GST-CaADIP1 (500 ng) . Immunoblot analysis was performed using anti-GST antibody (top), and CBB staining (bottom) shows the same loading of extract M, MG132.
FIG. 1B shows the result of multiple sequence alignment of the RING domain. The amino acid sequence of the RING domain of CaDSR1 and the CaDSR1 homologous protein of the other species was darkened according to the identity using the ClustalW2 program. * Indicates conserved cysteine (C) and histidine (H), and FIG. 1C is a diagram showing the result of visualizing the hydrophobic part of the CaDSR1 protein.
FIG. 1D shows the result of a yeast two-hybrid assay for confirming the interaction between CaDILZ1 and CaDSR1. FIG. 1E shows the results of Bimolecular fluorescence complementation (BiFC) analysis. In the tobacco leaf, VYNE :: CaDILZ1 is CYCE :: CaDSR1 Lt; / RTI >
FIG. 1F shows the intracellular location of CaDSR1 and the flanking CaDSR1 protein labeled with C-terminal GFP protein in tobacco plants (white bar = 20 .mu.m), FIG. 1g shows the result of confirming that CaDSR1 is expressed entirely in the tissue, 1h shows the result of confirming the expression level of CaDSR1 in the case of ABA, dry and high salt treatment. pepper Actin1 (CaACT1) gene was used as a control gene.
Fig. 2 shows the result of multiple alignments of CaDSRl. Multiple alignment of the deduced amino acid sequence of CaDSRl with the homologous protein of CaDSRl was performed using ClustalW2. The same and similar amino acid residues were darkened according to identity, and the gaps introduced to maximize alignment in the homology region were indicated by dashes (the sequences used are: CaDILZ1 (accession no. NP_001311996), Solanum lycopersicum TGA2 (Accession No. XP_010322435), Solanum tuberosum TGA2 (accession No. XP_006347245), Glycine max TGA2-like (accession No. XP_003539469), Citrus sinensis TGA2-like (accession No. XP_006487950), Sesamum indicum TGA2 X1 (accession No. XP_011088884 ), Populus euphratica TGA2-like (Accession No. XP_011000921), Vitis vinifera TGA6 (XP_002276067), Beta vulgaris TGA2 (accession No. XP_010686013), Arabidopsis thaliana TGA9 (Accession No. NP_563810; AT1G08320), and Brassica napus TGA2- accession No. XP_002874883), red mark: BRLZ (green mark): DOG1 (DELAYED IN GERMINATION1) domain, nuclear signal is indicated by a black bar.
Fig. 3 is a view showing the results of confirming the interaction of CaDILZl and CaDSRl in the nucleus.
FIG. 4 shows the result of confirming the E3 ubiquitin ligase activity of the CaDSR1 protein. FIG. 4a shows the result of confirming the intracellular autoustinization of the CaDSR1 protein. The MBP-labeled recombinant CaDSR1 and the amino acid deletion mutant CaDSR1 ^C112S Proteins were incubated with Arabidopsis E1, E2, Ub, and ATP. Ubiquitinated CaDSRl protein was identified using anti-MBP (top) and anti-Ub (bottom) antibodies. FIG. 4B shows the results of confirming intracellular ubiquitination of CaDILZ1 by CaDSR1. As a result, GST-labeled CaDILZ1 protein was added to the mixture and incubated for 2 hours. Immunoblot analysis was performed using anti-GST and anti- Ub (bottom) antibody.
FIG. 5 shows the result of confirming the tolerance increase of CaDSR1-depressed pepper plants against dehydration stress. FIG. 5A shows the leaf temperature of ABF-treated CaDSR1-silenced pepper plants and CaDSR1 is a silenced pepper plant (TRV2 : CaDSR1) and a control plant (TRV2: 00) were representative images of leaf temperature after treatment with 50 μM ABA and after 6 hours, and FIG. 5b shows the average temperature of the first and second leaves of each plant Fig.
FIG. 5c is a photograph showing the appearance of pores induced by ABA of CaDSR1-silenced pepper plants (TRV2: CaDSR1) and control plants (TRV2: 00), and FIG. 5d shows the results of comparing the diameters and lengths of pores Fig.
FIG. 5E is a graph showing the change in the water loss of the citrus plants (TRV2: CaDSR1) and the control plant (TRV2: 00) in which CaDSR1 was silenced every 1 hour.
FIG. 5f shows the results of confirming the change in the amount of ABA after dehydration stress treatment of CaDSR1-silenced pepper plants (TRV2: CaDSR1) and control plants (TRV2: 00).
FIG. 5g shows a significant difference (*) between the CaDSR1-silenced pepper plants (TRV2: CaDSR1) and the control plant (TRV2: 00) .
FIG. 6 shows the results of RT-PCR analysis of CaDSR1 gene expression in CaDSR1-silenced pepper plants. FIG. 6B shows the results of RT-PCR analysis of CaDSR1 gene expression in CaDSR1-overexpressing transgenic Arabidopsis thaliana. The results are shown in Fig. The level of expression of each gene was analyzed by using the leaves of the 4 weeks old Arabidopsis thaliana of 35S :: CaDSR1. In the pepper plants, the third and fourth leaves were removed from the 6 leaf stage plants which removed the root and dehydrated. CaACT1 and the Arabidopsis Actin8 gene were used as controls.
FIG. 7 shows the results of confirming dehydration resistance of the 35S :: CaDSR1 transgenic Arabidopsis plants treated with dehydration stress, wherein FIG. 7a shows the temperature of the leaves taken from the Arabidopsis wild type plants and two independent 35S: CaDSR1 plants FIG. 7B shows the average temperature measured from the three largest rosette leaves, FIG. 7C shows the results of checking the amount of water loss in the leaves of the wild-type plants and 35S :: CaDSR1, 7d shows the results of pore-closure verification induced by 10 μM ABA, FIG. 7e shows the results of dehydration-sensitivity confirmation in the wild-type and 35S :: CaDSR1 plants, FIG. 7f shows the wild type and 35S :: CaDSR1 plants The relative expression level (ΔΔCT) of each gene was normalized using Actin8 as a control gene.

The present inventors have identified the CaDSR1 gene functioning as a negative regulator in the dry stress of the plant and completed the present invention by confirming the increase in resistance to the dry stress in the transgenic Arabidopsis thaliana plant in which the gene is silenced.

Accordingly, the present invention relates to a method for producing CaDSR1 ( Capsicum annuum (SEQ ID NO: 1)) comprising a nucleotide sequence of SEQ ID NO: 1, which encodes a negative regulator protein to a dry stress Drought Sensitive RING finger protein 1) gene.

The gene of the present invention, CaDSR1 , preferably consists of the nucleotide sequence of SEQ ID NO: 1, and the peptide encoded by the CaDSR1 gene preferably comprises the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

As used herein, a " negative regulator protein " refers to a protein that acts in the direction of inhibition in the regulation of life events. That is, the gene of the present invention, CaDSR1, encodes a protein having a function of inhibiting the regulation of the dry stress, and thus, when the CaDSR1 gene is overexpressed, the resistance to ABA sensitivity reduction and drying stress can be reduced.

The present inventors observed a protein interacting with the E3 ligase protein CaDILZ1. As a result, a protein interacting with CaDILZ1, which is a positive regulator of dry stress, was identified. The CaDSR1 was expressed in ABA, (Fig. 2). Therefore, the present inventors sought to determine whether the protein is related to the ABA drying stress response (see Example 2).

First, in one embodiment of the present invention, the expression of the CaDSR1 gene was increased in the leaves of pepper plants treated with ABA, dry, or high salt (see Example 3).

In one embodiment of the present invention, in the case of a pepper plant in which the CaDSR1 gene is silenced by VIGS (Virus Induced Gene Silencing) technique, the pore is closed due to the hypersensitivity to ABA, and the rate of transpiration is suppressed, (Resistance) significantly (see Example 4). In addition, overexpression of the CaDSR1 gene in Arabidopsis has shown that the CaDSR1 protein acts as a negative regulator of ABA signal transduction by confirming that the resistance to dry, osmotic, and high salt stress is significantly reduced (see See Example 5).

Therefore, by suppressing the expression or activity of the CaDSR1 protein, resistance to the dry stress (resistance) of the plant can be enhanced. Accordingly, in another aspect of the present invention, And a composition for promoting dryness resistance of a plant.

In the present invention, the plant (sieve) is a food crop including rice, wheat, barley, corn, soybean, potato, red bean, oats, sorghum; Vegetable crops including Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Special crops including ginseng, tobacco, cotton, sesame seed, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots, and bananas; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies, tulips; And feed crops including rice, red clover, orchardgrass, alpha-alpha, tall fescue, perennialla grass, and the like, most preferably, but not limited to, Arabidopsis thaliana or red pepper.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Example  1. Experimental Preparation and Experimental Methods

1-1. Plant materials and growth conditions

Capsicum annuum L., cv. Nockwang) and tobacco ( Nicotiana benthamiana seeds were grown in steam sterilized blended soil (peat moss: perlite: vermiculite = 5: 3: 2, v / v / v), sand, and loam soil 1: 1: 1 (v / v / v). Then the pepper plants were grown in a 24 ± 1 ° C room with a white fluorescence intensity of 130 μmol photons m ^-2 S ^-1 for 16 hours per day. Arabidopsis thaliana : ecotype Col-0) seeds were germinated in MS (Murashige and Skoog) salt supplemented with 1% sucrose and Microagar (Duchefa Biochemie). The Arabidopsis seedlings were grown under the same conditions as pepper in steam sterilized blended soil (peat moss: perlite: vermiculite = 9: 1: 1, v / v / v)

1-2. Virus-induced gene silencing ( VIGS )

Tobacco rattle virus (TRV) -based virus-induced gene silencing (VIGS) system was used to knockdown the CaDSR1 gene in pepper.

Agrobacterium tumefaciens strain GV3101 carrying pTRV1 and pTRV2: CaDSR1 or pTRV2: 00 as negative control was infiltrated into fully grown cotyledons of pepper plants (OD ₆₀₀ = 0.2). The plants were placed in a growth chamber set at 24 ° C for 16 hours / 8 hours at night to allow growth and virus propagation.

1-3. CaDSR1  Production of transgenic Arabidopsis overexpressed genes

CaDSR1 cDNA (accession no. KT693386) was inserted into a pENTR / D-TOPO vector (Invitrogen, Carlsbad, CA, USA). After the LR reaction, the gene cloned under the control of CaMV (cauliflower mosaic virus) 35S promoter was introduced into pK2GW7 to essentially express each gene. Each precise construct was introduced into Agrobacterium strain GV3101 by electroporation. All mutations used in the present invention are based on Col-0, and the floral dip method is CaDSRl (Clough & Bent, Plant Journal 16, 735-743, 1998). Transgenic lines were selected by germination of the estimated mutant seeds on MS medium supplemented with kanamycin 50 μg · mL ^-1 . T3 plant seeds were harvested from a second generation transgenic plant with a 3: 1 dissociation ratio in MS medium containing the same antibiotic.

1-4. ABA, dehydration, and High salt  process

To analyze the phenotype of CaDSR1 gene in pepper plants treated with ABA, NaCl, and dehydrated environment, leaf samples were sprayed with 100 μM ABA on six-leaf-stage red pepper plants, irrigated with salt solution (200 mM) Carefully removed from the soil, then dried in 3MM paper (Whatman, Clifton, UK), or only the top part of the pepper plant was dried. After treatment, the third and fourth leaves were harvested at the specified time.

For dehydration tolerance analysis, 4 weeks of gene silencing or control plants, and 3 weeks of transgenic Arabidopsis and wild type plants were randomly assigned and dry stress was given by stopping the water cycle for 10 and 12 days. After 5 days of rehydration, the survival rate was calculated by counting the number of plants with rehydrated leaves. To quantitatively measure dry tolerance, water loss rates were measured by drying leaves removed from the genetically silenced pepper plants and transgenic Arabidopsis plants. Leaves were placed in a growth chamber with 40% humidity, loss of fresh weight was measured at the indicated time, and all experiments were repeated three times.

For qRT-PCR analysis, 4-week-old 35S :: CaDSRl mutants and wild-type plants were isolated from the soil to treat dehydration stress and harvested at the given time after treatment.

1-5. Stomatal aperture  Biological assay

For biological assays of pore openings, leaf peel was removed from rosette leaves of 4 weeks old Arabidopsis thaliana plants, the first round of second harvest was harvested and stomatal opening solution (SOS: 50 mM KCl, 10 mM MES-KOH, pH 6.15, 10 mM CaCl 2). Pore confinement was induced by replacing SOS with various concentrations of ABA. After 2.5 hours of incubation, 100 pores were randomly observed with a Nikon eclipse 80i microscope, and the width and length of each pore was recorded using Image J 1.46r. The experiments were performed independently each three times.

1-6. Ten Imaging method (Thermal imaging)

Four-week-old pepper plants with fully grown primary and secondary leaves were treated with 50 μM ABA, and 3-week-old Arabidopsis plants were subjected to drying stress by removing their roots. Thermal images were obtained using an infrared camera (FLIR systems; T420), and plant leaf temperatures were measured using FLIR Tools + ver 5.2 software.

1-7. RNA isolation and qRT - PCR (quantitative reverse transcription-polymerase chain reaction)

Total RNA was isolated from leaves of Arabidopsis and pepper plants subjected to dry stress or ABA treatment and subjected to qRT-PCR.

Total RNA isolation was performed using RNeasy Mini kit (Qiagen, Valencia, CA, USA) and harvested from ABA or dehydrated stressed red pepper and Arabidopsis leaves. All isolated RNA samples were lysed with RNA-free DNase to remove genomic DNA and used as templates for cDNA synthesis using Transcript First Strand cDNA synthesis kit (Roche, Indianapolis, IN, USA). For qRT-PCR analysis, the cDNA synthesized by the above method was amplified using a CFX96 ™ Touch ™ Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) with iQ ™ SYBR Green Supermix and the specific primers shown in Table 1 below. . All reactions were performed in triplicate and PCR was performed with a 45-cycle program at 95 ° C for 5 minutes, 95 ° C for 20 seconds, 60 ° C for 20 seconds, 72 ° C for 20 seconds. The relative expression level of each gene was calculated by the ΔΔCt method, and the Arabidopsis actin8 ( AtACT8 ) gene and the pepper actin 1 (Ca ACT1 ) gene were used for normalization.

Primer name Primer sequence (5'-3 ') sequence for cloning CaDILZ1 Forward: ATGGCTAGTCAAGGAATAGGAGAGA (CA06g22960) Reverse: TCAGAAATTTGAGAAGTGGTTCTGAG CaDSR1 Forward: ATGACTCGTCCACTTAGGTTTCTAC (ALF95051) Reverse: CTACGCCGGCGGTGTAAC CaDSR1  1-56 Reverse: TACAACGATGAGACCTGAGACGC CaDSR1  57-184 Forward: ATGGCTCGGTGTACTTGGCTC Sequence for RT-PCR CaDILZ1 Forward: ATGGCTAGTCAAGGAATAGGAGAGA Reverse: CTGCTGCTGCTGCATATAAAGATG CaDSR1 Forward: AACCACTAATTCCTCCACTACTTCG Reverse: GGTAAAGTCTTCAAAGCCTTCTTCT CaACT1 Forward: GACGTGACCTAACTGATAACCTGAT (CA12g08730) Reverse: CTCTCAGCACCAATGGTAATAACTT CaNCED3 Forward: TTAAGGATCTTAAGCGTGGTTATGT (CA08g03620) Reverse: AGATTAGTTCAAGAACGTGAATTGG CaRD29B Forward: ATGGAGGCACAACTGCACCGTC (CA03g17780) Reverse: GGCCCACCATGAACTTCTGCAC AtActin8 Forward: CAACTATGTTCTCAGGTATTGCAGA (At1g49240) Reverse: GTCATGGAAACGATGTCTCTTTAGT NCED3 Forward: ACATGGAAATCGGAGTTACAGATAG (At3g14440) Reverse: AGAAACAACAAACAAGAAACAGAGC RAB18 Forward: GGAAGAAGGGAATAACACAAAAGAT (At5g66400) Reverse: GCGTTACAAACCCTCATTATTTTTA RD29B Forward: GTTGAAGAGTCTCCACAATCACTTG (At5g52300) Reverse: ATACAAATCCCCAAACTGAATAACA VIGS XbaI-CaDILZ1 Forward: TCTAGAATGGCTAGTCAAGGAATAGGA XhoI-CaDILZ1 Reverse: CTCGAGCTGTTGGAATCTCATAGGC XbaI-CaDSR1 Forward: TCTAGAATGACTCGTCCACTTAGGTTTC XhoI-CaDSR1 Reverse: CTCGAGGAGTAATTGAATTTGGTAAA

1-8. Measurement of ABA amount

The amount of ABA was harvested 2 hours and 4 hours after dehydration of red pepper and Arabidopsis plants, and about 50 mg of basic tissue was used for ABA extraction. The amount of ABA in each sample was quantified using a Phytodetek-ABA kit (Agdia Inc., Elkhart, IN, USA), and the amount of ABA was expressed as tissue weight (pmol mg ^-1 ).

1-9. Subcellular localization analysis

The GFP-labeled CaDILZ1, CaDSR1, and truncated CaDSR1 were transiently expressed in the N. benthamiana plant through the introduction of the Agrobacterium strain. Agrobacterium strain GV3101 carrying each construct was mixed with the p19 strain at a ratio of 1: 1 (OD600 = 0.5), and a fully grown 5-week-old tobacco ( N. benthamiana ) The plant was infiltrated. On the third day after infiltration, the GFP signal was observed with a confocal microscope (510 UV / Vis Meta; Zeiss, Oberkochen, Germany) equipped with LSM Image Browser software.

1-10. Yeast two-hybrid assay, Y2H )

Y2H analysis was performed in a generally known manner (Lim & Lee, Plant Cell Environ 39, 1559-1575, 2016). The coding sequence of the CaDILZ1 gene (base sequence: SEQ ID NO: 3, amino acid sequence: SEQ ID NO: 4) or the CaDSR1 gene was subcloned into the pGBKT7 or pGADT7 vector and used as a yeast cell line using the lithium acetate-regulated transfer method (Ito et al. Was introduced into strain AH109. Interaction between bait and prey was assessed by selection of transgenic candidates in SC-leucine-tryptophan and SC-adenine-histidine-leucine-tryptophan medium.

1-11. 4 molecules  Bimolecular fluorescence complementation ( BiFC ) assay)

BiFC assays were performed as previously described (Lim & Lee, Plant Cell Environ 39, 1559-1575, 2016). To generate BiFC constructs, CaDILZ1, the full-length DNA of CaDSR1 and the truncated, Pro35S :: VYNE and Pro35S :: CYCE vectors, and gene introduction and microscopic analysis were performed as described above.

1-12. Purification of recombinant proteins and in vitro ubiquitination  assay

GST-labeled CaDILZl and MBP-labeled recombinant CaDSRl and amino acid replacement mutants were expressed in CaDSRl ^C112S protein bacterial cells (Park et al., Plant Cell Physiol 56, 1808-1819, 2015). The DNA sequences coding for the CaDILZl and CaDSR1Δ1-56 proteins were inserted into the GEX4T-3 vector (GE Healthcare Bio-Sciences, Uppsala, Sweden) and the pMAL-c2X vector (New England Biolabs) Respectively. Recombinant GST and MBP-labeled proteins were expressed and purified according to the manufacturer's instructions.

For the in vitro ubiquitination assay, purified MBP-labeled CaDISR1 (500 ng) was incubated with recombinant human UBE1 (Boston Biochemiclas, Cambridge, Mass., USA), his-tagged recombinant Arabidopsis E2s, and sowubiquitin (Sigma-Aldrich) (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 0.05 mM ZnCl ₂ , 1 mM Mg-ATP, 0.2 mM DTT, 10 mM phosphocreatine, and 0.1 unit of creatine kinase (Sigma-Aldrich)] and incubated at 30 ° C for 3 hours. To confirm that CaDSR1 regulates ubiquitination of CaDILZl, GST-labeled CaDILZl fusion protein (50 ng) as a substrate was added to the ubiquitin mixture and the mixture was incubated for 2 hours. The reacted proteins were separated by SDS-PAGE and analyzed by immunoblotting with anti-Ub, anti-MBP, and anti-GST antibodies.

1-13. Cell-free degradation assay

The crude protein extract was extracted with 4-week-old pepper plants using extraction buffer [25 mM Tris-HCl (pH 7.5), 10 mM MgCl ₂ , 5 mM dithiothreitol, 0.1% Triton X-100, 10 mM ATP, and 10 mM NaCl] It was prepared from leaves. The GST-labeled CaDILZ1 fusion protein (500 ng) was incubated with the original protein extract (50 μg total protein) for 1 hour and 3 hours, and at the same time incubated for 3 hours in the presence of 50 μM of MG132. Proteolysis was measured by immunoblotting using anti-GST and anti-Ub antibodies.

1-14. Statistical analysis

Statistical analysis was performed using student's t-test or ANOVA (Fisher's LSD test) to determine significant differences between genotypes. P value was less than 0.05.

Example  2. Pepper Ring finger E3 ligase CaDSR1 and Of CaDIZL1  Confirm interaction

Capsicum annuum Drought-Induced Leucine Zipper 1 (CaDILZ1), a red pepper bZIP transcription factor protein, functions as a positive regulator of plant dry stress. Therefore, we sought to investigate proteins that affect the degradation of the positive regulator CaDILZ1.

In order to identify CaDILZ1 interacting with degradation affecting proteins as described above, Y2H screening was performed using CaDILZ1 protein as a bait and prey as a cDNA library prepared from dehydrated pepper leaves. Analysis of the interacting partners including CaDSR1 (Fig. 1A) revealed that Ring type E3 ligase is involved in post-translational modification and proteolysis, and CaDSR1 was analyzed by the following analysis.

Analysis of the CaDSRl protein confirmed that the putative CaDSRl cDNA consisted of a 558-bp open reading frame encoding 185 amino acid residues (Figure 2). The presumptive protein encoding CaDSR1 conserved the C3H2C3 type Ring finger motif (residues 108-151) in the C-terminal region and the hydrophobic region in the N-terminal region (Fig. 1C). Ring finger motif is essential for E3 ligase activity in the ubiquitin-26S proteasome system, and the hydrophobic region is presumed to be related to the intracellular location of CaDSR1. To confirm if CaDSRl interacts with CaDILZl, a one-by-one Y2H assay was performed (Fig. 1d) and a bimolecular fluorescence complementarity assay was performed (Fig. Coexpression of CaDSR1-CYCE and CaDILZ1-VYNE resulted in pronounced yellow fluorescence in the nucleus.

3, the interaction of CaDILZ1 with CaDSR1 was confirmed in the nucleus using the BiFC assay. VYNE :: CaDILZ1 was coexpressed with CYCE :: CaDSR1C112S, CYCE :: CaDSR1 1-56, and CYCE :: CaDSR1 57-184 in leaves of tobacco plants using agroinfiltration, and CYCE :: empty as a control Respectively. For nuclear localization, the cells were stained with 4 ', 6-diamidino-2-phenylindole (DAPI) and the yellow fluorescent signal indicates the interaction between the partner proteins (white bar = 20 μm).

To determine the intracellular location of CaDSR1 in plant cells, fusion proteins of CaDTR1 and GFP genes were prepared under the control of the 35S promoter. Transient expression of the 35S: CaDSRl-GFP construct showed that the CaDSRl protein is located in the nucleus (Fig. 1f). (Amino acids: 1-56) -GFP and 35S: CaDSR1C ΔN-term (amino acids: 57-184) -GFP constructs in order to confirm that the hydrophobic region functions in the intracellular position of CaDSR1 Were used for the deletion analysis. The fluorescent signal of the CaDTR1? C-term is detected in the nuclear membrane and the CaDSR1C? N-term-GFP fusion protein is located in the nucleus and cytoplasm, meaning that the hydrophobic region is essential for intracellular localization of the CaDSR1 protein in the nucleus. In order to measure the expression level of CaDSR1 in leaves, stems, roots and flower tissues, RT-PCR analysis was performed (Fig. 1g) and CaDSR1 was found to be constitutively expressed in the tissues. The expression of CaDILZ1 was upregulated by abiotic stresses, confirming whether CaDSR1 is involved in ABA signaling and abiotic stress responses. To confirm the expression level of CaDSR1 under abiotic stress conditions, semi-quantitative RT-PCR analysis was performed (Fig. 1h) with ABA, dry and high heat treatment on the leaves and the results showed that transcription of CaDSR1 resulted in ABA, And accumulated by the treatment.

Example  3. E3 ligase  Active and Of CaDILZ1 On ubiquitinization  there is Of CaDSR1  Verify features

In vivo ubiquitination analysis was carried out using purified CaDSR1-MBP fusion protein to confirm that CaDSR1 functions as an E3 ligase, since the proteins including the ring finger domain have E3 ubiquitin ligase activity. In addition, a mutant fusion protein (mCaDSR1-MBP) with point mutation of the major residue Cystein to Serine in the RING domain was prepared. These fusion proteins were UBE1 (E1), UBCH5b (E2) and ubiquitin, respectively, cultured. The reaction mixture was analyzed by immunoblot analysis using anti-MBP and anti-ubiquitin antibodies (FIG. 4A). The formation of the polymer smearing band was confirmed in lanes of CaDSR1-MBP but not in mCaDSR1-MBP, so CaDSR1 is able to function as E3 ubiquitin ligase, and the RING domain is essential for ligase activity to be.

The interaction between CaDILZ1 and CaDSR1 indicates that CaDSR1 is a substrate for CaDILZ1, and CaDSR1 is able to act as an E3 ligase using CaDILZ1 as a substrate. Glutathione S-transferase-tagged CaDILZl (GST-CaDILZl) was expressed in E. coli and used for ubiquitination assay (Fig. 4b). As a result, CaDILZ1 was found to be polyubiquitinated by CaDSR1 in the presence of UBE1 (E1) and UBCH5b (E2), indicating that CaDSR1 is an upper signal of CaDILZ1 which is a positive of dry stress.

Example  4. CaDSR1 Silent  Drying from pepper plants Increased tolerance to stress  Confirm

To confirm the conclusions of the above examples, the biological function of CaDSR1 was confirmed by preparing VIGS analysis of pepper plants and transgenic Arabidopsis thaliana (FIG. 5).

RT-PCR analysis showed that the expression of CaDSR1 was significantly lowered in CaDSR1-silenced pepper plants, and the interaction between CaDILZ1 and CaDSR1 and the CaSIL1-induced ubiquitination of CaDILZ1 indicated that the stability of CaDILZ1 was due to ubiquitin-26S proteasome It is implied that it is regulated by pathways. In order to confirm this possibility, intracellular cell-free degradation analysis was performed on CaDSR1 in silenced pepper plants (FIG. 5b).

The transpiration is caused by the pore. The results of the leaf temperature measurement and the pore size measurement are shown in Figs. 5C to 5F to confirm whether CaDSR1 plays a role in regulating pore opening. Leaf temperature and pore size without ABA treatment were not different between CaDSR1-silenced pepper plants and non-silenced pepper plants. However, when 20 μM ABA was treated, the temperature of leaves silenced by CaDSR1 was not silenced (Fig. 5C and Fig. 5D). In addition, the CaDSR1 silenced pepper plants exhibited broad pore opening compared to the non-silenced plants (Fig. 5e and Fig. 5f). To determine if CaDSR1 affects plant response to dry stress, both plants were subjected to a dry stress (Figure 5g) by stopping the 12 day water cycle and rehydrating for 5 days. The CaDSR1-silenced pepper plants exhibited a high resistance phenotype, respectively, in dry conditions (middle panel of FIG. 5g) and rehydration conditions (right panel of FIG. 5g), respectively, than non-silenced plants. The survival rate was 65.8% higher in the CaDSR1 silenced pepper plants compared to 9.2% in the non-silenced plants. This indicates that the function of CaDSR1 is related to the drying reaction regulated by ABA.

Example  5. Ca DSR1 Identification of increased resistance to dryness by gene overexpression

To confirm the role of CaDSR1 in dry stress, the CaDSR1-overexpressing (CDIR1-OX) transgenic Arabidopsis plants were prepared. Semi-quantitative RT-PCR analysis showed that the expression of CaDSR1 was detected in independent T3 homozygous transgenic lines (# 1 and # 2) (Figure 6a) and dehydrated stress was applied to wild type and CaDSRl- The temperature was measured (Figs. 7A and 7B). Before the dehydration treatment, the leaf temperature of the two plants did not differ (Fig. 7B). However, when dehydrated, transgenic plant lines # 1 and # 2 exhibited leaf temperatures of 22.5 ° C and 22.6 ° C, respectively, indicating that wild-type plants were significantly lower than those at 23.0 ° C. The rosette leaves were removed, and the water loss was measured. Similar to the leaf temperature, it was confirmed that the leaves of the plants overexpressing CaDSR1 had more water loss than the wild type (FIG. 7C). Then, pore openings were observed when ABA was treated or not treated. Similar to the leaf temperature measurement, no difference was found in the pore opening when the ABA was not treated, but it was confirmed that the pore of the CaDSR1 overexpressing leaf was larger than the wild type pore when the ABA was treated (Fig. 7d).

As described above, ABA plays an important role in controlling pore opening in various environmental stresses. CaDSRl overexpressing plants have low sensitivity to ABA and show high water loss in leaf tissues, which implies that they are associated with dry stress. A phenotypic analysis of the soil drying stress of CaDSRl-overexpressing plants was performed to check the theory (Fig. 7e). The 3-week-old plant (Fig. 7e, left panel) was exposed to drying stress for 10 days (Fig. 7e, middle panel) and rehydrated for 5 days (Fig. 7e, right panel). The CaDSR1 overexpressed plants showed a wilted phenotype compared to the wild type plants, and the survival rate of the CaDSR1 overexpressing plants was about 12 to 16% as compared with 88% of the wild type plants. QRT-PCR analysis was performed with the RAB18, RD29B, and NCED3 genes (Fig. 7f) to determine whether the dry-sensitive phenotype was expressed by changes in the level of dry response gene expression. Expression levels of these genes in CaDSRl-overexpressing plants were lower than in wild-type plants. The amount of lozenge and ABA was measured (Fig. 7g). Similar to the expression level of NCED3 gene, ABA in CaDSR1 leaf was less accumulated than wild type leaf. These results suggest that the dry sensitive phenotype of CaDSR1 overexpressing plants accumulates less ABA.

In the present invention, it was confirmed that the new C3H2C3 type RING E3 ligase CaDSR1 acts as a negative regulator in the dry stress response. In addition, CaDSR1 directly ubiquitinates CaDILZ1 and subsequently leads to protein degradation of CaDILZ1. First, CaDSR1-silenced pepper plants display a dry tolerance phenotype with higher ABA levels, while overexpressed plants can accumulate lower ABA levels associated with the dry-sensitive phenotype. In addition, CaDSR1 can ubiquitinate CaDILZ1 when using in vitro ubiquitination assays.

In addition, it is known that the expression level of ABA-dependent stress related to the stress-related gene is related to the dry stress tolerance, and the present invention can confirm the change of the stress-related gene including the NCED3 gene. Under water-poor conditions, NCED3 functions predominantly in ABA biosynthesis, which plays an important role in adapting to plant dry stress. Abiotic stress conditions, such as drying and high salinity, increase the cellular level of ABA levels through the induction of ABA biosynthetic genes, including NCEDs. Upregulation of NCED3 gene expression and ABA levels in CaDILZl overexpressing plants induces ABA and contributes to dry tolerance.

In other words, the function of CaDSR1 is related to that expressed by two mechanisms by the induction of ABA and the amplification of ABA signal. RING-type E3 ligase CaDSR1 serves as a negative regulator in the response to dry stress, And is located at the top of CaDILZ1. The results of the present invention provide a valuable insight into the defensive response acting during the dry stress signal and may enable selective adaptation to the drying stress. That is, the present invention can suggest a new method of regulating the dry stress response by CaDSR1 in plants.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention. There will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving the resistance to the drought stress using          pepper E3 ligase CaDSR1 in plants <130> MP16-451 <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 555 <212> DNA <213> Capsicum annuum Drought Sensitive RING finger protein 1_CaDSR1 <400> 1 atgactcgtc cacttaggtt tctactaacc actaattcct ccactacctc gccgccgtcg 60 atggcaacgg cggagccacc gtcagtcgcg gcagcagaat ccgacttcgt cgtcattctc 120 tcggtgtag tggctccggc gagactcgcc ggaaaatgca cagccgccgg taaaaatcaa aggcttaaag 240 aagaaggctt tgaagacttt accaaaattc aattactctc ccggcaccgg tggtaccgac 300 ggcgacggtg acggtgacgg cgagtgtgca atttgtcttg tggaatatgt tgaaggagat 360 gaaattcgag tgttgccaaa ttgtggccat cggttccacg tattgtgtgt cgacacgtgg 420 cttttatcga actcgtcatg tccgtcgtgt cgacggacac tcgtcgttgc tcgtgctcgg 480 tgccggaagt gcggcgaagt tccggcaatc tccggcgagt cttctgacgg atgtccggtt 540 acaccgccgg cgtag 555 <210> 2 <211> 184 <212> PRT <213> Capsicum annuum Drought Sensitive RING finger protein 1_CaDSR1 <400> 2 Met Thr Arg Pro Leu Arg Phe Leu Leu Thr Thr Asn Ser Ser Thr Thr   1 5 10 15 Ser Pro Pro Ser Met Ala Thr Ala Glu Pro Pro Ser Val Ala Ala Ala              20 25 30 Glu Ser Asp Phe Val Ile Leu Ala Ala Leu Leu Cys Ala Val Ile          35 40 45 Cys Val Ser Gly Leu Ile Val Val Ala Arg Cys Thr Trp Leu Arg Arg      50 55 60 Asp Ser Pro Glu Asn Ala Gln Pro Pro Val Lys Ile Lys Gly Leu Lys  65 70 75 80 Lys Lys Ala Leu Lys Thr Leu Pro Lys Phe Asn Tyr Ser Pro Gly Thr                  85 90 95 Gly Gly Thr Asp Gly Asp Gly Asp Gly Asp Gly GIy Cys Ala Ile Cys             100 105 110 Leu Val Glu Tyr Val Glu Gly Asp Glu Ile Arg Val Leu Pro Asn Cys         115 120 125 Gly His Arg Phe His Val Leu Cys Val Asp Thr Trp Leu Leu Ser Asn     130 135 140 Ser Ser Cys Pro Ser Cys Arg Arg Thr Leu Val Val Ala Arg Ala Arg 145 150 155 160 Cys Arg Lys Cys Gly Glu Val Pro Ala Ile Ser Gly Glu Ser Ser Asp                 165 170 175 Gly Cys Pro Val Thr Pro Pro Ala             180 <210> 3 <211> 1509 <212> DNA <213> Capsicum annuum Drought-Induced Leucine Zipper 1_CaDILZ1 <400> 3 atggctagtc aaggaatagg agagactggt ttgacagact ctggaccatc atcacattca 60 caccataacc acaatatgcc atatgctgtt tataggggga taaatcctgc tagcacaagt 120 ttcattaatc aagaaagttc tggttttgat tttggagagc tagaagaagc ttttgtacta 180 caaggattta agattagtaa tgatgaagct aaagcatctt tatatgcagc agcagcagcc 240 acagggaaac ctgctgcaac tctggagatg ttcccttctt ggcctatgag attccaacag 300 accccaagag agaagtcaaa atcaagagaa gagagtactg attctggttc actttcaagt 360 agagttcaac cccatttaga gccagaatca cccatcagta gaaaggcatc ttcagaccat 420 caacaaaatc aacttcacat aacacacaaa tctcaagaac agcaacagca actccaaaat 480 atggcaagta ataatccaag aacaggaggt ttacaaactg aactagcagc ttccaaatcc 540 aacagtgaaa agaaaaaggg tgctgcttca acttcagaga gggtacttga tccaaagaca 600 ttgagacgtt tagctcaaaa tagagaagca gcaaagaaaa gcaggataag aaaaaaagct 660 tatgtacaac agcttgaaac aagtaggatg agactttctc agctagaaca agaacttcaa 720 agggctagct ctcaggggat tttcttggga ggtggtacta ctgctggttc caatatcagc 780 tcaggtgctg caatatttga catggaatat tcaaggtggt tggatgatga tcaaaggcac 840 atgtccgaac ttcgaactgc attacaagca catttatcag atggtgatct tagactaata 900 gttgatggat acattgctca ttacgacgaa attttctgcc tgaaaggagt ggcagcaaaa 960 tctgatgtat ttcatttaat tactggaatg tggacaactc cagctgaacg ttgcttcctt 1020 tggatgggtg gttttaggcc ttctgagctg atcaagatgt tgataggaca attggaccct 1080 ttaacagagc aacaagtagt tggaatatac agcctccagc aatcttctca acaggcagag 1140 gatgcacttt cacagggatt ggaacaacta caacaatctt taattgatac tattgccact 1200 gcttctctac atgatggcat gcatcatatg gctcttgctt taggcaagct ctccaatctt 1260 gaaggatttg ttcgtcaggc tgataatttg agacaacaaa cattgcatca gttacacaga 1320 atattgacag ttaggcaagc agccagatgt ttcttggtga ttggagaata ctatggtcga 1380 ctacgagctc taagttctct atggttatct cgtccacgag agacattgat cgtggatgat 1440 aattcatgtc aaacaataac ggggttacaa atggtacaat cttctcagaa ccacttctca 1500 aatttctga 1509 <210> 4 <211> 502 <212> PRT <213> Capsicum annuum Drought-Induced Leucine Zipper 1_CaDILZ1 <400> 4 Met Ala Ser Gln Gly Ile Gly Glu Thr Gly Leu Thr Asp Ser Gly Pro   1 5 10 15 Ser Ser His Ser His His Asn His Asn Met Pro Tyr Ala Val Tyr Arg              20 25 30 Gly Ile Asn Pro Ala Ser Thr Ser Phe Ile Asn Gln Glu Ser Ser Gly          35 40 45 Phe Asp Phe Gly Glu Leu Glu Glu Ala Phe Val Leu Gln Gly Phe Lys      50 55 60 Ile Ser Asn Asp Glu Ala Ala  65 70 75 80 Thr Gly Lys Pro Ala Ala Thr Leu Glu Met Phe Pro Ser Trp Pro Met                  85 90 95 Arg Phe Gln Gln Thr Pro Arg Glu Lys Ser Lys Ser Arg Glu Glu Ser             100 105 110 Thr Asp Ser Gly Ser Leu Ser Ser Arg Val Gln Pro His Leu Glu Pro         115 120 125 Glu Ser Pro Ile Ser Arg Lys Ala Ser Ser Asp His Gln Gln Asn Gln     130 135 140 Leu His Ile Thr His Lys Ser Gln Glu Gln Gln Gln Gln Leu Gln Asn 145 150 155 160 Met Ala Ser Asn Asn Pro Arg Thr Gly Gly Leu Gln Thr Glu Leu Ala                 165 170 175 Ala Ser Lys Ser Asn Ser Glu Lys Lys Lys Gly Ala Ala Ser Thr Ser             180 185 190 Glu Arg Val Leu Asp Pro Lys Thr Leu Arg Arg Leu Ala Gln Asn Arg         195 200 205 Glu Ala Ala Lys Lys Ser Arg Ile Arg Lys Lys Ala Tyr Val Gln Gln     210 215 220 Leu Glu Thr Ser Arg Met Arg Leu Ser Gln Leu Glu Gln Glu Leu Gln 225 230 235 240 Arg Ala Ser Ser Gln Gly Ile Phe Leu Gly Gly Gly Thr Thr Ala Gly                 245 250 255 Ser Asn Ile Ser Ser Gly Ala Ala Ile Phe Asp Met Glu Tyr Ser Arg             260 265 270 Trp Leu Asp Asp Asp Gln Arg His Met Ser Glu Leu Arg Thr Ala Leu         275 280 285 Gln Ala His Leu Ser Asp Gly Asp Leu Arg Leu Ile Val Asp Gly Tyr     290 295 300 Ile Ala His Tyr Asp Glu Ile Phe Cys Leu Lys Gly Val Ala Ala Lys 305 310 315 320 Ser Asp Val Phe His Leu Ile Thr Gly Met Trp Thr Thr Pro Ala Glu                 325 330 335 Arg Cys Phe Leu Trp Met Gly Gly Phe Arg Pro Ser Glu Leu Ile Lys             340 345 350 Met Leu Ile Gly Gln Leu Asp Pro Leu Thr Glu Gln Gln Val Val Gly         355 360 365 Ile Tyr Ser Leu Gln Gln Ser Ser Gln Gln Ala Glu Asp Ala Leu Ser     370 375 380 Gln Gly Leu Glu Gln Leu Gln Gln Ser Leu Ile Asp Thr Ile Ala Thr 385 390 395 400 Ala Ser Leu His Asp Gly Met His His Met Ala Leu Ala Leu Gly Lys                 405 410 415 Leu Ser Asn Leu Glu Gly Phe Val Arg Gln Ala Asp Asn Leu Arg Gln             420 425 430 Gln Thr Leu His Gln Leu His Arg Ile Leu Thr Val Arg Gln Ala Ala         435 440 445 Arg Cys Phe Leu Val Ile Gly Glu Tyr Tyr Gly Arg Leu Arg Ala Leu     450 455 460 Ser Ser Leu Trp Leu Ser Arg Pro Glu Thr Leu Ile Val Asp Asp 465 470 475 480 Asn Ser Cys Gln Thr Ile Thr Gly Leu Gln Met Val Gln Ser Ser Gln                 485 490 495 Asn His Phe Ser Asn Phe             500

Claims (4)

A composition for enhancing the dry stress resistance of a plant, comprising as an active ingredient an expression or activity inhibitor of CaDSR1 ( Capsicum annuum Drought Sensitive RING finger protein 1) protein. The method according to claim 1,
Wherein the CaDSRl protein comprises the nucleotide sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2. A recombinant VIGS (Virus Induced Gene Silencing) vector comprising an ORF (open reading frame) of a gene encoding CaDSR1 (Capsicum annuum Drought Sensitive RING finger protein 1) protein. A method for promoting dryness resistance of a plant comprising transforming a plant with the vector of claim 3 and silencing CaDSRl (Capsicum annuum Drought Sensitive RING finger protein 1) gene.

Images