KR20170119422A - Cosmetic compositions for improving of skin comprising the extract of Piper cambodianum - Google Patents

Abstract

The present invention relates to a composition for improving skin comprising Piper cambodiaeum. The extract of Piper cambodiae of the present invention is a natural extract, harmless to the human body, and also contains collagen, elastin and HAS-2 gene And exhibits excellent antioxidative, anti-aging and wound healing effects by inhibiting the expression of the MMP-1 gene and ROS activity, and thus can be effectively utilized as a composition for skin improvement, a composition for wound healing, and a composition for antioxidation .

Description

TECHNICAL FIELD The present invention relates to a cosmetic composition for improving skin comprising Piper cambodiae extract,

The present invention relates to a cosmetic composition for improving skin comprising Piper cambodianum extract.

The skin occupies most of the human body and has various functions such as body temperature control, secretion, excretion, absorption, and especially functions to protect the human body physically, chemically and biologically from outside by being present at the outermost part of the human body. The skin is composed of epidermis, dermis and subcutaneous fat. The epidermis protects from the outside and inside of the body. The dermis has the function of supporting elasticity and support of skin, and subcutaneous fat has the function of maintaining body temperature.

An enzyme called matrix metalloproteinase (MMP), a collagenase, is involved in anti-aging and wound healing. That is, although synthesis and degradation of extracellular matrix such as collagen in vivo are appropriately controlled, collagen synthesis is reduced by aging or ultraviolet irradiation, and expression of matrix metalloproteinase (MMP), an enzyme that degrades collagen, The elasticity of the skin is lowered and wrinkles are formed. In addition, when the expression of collagen-degrading matrix metalloproteinase is reduced, the wound is not healed well.

On the other hand, reactive oxygen species are known to alter gene expression, cell adsorption, metabolism, cell cycle, and apoptosis by altering various signal transduction processes. Activated oxygen species are involved in signal transduction induced by reactive oxygen species such as mitogen-activated protein kinase ), NF-κB (nuclear factor-κB), phosphatidylinositol 3-kinase (PI3K), p53 and β-catenin / Wnt. Recently, there have been various studies on anti-aging through antioxidation that protects the human body from damage by active oxygen species.

In response to the well-being trend of eating well and living well, cosmetics for use in skin that acts as protection, elasticity, and support as described above are becoming an indispensable element rather than an option, Are preferring high quality products using natural resources, which are not widely used chemically synthesized materials. In line with these consumer needs, cosmetics such as functional cosmetics and functional foods, The development of functional cosmetics based on natural resources with medicinal efficacy at the intermediate stage of pharmaceuticals is attracting attention. Accordingly, various materials that can be used as raw materials for cosmetics, such as natural products, microorganisms, protein cultures, and stem cell-derived cultures, are under development.

In particular, recently, problems arise due to genetic modification of cosmetic ingredients and environmental hormones, so that functional cosmetics based on extracts of natural substances that can be safely used without being harmful to the human body in the long term are increasingly expected.

On the other hand, Piper cambodianum is a plant belonging to the genus Piper , originating in Vietnam, and its scientific name has not yet been known.

The inventors of the present invention found that Piper cambodia nymph extract exhibits excellent wound healing effects through inhibition of substrate metalloproteinase (MMP) and reduction of reactive oxygen species while studying functional cosmetics using natural substances, Aging effect and completed the present invention.

Korean Patent Application No. 10-20150135743 Korean Patent Application No. 10-20030003994 Korean Patent Application No. 10-20110144667 Korean Patent Application No. 10-20150057737

It is an object of the present invention to provide a composition for improving skin comprising Piper cambodianum extract.

It is another object of the present invention to provide a composition for treating wounds comprising Piper cambodianum extract.

It is another object of the present invention to provide a composition for antioxidation comprising Piper cambodianum extract.

In order to achieve the above object, the present invention provides a cosmetic composition for skin improvement comprising Piper cambodianum extract.

The present invention also provides a pharmaceutical composition for the treatment of wounds comprising Piper cambodianum extract.

The present invention also provides a composition for external application for skin for wound healing, which comprises Piper cambodianum extract.

The present invention also provides an antioxidant or wound-healing health functional food composition containing Piper cambodianum extract.

The extract of Piper cambodianum of the present invention is a natural extract, which is not only harmless to human body but also increases the expression of collagen, elastin and HAS-2 gene, and the expression of MMP-1 gene and ROS Inhibiting activity of the present invention exhibits excellent antioxidation, anti-aging effect and wound healing effect, it can be effectively utilized as a composition for skin improvement, a composition for wound healing, and a composition for antioxidation.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a view showing the appearance of leaves and trees of Piper Cambodianum used in the present invention. FIG.
FIG. 2 is a graph showing the effect of Piper cambodiae extract on cell viability through MTT assay.
FIG. 3 is a view for confirming wound regeneration effect of Piper cambodia nemium extract in a human dermal fibroblast cell line.
FIG. 4 is a graph showing the effect of Piper cambodiae extract on gene expression in a human dermal fibroblast cell line.
FIG. 5 is a graph showing the effect of Piper cambodiae extract on protein expression in human dermal fibroblast cells.
FIG. 6 is a graph showing the effect of the extract of Piper cambodia on the protein expression after UV irradiation.
FIG. 7 is a graph showing the effect of Piper cambodiae extract on the change of ROS activity after UV irradiation. (ROS-NHDF-control 1: Piper Cambodia treated group without UV treatment, ROS-NHDF-40J / 3 min: Piper Cambodia treated group treated with UV of 40 J for 180 seconds)
8 is a view for confirming the wound regeneration effect of the Piper cambodia nemium extract through a change in the wound area ratio in wound model mice.

The present invention provides a cosmetic composition for improving skin comprising Piper cambodianum extract.

Hereinafter, the present invention will be described in more detail.

Skin improvement in the present invention includes anti-aging and wound healing.

In the present invention, anti-aging includes antioxidative effect and wrinkle-reducing effect.

The extract of Piper cambodia nem, which is an active ingredient of the present invention, can be obtained by extraction and separation using extraction and separation methods known in the art, and the 'extract' defined in the present invention can be used as crude extract, polar solvent extract Or non-polar solvent-soluble extracts.

The extraction solvent for extracting the Piper cambodiaeum extract is not limited thereto, but one or more solvents selected from water, alcohols having 1 to 4 carbon atoms, and a mixed solvent thereof may be used, and methanol is preferably used.

The Piper Cambodiaeum extract can be extracted from the stem or leaf of Piper Cambodianum.

The Piper cambodiaeum extract may be a Piper cambodianum P. fourn extract.

The Piper cambodia genus extract may increase the activity of collagen, elastin or HAS-2 gene related to extracellular matrix, and may inhibit the activity of MMP-1 gene, thereby exhibiting wound healing, wrinkle improvement and skin aging prevention effect.

In addition, the above-mentioned Cambodia genus extract inhibits the activity of reactive oxygen species (ROS), thereby inhibiting oxidative stress and thus exhibiting an anti-aging effect through antioxidation.

In addition, the above-mentioned Piper cambodiae extract can exhibit an excellent wound healing effect in an in vitro and wound animal model.

Therefore, the extract of Piper cambodiae according to the present invention can be contained as an active ingredient in a cosmetic composition for improving skin condition.

The cosmetic composition of the present invention may contain one or more known active ingredients having antioxidant or wound-improving effect together with the above-mentioned Piper cambodiaeum extract.

The cosmetic composition of the present invention can be produced in the form of a general emulsified formulation and a solubilized formulation. Cosmetics of emulsified form include nutrition lotion, cream, essence, etc., and cosmetics of solubilized form have softening longevity. More specifically, the cosmetic composition of the present invention may be in the form of a solution, a gel, a solid or a paste anhydrous product, an emulsion obtained by dispersing an oil phase in water, a suspension, an emulsion, a microemulsion, a microcapsule, The composition of the ionic fibrin dispersant may be in the form of a cream, a skin, a lotion, a powder, an ointment, a spray, a paste, a pack, a cleanser containing a soap, a surfactant, an oil, a powder foundation, an emulsion foundation, a wax, And the like. It can also be prepared in the form of a foam or an aerosol composition further containing a compressed propellant.

The cosmetic composition of the present invention may further contain, in addition to the active ingredient Piper cambodia gum extract, a lipid, an organic solvent, a solubilizing agent, a thickening agent and a gelling agent, a softening agent, an antioxidant, a suspending agent, a stabilizer, surfactants, water, ionic or nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents , Lipid vesicles, or any other ingredient commonly used in cosmetics, as well as adjuvants commonly used in the cosmetics or dermatological sciences. In addition, the above ingredients may be introduced in amounts commonly used in the field of dermatology.

When the formulation of the cosmetic composition of the present invention is a paste, a cream or a gel, an animal oil, vegetable oil, wax, paraffin, starch, tracer, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide May be included.

When the formulation of the cosmetic composition of the present invention is a powder or a spray, the carrier component may include lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder and the like. Carbon, propane / butane, dimethyl ether, and the like.

When the formulation of the cosmetic composition of the present invention is a solution or an emulsion, the carrier component may include a solvent, a solubilizing agent, and an emulsifying agent. Specific examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, Octylene glycol, octylene glycol, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, fatty acid esters of sorbitan and the like.

When the formulation of the cosmetic composition of the present invention is a suspension, a liquid diluent such as water, ethanol, propylene glycol or the like as a carrier component; Suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester; Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, trachant, and the like.

When the formulation of the cosmetic composition of the present invention is a surfactant-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, Fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, ethoxylated glycerol fatty acid ester, and the like.

In addition, any of the above components may be compounded within a range that does not impair the objects and effects of the present invention, but is preferably 0.01-10% by weight based on the total weight , More preferably from 0.01% to 5% by weight.

The present invention also provides a pharmaceutical composition for the treatment of wounds comprising Piper cambodia genome extract as an active ingredient.

The pharmaceutical composition of the present invention may further contain one or more known active ingredients having wound healing effect together with the above-mentioned Piper cambodiae extract.

The compositions of the present invention may further comprise suitable carriers, excipients and diluents conventionally used in the manufacture of pharmaceutical compositions. In addition, it can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, oral formulations such as syrups and aerosols, external preparations, suppositories and sterilized injection solutions according to a conventional method. Suitable formulations known in the art are preferably those as disclosed in Remington ' s Pharmaceutical Science, recently, Mack Publishing Company, Easton PA. Examples of carriers, excipients and diluents which may be included include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, Cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When the composition is formulated, it is prepared using a diluent such as a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, or an excipient usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose, lactose, Gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrups and the like. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The term "administering" as used herein is meant to provide any desired composition of the invention to a subject in any suitable manner.

The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and the weight of the individual, the degree of disease, the type of drug, the route of administration and the period of time, but can be appropriately selected by those skilled in the art. For a desired effect, the pharmaceutical composition of the present invention may be administered in an amount of 1 mg / kg to 10000 mg / kg per day, and may be administered once or several times a day.

The pharmaceutical composition of the present invention may be administered to a subject in various routes. All modes of administration may be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine dural or intracerebral injection.

The composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers for wound healing.

The present invention also provides a composition for external application for skin for wound healing, which comprises Piper cambodia genome extract as an active ingredient.

The composition for external application for skin of the present invention may further contain one or more known active ingredients having wound healing effect together with the above-mentioned Piper cambodia nymph extract.

The composition for external application for skin of the present invention is not particularly limited depending on the body part, and may be prepared in any formulations conventionally prepared by referring to known techniques in the art. For example, it can be used in the form of liquid, ointment, cream, lotion, spray, patch, oil, wax, emulsion, suspension, gel or aerosol.

The composition for external application for skin of the present invention may contain conventional additives such as preservatives, solvents to assist drug penetration, softening agents for ointments and creams, and the like, and may contain conventional carriers such as ethanol or oleyl alcohol .

The composition for external application for skin of the present invention is not limited to the above-mentioned components, and may include other components to be incorporated into a usual cosmetic composition or pharmaceutical composition, if necessary. For example, it is possible to use a water-soluble organic solvent such as a preservative, a humectant, an emollient, a surfactant, an organic or inorganic pigment, an organic powder, an ultraviolet absorbent, an antiseptic, a bactericide, an antioxidant, a plant extract, Cold agents, antiperspirants, purified water, and the like.

The present invention also provides a health functional food composition for antioxidant or wound healing, which comprises Piper cambodia genus extract as an active ingredient.

The health functional food of the present invention may contain at least one known active ingredient having an antioxidant or wound-improving effect together with the above-mentioned Piper cambodiaeum extract.

In the present invention, the term "health functional food" refers to a food having a biological control function such as prevention and improvement of disease, bio-defense, immunity, recovery after disease and aging inhibition.

When the Piper cambodiae extract of the present invention is used as a food additive, the Piper Cambodiaeum extract may be directly added or used together with other food or food ingredients, and may be suitably used according to a conventional method. The amount of the active ingredient to be mixed can be suitably determined according to the intended use (prevention, health or therapeutic treatment). Generally, the Piper cambodiae extract of the present invention is added in an amount of not more than 15% by weight, preferably not more than 10% by weight based on the raw material, in the production of food or beverage. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of controlling health, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount exceeding the above range.

There is no particular limitation on the kind of the food. Examples of the foods to which the above substances can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen noodles, gums, ice cream, various soups, drinks, tea, Alcoholic beverages, and vitamin complexes, all of which include health foods in a conventional sense.

The health beverage composition of the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, synthetic sweeteners such as saccharine and aspartame, and the like. The ratio of the natural carbohydrate is generally about 0.01 to 10 g, preferably about 0.01 to 0.1 g per 100 ml of the composition of the present invention.

In addition to the above, the composition of the present invention may further contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, A carbonating agent used in a carbonated beverage, and the like. In addition, the composition of the present invention may comprise flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components may be used independently or in combination. Although the ratio of such additives is not critical, it is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described in more detail with reference to preferred embodiments, experimental examples, and production examples. However, the following Examples, Experimental Examples and Preparation Examples are intended only to illustrate the contents of the present invention and not to limit the present invention.

Example 1 Preparation of Piper Cambodiae Extract

The stem and leaves of Piper cambodianum P. Fourn originating in Vietnam were extracted from methanol by the International Center for Biotechnology (FBN151-010, Barcode PBVN12811). The stem and leaves of the used Piper Cambodianum are shown in Fig.

Example 2 Culture of Human Human Dermal Fibroblast (NHDF) Cell Lines

For the cultivation of human dermal fibroblast cells, 10% fetal bovine serum and 1% antibiotics were added to Dulbecco's modified Eagle's medium (DMEM) and cultured in a 5% CO ₂ incubator at 37 ° C Respectively.

Experimental Example 1. Determination of the effect of Piper Cambodiaeum extract on cell growth rate by MTT assay (Assay)

MTT assay was performed to confirm the cell viability of Piper cambodiae extract. First, human dermal fibroblast cell line (NHDF) was dispensed into 96-well plates in an amount of 1 × 10 ³ , and cultured for 24 hours in the same manner as in Example 2. The following day, the extract of Piper cambodiaum obtained in Example 1 was added at 1 μg / ml, 10 μg / ml and 50 μg / ml, and the cells were cultured for 24 hours. In the control group, Piper Cambodiaeum extract was not treated. After 24 hours, add 10 μl of Ez-Cyto (MTT) reagent to 90 μl of fresh medium per well and incubate for 30 minutes. When the color change begins, measure the absorbance at 450 nm (650 nm) The results are shown in FIG.

As shown in FIG. 2, even when the concentration of Piper cambodiae extract was increased, there was no significant change in cell viability, and it was confirmed that the extract had no cytotoxicity.

Experimental Example 2. Confirmation of wound regeneration effect of Piper cambodiaeum extract on human dermal fibroblast cell line

Human dermal fibroblast cell line was used to confirm wound regeneration effect of Piper cambodiaeum extract. The human dermal fibroblast cells cultured under the same conditions as in Example 2 were divided into 4 wells of each of the 6 well plates at a rate of 10 ⁶ , and when the cells were grown by about 70% the next day, Scratched cell surface. 2 ml of the fresh medium was added to the well, which was not added to the control well. In the remaining three wells of the experimental group, 2 ml of the culture medium contained 1 μg / ml, 10 μg / ml and 50 μg / ml of Piper cambodia . After incubation for 24 hours, the images were confirmed under a microscope. The results are shown in Fig.

As shown in FIG. 3, it was confirmed that the wound regeneration was well performed in the human dermal fibroblast cell line as the concentration of the Piper cambodia genome extract increased. This indicates that the Piper cambodiae extract has a concentration dependent wound regeneration effect.

Experimental Example 3. Confirmation of effect of Piper Cambodiae Extract on gene expression in human dermal fibroblast line through Q-PCR

In order to confirm the effect of Piper cambodia on the gene expression level in human dermal fibroblast cell line, 3 x 10 ⁵ human fibroblast cell lines cultured in the same manner as in Example 2 were dispensed into 6-well plates, Piper cambodiae extracts were treated at a concentration of 1 μg / ml, 10 μg / ml and 50 μg / ml, respectively, and cultured for 24 hours. In the control group, Piper Cambodiaeum extract was not treated. After washing each well with 1X PBS, mRNA was extracted according to the protocol provided by using a commercially available RNA extraction kit (Nanohelix; Pure Helix RNA Extraction Solution Nanohelix) and quantitated with GE Nano vue. For Q-PCR, cDNA was synthesized from mRNA using a cDNA synthesis kit and the activity of extracellular matrix active genes, collagen, elastin, HAS-2 and intercellular protease, MMP-1, was confirmed.

The primers used are shown in Table 1 below, and the PCR cycles are shown in Table 2 below. The statistical analysis of the results was performed using the one-way ANOVA (ANOVA) and the normalized cycle threshold (CT), and the significance was tested at the p <0.05 level. The GAPDH Activity was compared and corrected. The results are shown in Fig.

name primer The DNA sequence from the 5 'end to the 3' Collagen F (Forward) TCC CCA GCC ACA AAG AGT CTA R (Reverse) TTT CCA CAC GTC TCG GTCA MMP-1 F CGA CTC TAG AAA CAC AAG AGC AAGE R AAG GTT AGC TTA CTG TCA CAC GCT T Elastin F CTGCAAAGGCAGCCAAATAC R CACCAGGAACTAACCCAAACT HAS-2 F GCT ACC AGT TTA TCC AAA CG R GGC TGT CAG AGC CTC GTG GCT TTG G

Temperature Time Initial denaturation 95 ℃ 10-15 minutes denaturalization 95 ℃ 10 seconds Annealing 60 ° C 15 seconds Elingation 72 ℃ 15 to 30 seconds Number of Cycles 40 times

As shown in FIG. 4, it was confirmed that the expression of collagen, elastin, and HAS-2 was increased and the expression of MMP-1 was decreased as the concentration of Piper cambodia genome extract increased. This is because the extract of Piper cambodia suppresses the expression of MMP-1 and thereby increases the expression of collagen, elastin, and hyaluronan synthase 2 (HAS-2) .

EXPERIMENTAL EXAMPLE 4 Confirmation of Effect of Piper Cambodiae Extract on Protein Activity in Human Dermal Fibroblast Cell Lines

In order to confirm the effect of Piper cambodiae extract on the activity of the protein in the human dermal fibroblast cell line, the human dermal fibroblast cell line cultured as in Example 2 was dispensed into 6-well plates at 1 × ¹⁰ 6 cells. 2 ml of fresh medium containing no additions was added to the control, and in the remaining three experimental groups, 2 ml of the medium was treated with 1 μg / ml, 10 μg / ml and 50 μg / ml of the extract of Piper cambodiae And cultured for 24 hours. After that, the medium was removed, washed with 1X PBS, and proteins were extracted and quantified with a lysis buffer. Western blotting was performed to confirm the activity of collagen, elastin and ERK2, which are extracellular matrix active proteins, and MMP-3, an activity-inhibiting protein, and the results are shown in FIG.

As shown in FIG. 5, the expression levels of collagen, elastin and ERK2 protein in the human dermal fibroblast cell line were increased and the expression level of MMP-3 was decreased as the concentration of Piper cambodiae extract increased. This indicates that the extract of Piper cambodiae improves the ability of cell elastic reconstruction by increasing the synthesis of collagen, elastin and ERK2, thereby improving wrinkles and having wound healing effect.

Experimental Example 5. Confirmation of Effect of Piper Cambodiae Extract on Protein Activity after UV Irradiation

In order to confirm the effect of the Piper cambodiaeum extract on the protein activity after UV irradiation, which is known to cause aging, the human dermal fibroblast cultured as described in Example 2 was dispensed into 6 well plates at a rate of 1 × 10 ⁶ , Gt; UV &lt; / RTI &gt; 2 ml of fresh medium was added to the control group, and 1 μg / ml, 10 μg / ml and 50 μg / ml of Piper cambodia nymph extract were added to 2 ml of the medium in the remaining three experimental groups and cultured for 24 hours Respectively. Then, the medium was removed, washed with 1X PBS, and proteins were extracted and quantified with a lysis buffer. Thereafter, the activity of TNFR, EGFR, p38, p53 and cJUN, which are known to be activated by UV through western blotting, was confirmed, and the results are shown in Fig.

As shown in FIG. 6, it was confirmed that TNFR, EGFR, p38, p53 and cJUN activity, which are known to be activated by UV in a dose dependent manner, are reduced in the experimental group treated with Piper cambodiaeum extract. This indicates that Piper cambodium has antioxidative and thus anti-aging effects by inhibiting the activity of the sub-proteins regulated by UV irradiation.

Experimental Example 6. Determination of Effect of Piper Cambodiae Extract on Changes in ROS Activity after UV Irradiation

In order to confirm the effect of the Piper cambodiaeum extract on the activity of ROS after UV irradiation, the human skin fibroblast cells cultured in the same manner as in Example 2 were dispensed into 6-well plates at a rate of 1 × ¹⁰ 6 cells / To the three wells of the experimental group, 2 ml of the culture medium was added at a concentration of 1 μg / ml, 10 μg / ml and 50 μg / ml, respectively, and cultured for 24 hours. In the control group, Piper Cambodiaeum extract was not treated. Then, DCFDA (2 ', 7'-dichlorofluorescin diacetate) and CM-H2DCFDA were added and pretreated for 30 minutes, and ROS production was measured by FACS (Flow Cytometry). The results are shown in FIG.

As shown in FIG. 7, it was confirmed that ROS production was increased when irradiated with UV, but that ROS production was significantly decreased when Piper Cambodia rum extract was treated. This indicates that Piper cambodia num inhibits ROS production and thus has antioxidative and anti-aging effects.

Experimental Example 7: Preparation of Piper Cambodiae Extract in vivo Check the effect of wound regeneration in

In order to confirm the wound regeneration effect of Piper cambodiae extract, the injured model mouse's epilator was removed and four scars were wound in the same size. One wound area as a control was not treated with the Piper Cambodianum extract, , And Piper cambodiae extract was treated at a concentration of 1 μg / ml, 10 μg / ml and 50 μg / ml, respectively, and then photographed every day. The results are shown in FIG.

As shown in FIG. 8, it was confirmed that the wound size decreased in the experimental group treated with the Piper cambodia genome extract, and the effect was more remarkable as the concentration increased. This indicates that Piper cambodiaeum extract has an effect of wound healing in vivo .

The statistics of the experiments were ± SD and were recorded as p <0.05 (*), p <0.01.

The Piper cambodianum extract according to the present invention increased the expression of collagen, elastin and HAS-2 gene and inhibited the expression of MMP-1 gene and ROS activity Which can exhibit excellent wound healing and anti-aging effects, and that it can be used variously as a cosmetic composition, a pharmaceutical composition, a composition for external application for skin, and a health functional food composition.

Examples of formulations for the composition of the present invention are illustrated below.

Formulation Example 1. Preparation of cosmetic preparation

1. Flexible longevity manufacturing

0.1% by weight of Piper cambodiae extract

5.2% by weight of 1,3-butylene glycol, 1.5% by weight of oleyl alcohol,

3.2% by weight of ethanol

Polysorbate 20 3.2 wt%

Benzophenone-9 2.0 wt%

1.0% by weight of a carboxyl vinyl polymer, 3.5% by weight of glycerin,

A minor amount of fragrance, a small amount of preservative, and a remaining amount of purified water were mixed to prepare a softening water by a conventional method.

2. Milk lotion manufacturing

0.1% by weight of Piper cambodiae extract

Glycerin 5.1 wt%

Propylene glycol 4.2 wt%

3.0% by weight of tocopheryl acetate

Liquid paraffin 4.6 wt%

1.0% by weight triethanolamine

Squalane 3.1 wt%

Macadamia nut oil 2.5 wt%

Polysorbate 60 1.6 wt%

1.6% by weight &lt; RTI ID = 0.0 &gt;

Propyl paraben 0.6 wt%

Carboxyl vinyl polymer 1.5 wt%

A minor amount of fragrance, a small amount of preservative, and a remaining amount of purified water were mixed to prepare an milk lotion by a conventional method.

3. Nutritional cream manufacturing

0.5% by weight of Piper cambodiae extract

Glycerin 4.0 wt%

Vaseline 3.5 wt%

2.1% by weight triethanolamine

Liquid paraffin 5.3 wt%

Squalane 3.0 wt%

Wax 2.6 wt%

Tocopheryl acetate 5.4 wt%

Polysorbate 60 3.2 wt%

Carboxyl vinyl polymer 1.0 wt%

3.1 weight percent sorbitan sesquioleate

A minor amount of fragrance, a small amount of preservative, and a remaining amount of purified water were mixed to prepare a nutritional cream by a conventional method.

4. Massage cream manufacturing

0.5% by weight of Piper cambodiae extract

Glycerin 4.0 wt%

3.5% by weight of petrolatum, 0.5% by weight of triethanolamine,

Liquid paraffin 24.0 wt%

Squalane 3.0 wt%, wax 2.1 wt%

0.1% by weight of tocopheryl acetate

Polysorbate 60 2.4 wt%

Carboxyl vinyl polymer 1.0 wt%

2.3 weight% sorbitan sesquioleate

A minor amount of fragrance, a small amount of preservative and a remaining amount of purified water were mixed to prepare a massage cream by a conventional method.

Formulation Example 2. Preparation of pharmaceutical preparations

1. Manufacturing of powder

Piper cambodiae extract 20 mg

Lactose 100 mg

Talc 10 mg

The above components are mixed and filled in airtight bags to prepare powders.

2. Preparation of tablets

Piper cambodiae extract 10 mg

Corn starch 100 mg

Lactose 100 mg

Magnesium stearate 2 mg

After mixing the above components, tablets are prepared by tableting according to the usual preparation method of tablets.

3. Preparation of capsules

Piper cambodiae extract 10 mg

Crystalline cellulose 3 mg

Lactose 14.8 mg

Magnesium stearate 0.2 mg

The above components are mixed according to a conventional capsule preparation method and filled in gelatin capsules to prepare capsules.

4. Preparation of injections

Piper cambodiae extract 10 mg

180 mg mannitol

Sterile sterilized water for injection 2974 mg

Na ₂ HPO ₄ 2H ₂ O 26 mg

(2 ml) per 1 ampoule in accordance with the usual injection preparation method.

5. Manufacture of liquids

Piper cambodiae extract 20 mg

10 g per isomer

5 g mannitol

Purified water quantity

Each component was added and dissolved in purified water according to the usual liquid preparation method, and the lemon flavor was added in an appropriate amount. Then, the above components were mixed, and purified water was added thereto. The whole was added with purified water to adjust the total volume to 100 ml, And sterilized to prepare a liquid preparation.

Formulation Example 3. Preparation of food preparation

1. Manufacture of health food

Piper cambodiae extract 100 mg

Vitamin mixture quantity

70 g of vitamin A acetate

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

0.15 mg of vitamin B2

Vitamin B6 0.5 mg

0.2 g of vitamin B12

Vitamin C 10 mg

Biotin 10 g

Nicotinic acid amide 1.7 mg

Folate 50 g

Calcium pantothenate 0.5 mg

Mineral mixture quantity

1.75 mg of ferrous sulfate

0.82 mg of zinc oxide

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Secondary calcium phosphate 55 mg

Potassium citrate 90 mg

Calcium carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

2. Manufacture of health drinks

Piper cambodiae extract 100 mg

Vitamin C 15 g

Vitamin E (powder) 100 g

19.75 g of ferrous lactate

3.5 g of zinc oxide

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B1 0.25 g

Vitamin B2 0.3 g

Water quantification

The above components were mixed according to a conventional health drink manufacturing method, and the mixture was stirred and heated at 85 for about 1 hour. The resulting solution was filtered, sterilized in a sterilized 2 L container, sealed, &Lt; / RTI &gt;

Although the compositional ratio is relatively mixed with a component suitable for a favorite drink, it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as the demand class, the demanding country, and the use purpose.

Claims (11)

A cosmetic composition for improving skin comprising Piper cambodianum extract.
2. The method of claim 1, wherein the Piper cambodiae extract is selected from the group consisting of Piper cambodianum P. Fourn). &Lt; / RTI &gt;
The cosmetic composition for skin improvement according to claim 1, wherein the skin improving agent is for improving wrinkles or preventing aging.
The cosmetic composition for improving skin according to claim 1, wherein the skin improving agent is for wound healing.
The cosmetic composition for skin improvement according to claim 1, wherein the extract is extracted with water, a C ₁ -C ₄ alcohol, or a mixed solvent thereof.
The cosmetic composition for skin improvement according to claim 1, wherein the extract is extracted from a stem or a leaf.
The cosmetic composition for skin improvement according to claim 1, wherein the extract increases the expression of at least one gene selected from the group consisting of collagen, elastin, and hyaluronan synthase 2 (HAS-2) genes .
The cosmetic composition for skin improvement according to claim 1, wherein the extract inhibits the activity of ROS (reactive oxygen species).
A pharmaceutical composition for the treatment of wounds comprising Piper cambodianum extract.
A composition for external application for skin for wound healing comprising Piper cambodianum extract.
An antioxidant or wound health improving food composition comprising Piper cambodianum extract.

Images