KR101395883B1 - Molecular Markers for Selecting of Bulb Color in Onion - Google Patents

Abstract

The present invention relates to a novel nucleic acid molecule marker capable of screening a yellow or red goat of an onion variety and its use. According to the present invention, polymorphisms associated with chrominance between red and yellow onions ( Allium cepa L.) can be identified within a short time, thereby clearly identifying yellow and red individuals in the F ₂ segregating population of the onion, And can be used as a function marker by clearly selecting red individuals that are separated from the red color. Also, it is possible to mass-produce red onion cultivars selected using the molecular markers of the present invention, and accurate genetic quality analysis is possible.

Description

{Molecular Markers for Selecting of Bulb Color in Onion}

The present invention relates to a novel nucleic acid molecule marker capable of screening a yellow or red goat of an onion variety and its use.

The bulb color is onion ( Allium cepa L.) is an important plant characteristic in breeding programs. Red, yellow and white goat colors are common in onion varieties. Rarely reported colors are golden (Kim et al. 2004b) and chartreuse (El-Shafie and Davis 1967) colors. In addition to qualitative color differences, quantitatively different spectra of different goofy colors exist in red or yellow onions. The pigments that are associated with the onion goofy color are fluorobondoid compounds.

Flavonoids are one of the secondary metabolites of plants and have the function of UV blocking, pigmentation and disease resistance (Shirley 1996; Dao et al 2011; Fini et al 2011). Up to now, more than 8,000 flavonoid derivatives have been reported in plants (Veitch and Grayer 2011) and 54 flavonoids have been identified in onions (Fossen et al. 1996; Rhodes and Price 1996; Slimestad et al. 2007). Quercetin is the most abundant flavonoid in onion goby (bulb), and anthocyanin is the causative pigment of red goop color. A number of studies have been reported on the health benefits of flavonoids such as strong antioxidant and anticancer activities (Cook and Samman 1996; Lotto and Frei 2006; Clere et al 2011; Cushnie and Lamb 2011; Nishiumi et al. 2011 ; Russo et al., 2012).

Anthocyanin biosynthetic pathways have been extensively studied in model plants such as maize, snapdragon and petunia (Holton and Cornish 1995). Various mutants of the color phenotype of these plant species have been used to isolate enzymes encoding structural genes associated with the biosynthetic pathway. (Ferrer et al. 2008; Vogt 2010). Also, multiple regulatory genes have been identified that regulate expression of all or part of the structural gene in the pathway (Goodrich et al., 1992; Quattrocchio et al., 1993; Holton and Cornish, 1995; Spelt et al., 2000; Yamazaki et al. 2003). Accumulated sequence information of genes isolated from model plant species has been used to isolate the onion genes associated with the anthocyanin biosynthetic pathway and has been used to characterize the mechanism of the onion coloration (Kim et al., 2004a; Kim et al. 2005a).

Five major loci related to the inheritance of onion goat color have been reported (Rieman 1931; Clarke et al. 1944; El-Shafie and Davis 1967). The I and C loci determine the white goofy color. Regardless of the genotypes of the other four loci, the dominant I allele suppresses color expression, resulting in white goat color. The heterozygous genotype of I locus is either buff or creamy (El-Shafie and Davis 1967). When the genotype of the C locus is homozygous recessive, the C locus, the basic coloring factor, is associated with the white goat color. C- locus may be a regulatory gene that regulates genes encoding CHS (chalcone synthase), a major enzyme in the pathway of flavonoid biosynthesis. Kim et al. (2005b) is the C locus genotype homozygous recessive the enemy, white F ₂ separation plant in two onion (segregating plants) CHS Indicating that the transcription of the gene was significantly reduced.

The genotypes I , C, and G are ii / C - / gg , The G- locus is associated with the color chartreuse (El-Shafie and Davis 1967). G- loci are still unconfirmed, but genes associated with golden color, which showed an epistatic interaction pattern similar to the chartreuse color, were identified. Inactivation of the gene encoding CHI (chalcone isomerase) due to the presence of a premature stop codon causes the production of gold (Kim et al., 2004b). The accumulated chalcone can be a golden pigment since the CHI enzyme acts on the next step of CHS in the anthocyanin biosynthetic pathway and catalyzes the conversion of chalcone to naringenin.

The R and L loci are complementarily related to the generation of red goofy colors. At least one dominant allele of two loci is required to generate a red goofy color (El-Shafie and Davis 1967). R and L loci are genes encoding DFR (dihydroflavonol 4-reductase) and ANS (anthocyanidin synthase), respectively (Kim et al. 2005a, 2005c). Inactivation of the DFR gene caused by deletion of the 3 'coding sequence determines the color difference between yellow and red onion (Kim et al., 2005c). On the other hand, inactivation of the ANS gene caused by the presence of significant amino acid changes in the conserved region has been confirmed in the yellow onion that has been bred in Brazil (Kim et al., 2005a). F ₁ hybrids between the yellow onion containing the inactivated DFR gene and the Brazilian yellow onion containing the inactivated ANS gene produce red goat color by complementation and the F ₂ population is 9 : The ratio of red onion to yellow onion of 7 (Kim et al. 2005a).

In addition, two homologous DFR genes were isolated, which are known as pseudogenes. To distinguish active DFR genes from other homologous genes, the active DFR gene was designed with the DFR- A gene and two other homologs designated as DFR- B and DFR- C (Kim et al. 2005c ). The inactivated DFR- A allele isolated from yellow onion was designated DFR-A ^TRN . Two additional inactivated DFR- A alleles were identified in onion cultivars breeding in Korea and Japan, and these were identified as DFR - A ^PS and DFR - A ^DEL (Kim et al. 2009). The DFR - A ^PS allele contains the premature stop codon and the DFR-A ^DEL The allele is the entire DFR- A gene deleted.

In the present invention, the present inventors have discovered that an ideal functional marker for screening a DFR - A ^PS allele based on a sequence motif that generates a premature stop codon and a DFR- A ^DEL Simple PCR markers for reliable screening of alleles have been developed. In addition, the distribution of inactivated DFR- A allele was investigated using molecular markers developed from onion cultivars breed in Korea and Japan.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a molecular marker capable of screening genetically fixed red individuals in the development of red cultivars by crossing the yellow variety of onion suitable for domestic cultivation with the red genetic resource introduced from abroad. As a result, red and yellow onions ( Allium cepa L.). As a result of the development of molecular markers for the mutation of the gene encoding DFR (dihydroflavonol 4-reductase), the yellow and red individuals were clearly identified in the F ₂ segregation group, In addition, the present invention has been accomplished by confirming that red individuals, which are genetically fixed red and separated, can be clearly selected and used as function markers.

Accordingly, an object of the present invention is to provide a nucleic acid molecule for yellow goose or red goose selection of an onion variety.

Another object of the present invention is to provide a primer set for screening yellow goose or red goose of an onion variety.

It is still another object of the present invention to provide a yellow goose or red goose sorting kit of an onion variety.

Another object of the present invention is to provide a method of selecting a yellow or red goat of an onion variety.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a nucleic acid molecule for yellow goose selection of an onion variety comprising a nucleotide sequence of the first sequence of the sequence listing.

According to another aspect of the present invention, there is provided a nucleic acid molecule for red goose selection of onion cultivars comprising the nucleotide sequence of the second sequence of the sequence listing.

According to another aspect of the present invention, there is provided a nucleic acid molecule for yellow goose selection of an onion variety comprising a nucleotide sequence of the third sequence of Sequence Listing.

In accordance with another aspect of the present invention, there is provided a nucleic acid molecule for red goose selection of an onion variety comprising a nucleotide sequence of Sequence Listing 4.

The present inventors have sought to develop a molecular marker capable of screening genetically fixed red individuals in the development of red cultivars by crossing the yellow variety of onion suitable for domestic cultivation with the red genetic resource introduced from abroad. As a result, the red and yellow onion (Allium cepa L.) After a developing color difference and molecular beacon targeting variants of the gene encoding DFR (dihydroflavonol 4-reductase) which is associated between, F ₂ separated from the yellow group It was confirmed that the individual and the red individual could be clearly identified and also the red individuals with genetically fixed red and segregation could be clearly selected and used as function markers.

The present invention provides nucleic acid molecules comprising the nucleotide sequence of the first to fourth sequences of the sequence listing.

As used herein, the term " nucleic acid molecule " has the meaning inclusive of DNA (gDNA and cDNA) and RNA molecules. In the nucleic acid molecule, the nucleotide which is a basic constituent unit is not only a natural nucleotide, Also included are analogues (Scheit, Nucleotide Analogs , John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990)).

SEQ ID NO: 1 and the second sequence is irradiated with the red and onion varieties gene encoding DFR (dihydroflavonol 4-reductase) to determine the color difference of the yellow variant of DFR -A for domestic yellow resources DFR - the coding region of the a gene was confirmed to have a genotype which there is a premature stop codon (premature stop codon), which adenine (a to determine the difference between the DFR genes of -A -A DFR gene and variants to create a normal red ) Nucleotide was a single nucleotide polymorphism (SN) converted to a thymine (T) nucleotide, and it was a molecular marker developed for easy identification. The first sequence of the sequence listing is a nucleic acid molecule for yellow goose selection of an onion variety, and the second sequence is a nucleic acid molecule for red goose selection of an onion variety.

Sequence Listing The third and fourth sequences were developed as molecular markers for selection of the DFR - A ^DEL allele in which the entire DFR- A gene has been deleted. Sequence Listing 3 is the nucleotide sequence of the yellow goose selection nucleic acid And Sequence Listing 4 is a nucleic acid molecule for red goose selection of onion varieties.

Considering a variant with biologically equivalent activity, the nucleic acid molecule of the present invention is interpreted to include a sequence that exhibits substantial identity with the sequence set forth in the sequence listing. The above-mentioned substantial identity is determined by aligning the above-described sequence of the present invention with any other sequence as much as possible, and analyzing the aligned sequence using an algorithm commonly used in the art, at least 80% Homology, more preferably 90% homology, and most preferably 98% homology. Alignment methods for sequence comparison are well known in the art. Various methods and algorithms for alignment are described by Smith and Waterman, Adv . Appl . Math. 2: 482 (1981); Needleman and Wunsch, J. Mol . Bio . 48: 443 (1970); Pearson and Lipman, Methods in Mol . Biol . 24: 307-31 (1988); Higgins and Sharp, Gene 73: 237-44 (1988); Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc . Acids Res . 16: 10881-90 (1988); Huang et al., Comp . Appl . BioSci . 8: 155-65 (1992) and Pearson et al., Meth . Mol . Biol . 24: 307-31 (1994). The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol . Biol . 215: 403-10 (1990)) is accessible from National Center for Biological Information (NBCI) It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. BLSAT is available at http://www.ncbi.nlm.nih.gov/BLAST/.

A method for comparing sequence homology using this program can be found at http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html.

The nucleic acid molecule comprising the nucleotide sequence of the first to fourth sequences of the Sequence Listing above can be used in a breeding program of the onion through the crossing of the yellow and red cultivars of the onion to the segregation of the subsequent population, Can be used as a genetic marker useful for marker-assisted selection in isolating individuals and red individuals and selecting red individuals that are genetically fixed homozygous and heterozygous.

According to another aspect of the present invention, the present invention provides a method for amplifying a nucleic acid molecule comprising a nucleotide sequence of the first or second sequence of the present invention, Of yellow onion or red goose of an onion variety including a primer set of the primer set of the present invention.

According to another aspect of the present invention, there is provided a kit for screening a yellow or red goat of an onion variety comprising a primer set of the Sequence Listing 5 sequence and the Sequence Listing 6 sequence.

The primer set of Sequence Listing 5 and Sequence Listing 6 was designed to screen for A / T transitions, which are SNPs generated by premature stop codons that inactivate the DFR - A ^PS allele derived cleaved amplified polymorphic sequences (dCAPS) primers.

The primer set is a primer that hybridizes (or anneals) to a sequence flanking the mutation site. In particular, the primer of the Sequence Listing 6 sequence is a dCAPS primer designed to discriminate the SNP as a reverse primer, introducing a single mismatched 'G' sequence to generate Xba I in the DFR - A ^PS allele And provides a recognition sequence of only the restriction enzyme. In order to prevent the amplification of two homologous pseudogenes DFR- B and DFR- C genes, the primer of Sequence Listing 5, which is a forward primer, contains a 499 bp deletion region of the DFR- C gene and a primer sequence At the 3 ' end, the region containing three mismatches between the DFR- A and DFR- B genes.

When the nucleic acid molecule containing the nucleotide sequence of the first sequence is obtained as an amplification product by gene amplification (for example, PCR) using the primer set, the goip color of the onion variety is determined to be yellow, When only the nucleic acid molecule containing the nucleotide sequence of the second sequence of the sequence listing is obtained as an amplification product, the goofy color of the onion variety is judged to be a homozygous red, and the first sequence of the sequence listing and the second sequence of the sequence listing If the nucleic acid molecule containing the nucleotide sequence is obtained as an amplification product, the goofy color of the onion varieties is determined to be heterozygous.

The primers and kits can clearly screen red F ₂ plants that are homozygous and heterozygous.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8 which can amplify a nucleic acid molecule comprising the nucleotide sequence of the third or fourth sequence of the above- Or a primer set of SEQ ID NO: 7 and a sequence set forth in SEQ ID NO: 9, is provided as a primer set for selecting a yellow goat or a red goat of an onion variety.

According to another aspect of the present invention, the present invention provides a primer set of SEQ ID NO: 7 or SEQ ID NO: 8 or a yellow goat of an onion variety comprising a primer set of SEQ ID NO: A red goose screening kit is provided.

The primer set of SEQ ID No. 7 and the sequence No. 8 of SEQ ID No. 8 or the sequence set No. 7 and the sequence No. 9 of the 9th sequence are those in which the entire DFR- A gene is deleted for use as an Indel (insertion deletion) It is a primer designed for the screening of the DFR - A ^DEL allele.

The primer set is a primer that is hybridized (or annealed) to a sequence flanking the site of the Indel (insertion deletion) mutation.

As a result of gene amplification (for example, PCR) using the above primer set, when the nucleic acid molecule including the nucleotide sequence of the third sequence of the Sequence Listing is amplified, the goip color of the onion variety is determined to be yellow, When the nucleic acid molecule containing the nucleotide sequence of the fourth sequence is amplified, the goip color of the onion varieties is determined to be red.

The red and yellow F ₂ plants can be clearly screened with the primers and kit.

As used herein, the term " primer " means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at suitable temperature and pH conditions. Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides. The design of such a primer can be easily carried out by a person skilled in the art with reference to the above-mentioned nucleotide sequence, for example, by using a program for primer design (for example, PRIMER 3 program).

The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The appropriate length of the primer is determined by a number of factors, such as temperature, application, and the source of the primer. The term " annealing " or " priming " means that the oligodeoxynucleotide or nucleic acid is apposited to the template nucleic acid, which polymerizes the nucleotide to form a complementary nucleic acid molecule to the template nucleic acid or a portion thereof .

The primers used in the present invention include sequences substantially complementary to the target nucleic acid sequence. The term " complementary " means that under certain annealing or hybridization conditions the primer or probe is sufficiently complementary to hybridize selectively to the target nucleic acid sequence and is substantially complementary and perfectly complementary , And preferably means completely complementary. Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides.

The term " hybridization " in this specification means that two single-stranded nucleic acids form a duplex structure by pairing complementary base sequences. Hybridization can occur either in perfect match between single stranded nucleic acid sequences or in the presence of some mismatching nucleotides. The degree of complementarity required for hybridization can vary depending on hybridization reaction conditions, and can be controlled by temperature.

The terms " annealing " and " hybridization " are no different and are used interchangeably herein.

The present invention can provide a kit for screening a yellow goat or a red goat of an onion variety including a probe that hybridizes with a target sequence.

As used herein, the term " probe "is a single-stranded nucleic acid molecule comprising a sequence substantially complementary to a target nucleic acid sequence. Preferably, the probe is a deoxyribonucleotide and a single strand. Naturally occurring dNMPs (i.e. dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, probes may also comprise ribonucleotides.

According to another aspect of the present invention, the present invention provides a method of screening a yellow or red goat of an onion variety comprising: (a) obtaining gDNA (genomic DNA) from an onion; And (b) analyzing whether a nucleic acid molecule comprising a nucleotide sequence of the first or second sequence of the sequence listing is present in the gDNA of the onion; In the step (b), when only the nucleic acid molecule including the nucleotide sequence of the first sequence of the sequence listing exists, the goip color of the onion variety is determined to be yellow, and the nucleotide sequence of the nucleotide sequence of the second sequence When only the nucleic acid molecule is present, the goofy color of the onion varieties is judged as a homozygous red color. If nucleic acid molecules containing the nucleotide sequence of the first sequence of the sequence listing and the second sequence of the sequence listing are present The goofy color of onion varieties is judged to be heterozygous.

According to another aspect of the present invention, the present invention provides a method of screening a yellow or red goat of an onion variety comprising: (a) obtaining gDNA (genomic DNA) from an onion; And (b) analyzing whether a nucleic acid molecule comprising a nucleotide sequence of the third or fourth sequence of the sequence listing is present in the gDNA of the onion; In the step (b), when a nucleic acid molecule including the nucleotide sequence of the third sequence of the sequence listing is present, the goip color of the onion variety is determined to be yellow, and the nucleic acid comprising the nucleotide sequence of the fourth sequence When the molecule is present, the goip color of the onion variety is judged to be red.

Among the two methods of the present invention, the first method utilizes a functional marker based on a premature stop codon that inactivates the DFR - A ^PS allele, and the second method uses the entire DFR- A gene Using a molecular marker for selection of the deleted, DFR - A ^DEL allele.

According to the method of the present invention, first gDNA is obtained from an onion.

The gDNA can be obtained from various organs of onion, for example, from leaves, roots, stems, seeds, bulbs, gooses, flowers or hibiscus, and most preferably from leaves or germinated gooses. Plants as a source of nucleic acid molecules can be used as sources, whatever the stage of development.

Methods for isolating / obtaining gDNA from onion can be accomplished through a variety of methods known in the art (see Murray MG, Thompson WF, Rapid isolation of high-molecular-weight plant DNA. Nucleic Acids Res 8: 4321-4326 (1980)).

Step (b) can be carried out according to various gene analysis methods known in the art.

According to a preferred embodiment of the present invention, the step (b) is carried out according to a gene amplification method using a primer.

According to a preferred embodiment of the present invention, the step (b) is performed according to a hybridization method using a probe.

According to a preferred embodiment of the present invention, step (b) is performed by sequencing.

When the method of the present invention is carried out in accordance with a hybridization method using a probe, a probe is immobilized on a solid phase surface of a solid phase such as a microarray. When the method of the present invention is carried out through gene amplification, a primer is used.

In the microarray of the present invention, the probe is used as a hybridizable array element and immobilized on a substrate. Preferred gases include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic beads or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries, as suitable rigid or semi-rigid supports. The hybridization array elements are arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bound by UV on a polylysine coating surface. In addition, the hybridization array element may be coupled to the gas through a linker (e.g., ethylene glycol oligomer and diamine).

On the other hand, the sample DNA to be applied to the microarray of the present invention can be labeled and hybridized with the array elements on the microarray. Hybridization conditions can be varied. The detection and analysis of the hybridization degree can be variously carried out according to the labeling substance.

The method of the present invention can be carried out based on hybridization. In this case, a probe having a sequence complementary to the nucleotide sequence of the markers of the present invention described above is used.

Hybridization-based analysis can be performed using a probe hybridized to the nucleotide sequence of the markers of the present invention to select a yellow or red goat of an onion variety.

The label of the probe may provide a signal to detect hybridization, which may be linked to an oligonucleotide. Suitable labels include fluorescent moieties (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent moieties, magnetic particles, (P ³² and S ³⁵ ), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), joins, substrates for enzymes, heavy metals such as gold and antibodies, streptavidin , Haptens with specific binding partners such as biotin, digoxigenin and chelating groups. Markers can be generated using a variety of methods routinely practiced in the art such as the nick translation method, the Multiprime DNA labeling systems booklet (Amersham, 1989) and the kaination method (Maxam & Gilbert, Methods in Enzymology , 65: 499 (1986)). The label provides signals that can be detected by fluorescence, radioactivity, colorimetry, weighing, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, and nanocrystals.

When a probe is used, the probe is hybridized with the separated gDNA molecule. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. The detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning , A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc .; NY (1999). For example, high stringency conditions were hybridized at 65 ° C in 0.5 M NaHPO ₄ , 7% SDS (sodium dodecyl sulfate) and 1 mM EDTA, followed by addition of 0.1 x SSC / 0.1% SDS Lt; RTI ID = 0.0 > 68 C < / RTI > Alternatively, high stringency conditions means washing at < RTI ID = 0.0 > 48 C < / RTI > in 6 x SSC / 0.05% sodium pyrophosphate. Low stringency conditions mean, for example, washing in 0.2 x SSC / 0.1% SDS at 42 ° C.

After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. The hybridization signal can be carried out in various ways depending on, for example, the type of label attached to the probe. For example, when a probe is labeled with an enzyme, the substrate of the enzyme can be reacted with the result of hybridization reaction to confirm hybridization. Combinations of enzymes / substrates that may be used include, but are not limited to, peroxidases (such as horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis- Acetyl-3,7-dihydroxyphenox), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2) , 2'-Azine-di [3-ethylbenz thiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronine; (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate, and ECF substrate; alkaline phosphatase and bromochloroindoleyl phosphate; Glucose oxidase and t-NBT (nitroblue tetrazolium) and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate. Therefore, when the method for detecting the yellow marker or the yellow marker of the onion varieties of the present invention is carried out based on hybridization, specifically (i) a probe having a sequence complementary to the nucleotide sequence of the marker of the present invention Hybridizing to a nucleic acid sample; (ii) detecting whether the hybridization reaction has occurred. By analyzing the intensity of the hybridization signal by the hybridization process, the yellow or red goip of the onion variety can be selected.

According to a preferred embodiment of the present invention, the method of the present invention is carried out according to a gene amplification method.

The term " amplification " as used herein refers to a reaction that amplifies a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including PCR (PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning . A Laboratory Manual , 3rd ed. Methods of ligase chain reaction (LCR) (17, 18), Gap-HI (WO 89/06700) and Davey, C. et al (EP 329,822) LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA, WO 88/10315), self sustained sequence replication (U.S. Patent No. 6,410,276), consensus sequence primer polymerase chain reaction (CP-PCR), and the like, 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR), U.S. Pat. Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA) Patent Nos. 5,130,238 and 5,409,818 , 5,554,517, and 6,063,603), strand displacement amplification (21, 22) and loop-mediated isothermal amplification (LAMP) (23) . Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR . BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

When the present invention is carried out using a primer, the presence of the nucleotide sequence of the marker of the present invention is examined by performing a gene amplification reaction.

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-stranded structure. Conditions for nucleic acid hybridization suitable for forming such a double-stranded structure are described in Joseph Sambrook, et al., Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, etc., Nucleic Acid Hybridization , A Practical Approach , IRL Press, Washington, DC (1985).

A variety of DNA polymerases can be used in the amplification of the present invention, including the " Clenow " fragment of E. coli DNA polymerase I, the thermostable DNA polymerase and the bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus (Pfu).

When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. To provide joinja, dATP, dCTP, dGTP and dTTP, such as Mg ^{+ 2} to the reaction mixtures to have a desired degree of amplification can be achieved is required. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reaction without changing the conditions such as the addition of reactants.

In the present invention, annealing is carried out under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables.

The amplified amplified product is subjected to gel electrophoresis, for example, and the resulting band is observed and analyzed to determine the presence of the nucleotide sequence of the marker of the present invention.

When genetic analysis is carried out using the novel gene markers of the present invention, it is possible to clearly distinguish yellow and red individuals in the F ₂ -semic group of the onion in a simpler and more reliable manner on a mass scale in comparison with the prior art, It is possible to clearly select red objects that are totally fixed red and separated.

The features and advantages of the present invention are summarized as follows:

(I) The present invention relates to a method for producing cepa L.) can be identified within a short period of time, thereby clearly distinguishing yellow and red individuals from the F ₂ segregating population of the onion and clearly distinguishing red individuals that are separated from the genetically fixed red And can be used as a function marker.

(Ii) It is also possible to mass-produce red onion cultivars selected using the molecular beacons of the present invention, and accurate genetic quality analysis is possible.

Figure 1 shows DFR - A ^R , DFR - A ^PS It shows the structure of two alleles and homologous pseudogenes. In the encryption area, gray and empty boxes represent introns and exons, respectively. Arrow-shaped boxes represent the 5 'to 3' direction. The nucleotide on the inverted triangle in the coding region of the DFR- A allele represents a single nucleotide polymorphism (SNP) at the premature stop codon. The arrow indicates the primer binding site.
Figures 2a-2b relate to the development of functional markers for screening of DFR - A ^PS alleles. Figure 2a DFR -A ^PS, DFR - shows an array of nucleotide sequences of ^R A and -B DFR gene. Only partial sequences around the early termination codon are shown. The arrows indicate the positions of the forward and reverse primers. The complementary sequences of the reverse dCAPS primers are shown below the arrows. The introduced and mismatched nucleotides are shown underlined. Arranged nucleotides containing early termination codons are filled with empty boxes. Figure 2b shows the results of amplification of the PCR products cleaved using primer combinations of DFR-PS-F and DFR-PS-R. PS represents the DFR - A ^PS allele and R represents the DFR-A ^R allele, 1-3 lanes represent the yellow F ₂ plants, 4-6 lanes represent the heterozygous F ₂ plants and 7- 9 lanes represent red homozygous F ₂ plants, respectively.
Figs. 3A-3C show DFR - A ^DEL To the development of simple PCR markers for selection of alleles. Figure 3a shows the DFR-A ^R And the structure of the flanking sequence of the DFR- B gene. An arrow-shaped box represents the 5 'to 3' direction and represents an encryption area containing an intron. The filled box on the 3 ' end of the DFR gene represents a sequence block having homology. FIG. 3B shows the DFR - A ^R The amplified PCR products are shown using a primer combination that binds to the allele. F1-F7 is a forward primer and R1-R7 is a reverse primer. The primer positions are shown in Fig. R represents the red F ₂ population (bulk) and Y represents the yellow F ₂ population (bulk). Figure 3c shows the PCR product amplified with the combination of three primers (DFR-DEL-F, DFR-DEL-R1, DFR-DEL-R2). 1-4 lanes represent red F ₂ plants and 5-8 lanes represent yellow F ₂ plants.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not to be construed as limiting the scope of the present invention. It will be self-evident.

Example

Materials and Experiments

Plant

Previous studies (Kim et al. 2009) the two F ₂ population (populations) resulting from crosses between the red and yellow breeding lines (breeding lines) were selected from 11 F ₂ population (populations) created from. After PCR (polymerase chain reaction) amplification and sequencing of the DFR-A gene of yellow F ₂ plants, F ₂ populations including the alleles DFR-A ^PS and DFR-A ^DEL were selected. To investigate the frequency of inactivation of the DFR-A allele, a total of 38 onion cultivars cultivated in Korea and Japan were used. The breed name and DFR-A allele are listed in Tables 1 and 2 below:

designation DFR-A allele Remarks Sura ball DFR-A ^PS - Gumgu DFR-A ^PS - Tobagi DFR-A ^PS - Singihanyangpa DFR-A ^PS - Whangjae DFR-A ^PS - Chunjudaego DFR-A ^PS - Superio DFR-A ^PS - Doongji DFR-A ^PS - Yamujin DFR-A ^PS - New marus DFR-A ^PS - Bisulwhang DFR-A ^PS - Arus DFR-A ^PS - e-Joeun DFR-A ^PS - Hanbit515 DFR-A ^PS - Sisadul530 DFR-A ^PS - Hard ball DFR-A ^PS - Sun power DFR-A ^PS - Hanrodakari DFR-A ^PS - Ball DFR - A ^PS - Dark horse DFR - A ^PS - Magic gold DFR - A ^PS - Okay DFR - A ^PS - Phantom DFR - A ^PS - Okimaru DFR - A ^PS - Wangjungwang DFR - A ^PS - Water DFR - A ^PS - Kreo DFR - A ^PS - Chairman DFR - A ^PS - Matrix DFR - A ^PS - Big ho DFR - A ^PS - Daechoowhang DFR - A ^PS - Hiromaru DFR - A ^PS -

designation DFR- A allele Remarks Long power - Unidentified allele + DFR - A ^PS Topase - Unidentified allele + DFR - A ^PS This - Unidentified allele Marusino DFR - A ^DEL - Pachongwhang DFR - A ^DEL - Goldangango DFR - A ^DEL -

DNA  extraction, PCR  Amplification and PCR  Sequencing of Products

Total gDNA was extracted from leaf or seeded sprouted bulbs of 4-5 leaf stage seedlings using the CTAB (cetyltrimethylammonium bromide) -based method (Doyle and Doyle, 1987). The PCR was carried out using 0.05 μg template, 1 μL 10 × PCR buffer, 0.2 μL forward primer (10 μM), 0.2 μL reverse primer (10 μM), 0.2 μL dNTPs (10 mM each) and 0.1 μL Advantage 2 polymerase mix , Clontech, Palo Alto, Calif.). PCR amplification for genotyping of the dCAPS (derived cleaved amplified polymorphic sequence) marker was carried out at 95 ° C for 4 minutes, at 95 ° C for 30 seconds, at 67 ° C (0.8 ° C decrease per cycle) Min at 95 ° C for 30 sec, at 59 ° C for 30 sec, at 72 ° C for 1 min, and finally at 72 ° C for 7 min. The PCR product was digested with Xba I restriction enzyme at 37 ° C for 3 hours. The digested PCR product was stained with EtBr (ethidium bromide) and visualized on 2.0% agarose gel.

DFR - A ^DEL PCR amplification for the detection of the allele was carried out at an initial denaturation step of 95 ° C for 5 minutes, at 95 ° C for 30 seconds, at 68 ° C for 30 seconds, at 72 ° C for 2 minutes, and finally at 72 ° C for 10 minutes Respectively. The PCR product was stained with EtBr (ethidium bromide) and visualized on a 1.5% agarose gel. The primer sequences of the molecular markers developed in this experiment are summarized in Table 3 below:

primer SEQ.NO The primer sequence (5 'to 3') Tm DFR-PS-F SEQ.NO 5 GAATGTTAAGCATAATGAAGTCTTGTAAG 63.4 DFR-PS-R SEQ.NO 6 AATATGTTTACCCATCCTGTCATCT 60.9 DFR-DEL-F1 SEQ.NO 7 TGCAAACAGCAGTGGAGCTGCAACTTA 65.0 DFR-DEL-R1 SEQ.NO 8 TGGCCAACAGTATTGCTTCTTCCCAGT 65.0 DFR-DEL-R2 SEQ.NO 9 ACGCTGGCTTTCTCATGCTTCTTGAGC 66.5

The positions of the primers are shown in FIG. 1 and FIG.

For sequencing the PCR product, the PCR product was purified using QIAGEN kit (QIAquick PCR purification kit, Valencia, Calif.) And immediately sequenced. Sequencing reactions were performed using Big Dye (Applied Biosystems, Foster City, Calif.) According to the manufacturer's protocol, and sequences were obtained using ABI PRISM 3730XL Analyzer (Applied Biosystems).

Genome Walking (genome walking) method  Used DFR -A gene Flanking ( flanking ) Sequence of  Confirm

A flanking sequence of the DFR- A gene was obtained using Universal Genome Walker Kit (Clontech) according to the manufacturer's protocol. A breeding line containing the DFR - A ^R allele was used to construct the genome working library. The amplified PCR product was purified using QIAGEN kit (QIAquick PCR purification kit, Valencia, Calif.) And sequenced according to the aforementioned method.

dCAPS Marker  For development primer  design

A reverse primer of a molecular marker for the detection of the DFR - A ^PS allele was designed using the web-based software dCAPS Finder 2.0 (Neff et al. 2002). One mismatch nucleotide was introduced into the primer. As shown in the dCAPS Finder software manual, the forward primer was designed to be about 200 bp upstream of the reverse dCAPS primer using Primer3 v.4.0 software (Rozen and Skaletsky 2000).

Experiment result

DFR - A ^PS  Functionality for screening alleles Marker  Development

Previous studies have shown that the inactivated DFR- A allele, DFR - A ^PS , possesses a premature stop codon from yellow onion cultivars breed in Korea and Japan (Kim et al. 2009). DFR-A ^PS for the detection of allele 5 'non-but using a 20 bp deletion of the encryption region for the first time, such a 20 bp deletion of the DFR-A ^PS alleles are identified from several red onion breeding lines or varieties It was also found in other activated DFR- A alleles (GenBank accession number: AY221250) (data not shown). Since the 20 bp deletion was confirmed in the activated DFR- A allele, the application of such deletion-based molecular markers would be limited only in certain populations, and the DFR - A from an unknown oncogenic germplasm ^The molecular marker for detection of the ^PS allele should be different from the marker.

In order to improve the limited application of the previously developed molecular markers, attempts have been made to develop functional markers based on the early termination codon, which are causal mutations associated with the inactivation of the DFR - A ^PS allele causal mutation) (Fig. 1). A dCAPS marker was developed to identify single nucleotide polymorphisms (SNPs) that generate 'TAA', a premature stop codon. A reverse primer containing one mismatch was designed using dCAPS Finder software. The introduction of the mismatched 'G' sequence provided the Xba I restriction enzyme recognition sequence in the DFR - A ^PS allele (FIG. 2a). When designing a forward primer without considering two homologous pseudogenes ( DFR- B and DFR- C ), even if only one band appeared on the agarose gel, the multiplex PCR products were amplified (Data not shown). The amplification of multiple PCR products interfered with the identification of heterozygous individuals in homozygous red F ₂ plants. Thus, DFR -B and -C DFR to prevent the amplification of the gene, in a 499 bp deletion region and a primer sequence 3 'end of the DFR -C gene containing three mismatches between DFR -A-B and the DFR gene Directional primer was designed in the region (Figs. 1 and 2a). A single PCR product was amplified using the modified primer combination, and the PCR product was cut out with Xba I restriction enzyme, and homozygous and heterozygous red F ₂ plants were clearly screened (Fig. 2b). Then, a molecular marker for screening the DFR - A ^PS allele was designed as a 'DFR-PS' marker.

DFR - A ^DEL  For discrimination of alleles simple PCR Marker  Development

A third inactivated DFR- A allele lacking the entire DFR- A coding region has been previously reported (Kim et al. 2009). To obtain a more elongated flanking sequence of the DFR- A coding region, multiple cycles of genome walking were performed and the 839 bp added 5 'end sequence of the previously reported DFR- A sequence (AY221250) and the 2,642 bp 3' We got a new sequence. Also, a 1,205 bp 3 'end sequence of the DFR- B gene was accidentally obtained during genome walking of the DFR- A gene. The 3 'end sequence of the DFR- A and DFR- B genes was completely different starting from the 269 bp downstream of the stop codon except for 211 bp homologous blocks (Fig. 3a). The sequence homology of the block between DFR- A and DFR- B was 89%.

PCR amplification was performed using multiple primer combinations designed for the elongated DFR- A sequence (Figure 3a). DFR - A ^DEL Positive PCR products were not observed in the yellow F ₂ population (bulks) containing the allele (Fig. 3b). These results show that DFR - A ^DEL It means that the stretched region in the allele is missing. The present inventors have found that DFR - A ^DEL No specific sequence could be obtained, but DFR - A ^DEL The 3 'extension sequence of the DFR- A and DFR- B genes was used for the development of molecular markers for allele discrimination. A common forward primer was designed that binds homologous sequences of the DFR- A and DFR- B genes. The forward primer contained one mismatch at the 3 'end of the DFR- B sequence and the primer sequence, but the primer sequence perfectly matched the DFR- A sequence. The DFR DFR -A and - specificity of the B 3 'was designed for two reverse primers that bind to the region. The presence of one mismatched sequence in the forward primer only affects DFR-A ^DEL < RTI ID = 0.0 > Showed the presence, only in the case of allele amplification of a DFR -B sequences are possible, which in the case of yellow onions homozygous (homozygous) DFR - A ^DEL It is made up of alleles. The results of PCR amplification were as follows: DFR - A ^DEL Only the DFR- B specific sequence was amplified in the yellow F ₂ population containing the allele, but in the red F ₂ population it was amplified from the smaller strong band amplified from the DFR -A sequence and from the DFR -B sequence A larger faint band was observed (Figure 3c). These molecular markers were designed as 'DFR-DEL'.

In yellow and onion cultivars breed in Korea and Japan DFR -A  Allele distribution

The applicability of newly developed markers among the yellow onion cultivars breeded in Korea and Japan was tested and compared with DFR- A ^PS and DFR - A ^DEL In order to investigate the frequency of an allele, using a DFR-PS DFR and DEL-markers it was confirmed in 38 of onion varieties of DFR -A genotype (genotype). First, onion cultivars were screened with DFR-PS marker to identify DFR - A ^PS allele. Most onion varieties (84%) contained the DFR - A ^PS allele (see Table 1 and 2). Onion varieties that did not contain the DFR - A ^PS allele were then tested with the above - mentioned molecular markers for the identification of the DFR - A ^TRN allele (Kim et al., 2005c). PCR products corresponding to the DFR-A ^TRN allele were not observed in all onion varieties tested (data not shown). These results suggest that onion cultivars do not contain DFR - A ^TRN allele but DFR - A ^DEL It may contain alleles. DFR - A ^DEL The presence of alleles was confirmed by DFR-DEL markers in three onion varieties. As expected, PCR products specific for DFR- B were observed in the three onion varieties (data not shown). However, it has also been identified in three other onion varieties, including the undifferentiated DFR- A allele. There was one 3 bp insertion on the coding sequence of two SNPs and an undetermined allele compared to the DFR- A ^R allele. Additional identification of these novel alleles is needed in the future.

Argument

DFR - A ^PS  Functionality for discrimination of alleles Marker  Development

A dCAPS marker was developed in this experiment to discriminate DFR - A ^PS allele containing early - termination codon. Because the molecular marker has been designed based on a single point mutation that forms a 'TAA' termination codon by an A / T transition, the marker is considered a typical 'functional marker' (Andersen and L2003). According to the definition given by Andersen and L (2003), functional markers are DNA markers derived from functionally identified sequence motifs. Because of the complete linkage between polymorphic sequence motifs and phenotypic variations, functional markers are the most ideal marker for marker-assisted selection (MAS).

Meanwhile, a previously developed molecular marker (Kim et al. 2009) for the discrimination of the DFR- A ^PS allele based on 20-bp indel (insertion deletion) located in the 5 'non-coding sequence is described by Andersen and L 0.0 > (2003). ≪ / RTI > Despite the strong association between markers and mutations affecting phenotypic variation, gene-targeting markers have limitations relative to functional markers. The number of alleles of a gene-targeting marker does not always match the number of alleles of a target gene. Actual, -A DFR gene in the 5 'non-- 20 bp deletion on the encryption region is DFR - was confirmed in addition to A ^PS alleles different DFR -A allele. For this reason, only functional markers can be used to screen yellow amphibian varieties containing the DFR - A ^PS allele among the unknown germplasm. Thus, the functional markers developed in the present invention are more useful than the gene-targeting markers in onion breeding programs.

In particular, functional markers are useful for marker-assisted backcrossing programs using molecular markers as foreground selection markers (Neeraja et al. 2007; Septiningsih et al. 2009). If molecular markers bound to the target trait are used as foreground selection markers, confirmation of the phenotype of the selected individuals through backcross generations due to recombination between the marker and the target gene is required at least once . However, when a functional marker is used as a foreground selection marker, identification of a phenotype is not required. Thus, functional markers for the discrimination of the DFR- A ^PS allele will be useful for marker-assisted backcrossing programs using onion molecular markers. For example, by transforming the active DFR - A ^R allele with yellow marker lines or varieties using marker-assisted backcrossing using molecular markers, the desired red onion breeding line or variety Breed, in which case the DFR-PS marker is used as the foreground selection marker. Indeed, a marker-assisted backcrossing program using molecular markers for the purpose of improving the low shelf-life of red onion varieties is currently being carried out in our onion breeding program. The red onion cultivated in Korea was generally lower in storage than the yellow onion cultivar (Nam et al. 2011).

Onion breeding program DFR -A  Molecule for discrimination of alleles Marker  Use

The availability of functional markers depends in part on robust marker assay technologies. To detect SNPs in the DFR - A ^PS allele, dCAPS assay was used in the present invention. Although SNPs are the most abundant polymorphisms in eukaryotic genomes, the discovery of SNPs has become a bottleneck in non-model plant species with limited genomic information. However, as sequencing technology has developed recently (Varshney et al. 2009; Edward and Batley 2010), a large number of SNPs have been found in many crops. In addition, many SNP genotyping techniques such as single-base extension (SBE), allele-specific PCR and pyrosequencing have been developed (Chen and Sullivan 2003; Appleby et al. 2009). However, most of these techniques have not been widely used in breeding programs due to the demand for expensive equipment, special reagents and complex protocols. On the other hand, Neff et al. (1998) is a relatively simple, inexpensive, and suitable throughput SNP genotyping technique. The web-based software dCAPS Finder 2.0 (Neff et al. 2002) is useful for designing dCAPS primers to detect any SNP. In fact, although there was no recognition site for any restriction enzyme in the SNP that produced a premature stop codon in the DFR - A ^PS allele, the reverse primer designed by the software contained the Xba I restriction A recognition site for the enzyme was generated. Taken together, the dCAPS assay is a robust SNP genotyping technique that specifically detects SNPs that affect phenotypic variation.

The DFR-DEL marker was developed to screen yellow onion varieties containing the DFR - A ^DEL allele. However, these markers have limitations in selecting heterozygous plants. Since selection of homozygous red onion from segregating populations is the most important use of molecular markers developed for DFR- A allele screening, DFR-DEL markers appear to be useless for this purpose . However, the DFR-DEL marker is useful in identifying the presence of the DFR - A ^DEL allele among the onion genetic resources that are not known. Although the unknown phenotype of the genetic circle is the same as yellow, there will be three completely different inactivated DFR- A alleles in different genetic resources. Thus, identification of specific DFR- A alleles is an important step in the goat color screening of onion breeding programs. In order to improve the utility of the DFR-DEL marker, a flanking sequence of the deleted DFR- A gene must be obtained. The present inventors were unable to obtain a flanking sequence using a repetitive cycle of short-distance genome walking. Thus, the onion genome to-scale (large-scale) sequencing DFR - you may be required to get the flanking sequences of the genes in the DFR -A A ^DEL alleles.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

references

[One]. Andersen JR, LT (2003) Functional markers in plants. Trends Plant Sci 11: 554-560

[2]. Appleby N, Edwards D, Batley J (2009) New technologies for ultra-high throughput genotyping in plants. Methods Mol Biol 513: 19-39

[3]. Chen X, Sullivan PF (2003) Single nucleotide polymorphism genotyping: biochemistry, protocol, cost and throughput. Pharmacogenomics J 3: 77-96

[4]. Clarke AE, Jones HA, Little TM (1944) Inheritance of bulb color in the onion. Genetics 29: 569-575

[5]. Clere N, Faure S, Martinez MC, Andriantsitohaina R (2011) Anticancer properties of flavonoids: roles in various stages of carcinogenesis. Cardiovasc Hematol Agents Med Chem 9: 62-77

[6]. Cook NC, Samman S (1996) Flavonoids-Chemistry, metabolism, cardioprotective effects, and dietary sources. Nutr Biochem 7: 66-76

[7]. Cushnie TP, Lamb AJ (2011) Recent advances in understanding the antibacterial properties of flavonoids. Int J Antimicrob Agents 38: 99-107

[8]. Dao TTH, Linthorst HJM, Verpoorte R (2011) Chalcone synthase and tis functions in plant resistance. Phytochem Rev 10: 397-412

[9]. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19: 11-15

[10]. Edwards D, Batley J (2010) Plant genome sequencing: applications for crop improvement. Plant Biotechnol J 8: 2-9

[11]. El-Shafie MW, Davis GN, (1967) Inheritance of bulb color in the onion (Allium cepa L.). Hilgardia 38: 607-622

[12]. Ferrer JL, Austin MB, Stewart Jr. C, Noel JP (2008) Structure and function of enzymes involved in the biosynthesis of phenylpropanoids. Plant Physiol Biochem 46: 356-370

[13]. Finia, Brunetti C, Di Ferdinando M, Ferrini F, Tattini M (2011) Stress-induced flavonoid biosynthesis and the antioxidant machinery of plants. Plant Signal Behav 6: 709-711

[14]. Fossen T, Andersen OM, Ovstedal DO, Pedersen AT, Raknese A (1996) Characteristic anthocyanin pattern from onions and other Allium spp. J Food Sci 61: 703-706

[15]. Goodrich J, Carpenter R, Coen ES (1992) A common gene regulates pigmentation pattern in diverse plant species. Cell 68: 955-964

[16]. Holton TA, Cornish EC (1995) Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7: 1070-1083

[17]. Kim S, Baek D, Cho DY , Yoon M (2009) Identification of two novel inactive DFR -A alleles responsible for failure to produce anthocyanin and development of a simple PCR-based molecular marker for bulb color selection in onion (Allium cepa L.) Theor Appl Genet 118: 1391-1399

[18]. Inactivation of DFR (Dihydroflavonol 4-reductase) gene transcription results in blockage of anthocyanin production in yellow onions ( Allium cepa ). Mol Breed 14: 253-263

[19]. Kim S, Jones R, Yoo K, Pike LM (2004b) Gold color in onions ( Allium cepa ): a natural mutation of the chalcone isomerase gene resulting in a pre-mature termination codon. Mol Gen Genomics 272: 411-419

[20]. Kim S, Jones R, Yoo K, Pike LM (2005a). The L locus, one of the complementary genes required for anthocyanin production in onions ( Allium cepa ), encodes anthocyanidin synthase. Theor Appl Genet 111: 120-127

[21]. Kim S, Yoo K, Pike LM (2005b). The basic color factor, the C locus, encodes a regulatory gene controlling transcription of chalcone synthase genes in onions ( Allium cepa ). Euphytica 142: 273-282

[21]. Kim S, Yoo K, Pike LM (2005c) Development of a PCR-based marker utilizing a deletion mutation in the DFR (dihydroflavonol 4-reductase) gene responsible for the lack of anthocyanin production in yellow onions (Allium cepa ). Theor Appl Genet 110: 588-595

[22]. Lotto SB, Frei B (2006) Consumption of flavonoids-rich foods and increased plasma antioxidant capacity in humans: cause, consequence, or epiphenomenon? Free Radic Biol Med 41: 1727-1746

[23]. (2011) Bulb storability of red and yellow onion ( Allium, Korea) cepa L.) cultivars grown in Korea. Kor. J. Breed. Sci 43: 132-138

[24]. A marker-assisted backcross approach for developing submergence-tolerant rice cultivars (Neeraja CN, Maghirang-Rodriguez R, Pamplona A, Heuer S, Collard BCY, Septiningsih EM, Vergara G, Sanchez D, Xu K, . Theor Appl Genet 115: 767-776

[25]. Neff MM, Neff JD, Chory J, Pepper AE (1998) dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: Arabidopsis thaliana genetics. Plant J 14: 387-392

[26]. Neff MM, Turk E, Kalishman M (2002) Web-based primer design for single nucleotide polymorphism analysis. Trends Genetics 18: 613-615

[27]. Nishiumi S, Miyamoto S, Kawabata K, Ohnishi K, Mukai R, Murakami A, Ashida H, Terao J (2011) Dietary flavonoids as cancer-preventive and therapeutic biofactors. Front Biosci 3: 1332-1362

[28]. Quattrocchio F, Wing JF, Leppen HTC, Mol JN, Koes RE (1993) Regulatory genes controlling anthocyanin pigmentation. Plant Cell 5: 1497-1512

[29]. Reiman GH (1931) Genetic factors for pigmentation in the onion and their relation to disease resistance. J Agr Res 42: 251-278

[30]. Rhodes MJC, Price KR (1996) Analytical problems in the study of flavonoid compounds in onions. Food Chem 57: 113-117

[31]. Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinormatics methods and protocols: methods in molecular biology. Humana Press, Totowa, NJ, pp. 365-386

[32]. Russo M, Spagnuolo C, Tedesco I, Bilotto S, Russo GL (2012) The flavonoid quercetin in disease prevention and therapy: Facts and fancies. Biochem Pharmacol 83: 6-15

[33]. Sochez DL, Neeraja CN, Vergara GV, Heuer S, Ismail AM, Mackill DJ (2009) Development of submergence-tolerant rice cultivars: Sub1 locus and beyond. Ann Bot 103: 151-160

[34]. Shirley BW (1996) Flavonoid biosynthesis: 'new' functions for an 'old' pathway. Trends Plant Sci 1: 377-382

[35]. Slimestad R, Fossen T, VIM (2007) Onions: a source of unique dietary flavonoids. J Agric Food Chem 55: 10067-10080

[36]. Spelt C, Quattrocchio F, Mol JN, and Koes RE (2000) anthocyanin1 of Petunia encodes a basic helix-loop-helix protein that directly activates transcriptional structural anthocyanin genes. Plant Cell 12: 1619-1631

[37]. Varshney RK, Nayak SN, May GD, Jackson SA (2009) Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends Biotechnol 27: 522-530

[38]. Veitch NC, Grayer RJ (2011) Flavonoids and their glycosides, including anthocyanins. Nat Prod Rep 28: 1626-1695

[39]. Vogt T (2010) Phenylpropanoid biosynthesis. Mol Plant 3: 2-20

[40]. Yamazaki M, Makita Y, Springob K, Saito K (2003) Regulatory mechanisms for anthocyanin biosynthesis in chemotypes of Perilla I have frutescens . crispa. Biochem Eng J 14: 191-197

Attach an electronic file to a sequence list

Claims (16)

A nucleic acid molecule comprising a nucleotide sequence of a first sequence.
delete delete delete A primer set for screening goif color of onion varieties comprising a primer set of SEQ ID No. 5 and a sequence set forth in SEQ ID No. 6 of the Sequence Listing which can amplify the nucleic acid molecule of Claim 1.
6. The method according to claim 5, wherein the primer set comprises SEQ ID No. 7 sequence which can amplify a nucleic acid molecule comprising the nucleotide sequence of SEQ ID No. 3 or 4 and a primer set or sequence of SEQ ID No. 8 A primer set for goat color selection of an onion variety further comprising a primer set of SEQ ID NO: 7 and SEQ ID NO: 9;
A goat color selection kit for onion cultivars comprising the primer set of claim 5.
8. The kit according to claim 7, wherein said kit comprises SEQ ID No. 7 sequence which can amplify a nucleic acid molecule comprising the nucleotide sequence of SEQ ID No. 3 or 4 and a primer set or sequence listing of SEQ ID No. 8 A goat color selection kit of an onion variety further comprising a primer set of SEQ ID NO: 7 and SEQ ID NO: 9.
A method for screening goofy colors of onion varieties comprising the steps of:
(a) obtaining gDNA (genomic DNA) from an onion; And
(b) analyzing whether the nucleic acid molecule to be analyzed exists in the gDNA of the onion, wherein the nucleic acid molecule to be analyzed is a nucleic acid molecule comprising a nucleotide sequence of the first sequence of the sequence listing;
In step (b), when only the nucleic acid molecule containing the nucleotide sequence of the first sequence of the Sequence Listing is present, the goip color of the onion variety is determined to be yellow.
10. The method of claim 9, wherein the nucleic acid molecule to be analyzed further comprises a nucleic acid molecule comprising a nucleotide sequence of the third or fourth sequence of the sequence listing, wherein the nucleotide sequence of the third sequence of the sequence listing in step (b) , The goip color of the onion varieties is determined to be yellow, and when there is a nucleic acid molecule comprising the nucleotide sequence of the sequence listing 4, the goip color of the onion varieties is determined to be red ≪ / RTI >
10. The method according to claim 9, wherein the step (b) is performed according to a gene amplification method using a primer.
10. The method according to claim 9, wherein the step (b) is performed according to a hybridization method using a probe.
10. The method of claim 9, wherein step (b) is performed by sequencing.
6. The method according to claim 5, wherein said primer set further comprises a primer set of SEQ ID No. 5 and SEQ ID No. 6 which are capable of amplifying a nucleic acid molecule comprising a nucleotide sequence of the second sequence of the sequence listing A primer set for goofy color selection of onion varieties.
8. The kit according to claim 7, wherein the kit further comprises a primer set of SEQ ID No. 5 and a sequence set forth in SEQ ID No. 6, which are capable of amplifying a nucleic acid molecule comprising the nucleotide sequence of the second sequence of Sequence Listing, Screening kit.
10. The method of claim 9, wherein the nucleic acid molecule to be analyzed further comprises a nucleic acid molecule comprising a nucleotide sequence of the second sequence of SEQ ID NO: 2, wherein the nucleic acid molecule comprising the nucleotide sequence of the second sequence of the sequence listing in step (b) In the case where only the molecule is present, the goofy color of the onion variety is determined as homozygous, and when nucleic acid molecules including the nucleotide sequence of the first sequence of the Sequence Listing and the second sequence of the Sequence Listing are present, Characterized in that the goofy color of the varieties is determined as heterozygous.

Images