KR20170121468A - Composition for regenerating skin tissue comprising extract of citrus preicarp - Google Patents

Abstract

The present invention provides a composition for regenerating skin tissue, comprising an extract of the pericarp of a citrus fruit as an effective component, wherein the extract of the pericarp of a citrus fruit contains nobiletin and tangeretin. The effective component of the composition, the extract of the pericarp of a citrus fruit is derived from natural plants, and thus does not cause side effects on human skin, and shows an excellent regeneration effect on skin tissue. Further, the extract of the pericarp of a citrus fruit, as the effective component of the composition according to the present invention and a predetermined flavonoid compound may be used together to create a synergistic effect, thereby maximizing the effect of skin tissue regeneration. Accordingly, the composition according to the present invention may be utilized as drug, cosmetic product, and personal-care product for regenerating skin tissue damaged by inflammatory response or abrasion.

Description

TECHNICAL FIELD The present invention relates to a composition for regenerating skin tissue containing citrus peel extract,

TECHNICAL FIELD The present invention relates to a composition for regenerating skin tissue, and more particularly, to a composition containing a natural extract as an effective ingredient to effectively regenerate skin tissue harmless to human skin and damaged by an inflammatory reaction or the like.

The skin consists of the epidermis, the dermis and the subcutaneous tissue. The outer skin of the skin consists of a stratified squamous epithelium, which acts as a protective barrier against the external environment. The epidermis is divided from the outside into stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum and stratum basale. The dermis is the layer between the epidermis and the subcutaneous tissue. It is divided into the papillary dermis and the reticular dermis. The dermis is composed of blood vessels, collagen, elastin fibers, pores, lipids, sebaceous glands, Sensory nerves, fibroblasts, and macrophages, and they occupy the largest portion of the skin. The dermis consists mainly of collagen and elastin fibers, which play a role in supporting the skin. Therefore, when such a dermis is troubled, wrinkles occur and skin elasticity is lost and the skin ages. Collagen is known to play the most important role in skin regeneration, skin moisture content, wound healing and wrinkle improvement, and is produced from fibroblasts. Collagen has a function to contain a large amount of water, and serves to supply moisture to the dermis. When aging occurs, collagen's water-containing function is deteriorated and wrinkles are increased. Collagen also causes wound healing by filling the wound with continuous collagen production of fibroblasts when a wound is developed.

Such skin is known to be aged due to cell deformation, active oxygen radicals, accumulation of toxic substances and deformation of the skin gap constituent protein. Despite numerous studies on its precise cause, , And the results of the aging result from the formation of wrinkles, decrease in elasticity, and formation of spots in the skin. In addition, the scar is not left even when the skin is damaged at the time of childhood, but when the skin is damaged due to age, the scar is left because the degree of proliferation of the skin keratinocyte and metastasis- Which is significantly lower than that of the others. That is, as the aging progresses, the degree of proliferation of the above-mentioned cells is lowered, and the skin regenerating ability is decreased, so that the recovery of wounds and the like may be delayed and the skin elasticity may be worsened. In order to prevent this phenomenon and to maintain healthier and more resilient skin, it is possible to maintain the natural function of skin by using the cosmetic material strengthened with physiologically active substances obtained from various animals, plants, microorganisms, etc., Efforts are being continued to effectively inhibit and promote skin regeneration.

In recent years, laser therapy or skin rinsing has been performed for the purpose of treating beauty or disease. Laser therapy is the treatment of light of a single wavelength by using the properties of radiation transmission and absorption energy transfer. In the sense of a single wavelength, the treatment laser has many kinds depending on the wavelength band and the energy emitting method. That is, the treatment laser is different for each disease. When the laser beam hits the body, it turns into heat, and the part absorbed by heat rises in temperature, and when the temperature exceeds 40 degrees, protein denaturation starts. If the blood coagulation degree is above 68 degrees, the blood coagulation will be carbonized or increased if it is above 100 degrees. On the other hand, below 40 degrees Celsius, cell tissue is activated and blood circulation and metabolism become better and higher. Treatment with light stimuli less than 40 degrees is called low response laser therapy and heat stimulation more than 40 degrees is called high response laser therapy. Peeling is a procedure in which a part of skin is peeled to various degrees depending on the type of peeling using chemicals or lasers to induce the formation of new epidermis and to stimulate the production of collagen fibers of the dermis. Acne, scars, wrinkles, pigmented lesions, and wider pores. The classification according to the peeling method includes chemical peeling which peels the skin using chemicals and laser peeling which peels the skin using laser. The classification according to the peeling depth includes superficial peeling that peels only the horny layer or the epidermis, And peeling of the dermis to the bottom of the dermis. It is important to induce skin regeneration without inflammatory reaction after laser treatment or peeling, and various cosmetic products for skin regeneration and wound healing are being developed. For example, in relation to skin regeneration technology, Korean Patent Laid-Open Publication No. 10-2015-0135743 discloses a wound treatment including gadoleic acid isolated from algae extract or a pharmaceutically acceptable salt thereof as an active ingredient, A pharmaceutical composition for skin regeneration, wherein the algae are selected from the group consisting of Myelophycus simplex, Leathesia difformis, Colpomenia peregrine, Ishige okamurae, Colpomenia bullosa, Ishige foliacea). < / RTI > Korean Patent Registration No. 10-1151397 discloses a functional cosmetic composition for skin regeneration comprising 5-aminolevulinic acid ester or a cosmetically acceptable salt thereof as an active ingredient for skin regeneration. Korean Patent Registration No. 10-1042712 discloses a cosmetic composition for skin regeneration and wound healing which comprises, as an active ingredient, a peptide having glycocin aminoglycan, madecaside, folic acid, ascorbic acid and a specific amino acid sequence as an active ingredient have. However, the conventional cosmetic raw materials for skin regeneration and wound healing developed until now have various problems such as limitations on skin regeneration or skin side effects, which are not effective in most cases.

On the other hand, citrus fruit is a lot of fruit produced in Korea, and citrus fruits (Citrus sunki hort. Ex Tanaka) are cultivated in various varieties in Jeju Island. For citrus fruits, vitamin C has been said to be synonymous. However, citrus has a variety of other functional materials that are beneficial to the body. Flavonoids, a polyphenolic compound with a small molecular weight, are a kind of this functional substance, and there exist about 60 kinds of citrus fruit. Most flavonoids have a hydroxyl group (-OH), which appears to be related to antioxidant functions. On the other hand, nobiletin belongs to a flavone group having many methoxy groups (CH3O-) among flavonoids, which is known to have higher biological activity than flavones having a hydroxy group. Polymethoxy flavonoids (PMF), found only in citrus fruits, include nobiletin, tangeretin, and sinensitin, which show the usefulness of citrus as a natural ingredient.

<Novyl Retin Chemical Structure>

<Anthrax Retinomical Structure>

<Synthetic Tin Chemical Structure>

Anti-cancer, anti-inflammatory, immunomodulatory, neuroprotective, and memory-damaging effects (Li, RW, Theriault, AG, Au, K., Douglas, T., Casaschi, A., Kurowska, EM and Mukherjee, R., Citrus polymethoxylated flavones, lipid and glucose homeostasis and modulating adipocytokines in fructose-induced insulin resistant hamsters. : 365-373, 2006).

The present invention has been made under the conventional technical background, and an object of the present invention is to provide a composition containing natural products as an active ingredient and highly effective for skin tissue regeneration.

In order to solve the above-mentioned object, one example of the present invention provides a composition for regenerating skin tissue comprising citrus peel extract as an active ingredient. Herein, the citrus peel extract includes nobiletin and tangeretin.

Further, another example of the present invention is a flavonoid compound comprising at least one flavonoid compound selected from flavones having three methoxy groups or isoflavones having three methoxy groups; And a citrus peel extract as an active ingredient.

Since the citrus peel extract, which is an active ingredient of the composition according to the present invention, is derived from a natural plant, it has no adverse effect on human skin and exhibits excellent skin tissue regeneration effect. In addition, when the citrus peel extract and the predetermined flavonoid compound are simultaneously used as the active ingredient of the composition according to the present invention, a synergistic action can be performed to maximize the skin tissue regeneration effect. Accordingly, the composition according to the present invention can be used as medicines, cosmetics, personal care products and the like for regenerating skin tissue induced by wounding by inflammation reaction or friction.

FIG. 1 is a result of observing the skin change of the experimental group with a digital camera in the skin tissue regeneration efficiency evaluation experiment.
FIG. 2 is a photograph showing the histological changes of the skin with an optical microscope by staining with a Haematoxylin and eosin (H & E) solution and changing the skin texture of the experimental group in the evaluation test of skin tissue regeneration efficacy.
FIG. 3 is a graph showing the thickness (y-axis) of the skin dermal layer according to the experimental group measured based on the observation result of FIG.
FIG. 4 is a graph showing relative amounts of expression of GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) mRNA expression level of vascular epidermis growth factor (VEGF) mRNA in the skin tissue of the experimental group in the skin tissue regeneration activity evaluation test.
FIG. 5 is a graph showing relative expression of insulin like growth factor (IGF-1) mRNA expression level in GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) mRNA expression level in the skin tissue of the experimental group in the skin tissue regeneration activity evaluation test.

As used herein, the term "pharmaceutically acceptable" means not significantly stimulating an organism and not interfering with the biological activity and properties of the administered active substance.

The term "prophylactic, " as used herein, refers to any act that inhibits the symptoms of a particular disease or delays progression by administration of the composition of the present invention.

As used herein, the term "treatment" refers to any action that improves or alleviates the symptoms of a particular disease upon administration of the composition of the present invention.

As used herein, the term "improvement" means all actions that at least reduce the degree of symptom associated with the condition being treated.

As used herein, the term "administering" means providing any of the compositions of the present invention to an individual by any suitable method. The term &quot; individual &quot; means any animal such as a human, a monkey, a dog, a goat, a pig, or a mouse having a disease in which symptoms of a specific disease can be improved by administering the composition of the present invention.

As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit or risk ratio applicable to medical treatment, including the type of disease, severity, The sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including simultaneously used drugs, and other factors well known in the medical arts.

Hereinafter, the present invention will be described in detail.

The composition for regenerating skin tissue according to an embodiment of the present invention includes citrus peel extract as an active ingredient. In the present invention, the citrus peel extract includes certain polymethoxy flavonoids (PMF) such as nobiletin or tangeretin. In addition, the type of the citrus fruits is not limited as long as it contains perianthin nobiletin and / or tangeretin. For example, when considering the amount of nobiletin and tangeretin contained in the perilla, the citrus fruits are selected from the group consisting of Citrus aurantium, Citrus depressa, Citrus tachibana, Citrus leucocarpa, Citrus tardiva, Citrus succosa, Citrus kinokuni, Citrus erythrosa, Citrus deliciosa, Citrus nobilis, Citrus reticulata, , Citrus tangerina, Citrus hanaya, Citrus nippokoreana, Citrus sunki hort. Ex Tanaka and Citrus hybrid Shiranuhi, and more preferably at least one selected from the group consisting of citrus fruits Citrus aurantium or Citrus sunki hort ex Tanaka is more preferable.

The citrus peel extract preferably includes both nobiletin and tangeretin. At this time, the weight ratio of nobiletin to tangeretin present in the citrus peel extract may vary depending on the kind of citrus used as an extraction raw material, extraction method, extraction condition, and the like, In view of the organic interaction and synergistic effect of noviracin and anthraquinone, the ratio is preferably 1: 0.5 to 1: 1, more preferably 1: 0.7 to 1: 0.9. Also, the content of nobiletin is preferably 25 to 30 wt% and the content of tangeretin is preferably 20 to 25 wt% based on the dry weight of the citrus peel extract. In addition, the content of nobiletin and anthraquinone based on the dry weight of the citrus peel extract is preferably 45 to 55% by weight.

The citrus peel extract can be produced by a conventional extraction method known in the art, for example, a solvent extraction method. The extraction solvent that can be used when preparing the citrus peel extract using the solvent extraction method includes water, a lower alcohol having 1 to 4 carbon atoms (e.g., methanol, ethanol, propanol and butanol), or a mixture thereof, Propylene glycol, 1,3-butylene glycol, glycerin, acetone, diethyl ether, ethyl acetate, butyl acetate, dichloromethane, chloroform, hexane and mixtures thereof. When water is used as the extraction solvent, the water is preferably hot water. When an alcohol is used as an extraction solvent, the alcohol is preferably a lower alcohol having 1 to 4 carbon atoms, and the lower alcohol is more preferably selected from methanol or ethanol. In addition, when the functional alcohol is used as the extraction solvent, the alcohol content is preferably 50 to 90%. On the other hand, it is apparent to those skilled in the art that citrus peel extracts can be obtained not only by the above-mentioned extraction solvents but also by other extracting solvents, which exhibit substantially the same effects. For example, extraction with supercritical fluid extraction using carbon dioxide, extraction with extraction using ultrasound, separation using an ultrafiltration membrane with a constant molecular weight cut-off value, or various chromatography (size, charge, The active fraction obtained through various further purification and extraction methods, such as separation by hydrophobic or affinity separation), is also included in the extract of the present invention.

The citrus peel extract used as an active ingredient of the composition for regenerating dermal tissue in the present invention preferably comprises a step of obtaining an extract containing an extract, a step of obtaining a concentrated extract and a step of obtaining an extract in the form of a precipitate &Lt; / RTI &gt; Hereinafter, a method for preparing a citrus peel extract according to a preferred embodiment of the present invention will be described in each step.

Step of obtaining an extract containing the extract

In a preferred embodiment of the present invention, the step of obtaining the extract containing the extract in the process for preparing the citrus peel extract comprises adding a functional lower alcohol to the citrus peel and extracting it. The extract is a concept that includes both components extracted from citrus rind, an extraction solvent, and citrus rind residue.

The type of the citrus fruits is not limited as long as they include perennial nobiletin and tangeretin. For example, when considering the amount of nobiletin and tangeretin contained in the perilla, the citrus fruits are selected from the group consisting of Citrus aurantium, Citrus depressa, Citrus tachibana, Citrus leucocarpa, Citrus tardiva, Citrus succosa, Citrus kinokuni, Citrus erythrosa, Citrus deliciosa, Citrus nobilis, Citrus reticulata, , Citrus tangerina, Citrus hanaya, Citrus nippokoreana, Citrus sunki hort. Ex Tanaka and Citrus hybrid Shiranuhi, and more preferably at least one selected from the group consisting of citrus fruits Citrus aurantium or Citrus sunki hort ex Tanaka is more preferable.

In addition, the alcohol concentration of the above-mentioned lower alcohol can be determined by extracting yields of polymethoxy flavonoids (PMF), especially nobiletin and anthraquinone, contained in citrus peels, It is preferably 50 to 80% by weight, more preferably 60 to 80% by weight, and most preferably 65 to 75% by weight. When the alcohol concentration of the functional lower alcohol is less than 50% by weight, the energy consumption and the concentration time are increased in the following concentration process, and the economical efficiency of the entire process may deteriorate. In addition, when the alcohol concentration of the functional lower alcohol exceeds 80% by weight, the extraction yield of polymethoxy flavonoids (PMF) may significantly decrease.

The lower alcohol may be selected from alcohols having 1 to 4 carbon atoms (for example, methanol, ethanol, propanol, isopropanol, isopropanol, butanol and the like) in consideration of extraction yield, distribution of polymethoxy flavonoids (PMF) Propanol, and butanol), and more preferably ethanol.

In addition, in the step of obtaining the extract containing the extract, the amount of the lower alcohol to be added is preferably 5 to 20 times, more preferably 8 to 20 times the weight of the citrus peel in view of uniform extraction and economy of the whole process And most preferably from 8 times to 15 times.

In the step of obtaining the extract containing the extract, the extraction temperature is preferably 10 to 30 ° C, more preferably 15 to 25 ° C, in view of extraction yield and economical efficiency of the whole process.

In the step of obtaining the extract containing the extract, the extraction time is preferably 2 to 10 days, more preferably 3 to 7 days, in view of extraction yield and economical efficiency of the whole process.

Step of obtaining a concentrated extract

In the method for producing citrus peel extract according to a preferred embodiment of the present invention, the step of obtaining the concentrated extract comprises filtering the extract containing the extract and concentrating the filtered extract.

In the method for preparing citrus peel extract according to a preferred embodiment of the present invention, the means for filtering the extract containing the extract is not limited as far as it is used in the field of foodstuffs or in the field of extracting, and examples thereof include a filter cloth, Ceramic filters, membranes, and the like. The extract containing the extract is separated into an extract and a filter cake which are filtered by filtration. The filtered extract is then concentrated to a predetermined concentration through atmospheric pressure concentration or reduced pressure concentration.

Step of obtaining an extract in the form of a precipitate

In the method for preparing a citrus peel extract according to a preferred embodiment of the present invention, the step of obtaining a precipitate-like extract comprises adding water or a lower alcohol aqueous solution to the concentrated extract to precipitate the extract to separate the precipitated extract .

In the step of obtaining the above precipitate type extract, the alcohol concentration of the lower alcohol aqueous solution is not more than 30% by weight (for example, 1 to 30% by weight), considering the precipitation rate of the concentrated extract, the precipitation yield, It is preferably 5 to 25% by weight, more preferably 10 to 25% by weight.

The lower alcohol may be an alcohol having a carbon number of 1 to 4 in consideration of the precipitation rate, the precipitation yield, the purity of the precipitate, the distribution of the polymethoxy flavonoids (PMF) contained in the precipitate, , Methanol, ethanol, propanol, and butanol), and more preferably ethanol.

In addition, in the step of obtaining the above precipitate type extract, the addition amount of water or a lower alcohol aqueous solution is preferably 3 to 12 times, more preferably 4 to 4 times as much as the weight of the concentrated extract in consideration of the precipitation rate, precipitation yield, To 10 times, and most preferably from 4 times to 8 times.

In the process for preparing citrus peel extract according to an embodiment of the present invention, the precipitate-type extract includes nobiletin and tangeretin, and may further include other polymethoxy flavonoids (PMF) have. In addition, the content of nobiletin in the above-mentioned precipitate-type extract is preferably 25 to 30% by weight, based on the dry weight of the extract in the form of a precipitate. In addition, the content of tangeretin in the above-mentioned precipitate type extract is preferably 20 to 25% by weight, based on the dry weight of the extract in the form of a precipitate. The content of polymethoxy flavonoids (PMF) in combination with nobiletin and tangeretin in the above-mentioned precipitate-type extract is preferably 45 to 55%, based on the dry weight of the extract of the precipitate form, Weight%. However, the above-mentioned precipitate-type extract may contain polymethoxy flavonoids (PMF) other than nobiletin and tangeretin, so that all of the polymethoxy flavonoids Polymethoxy flavonoids, PMF) may be greater than 55% by weight, for example 55 to 65% by weight, based on the dry weight of the extract in the form of a precipitate. In addition, the weight ratio of nobiletin to tangeretin in the precipitate-type extract may vary depending on the kind of citrus used as an extraction raw material, the type of extraction solvent, the type of precipitation solvent, the extraction temperature, and the like , And 1: 0.5 to 1: 1, and more preferably 1: 0.7 to 1: 0.9 in consideration of the organic interaction and synergistic effect of novirenretin and anthrax retin on skin moisturization.

In the method for preparing citrus peel extract according to an embodiment of the present invention, the precipitated extract is separated from the precipitating solvent and impurities by various separation means such as centrifugation. Subsequently, the separated precipitate-type extract is converted to a solid phase extract, such as a powder or granule form, through a drying process.

The composition for regenerating skin tissue according to another embodiment of the present invention may further comprise at least one flavonoid compound selected from flavone having three methoxy groups or isoflavone having three methoxy groups as an active ingredient; And citrus peel extracts. Specific features of the citrus peel extract are described in the citrus peel extract according to an example of the present invention.

The predetermined flavonoid compound used as an active ingredient in the composition for regenerating skin tissue according to another example of the present invention is a combination of flavone having three methoxy groups or isoflavone having three methoxy groups in consideration of synergistic action with citrus skin extract It is preferable that it is composed of at least one compound selected from at least one compound selected from isoflavones having three methoxy groups rather than three methoxy-group flavonols in consideration of maximizing the synergistic action with the citrus pea extract Do.

The type of flavone having three methoxy groups is not particularly limited as long as it is a compound having a structural formula of the following formula 1, for example, 6,2 ', 4'-trimethoxy flavone (6,2', 4'- trimethoxyflavone (CAS registration number: 720675-90-1), 5,6,7-trimethoxyflavone (CAS registration number: 973-67-1), 5,7,4'- Trimethoxyflavone (CAS Registry Number: 5631-70-9), 3 ', 4', 5'-trimethoxyflavone (3 ', 4', 5'-trimethoxyflavone; CAS registration number: 67858-30-4), 7,3 ', 4'-trimethoxyflavone (CAS registration number: 22395-24-0), 7,2' Trimethoxyflavone (CAS registration number: 7578-51-0), 3,5,7-trimethoxyflavone (registered as CAS), 3,5,7-trimethoxyflavone No. 26964-29-4), 5,6,2'-trimethoxyflavone (CB Number: CB41411221), 3,7,3'-trimethoxy flavone (3, 7,3'-trimethoxyflavone; CB Number: CB6283388), 3,6,2'-trimethoxyflavone CB No. CB9715958), 3,6,3'-trimethoxyflavone (CB Number: CB3462892), 3,3 ', 4-trimethoxyflavone 3 ', 4'-trimethoxyflavone (CB Number: CB4771498), 6,2', 3'-trimethoxyflavone (CB Number: CB4263353 3 '-trimethoxyflavone (CB Number: CB4701705), 2', 3 ', 4'-trimethoxy flavone (2', 3 ' , 4'-trimethoxyflavone; CAS registration number: 7143-46-6), 5,7,2'-trimethoxyflavone (CAS registration number: 4308-57-0), or 5,7,3'- - 5,7,3'-trimethoxyflavone (CB Number: CB7106787).

[Chemical Formula 1]

(In Formula 1, the three bonding groups selected from R ³ , R ⁵ , R ⁶ , R ⁷ , R ⁸ , R ^{2 '} , R ^3' , R ^{4 '} , R ^5' and R ^{6 '} , And the remainder is a hydrogen atom.)

The isoflavone having three methoxy groups is not particularly limited as long as it is a compound having a structural formula of the following formula (2), for example, 6,7,4'-trimethoxy isoflavone (6,7,4,4 '-trimethoxyisoflavone; CAS Registry Number: 798-61-8), 7,8,4'-trimethoxyisoflavone (CAS Registry Number: 37816-21-0), 5, 7,4'-trimethoxyisoflavone (CAS registration number: 1162-82-9), 7,3 ', 4'-trimethoxy isoflavone (7,3' 4'-trimethoxyisoflavone (CAS registry number: 1621-61-0), 7,2 ', 4'-trimethoxyisoflavone (CAS registry number: 7678-84-4) , Or 7,8,4'-trimethoxyisoflavone (CAS registration number: 37816-21-0), and can be selected from the synergistic action with the citrus peel extract or the economic efficiency 6,7,4'-trimethoxyisoflavone (CAS registry number: 798-61-8) It is desirable.

(2)

(In the formula (2), the three bonding groups selected from R ² , R ⁵ , R ⁶ , R ⁷ , R ⁸ , R ^{2 '} , R ^3' , R ^{4 '} , R ^5' and R ^{6 '} , And the remainder is a hydrogen atom.)

Since the composition of the present invention has an excellent skin tissue regeneration effect, the composition of the present invention can be used for the improvement or treatment of skin tissue induced by inflammation reaction or friction. In addition, the composition of the present invention can be embodied in a pharmaceutical composition, a cosmetic composition, a personal care product and the like depending on the intended use or aspect, and can be used as an active ingredient in citrus peel extract or three methoxy groups The content of the predetermined flavonoid compound and the like may be adjusted in various ranges depending on the specific form of the composition, the purpose of use, and the manner of use. For example, in a composition according to another embodiment of the present invention, the weight ratio of the predetermined flavonoid compound having three methoxy groups to the citrus peel extract is in the range of 1: 1 to 1: 1, considering the synergistic action, regeneration, 1:60, and it is preferably 1: 5 to 1:40, more preferably 1:10 to 1:30.

The content of the active ingredient in the pharmaceutical composition according to the present invention is not particularly limited and is, for example, 0.01 to 99% by weight, preferably 0.5 to 50% by weight, more preferably 1 to 30% by weight, Lt; / RTI &gt; In addition, the pharmaceutical composition according to the present invention may further contain, in addition to the active ingredient, an additive such as a pharmaceutically acceptable carrier, excipient or diluent. Examples of carriers, excipients and diluents that can be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate , Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the pharmaceutical composition of the present invention may contain, in addition to a citrus peel extract or a predetermined flavonoid compound having three methoxy groups, at least one known active ingredient having a skin tissue regeneration effect (for example, ginsenoside, neoindoline, Herbal medicine extract, etc.). The pharmaceutical composition of the present invention can be formulated into a formulation for oral administration or parenteral administration by a conventional method, and can be formulated into a pharmaceutical composition such as a filler, an extender, a binder, a wetting agent, a disintegrant, Diluents or excipients. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose ), Lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of suppository bases include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA. The pharmaceutical composition of the present invention may be administered orally or parenterally to a mammal including a human according to a desired method. Examples of the parenteral administration method include external dermal application, intraperitoneal injection, intramuscular injection, subcutaneous injection, intravenous injection, Intravenous injection or intra-thoracic injection. The dosage of the pharmaceutical composition of the present invention is not limited as long as it is a pharmacologically effective amount and is not limited as long as it depends on the body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, Varies. The typical daily dose of the pharmaceutical composition of the present invention is not particularly limited, and is, for example, in the range of 1 to 3000 占 퐂 / kg, preferably 10 to 2000 占 퐂 / kg on the basis of the active ingredient, 20 to 1000 占 퐂 / kg. In addition, the pharmaceutical composition of the present invention can be administered once a day or divided into several times. The pharmaceutical composition according to the present invention is preferably prepared in the form of a skin external preparation such as a cream, a gel, a patch, a spray, a research agent, a warning agent, a lotion, a liniment, a pasta agent or a cataplasma agent Do.

The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. Specifically, the cosmetic composition of the present invention can be prepared in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder. When the formulation of the cosmetic composition of the present invention is a paste, a cream or a gel, an animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide Can be used. When the formulation of the cosmetic composition of the present invention is a solution or emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, Glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid esters of sorbitan. When the formulation of the cosmetic composition of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspension such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester , Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used. When the formulation of the cosmetic composition of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. Especially, in the case of a spray, Propellants such as carbon, propane / butane or dimethyl ether. When the formulation of the cosmetic composition of the present invention is a surfactant-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, Fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester. The cosmetic composition according to the present invention can be used as a hair cosmetic composition for hair tonic, hair conditioner, hair essence, hair lotion, hair nourishing lotion, hair shampoo, hair conditioner, hair treatment, hair cream, Hair cosmetic cream, hair wax, hair aerosol, hair pack, hair nutrition pack, hair soap, hair cleansing foam, hair oil, hair drying agent, hair preservative, hair dye, hair wave agent, hair decolorant, hair gel, hair glaze, hair dressing Hair lacquers, hair moisturizers, hair mousses or hair sprays.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to clearly illustrate the technical features of the present invention and do not limit the scope of protection of the present invention.

1. Citrus pericarp  Preparation of extract

Production Example 1

To 20 g of citrus aurantium crust powder was added 200 ml of a functional ethanol (ethanol concentration: 70% by weight) and the mixture was extracted at room temperature (about 20 ± 5 ° C) for 3 days. Thereafter, the extract was filtered to remove the insoluble residue. Then, the filtered extract was concentrated at room temperature (about 20 ± 5 ° C) and under reduced pressure. Then, water was added to the concentrated extract at a weight corresponding to about 5 times of the concentrated extract, and the mixture was allowed to stand for about 24 hours to precipitate the extract. Thereafter, the mixture was centrifuged at 3000 rpm for about 3 minutes to obtain an extract in the form of a precipitate. Thereafter, the precipitate-type extract was dried to obtain a solid citrus peel extract.

Comparative Production Example 1

To 20 g of citrus aurantium crust powder was added 200 ml of a functional ethanol (ethanol concentration: 70% by weight) and the mixture was extracted at room temperature (about 20 ± 5 ° C) for 3 days. Thereafter, the extract was filtered to remove the insoluble residue. Then, the filtered extract was concentrated at room temperature (about 20 ± 5 ° C) and under reduced pressure. Thereafter, the concentrated extract was lyophilized to obtain a solid citrus peel extract.

Comparative Preparation Example 2

To 20 g of citrus aurantium crust powder was added 200 ml of a functional ethanol (ethanol concentration: 50% by weight), and the mixture was extracted at room temperature (about 20 ± 5 ° C) for 3 days. Thereafter, the extract was filtered to remove the insoluble residue. Then, the filtered extract was concentrated at room temperature (about 20 ± 5 ° C) and under reduced pressure. Thereafter, the concentrated extract was lyophilized to obtain a solid citrus peel extract.

Comparative Preparation Example 3

200 ml of 100% ethanol was added to 20 g of citrus aurantium crust powder and the mixture was extracted at room temperature (about 20 ± 5 ° C) for 3 days. Thereafter, the extract was filtered to remove the insoluble residue. Then, the filtered extract was concentrated at room temperature (about 20 ± 5 ° C) and under reduced pressure. Thereafter, the concentrated extract was lyophilized to obtain a solid citrus peel extract.

Comparative Preparation Example 4

To 20 g of citrus aurantium crust powder was added 200 ml of water and extracted on a water bath at about 60 캜 for 3 days. Thereafter, the extract was filtered to remove the insoluble residue. Then, the filtered extract was concentrated at room temperature (about 20 ± 5 ° C) and under reduced pressure. Thereafter, the concentrated extract was lyophilized to obtain a solid citrus peel extract.

2. Citrus pericarp  Polymethoxy flavonoids contained in the extract ( Polymethoxy  flavonoids, PMF ) Content analysis

The contents of nobiletin and tangeretin contained in the solid citrus peel extracts prepared in Preparation Example 1 and Comparative Preparation Examples 1 to 4 were analyzed using high performance liquid chromatography (HPLC) . High-performance liquid chromatography (HPLC) The analytical conditions are as follows.

* Analytical sample: Citrus peel extract is prepared by dissolving in methanol to a concentration of 10 mg / ml.

* Two-component mobile phase: A solution of distilled water and methanol in a volume ratio of 50:50 was used as the first phase, 100% methanol was used as the second phase, and the volume ratio of the first phase to the second phase was 100: 0 Using a linear gradient solvent composition method, starting at 0: 100 over 50 minutes and then being held for 10 minutes.

* Detector: UV detector fixed at a wavelength of 215 nm

Thereafter, nobiletin and tangeretin standard reagents (Wako, JP) were analyzed by concentration and standard calibration curves were prepared based on peak area values. Then, the contents of nobiletin and tangeretin in the analytical sample were calculated using a standard calibration curve.

The contents of nobiletin and tangeretin contained in citrus peel extracts are shown in Table 1 below based on the dry weight of citrus peel extracts.

Citrus peel extract PMF content (%, based on dry weight of citrus peel extract) Novyletin Anthrax Retin Nobilreten + Angora Retin Production Example 1 27.5 22 49.5 Comparative Preparation Example 1 10.3 7.8 18.1 Comparative Production Example 2 12.9 9.7 22.6 Comparative Production Example 3 1.1 0.7 1.8 Comparative Production Example 4 10.7 7.5 18.2

As shown in Table 1, the citrus peel extracts prepared in Preparation Example 1 showed higher contents of nobiletin and tangeretin than those of other citrus peel extracts. On the other hand, when 100% ethanol was used as the extraction solvent, the content of nobiletin and the content of tangeretin in the citrus peel extract were remarkably decreased (see the result of Comparative Production Example 3), and hot water was used as the extraction solvent Nobiletin and tangeretin contents of citrus peel extracts were similar to those of 70% ethanol but the enrichment time and energy consumption were increased. Respectively.

3. Citrus with experimental animals pericarp  Evaluation of skin tissue regeneration efficacy of extracts

(1) Experimental method

Four week old male C57BL / 6 mice were used for the experiment after being purified for 1 week. During the purification process, the mice were housed at a temperature of 23 ± 1 ° C, humidity of 55 ± 5%, a light-dark cycle of 12 hours, and feeding and drinking water were provided freely. Eight mice were divided into five groups. After that, mice were anesthetized with anesthetics, and the resting hair was removed by using an epilator and a cream, and a physical contact stimulus was given to the skin to cause an injury caused by an inflammatory reaction. The specimens were applied to the wound-induced area at a dose of 200 1 once a day for one week and rubbed 10-15 times by hand to promote absorption. Specifically, in the case of the negative control group, butylene glycol was used as a coating sample. In the positive control group, madecasol ointment (manufacturer: Dongkuk Pharm, Korea) was applied once in an amount of 0.5 g. In the TMF treatment group, 6,7,4'-trimethoxyisoflavone (Supplier: EXTRASYNTHESE, France) was added to butylene glycol to 200 lt; RTI ID = 0.0 &gt; uM. &lt; / RTI &gt; In the case of the 'Citrus pea extract' treated group, the citrus peel extract prepared in Preparation Example 1 was dissolved in butylene glycol at a concentration of 1000 μg / ml. In the case of 'TMF + citrus pea extract' treated group, 6,7,4'-trimethoxyisoflavone (supplier: EXTRASYNTHESE, France) as a coating sample was dissolved in butylene glycol ) At a concentration of 200 μM and a citric peel extract solution in butylene glycol at a concentration of 1000 μg / ml were mixed with each other.

(2) Assessment of skin tissue regeneration effect by observation of histological change of skin

After the end of the experiment, the animals were sacrificed and pictures of the back area were taken with a digital camera to confirm the extent of wound healing by skin tissue regeneration. In addition, tissues of the back region were collected and fixed with 4% formaldehyde solution. Thereafter, the fixed tissue was washed, dehydrated, embedded in paraffin, and cut to a thickness of about 7 μm to prepare a specimen. Then, the specimens were stained with Haematoxylin and eosin (H & E) solution, and histological changes of the skin were observed with an optical microscope capable of scaling.

FIG. 1 shows the result of observing the skin change by the experiment group in the skin tissue regeneration efficacy evaluation experiment, FIG. 2 shows the skin tissue regeneration effect in the skin tissue regeneration efficacy evaluation experiment by dyeing with the Haematoxylin and eosin (H & E) Were observed by light microscopy. FIG. 3 is a graph showing the thickness (y-axis) of the skin dermal layer according to the experimental group measured based on the observation result of FIG. In FIGS. 1 to 3, the 'A' group represents a negative control group, the 'B' group represents a positive control group, the 'C' group represents a 'TMF' treatment group and the 'D' group represents a 'citrus peel extract' treatment group The 'E' group represents 'TMF + citrus peel extract' treated group. As shown in FIG. 1, at the end of the experiment, there were scars and marks on the skin at the end of the experiment. In the positive control, the skin of the skin became pale. In the TMF treated group, the skin of the skin became thinner, but the redness of the skin remained. In the 'citrus peel extract' treated group, the shallow scars and deep scars of the skin almost disappeared, and the hair follicles began to form in the wound area. In the case of 'TMF + citrus peel extract' treatment, skin wounds almost disappeared, deep and wide wounds healed, and began to grow off the hair follicle. As shown in FIGS. 2 and 3, the 'citrus peel extract' treated group had a much greater thickness of the dermal layer than the positive control coated with commercial skin wound treatment madecasol. In addition, when 6,7,4'-trimethoxy isoflavone and citrus peel extract are treated simultaneously, 6,7,4'-trimethoxy flavone is solubilized by synergism or citrus peel extract is treated alone The thickness of the dermal layer was much higher than in the case. The increase in the thickness of the dermal layer is attributed to the proliferation of fibroblasts and means that dermal regeneration has occurred under the epidermis.

(3) Identification of mechanism of skin tissue regeneration by gene expression confirmation

After completion of the experiment, the experimental animals were sacrificed, skin tissue of the back region was collected, and total RNA was isolated according to the standard protocol. Specifically, the collected skin tissue was put into a tube and ground with a homogenizer. Then, 1 ml of Trizol reagent was added to dissolve and left at room temperature for 5 minutes. Subsequently, 200 클로 of chloroform was added to the tube, vortexed vigorously for 15 seconds, left at room temperature for 5 minutes, and centrifuged at 4 캜 and 13,200 rpm for 15 minutes. Then, only the supernatant was transferred to a new tube, an equal amount of isopropanol was added, and the supernatant was removed by centrifugation at 4 ° C and 13,200 rpm for 15 minutes. DEPC (diethyl pyrocarbonate) treatment RNA pellets were washed with 1 ml of 75% ethanol solution diluted with distilled water. The RNA pellet was dried at room temperature, diluted with DEPC (diethyl pyrocarbonate) -treated distilled water, and then its concentration was measured with a spectrophotometer.

Then, cDNA was synthesized using GoScript ™ Reverse Transcription system kit (Promega, WI, USA). Specifically, 1 μg of total RNA and 1 μl of Oligo (dT) 15 primer (0.5 μg / reaction) were added to the PCR tube and preheated at 70 ° C. for 5 minutes. Then, 4 μl of 5 × reaction buffer, 3 μl of 25 mM MgCl ₂ , 1 μl of PCR nucleotide mix, 0.5 μl of RNase inhibitor, 0.5 μl of Goscript reverse transcriptase and 6 μl of nuclease free water were added to the reaction mixture, and the reaction was stopped by heating at 25 ° C. for 5 minutes, 42 ° C. for 60 minutes and 70 ° C. for 15 minutes.

VEGF mRNA expression and insulin like growth factor (IGF-1) mRNA expression were measured by real-time PCR. Vascular epidermis growth factor (VEGF) and insulin like growth factor (IGF-1) have been reported to stimulate growth and regeneration of skin cells as a skin cell growth factor involved in cell proliferation and differentiation of dermis. Real time PCR was performed using HotStart-IT SYBR Green qPCR Master mix (USB, OH, USA). Specifically, 10 μl of 2 × SYBR master mix, 1 μl of 15 pmol forward primer, 15 μl of reverse primer, 0.5 μl of 25 mM MgCl ₂ , 0.4 μl of 25 μM passive reference dye (ROX) mix. Then, 19 μl of master mix and 1 μl of cDNA were added to each tube, reacted for 1 minute at 95 ° C for 2 minutes, and then reacted at 95 ° C for 5 seconds and 60 ° C for 30 seconds for 40 cycles. . The primers used in the real time PCR were synthesized with reference to Bioneer Co., Korea, and the nucleotide sequences of the respective primers are shown in Table 2 below.

Gene name Forward primer sequence (5 'to 3') Reverse primer sequence (5 'to 3') GAPDH ATTCCATGGCACCGTCAAGGC TCAGGTCCACCACTGACACGT IGF-1 GGTAAGCGGAACCGTCATGCC CCACGTGGACTACTAGCACCT VEGF GTACAATGGCACCGTCAAGAC CCATTGDDGDDGGTAAGACAT

FIG. 4 is a graph showing relative amounts of expression of GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) mRNA expression level of vascular epidermis growth factor (VEGF) mRNA in the skin tissue of the experimental group in the skin tissue regeneration activity evaluation test. FIG. 5 is a graph showing relative expression of Insulin like growth factor (IGF-1) mRNA expression level in GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) mRNA expression level in the skin tissue of the experimental group in the skin tissue regeneration efficiency evaluation experiment. In FIG. 4 and FIG. 5, 'A' group represents negative control group, 'B' group represents positive control group, 'C' group represents 'TMF' treatment group and 'D' group represents 'citrus peel extract' treatment group The 'E' group represents 'TMF + citrus peel extract' treated group. As shown in FIGS. 4 and 5, the citrus peel extract showed more excellent effect for increasing the expression of skin cell growth factor than madecasol. In addition, when 6,7,4'-trimethoxy isoflavone and citrus peel extract are treated simultaneously, 6,7,4'-trimethoxy flavone is solubilized by synergism or citrus peel extract is treated alone (VEGF) and insulin-like growth factor (IGF-1) expression were significantly higher than those of the control group.

4. Production of pharmaceutical composition containing citrus peel extract, etc.

&Lt; 4-1 >

17.5 mg of the citrus peel extract of Preparation Example 1

6,7,4'-trimethoxy isoflavone 2.5 mg

Lactose 100 mg

10 mg of talc

The above components were mixed and packed in airtight bags to prepare powders.

<4-2> Preparation of tablets

9 mg of the citrus peel extract of Preparation Example 1

1 mg of 6,7,4'-trimethoxy isoflavone

Corn starch 100 mg

100 mg of milk

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

&Lt; 4-3 > Preparation of capsules

9 mg of the citrus peel extract of Preparation Example 1

1 mg of 6,7,4'-trimethoxy isoflavone

3 mg of crystalline cellulose

15 mg of milk

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules according to the conventional preparation method of capsules.

&Lt; 4-4 >

9 mg of the citrus peel extract of Preparation Example 1

1 mg of 6,7,4'-trimethoxy isoflavone

Lactose 150 mg

100 mg of glycerin

Xylitol 50 mg

After mixing the above components, they were prepared so as to be 4 g per one ring according to a conventional method.

<4-5> Preparation of granules

13.5 mg of the citrus peel extract of Preparation Example 1

1.5 mg of 6,7,4'-trimethoxy isoflavone

Soybean extract 50 mg

200 mg of glucose

600 mg of starch

After mixing the above components, 100 mg of 30% ethanol was added and the mixture was dried at 60 캜 to form granules, which were then filled in a capsule.

&Lt; 4-6 > Preparation of injection

9 mg of the citrus peel extract of Preparation Example 1

1 mg of 6,7,4'-trimethoxy isoflavone

Methyl paraben 0.8 mg

0.1 mg of propylparaben

Sterile sterilized water for injection

After mixing the above ingredients, 2 ml of the mixture was filled in an ampoule and sterilized to prepare an injection.

&Lt; 4-7 > Preparation of ointment preparation

0.4 mg of the citrus peel extract of Preparation Example 1

0.1 mg of 6,7,4'-trimethoxy isoflavone

250 mg of white petrolatum

Stearyl alcohol 220 mg

0.25 mg of ethyl p-oxybenzoate

120 mg of propylene glycol

15 mg of sodium lauryl sulfate

The above components were mixed to prepare an ointment agent.

5. Citrus pericarp  Extracts and the like Cosmetics  Preparation of composition

<5-1> Production of flexible lotion

The number of softening times was prepared according to the usual method as shown in Table 3 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
glycerin
1,3-butylene glycol
PEG 1500
Allantoin
DL-Panthenol
Lee D. TEE-2NA
Benzophenone-9
Sodium hyaruronate
ethanol
Octidodeces-16
Polysorbate 20
Preservative, fragrance, pigment
Distilled water 2.7
0.3
5.0
3.0
1.0
0.1
0.3
0.02
0.04
5.0
10.0
0.2
0.1
a very small amount
Balance Sum 100

<5-2> Production of convergent lotion

The convergent lotion was prepared according to the usual method as shown in Table 4 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
glycerin
1,3-butylene glycol
Allantoin
DL-Panthenol
Lee D. TEE-2NA
Benzophenone-9
Sodium hyaruronate
ethanol
Polysorbate 20
Location of Hazel extract
Citric acid
Preservative, fragrance, pigment
Distilled water 1.35
0.15
2.0
2.0
0.2
0.2
0.02
0.04
3.0
15.0
0.3
2.0
a very small amount
a very small amount
Balance Sum 100

<5-3> Production of nutrition lotion

Nutritional lotion was prepared according to the usual method as shown in Table 5 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
Stearyl alcohol
lanolin
Polysorbate 60
Sorbitan stearate
Hardened vegetable oil
Mineral oil
Squalane
Trioctanoin
Dimethicone
Tocopheryl acetate
Carboxyvinyl polymer
glycerin
1,3-butylene glycol
Sodium hyaruronate
Triethanolamine
Preservative, fragrance, pigment
Distilled water 1.35
0.15
1.5
1.5
1.3
0.5
1.0
5.0
3.0
2.0
0.8
0.5
0.12
5.0
3.0
5.0
0.12
a very small amount
Balance Sum 100

<5-4> Preparation of nutritional cream

Nutritive creams were prepared according to the usual methods as shown in Table 6 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
Pro-type glycerin monostearate
Cetearyl alcohol
Stearic acid
Wax
Polysorbate 60
Sorbitan stearate
Hardened vegetable oil
Squalane
Mineral oil
Trioctanoin
Dimethicone
Sodium magnesium silicate
glycerin
Betaine
Triethanolamine
Sodium hyaruronate
Preservative, fragrance, pigment
Distilled water 2.7
0.3
2.0
2.2
1.5
1.0
1.5
0.6
1.0
3.0
5.0
5.0
1.0
0.1
5.0
3.0
1.0
4.0
a very small amount
Balance Sum 100

<5-5> Manufacture of massage cream

Massage creams were prepared according to the usual methods as shown in Table 7 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
Chin type glycerin monosuccinic acid
Stearyl alcohol
Stearic acid
Polysorbate 60
Sorbitan stearate
Isostearyl isoserate
Squalane
Mineral oil
Dimethicone
Hydroxyethyl cellulose
glycerin
Triethanolamine
Preservative, fragrance, pigment
Distilled water 2.7
0.3
1.5
1.5
1.0
1.5
0.6
5.0
5.0
35.0
0.5
0.12
6.0
0.7
a very small amount
Balance Sum 100

<5-6> Production of essence

The essence was prepared according to a conventional method as shown in Table 8 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
glycerin
Betaine
PIZZY 1500
Allantoin
DL-Panthenol
Lee D. T.-2Na
Benzophenone-9
Hydroxyethyl cellulose
Sodium hyaruronate
Carboxyvinyl polymer
Triethanolamine
Octyldodecanol
Octyldodec-16
ethanol
Preservative, fragrance, pigment
Distilled water 4.5
0.5
10.0
5.0
2.0
0.1
0.3
0.02
0.04
0.1
8.0
0.2
0.18
0.3
0.4
6.0
a very small amount
Balance Sum 100

<5-7> Manufacture of pack

The pack was prepared according to a conventional method as shown in Table 9 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
Polyvinyl alcohol
Cellulose sword
glycerin
PIZZY 1500
Cyclostristin
DL - Panthenol
Allantoin
Monoammonium glycyrrhizin acid
Nicotinamide
ethanol
FYGEN 40 Hardened castor oil
Fragrance, coloring, preservative
Distilled water 2.7
0.3
15.0
0.15
3.0
2.0
0.15
0.4
0.1
0.3
0.5
6.0
0.3
a very small amount
Balance Sum 100

<5-8> Manufacture of shampoo

Shampoos were prepared according to the usual methods as shown in Table 10 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
Sodium laureth sulfate
Cocamidopropyl betaine
Propylene glycol
Guar hydroxypropyltrimonium chloride
Disodium ethylenediamine tetraacetic acid
Phage-12 dimethicone
Polyquaternium-7
Water-soluble keratin
Spices
Purified water 9
One
30
15
3
0.5
0.005
0.3
2.5
0.5
a very small amount
Balance Sum 100

<5-9> Production of soap

The soap was prepared according to a conventional method as shown in Table 11 below.

ingredient Content (unit:% by weight) The citrus peel extract of Preparation Example 1
6,7,4'-trimethoxy isoflavone
Titanium dioxide
Polyethylene glycol
glycerin
Disodium ethylenediamine tetraacetic acid
salt
Pigment
Soap incense
Soap base (13% moisture) 0.4
0.1
0.2
0.8
0.5
0.05
1.0
a very small amount
a very small amount
Balance Sum 100

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Therefore, the scope of the present invention should be construed as including all embodiments falling within the scope of the appended claims.

Claims (18)

A composition comprising citrus peel extract as an active ingredient,
Wherein the citrus peel extract comprises nobiletin and tangeretin. &Lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt;
The method of claim 1, wherein the citrus fruits are selected from the group consisting of Citrus aurantium, Citrus depressa, Citrus tachibana, Citrus leiocarpa, Citrus tardiva, Citrus succosa, Citrus kinokuni, Citrus erythrosa, Citrus deliciosa, Citrus nobilis, Citrus reticulata, Citrus tangerina, Citrus hanaya, Citrus nippokoreana, ), Citrus sunki hort (ex Tanaka), and citrus hybrid (Shiranuhi).
The composition for regenerating skin tissue according to claim 1, wherein the weight ratio of nobiletin to tangeretin present in the citrus peel extract is 1: 0.5 to 1: 1.
The method according to claim 1, wherein the content of nobiletin is 25-30 wt% and the content of tangerine is 20-25 wt% based on the dry weight of the citrus pea extract. / RTI &gt;
The composition for regenerating skin tissue according to claim 1, wherein the total content of nobiletin and anthrax is 45 to 55% by weight based on the dry weight of the citrus peel extract.
The composition for regenerating skin tissue according to claim 1, wherein the citrus peel extract is produced by a method comprising the steps of:
a) adding a functional lower alcohol having an alcohol concentration of 50 to 80% by weight to the citrus rind and extracting to obtain an extract containing the extract;
b) filtering the extract and concentrating the filtered extract to obtain a concentrated extract; And
c) adding a lower alcohol aqueous solution having a water or alcohol concentration of 30% by weight or less to the concentrated extract and allowing the extract to settle, and separating the extract to obtain an extract in the form of a precipitate.
(The lower alcohol is an alcohol having 1 to 4 carbon atoms, and the precipitate-type extract includes nobiletin and tangeretin).
The method of claim 6, wherein the citrus fruits are selected from the group consisting of Citrus aurantium, Citrus depressa, Citrus tachibana, Citrus leiocarpa, Citrus tardiva, Citrus succosa, Citrus kinokuni, Citrus erythrosa, Citrus deliciosa, Citrus nobilis, Citrus reticulata, Citrus tangerina, Citrus hanaya, Citrus nippokoreana, ), Citrus sunki hort (ex Tanaka), and citrus hybrid (Shiranuhi).
7. The composition for regenerating skin tissue according to claim 6, wherein the lower alcohol is ethanol.
[Claim 7] The composition for regenerating skin tissue according to claim 6, wherein the amount of the functional lower alcohol added in the step of obtaining the extract is 5 to 20 times the weight of the citrus peel.
[Claim 7] The composition for regenerating skin tissue according to claim 6, wherein the extraction temperature is 10 to 30 DEG C and the extraction time is 2 to 10 days.
[Claim 7] The composition for regenerating skin tissue according to claim 6, wherein the amount of water or a lower alcohol aqueous solution added in the step of obtaining the precipitate-type extract is 3 to 12 times the weight of the concentrated extract.
[Claim 7] The composition according to claim 6, wherein the content of nobiletin is 25-30% by weight and the content of tangerine is 20-25% by weight based on the dry weight of the precipitate- Composition for regeneration.
[Claim 7] The composition for regenerating skin tissue according to claim 6, wherein the sum of nobiletin and tangeretin is 45 to 55% by weight based on the dry weight of the precipitate-form extract.
14. The composition for regeneration of skin tissue according to any one of claims 1 to 13, which further comprises at least one flavonoid compound selected from flavone having three methoxy groups or isoflavone having three methoxy groups as an active ingredient .
15. The method according to claim 14, wherein the flavone having three methoxy groups is 6,2 ', 4'-trimethoxyflavone (CAS registration number: 720675-90-1), 5 , 5,7-trimethoxyflavone (CAS registry number: 973-67-1), 5,7,4'-trimethoxyflavone (5,7,4'-trimethoxyflavone; CAS Registry Number: 5631-70-9), 3 ', 4', 5'-trimethoxyflavone (CAS Registry Number: 67858-30-4), 7,3 ', 4'-trimethoxyflavone (CAS registration number: 22395-24-0), 7,2', 4'-trimethoxy flavone (7,2 ', 4 -trimethoxyflavone (CAS registration number: 7578-51-0), 3,5,7-trimethoxyflavone (CAS registration number: 26964-29-4), 5,6,2 Trimethoxyflavone (CB Number: CB41411221), 3,7,3'-trimethoxyflavone (CB Number: CB6283388), 3 , 6,2'-trimethoxyflavone (CB Number: CB9715958), 3,6,3'-trimethoxy flavone (3,6,3'-trimet 3,3 ', 4'-trimethoxyflavone (CB Number: CB4771498), 6,2', 3'-trimethoxy flavone ( 6,2 ', 3'-trimethoxyflavone; CB Number: CB4263353), 7,2', 3'-trimethoxyflavone (CB Number: CB4701705) , 4'-trimethoxy flavone (2 ', 3', 4'-trimethoxyflavone; CAS registration number: 7143-46-6), 5,7,2'-trimethoxyflavone (CAS registration number: 4308-57-0), or 5,7,3'- -Trimethoxyflavone (CB Number: CB7106787). &Lt; / RTI &gt;
15. The method according to claim 14, wherein the isoflavone having three methoxy groups is 6,7,4'-trimethoxyisoflavone (CAS registration number: 798-61-8), 7 , 8,4'-trimethoxyisoflavone (CAS registration number: 37816-21-0), 5,7,4'-trimethoxy isoflavone (5,7,4 '-trimethoxyisoflavone; CAS Registry Number: 1162-82-9), 7,3', 4'-trimethoxyisoflavone (CAS Registry Number: 1621-61-0) 7,2 ', 4'-trimethoxyisoflavone (CAS registration number: 7678-84-4), or 7,8,4'-trimethoxy isoflavone (7 , 8,4'-trimethoxyisoflavone; CAS Registry Number: 37816-21-0).
14. The composition for regenerating skin tissue according to any one of claims 1 to 13, wherein the skin tissue is wound-induced by an inflammatory reaction or friction.
14. The composition for regenerating skin tissue according to any one of claims 1 to 13, wherein the composition is a pharmaceutical composition or a cosmetic composition.

Images