KR20170082172A

KR20170082172A - Molecular marker for determining genotype of pink tomato and sorting method for pink tomato using same

Info

Publication number: KR20170082172A
Application number: KR1020160000908A
Authority: KR
Inventors: 노일섭; 황인덕; 정희정; 박종인; 양기웅; 정남희; 김회택
Original assignee: 순천대학교 산학협력단
Priority date: 2016-01-05
Filing date: 2016-01-05
Publication date: 2017-07-14
Also published as: KR101832457B1

Abstract

The present invention relates to a molecular marker capable of discriminating a SlMYB12 genotype of tomato and a method of selecting a tomato showing pink color by confirming the mutation of the SlMYB12 gene using the molecular marker, It is expected that the tomatoes representing simple pink color can be selected and identified before the fruit of the fruit is fully matured, thus saving time, cost and labor in cultivating the actual pink color tomatoes.

Description

Technical Field [0001] The present invention relates to a method for selecting a tomato marker for identifying a genotype of a tomato,

The present invention relates to a molecular marker for discriminating genotypes of tomatoes showing pink coloration and a method for screening tomatoes showing pink coloration using the same. More specifically, the present invention relates to molecular markers capable of discriminating the SlMYB12 genotype of tomatoes, And identifying the mutation of the SlMYB12 gene, thereby selecting a tomato showing pink coloration .

In recent years consumption of fruit and vegetables such as tomatoes ( Solanum lycopersicum ) has been an important factor in consumers. This color is determined by plant pigment such as carotenoids and flavonoids.

Specifically, carotenoids are organic molecules with C40 isoprenoid compounds that accumulate in flowers and fruits and exhibit orange, yellow, and red colors. The carotenoids protect from light during photosynthesis and play an important role in maintaining pollination and spreading seeds (Ronene, G. et al. , 2000, Proc. Natl. Acad. Sci. USA, 97: 11102 Grotewold E, 2006, Auun Rev Plant Biol., 57: 761-780.).

Flabonoids are another large group of plant pigments with various functions including pollination, pathogen protection, and seed propagation (dispense). The flavonoids are dispersed in red, purple, blue pigment (anthocyanin) and some yellow pigment (chalcone and oron) and accumulate mainly in the epidermis of fruit (Harborne JB, 1986, Prog. Clin. Biol. 15-24 .; Harborne JB and Wiliiams CA, 2000, Phytochemistry, 55: 481-504 .; Tanaka Y. et al. , 2008, Plant J. 54: 733-749.). Among the flavonoid compounds, naringenin chalcone is a pigment that accumulates in the epidermis of the fruit during maturation and imparts a yellow pigment, and exhibits the most abundant flavonoid function. Fruits and vegetables such as tomatoes lacking naringenin chalcone are transparent in appearance of the epidermis and exhibit a pinkish color. The deficiency of naringenin chalcone is due to the generation of chalcone synthase (CHS) from p-coumaroyl-CoA and malonyl-CoA, Is transformed into Naringenin (Nar) by an isomerase (CHI) (Muri SR, et al., 2001, Nature Biotechnology, 19: 470-474). In addition, the expression of many flavonoid genes does not affect the production of fruit and vegetables of pink color, and it is reported that pink fruit and vegetables are produced by controlling the protein encoding the pink phenotype in the flavonoid synthesis pathway rather than the biosynthetic enzyme (Bovy A, et al 2002, Plant Cell, 14: 2509-2526 .; Willits MG, et al. , 2005, J. Agric. Food Chem., 53: 1231-1236 .; Verhoeyen ME, et al. , 2002, J. Exp. Bot., 53: 2099-2106 .; Schijlen E. et al. , 2007, Plant Physiol., 152: 71-84.).

On the other hand, SlMYB12 is a transcription factor that regulates the flavonoid biosynthesis in tomatoes and is known to be inhibited in the pink tomato line (Ballester, AR et al. , 2010, Plant Physiol., 152: 71-84; Adato, A. et al. , 2009, PLoS Gent., 5: e1000777.). In addition, gene mapping, and separate analysis, and VIGS (virus-induced gene silencing) results SlMYB12 gene is present in the y locus (locus) of chromosome 1 (chromosome 1), play an important role in forming a pink fruit (Ballester , AR, et al. , 2010, Plant Physiol., 152: 71-84.). Is led to SIMYB12; (nucleotide substitution C> T and 1bp insertion TG> TAG nonsense mutation) More specifically, the pink tomato has two point mutations in the 603bp nucleotide deletion and second exon regions of the upstream region of the SlMYB12 gene from chromosome 1 (Lin T, et al. , 2014, Nat. Genet., 46 (11)), which is produced by transcriptional repression and the introduction of stop codons earlier than normal, thereby reducing the accumulation of naringenin chalcone in the epidermis : 1220-1226.). However, since all of the tomatoes having a true pinkish color do not exhibit the 603bp base deletion in the upstream region and the two point mutations in the second exon region in the SIMYB12 gene as described above, it is difficult to clearly select the tomato showing pinkish coloration have.

Accordingly, the present inventors investigated to develop a novel molecular marker capable of screening all tomatoes having a pink color , and discovered a new mutation region appearing in the SlMYB12 gene of a tomato with pink color , The inventors of the present invention have completed the present invention by confirming that all the tomatoes showing pinkish color can be simply and accurately selected by discriminating the SlMYB12 genotype of the tomato using the molecular marker.

One object of the present invention is to provide a molecular marker for determining the SlMBY12 genotype of tomato.

It is another object of the present invention to provide a method for screening tomatoes having a pink color using the above-mentioned molecular markers.

In one aspect, the invention provides a molecular marker for determining the SlMBY12 genotype of tomato.

Specifically, the present invention provides a primer set comprising (1) a primer set consisting of SEQ ID NOS: 5 and 6, and a primer set consisting of a primer set consisting of SEQ ID NOS: 5 and 7, and (2) Lt; RTI ID = 0.0 > SlMBY12 < / RTI >

In the present invention, the molecular marker is 603bp nucleotide deletion (Lin T, et al, 2014 , Nat Genet, 46 (11)....: 1220-1226) upstream of the area of the SlMYB12 gene and / or gene sequences SlMBY12 Wherein the first base G base in the second intronic region is designed to detect whether it is substituted with a T base. Here, the base sequence of the SlMBY12 gene can be found in the Sol genomics network (http://solgenomics.net).

In one specific example, the primer set consisting of SEQ ID NOS: 5 and 6 is a polynucleotide composed of 8 or more consecutive nucleotides including a base sequence in which a 603 bp base sequence in the upstream region of the SlMYB12 gene is deleted, The nucleotides can be amplified.

In another specific example, the primer set consisting of SEQ ID NOS: 5 and 7 is a polynucleotide consisting of 8 or more consecutive nucleotides including a nucleotide sequence in which a 603 bp base sequence in the upstream region of the SlMYB12 gene is deleted, The nucleotides can be amplified.

In another specific example, the set of primers consisting of SEQ ID NOS: 8 and 9 comprises a polynucleotide consisting of 8 or more consecutive nucleotides comprising the first base in the second intron of SlMBY12 gene, or a complementary polynucleotide thereof .

In the present invention, the deletion of the 603 bp nucleotide sequence upstream of the SlMYB12 gene inhibits the transcription of SlMBY12 and the deletion of the GTAACAG base in the CDS due to the substitution of the G base with the T base at the beginning of the second intron region The termination codon (TAG) is generated at the position of the 90th amino acid, so that the color of the tomato is represented by a pink phenotype.

Accordingly, the molecular marker of the present invention can be used as a kit for discriminating the SlMBY12 genotype of a tomato showing pink coloration and selecting a tomato showing pink coloration .

In the present invention, when the above-mentioned molecular marker is used as a kit for screening tomato showing pink coloration, a reagent for carrying out an amplification reaction such as a buffer solution, a DNA polymerase (for example, Thermus thermostable DNA polymerases obtained from aquatiucs (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Phyrococcus furiosis (Pfu), DNA polymerase joining (Mg2 ⁺ ), dNTPs (dATP, dCTP, dGTP and dTTP) and water (dH ₂ O). The buffer solution includes, but is not limited to, Triton X-100, dimethylsufoxide (DMSO), Tween 20, nonidet P40, PEG 6000, formamide and bovine serum albumin May be further included.

In the present specification, the term "primer" refers to a single strand of oligonucleotide complementary to the gene to be copied, a reagent for polymerization (DNA polymerase or reverse transcriptase) and a different four dNTPs (deoxynucleoside triphosphate < / RTI > in the presence of the template-directed DNA synthesis. The suitable length of the primer is determined by the characteristics of the primer to be used but is usually 18 or more, preferably 20 to 200, more preferably 20 to 100, even more preferably 20 to 30 consecutive Nucleotides that generally require lower temperatures to form sufficiently stable base pairs with the template.

In addition, the primers may incorporate additional features that do not alter the primer properties of primers that serve as a starting point for DNA synthesis. The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

In addition, the primers of the present invention may, if necessary, comprise labels that are detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horseradish oxidase, alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules, chemical groups (such as biotin), and the like.

In another aspect, the present invention relates to a method for screening tomatoes showing pink coloration by confirming the base sequence variation of the SlMYB12 gene from a tomato sample using the molecular marker.

Specifically, the method of selecting tomatoes showing pinkish color of the present invention is as follows: 1) when the 603bp base sequence in the upstream region of the SlMYB12 gene is deleted and the first base in the second intron base sequence of the SlMYB12 gene is 'G'; 2) The 603 bp nucleotide sequence in the upstream region of the SlMYB12 gene is present and the first base G in the second intron nucleotide sequence of the SlMYB12 gene is mutated to T and / or 3) the 603 bp nucleotide sequence in the upstream region of the SlMYB12 gene Or when the first base G of the SlMYB12 gene in the second intron sequence of the SlMYB12 gene is mutated to 'T' in the heterozygous type, it is determined that the tomato is a pink color.

In the present invention, the mutation of the SlMYB12 gene may be confirmed by polymerase chain reaction (PCR), real-time polymerase chain reaction (PCR), quantitative real time polymerase chain reaction, qPCR), western blot, DNA microarray, and the like, but the present invention is not limited thereto.

In one specific embodiment, the deletion of the 603bp nucleotide sequence of the upstream region of the SlMYB12 gene of the present invention is a SlMYB12 gene isolated from the skin of the tomato as a template, the primers designed to amplify a 603bp nucleotide sequence of the upstream region of the SlMYB12 gene (Primer set consisting of SEQ ID NOS: 5 and 6, and primer set consisting of SEQ ID NOS: 5 and 7), followed by performing polymerase chain reaction (PCR) and electrophoresis on agarose gel. Verified as an example, after performing an experiment by the method a single band (347bp) is the 603bp nucleotide sequence of the upstream region of the SlMYB12 gene deletion is judged when it is identified from the gel electrophoresis results, two bands (950bp and 614bp) , It is determined that the 603 bp nucleotide sequence in the upstream region of the SlMYB12 gene has not been deleted. If three bands (950 bp, 614 bp, and 347 bp) are found, the heterozygous type is determined.

In the present invention, the first base in the second intron sequence of the SlMYB12 gene may be selected from the group consisting of direct sequencing, DNA microarray, temperature gradient gel electroresis (TGGE), single strand conformation polymorphism (SSCP) , Dense high performance liqueur chromatography (DHPLC), high-resolution melting (HRM) analysis, and the like. Preferably, DNA sequencing is performed using direct sequencing and HRM -resolution melting method, more preferably high-resolution melting (HRM).

Amplifying the one of a specific embodiment, the second intron of the nucleotide sequence of the first nucleotide variation is a nucleotide sequence the second intron of the nucleotide sequence The first base of one of the SlMYB12 gene as a template, and SlMYB12 gene isolated from the skin of tomatoes of the SlMYB12 gene Real-time polymerase chain reaction (PCR) was performed using a primer set (SEQ ID NOS: 8 and 9) and unlabeled probe (SEQ ID NO: 10) designed for the purpose of performing melting curve analysis . As an example, when the melting curve is confirmed at 60 to 65 ° C, preferably at 63 ° C, the first base of the second intron sequence of the SlMYB12 gene, 'G' Is judged to have been mutated to 'T', and when a melting curve is confirmed at 55 to 60 ° C, preferably at 57.25 ° C, it can be judged that the first base in the second intron nucleotide sequence of the SlMYB12 gene is not mutated , And if two melting curves are identified at the same time, the heterozygous type is determined.

Therefore, the selection method according to the present invention can select and specify the varieties showing simple and precise pinkish color before the fruit of the tomato is completely matured, and thus, it is possible to reduce the time and labor in cultivating the tomato showing the actual pinkish color There is an effect that can be. In addition, since there is no need to carry out additional processes such as restriction enzyme treatment or base sequence analysis, there is an advantage that time and cost can be greatly saved.

The molecular markers and the screening method according to the present invention can select and identify tomatoes that exhibit a pinkish color easily and accurately before the fruits of the tomatoes are fully matured. Therefore, in the cultivation of tomatoes showing true pinkish color, the time, cost, .

Fig. 1 (A) is a photograph showing the epidermis of a tomato showing pinkish color and the skin of a tomato showing reddish-white color.
Fig. 1 (B) is a schematic diagram showing whether a 603 bp deletion and a point mutation of a second intron in the SlMYB12 gene of a tomato showing a pinkish color and a tomato showing a red / yellowish color are mutants.
Fig. 2 is a schematic diagram showing the results of a polymerase chain reaction (PCR) using a primer set (SEQ ID NOS: 5 and 6; and SEQ ID NOS: 5 and 7) prepared according to the present invention, using a SlMYB12 gene isolated from the epidermis of a tomato showing pinkish- PCR), the size of the product amplified by 1.5% agarose gel.
3 is SlMYB12 through HRM analysis using the primer set (SEQ ID NO: 8 and 9) and the probe (SEQ ID NO: 10) produced in accordance with the present invention a SlMYB12 gene isolated from the skin of the tomato showing a pink gwasaek as a template, It is a graph that confirms the genotype of the mutated base in the second intron of the gene.

Hereinafter, the present invention will be described in more detail by way of examples and the like. It is to be understood, however, that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. It will be obvious to you.

Example 1: Preparation of tomato materials

Tomato Biotechnology Research Institute (Korea) provided 20 pink tomatoes. The pink system names of the above 20 points are shown in Table 1 below.

No. System name No. System name One JSSW17-1 11 JSSW17-11 2 JSSW17-2 12 JSSW17-12 3 JSSW17-3 13 JSSW17-13 4 JSSW17-4 14 JSSW17-14 5 JSSW17-5 15 JSSW17-15 6 JSSW17-6 16 JSSW17-16 7 JSSW17-7 17 JSSW17-17 8 JSSW17-8 18 JSSW17-18 9 JSSW17-9 19 JSSW17-19 10 JSSW17-10 20 JSSW17-20

Example 2: SlMYB12 Genomic DNA (gDNA) and cDNA preparation

2-1. Preparation of SlMYB12 genomic DNA (gDNA) of each strain

Only the epidermis was isolated from each line prepared in Example 1, and genomic DNA of each line was extracted according to the manufacturer's method using a plant DNA isolation kit (Qiagen, USA). Then, 0.5 unit Taq DNA polymerase (PROMEGA, Madison, USA), 2.0 mM MgCl ₂ , 0.2 mM dNTPs, PCR solution (TaKara, Japan) and 0.2 μM primer set were mixed with the extracted 5 ng genomic DNA, performing polymerase chain reaction (PCR) to amplify the SlMYB12 genomic DNA was prepared by the SlMYB12 genomic DNA (gDNA). At this time, the primer set was synthesized based on SlMYB12 gene information disclosed in Sol genomics network (http://solgenomics.net), and its nucleotide sequence is shown in Table 2 below. The polymerase chain reaction was pre-denaturated at 94 DEG C for 5 minutes, followed by denaturation at 94 DEG C for 30 seconds, annealing at 60 DEG C for 30 seconds, extension at 72 DEG C for 45 seconds followed by extension for 30 cycles followed by post-extension at 72 ° C for 5 minutes.

2-2. SlMYB12 cDNA preparation for each strain

Only the epidermis was isolated from each strain prepared in Example 1, and RNA of each strain was extracted according to the manufacturer's method using an RNA extraction kit (RNeasy plant mini kit, Qiagen, USA). Specifically, a solution containing guanidine thiocyanate was added to the epidermis of each strain prepared in Example 1 to dissolve and homogenize the RNase, and the RNase was inactivated. Then, ethanol was added to the RNeasy mini spin column, and the RNA was dissolved, homogenized and RNase-inactivated in the column, and the total RNA was bound to the column membrane. Then, 30 μl of RNase free distilled water was added to the column to extract total RNA. Then, the extracted RNA was synthesized with cDNA using a reverse transcriptase (superscript II reverse-transcriptase, Invitrogen, USA). Specifically, 50 μl oligo dT primer and RNase / DNase free distilled water were added to 1 μg of the previously isolated RNA, and the whole RNA was denatured by treatment at 65 ° C for 5 minutes. After cooling rapidly for 1 to 2 minutes on ice, 2 μL of reverse transcriptase and 10 μL of 2X mixed reaction solution were added and reacted at 50 ° C. for 50 minutes to synthesize cDNA. The reaction was then quenched by heat treatment at 80 ° C for 5 minutes.

The synthesized cDNA was mixed with 0.5 unit Taq DNA polymerase (PROMEGA, Madison, USA), 2.0 mM MgCl ₂ , 0.2 mM dNTPs, PCR solution (TaKara, Japan) and 0.2 μM primer set, PCR) was performed to amplify SlMYB12 cDNA. At this time, the primer set was synthesized based on SlMYB12 gene information disclosed in Sol genomics network (http://solgenomics.net), and its nucleotide sequence is shown in Table 2 below. The polymerase chain reaction was pre-denaturated at 94 DEG C for 5 minutes, followed by denaturation at 94 DEG C for 30 seconds, annealing at 60 DEG C for 30 seconds, extension at 72 DEG C for 45 seconds followed by extension for 30 cycles followed by post-extension at 72 ° C for 5 minutes.

Primer name The primer sequence (5 '- > 3') Usage MYB12F3 ATGCCGGTACGATTACCTACTAATCT (SEQ ID NO: 1) Genomic DNA cloning MYB12-i2-cR2 CTAGCTCGAATCCATTACACTATGTTA (SEQ ID NO: 2) Genomic DNA cloning MYB12CDSF TCATTGCCTTTTGCTTCTCCATTTTGT (SEQ ID NO: 3) cDNA cloning MYB12CDSR CTAAGACAAAAGCCAAGATACAATGGTAC (SEQ ID NO: 4) cDNA cloning

Example 3: SlMYB12 Genomic DNA (gDNA) and cDNA sequencing

The SlMYB12 genomic DNA (gDNA) or cDNA of each strain prepared in Example 2 was cloned into a blunt vector (TOPcloner ™ Blunt kit, EZ002S, Enzynomics, Korea) in which both ends were cut off. Then, the SlMYB12 genomic DNA (gDNA) or a vector containing the cDNA was transformed into E. coli that had increased membrane permeability, that is, transformed cells, and then plasmid DNA kit (12125, Qiagen, USA) To extract a vector containing the SlMYB12 gene. Then, the extracted SlMYB12 genomic DNA (gDNA), or a vector containing the cDNA, was submitted to macrogen crop (Korea) for sequencing using M13 primer in the vector.

It has been reported by Lin et al. (2014) that pink chromosomal traits are deleted by 603bp sequence deletion in the upstream region of the SlMYB12 gene and that the 'A' base is inserted in the second exon or the 'C' base is replaced by 'T' Unlike the case, two SNP regions in which the 'A' base was added in the second exon region of the SlMYB12 gene of all the tomatoes used in the present invention and the 'C' base was substituted with 'T' Among the tomato lines, JSSW17-4, 11, 13 and 20 showed a gene in which 603 bp of the start codon was deleted. In the second intron region of the SlMYB12 gene, a new gene in which 'G' was substituted with 'T' was identified. When 'G' was substituted with 'T', a 7 bp base (GTAACAG) Was deleted. The results of the genotyping analysis are summarized in Table 3.

No. System name Phenotype genotype 603bp nucleotide deletion in the upstream region Insert 'A' in the second exon In the second exon
'C' is replaced with 'T' At the start of the second intron, 'G' is replaced with 'T' One JSSW17-1 pink H - / - C T / G 2 JSSW17-2 pink H - / - C T / G 3 JSSW17-3 pink H - / - C T / G 4 JSSW17-4 pink D - / - C G 5 JSSW17-5 pink H - / - C T / G 6 JSSW17-6 pink H - / - C T / G 7 JSSW17-7 pink H - / - C T / G 8 JSSW17-8 pink H - / - C T / G 9 JSSW17-9 pink N - / - C T 10 JSSW17-10 pink H - / - C T / G 11 JSSW17-11 pink D - / - C G 12 JSSW17-12 pink H - / - C T / G 13 JSSW17-13 pink D - / - C G 14 JSSW17-14 pink N - / - C T 15 JSSW17-15 pink H - / - C T / G 16 JSSW17-16 pink H - / - C T / G 17 JSSW17-17 pink N - / - C T 18 JSSW17-18 pink H - / - C T / G 19 JSSW17-19 pink H - / - C T / G 20 JSSW17-20 pink D - / - C G N: normal, H: heterozygote, D: deletion

As shown in Table 3 above, the tomatoes expressing the pink expression trait used in the present study were SlMYB12 ( Ii ) only 603 bp of the upstream region of the SlMYB12 gene is deleted, (iii) 603 bp of the upstream region of the SlMYB12 gene is deleted, and (iii) A region in which the 'G' is replaced with 'T' in the second intron, and iv) a region in which the first base 'G' in the second intron is replaced with 'T' is deleted in the region 603bp upstream of the SlMYB12 gene. Respectively.

Example 4: Generation of discrimination markers capable of discriminating genotypes of tomatoes showing pink phenotype and genotyping of tomatoes showing pink phenotype using the discriminating markers

4-1. Manufacture of discrimination markers

Based on the nucleotide sequence of the SlMYB12 gene analyzed in Example 3, a primer set capable of amplifying a 603 bp nucleotide sequence deletion region upstream of the SlMYB12 gene and a region in which a 'G' is replaced with 'T' in the second intron And a probe was designed and synthesized by asking Macrogen. The sequence of the primer set and probe is shown in Table 4 below.

designation The primer sequence (5 '- > 3') Usage MYB12-603del-aF1 GTGACGAACAACCGACCTAGAATAA (SEQ ID NO: 5) SCAR marker MYB12-603del-aR6 GCGGACAAAGTTAATTGGTCACTCA (SEQ ID NO: 6) SCAR marker MYB12-603del-aR5 ATTCTAGCGTTATCAGTCGGCATACA (SEQ ID NO: 7) SCAR marker SlMYB12-i2-aF1 GATTATTGAGATGCGGAAAGAGTTGT (SEQ ID NO: 8) HRM primer SlMYB12-i2-aR1 ACAAAATGAGTGGTTTAATTAGCAAGCT (SEQ ID NO: 9) HRM primer SlMYB12-i2-pF2 CTTTGGGTAACAGTTAATTAGTCAATTA (SEQ ID NO: 10) HRM probe

4-2. SCAR (sequence characterized amlified region) analysis to distinguish SlMYB12 genotype of tomato

Using a primer set consisting of SEQ ID NOS: 5 and 6 prepared in 4-1 above or a primer set consisting of SEQ ID NOS: 6 and 7, using the SlMYB12 genomic DNA (gDNA) of each strain prepared in Example 2 as a template, Polymerase chain reaction (PCR) was performed. PCR was performed by pre-denaturation at 94 ° C for 5 minutes followed by denaturation at 94 ° C for 30 seconds, annealing at 60 ° C for 30 seconds, extension at 72 ° C for 45 seconds After 30 cycles, post-extension was carried out at 72 < 0 > C for 5 minutes. The product produced by the PCR was inserted into 1.5% agarose gel with 0.5 μg / ml of EtBr and the band was confirmed on UV. The results are shown in Fig.

As shown in FIG. 2, the grid JSSW17-9, 14, and 17 having the genotype 603bp nucleotide sequence is not deleted in the upstream region of the gene was verified by SlMYB12 two bands of 960bp and 614bp in size, the upstream region of the gene SlMYB12 , A single band of a size of 347 bp was confirmed in JSSW17-4, 11, 13, and 20, which have genotypes lacking the 603 bp nucleotide sequence. In addition, three bands of 960 bp, 614 bp, and 347 bp were found in 13 lines in which the 603 bp deletion region of the upstream region of the SlMYB12 gene appeared heterozygous.

4-3. HRM (high-resolution melting) analysis to distinguish SlMYB12 genotype of tomato

A primer set consisting of SEQ ID NOS: 8 and 9 prepared in 4-1 above, a probe of SEQ ID NO: 10 in which 3'-terminal was unlabeled, and a 2X reaction (SEQ ID NO: (LightScanner Master Mix), distilled water was added to a final volume of 20 μl, pre-denaturation was performed at 95 ° C for 5 minutes, denaturation was performed at 95 ° C for 20 seconds, Followed by 30 cycles of extension at 72 ° C for 30 seconds followed by real-time PCR (PCR) at 72 ° C for 40 seconds post-extension. Then, the amplified sample was analyzed for melting curve by measuring the amount of fluorescence at a programmed temperature of 40 ° C to 80 ° C at a rate of 0.2 ° C per second using a LightScanner (LightScanner ^® Instrument System, Idaho Technology, USA). The results are shown in Fig.

As shown in FIG. 3, JSSW17-9, 14, and 17, which have a base sequence in which G 'is replaced with' T 'in the second intron of the SlMYB12 gene, have melting curves (red) And a melting curve (blue) was observed at 57.25 ° C for JSSW 17-4, 11, 13, and 20, which have a base sequence in which G 'is not substituted with' T 'in the second intron of SlMYB12 gene , And the remaining 13 lines with the nucleotide sequence of the G / T heterozygote in the second intron of the SlMYB12 gene were confirmed to have two melting curves (green) at 57.25 ° C and 63 ° C.

<110> Sunchon University Industry-Academic Cooperation Foundation <120> Molecular marker for determining genotype of pink tomato and sorting method for pink tomato using same <130> PA-15-0216 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MYB12F3 primer sequence <400> 1 atgccggtac gattacctac taatct 26 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MYB12-i2-cR2 primer sequence <400> 2 ctagctcgaa tccattacac tatgtta 27 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MYB12 CDSF primer sequence <400> 3 tcattgcctt ttgcttctcc attttgt 27 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> MYB12 CDSR primer sequence <400> 4 ctaagacaaa agccaagata caatggtac 29 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MYB12-603del-aF1 primer sequence <400> 5 gtgacgaaca accgacctag aataa 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> MYB12-603del-aR6 primer sequence <400> 6 gcggacaaag ttaattggtc actca 25 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MYB12-603del-aR5 primer sequence <400> 7 attctagcgt tatcagtcgg cataca 26 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SlMYB12-i2-aF1 primer sequence <400> 8 gattattgag atgcggaaag agttgt 26 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SlMYB12-i2-aR1 primer sequence <400> 9 acaaaatgag tggtttaatt agcaagct 28 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SlMYB12-i2-pF2 probe sequence <400> 10 ctttgggtaa cagttaatta gtcaatta 28

Claims

(1) at least one primer set selected from the group consisting of the primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6, and the primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 7, and (2) Molecular marker to identify the pink-colored genotype of the containing tomato.

The tomato is selected by analyzing the mutation of the SlMYB12 gene. The tomato is selected by 1) the 603bp base sequence in the upstream region of the SlMYB12 gene in the base sequence of the SlMYB12 gene is deleted, and the second intron of the SlMYB12 gene 2) the deletion of the 603 bp base sequence in the upstream region of the SlMYB12 gene in the base sequence of the SlMYB12 gene, and the deletion of the first base of the second intron base sequence of the SlMYB12 gene in the base sequence 'G' And / or 3) when the 603 bp base sequence in the upstream region of the SlMYB12 gene is deleted or the first base in the second intron base sequence of the SlMYB12 gene is mutated to 'T' Is a tomato showing a pinkish color, when it appears at the same time as a heterozygous type, Screening methods.

The method of claim 2, wherein the deletion of the 603bp nucleotide sequence of the upstream region of the SlMYB12 gene in the SlMYB12 gene isolated from tomato as a template, and SEQ ID NO: 5 and SEQ ID NO primer set consisting of 6, and SEQ ID NO: 5 and SEQ ID NO: 7 Wherein the primer set is selected from the group consisting of primers set in the order of the number of bands, and the number of bands is determined by polymerase chain reaction (PCR).

The method of claim 2, wherein the two sides of the first base of the second intron of the nucleotide sequence of the SlMYB12 gene is a SlMYB12 gene isolated from tomato as a template, using a primer set and the probe of SEQ ID NO: 10 consisting of SEQ ID NO: 8 and 9 When the melting curve is confirmed at 60 to 65 ° C, the first base of the second intron base sequence of the SlMYB12 gene is amplified by a real-time polymerase reaction (PCR) Is determined to be mutated.