KR102254956B1 - A molecular marker for selecting onion white bulb color and the use thereof - Google Patents

Abstract

The present invention relates to a molecular marker of a novel base sequence (AcWHITE) capable of selecting white bulb color onion and uses thereof. According to the present invention, it is possible to discriminate the transfer factors related to the formation of anthocyanin pigments in onions within a short time, so white individuals can be clearly identified from the F2:3 isolated group of onions. The molecular marker can be used as a functional marker that genetically select white individuals clearly. In addition, mass production of white bulb color onion varieties transformed through the recombinant vector using the molecular marker of the present invention is possible.

Description

A molecular marker for selecting onion white bulb color and the use thereof

The present invention relates to a novel sequence of molecular markers capable of selecting white guppy-colored onions and their use.

The size of the domestic vegetable seed market is showing a continuous increase of 287.2 billion won in 2018. Among them, onion is a major vegetable crop that ranks third over the past 10 years after pepper and radish, showing sales of about 36.1 billion won. However, the import of onion seeds is about 2.5 million dollars, ranking second after paprika, so it is urgent to develop excellent varieties that can replace imports.

Onion is a plant in the genus Allium of the Daffodil family. It is a food ingredient that has a pungent smell and a spicy taste, and is a plant used in various foods. Onions contain Allicin, so they taste spicy and sweet. Consuming onions has antioxidant properties and lowers blood cholesterol levels.

The bulb of onion refers to the part of the scale stem of the onion, and the bulb color refers to the color of the skin of the scale stem of the onion. Onions have various guppy colors, and most onions consumed in Korea are varieties with yellow guppy colors. However, due to the recent increase in income and dietary changes, the number of red guppy varieties is also increasing.

However, the white guppy color is rarely distributed in Korea. In the case of white guppy-colored onions, there is no pigment at all, so adding them when cooking has the advantage of not changing the original color of the dishes. Therefore, white guppy-colored onions belong to the main cultivar group in the United States and Europe. And it is expected that the number of white varieties will increase in Korea thanks to the advantages of these white varieties.

In particular, white guppy-colored onions are used as raw materials to make onion powder in the United States and elsewhere, and the market is known to be very large. Therefore, research on the development of white varieties is being conducted more actively in the United States and Europe than in Korea. Even in such active breeding studies, studies on the genetics that determine whiteness in onions are still very inadequate compared to other crops.

Korean Patent Registration No. 2013-0120589

According to the first aspect of the present invention, an object of the present invention is to provide a molecular marker for selecting white guppy-colored onions comprising the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.

In a second aspect of the present invention, an object of the present invention is to provide a composition for selecting white guppy-colored onions comprising a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.

In a third aspect of the present invention, an object of the present invention is to provide a kit for selecting white guppy-colored onions comprising a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.

In a fourth aspect of the present invention, an object of the present invention is to provide a method for selecting white guppy-colored onions comprising the step of analyzing whether or not the nucleotide sequence of SEQ ID NO: 1 (AcWHITE) is present.

In a fifth aspect of the present invention, an object of the present invention is to provide a recombinant vector for producing white guppy-colored onions comprising the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.

In the sixth aspect of the present invention, it is an object of the present invention to provide a method for producing white guppy-colored onions, comprising transforming onions using the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.

In the seventh aspect of the present invention, an object of the present invention is to provide a transformed onion transformed with the recombinant vector of the present invention.

In the eighth aspect of the present invention, an object of the present invention is to provide the seeds of the transformed onion of the present invention.

1. A molecular marker for selecting white guppy-colored onions, including the nucleotide sequence of SEQ ID NO: 1 (AcWHITE).

2. A composition for selecting white guppy-colored onions, including a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.

3. In the above 2, wherein the primer comprises the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, a composition for selecting a white guppy-colored onion.

4. A kit for selecting white guppy-colored onions, including a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.

5. In the above 4, wherein the primer comprises the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, white guppy-colored onion selection kit.

6. A method for selecting white guppy-colored onions comprising the step of analyzing whether the nucleotide sequence of SEQ ID NO: 1 (AcWHITE) is present in the onion gDNA.

7. In the above 6, the step of analyzing comprises the step of binding a primer capable of detecting at least a portion of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1 to the gDNA, white guppy color onion selection method.

8. In the above 6, the step of analyzing comprises a step of amplifying the gene by polymerase chain reaction (PCR), white guppy color onion selection method.

9. The method of 7 or 8 above, wherein the primer comprises a nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 8, white guppy-colored onion selection.

10. A recombinant vector for producing white guppy-colored onions containing the nucleotide sequence of SEQ ID NO: 1 (AcWHITE).

11. A method for producing a white guppy-colored onion comprising the step of transforming the nucleotide sequence (AcWHITE) of SEQ ID NO: 1 into onions.

12. The method of 11 above, wherein the transformation step is performed using the recombinant vector of claim 10.

13. The method of 11 above, wherein the transformation step is transformed using CRISPR/Cas9 to produce a white guppy-colored onion.

14. Transformed onion transformed with the recombinant vector of the above 10.

15. Transformed seeds of onion according to 14 above.

The onion having a white guppy color can be efficiently selected through the molecular marker according to the present invention.

The white guppy-colored onions can be efficiently selected by using the white guppy-colored onion selection composition or the selection kit containing the primer according to the present invention.

By using the vector for producing white guppy onions according to the present invention, it is possible to reduce the production cost and production cost of white guppy onions through transformation.

1 shows the positions of four contigs linked to the C locus on the onion chromosome.
Figure 2 shows the result of comparing the transcription level of the bHLH coding gene between white onions and yellow onions. Figure 2 (a) shows the transcription level measured using the RPKM value obtained by mapping on a reference transcript. Figure 2 (b) shows the transcription level measured using the RPKM value obtained by genetic mapping to the newly assembled contig (contig). Figure 2 (c) shows the B2 gene transcription level of _{F 2:3} individuals measured using real-time RT-PCR. (W1-W5: white F _2:3 individual, Y1-Y5: yellow F _2:3 individual)
3 is a comparison of the genes of onion B2, petunia AN1, dahlia DvIVS and corn IN1. (White part: intron, gray part: exon, filled box part: bHLH domain, hatched part: repeat sequence)
Figure 4 shows the structure of the onion B2 gene. (White part: intron, gray part: exon, filled box part: AcWHITE, hatched part: LTR sequence part, horizontal arrow part: primer binding site of B2 molecular marker, dotted box part: gag-pol polyprotein isolated from Vitis vinifera And domains showing homology)
5 shows the PCR results of the B2 marker. Figure 5 (a) shows the band pattern of two different primer combinations. (A band: dominant homozygous yellow F _2:3 individual, H band: heterozygous yellow F _2:3 individual, B band: recessive homozygous white F _2:3 individual) Figure 5 (b) is white, yellow and red It shows the band pattern of the B2 marker genotype of the breeding line. (A band: dominant homozygous yellow F _2:3 individuals, H band: heterozygous yellow F _2:3 individuals, B band: recessive homozygous white F _2:3 individuals (TIFF 335 kb))
6 shows C9860, a molecular marker perfectly linked to the C locus. Figure 6 (a) shows the structure of the full length yellow and white alleles of the contig. (Gray part: exon, white part: intron, black part of yellow allele: 53-bp INDEL, horizontal arrow: primer binding site of C9860 molecular marker) FIG. 6(b) is a white, yellow and red sarcoma line of C9860 molecular marker It shows the genotype of. (A band: dominant homozygous yellow F _2:3 individuals, H band: heterozygous yellow F _2:3 individuals, B band: recessive homozygous recessive white F _2:3 individuals (TIFF 358 kb))
7 shows the alignment of the amino acid sequence of the bHLH domain of proteins isolated from onion and other plant species.
8 shows the base sequence of AcWHITE and its upstream and downstream regions. (Gray part: AcWHITE sequence, white underline: terminal reverse repeat sequence, rectangle: target site duplication sequence, vertical arrow: start of transcription, bold: exon 1 part of B2 gene, black underline : B2 gene transcription start codon)

Hereinafter, the present invention will be described in detail. Unless otherwise defined, all terms in this specification are the same as the general meanings of the terms understood by those of ordinary skill in the art to which the present invention belongs. Follow the meaning used in the specification.

The structure of the onion is divided into a stem part, a bulb part, and a root part. Onions account for 90% of the total moisture, but contain large amounts of nutrients such as protein, carbohydrates, vitamin C, calcium, phosphorus, and iron. Onion's quercetin (Quercetin) helps prevent hypertension by inhibiting the accumulation of fat and cholesterol in blood vessels. In addition, quercetin plays a role in preventing cells from being attacked by free radicals and lipid peroxidation, and is effective in restoring inflammation and wounds of cells. Onions are rich in chromium, and chromium is a trace mineral that maintains the homeostasis of glucose metabolism, and helps to regulate blood sugar by promoting insulin action. Allicin in onions acts as a stabilizer. In addition, allicin has the effect of lowering blood pressure by releasing nitrogen monoxide, lowering the stiffness of blood vessels, preventing platelets from clogging and helping to dissolve fibrin in blood vessels, thereby reducing the risk of blood clots or stroke. In addition, glutathione contained in onions is a substance that aids in the absorption of vitamin B1 and aids in the breakdown of fat in the liver. In one example of this experiment, the onion was used Allium cepa L.

In the present specification, "bulb" refers to the part of the scale stem of the onion, and the scale stem refers to the base of the stem or the tip of the stem where a number of scale fragments succulent surround the stem and become an underground storage organ. Say that.

"Bulb color" refers to the color of the peel of the scales of onions. Guppy color is an important agronomic characteristic in onion breeding programs. Red, yellow and white guppy colors are common in onion varieties. Rarely reported colors are golden (Kim et al. 2004b) and chartreuse (light yellow or light green) colors (El-Shafie and Davis 1967). This is indicated by flavonoid compounds such as quercetin and anthocyanin, and it has been confirmed that at least 50 derivatives are involved in onion guppy color (Slimestad R, Fossen T, VIM (2007) Onions: a source of unique dietary flavonoids. J Agric Food Chem 55:10067-10080).

In the present specification, "pigment" refers to a component that allows the color of an object to appear. The "pigmented body" is an organelle found in plants and algae, and includes chloroplasts, colored bodies, and white bodies. A colored body is a carotenoid-based pigment, and the colors of carrots, pumpkins, tomatoes, peppers, etc. are represented by this. On the other hand, the white body does not have a pigment and is contained in cells in the vicinity of the meristem or underground, and is mainly involved in starch storage. Chloroplasts are involved in photosynthesis and are particularly well-studied, and their structure and function are known in detail.

In the present specification, "flavonoid" refers to a compound having a general structure of 15 carbon skeletons chemically composed of two phenyl rings (A and B) and one heterocyclic ring (C). They can be classified as flavonoids, bioflavonoids, isoflavonoids, or neoflavonoids. These are all ketone containing compounds, and therefore antoxanthines (flavones and flavonols). The three cycles or heterocycles of the flavonoid backbone are commonly referred to as rings A, B, C. Ring A generally represents a phloroglucinol substitution pattern. (See Formula 1) Flavonoids have been shown to have a wide range of biological and pharmacological activities in in vitro studies. For example, there are anti-allergic, anti-inflammatory, antioxidant, antimicrobial, cancer, and anti-diarrhea activity.

[Formula 1]

The main component of onions is flavonoids, one of the secondary metabolites of plants, and more than 8,000 flavonoids have been reported (Veitch NC, Grayer RJ (2011) Flavonoids and their glycosides, including anthocyanins. Nat Prod Rep 28:1626-1695). About 54 of these flavonoids have been reported in onions. Among them, the representative component of onions is quercetin, and the component that determines the guppy color of onions was found to be anthocyanin.

In the present specification, "Anthocyanin" is a flavonoid-based substance that has almost no smell and taste. It is a pigment mainly contained in flowers and fruits, and plays a role in determining the color of the guppies in the guppy cells of onions. It is red, purple, and blue depending on the concentration of hydrogen ions. It can also play a different role depending on the location of the plant. In the fruit, it acts as a color that attracts animals, and uses the animal to spread the seeds of plants. In flowers, it acts as a pigment representing the color of the flower, attracting insects to carry pollen. In leaves, it blocks strong ultraviolet rays. It also acts as an antioxidant that removes free radicals from plant cells.

The biosynthetic pathway of flavonoids has been reported in various plants (Vogt T (2010) Phenylpropanoid biosynthesis. Mol Plant 3:2-20). Genes involved in the biosynthetic pathway can be largely divided into two classes, one is structural genes and the other is regulatory genes. In the biosynthetic pathway, the structural gene is a group of genes encoding enzymes involved in the biosynthetic pathway. In the biosynthetic pathway, the regulatory gene is a gene that regulates the flavonoid biosynthetic pathway by regulating the expression of structural genes, and is regulated by forming an MBW complex composed of mostly MYB protein, bHLH protein, and WD40 protein.

In the present specification, "MBW complex (MYB-bHLH-WD)" is a transcription complex model for regulation of the flavonoid pigment biosynthetic pathway. It is composed of R2R3-MYB, bHLH and WD40 proteins. The three proteins, R2R3 MYB and WD40 proteins bind to the bHLH protein to form a ternary complex. For example, in Arabidopsis, the TTG1 protein (WD40 protein) affects the interaction between bHLH and MYB proteins. The combination of these proteins affects differently, and among them, the key protein that affects is the MYB protein. In addition to the interactions between proteins, the three proteins also regulate their expression patterns. For example, it was confirmed that AN2 MYB protein induces the expression of an1 bHLH gene through Petunia transformation experiments (Spelt C, Quattrocchio F, Mol JN, Koes RE (2000) anthocyanin1 of Petunia encodes a basic helixloop-helix protein that directly activates transcription of structural anthocyanin genes.Plant Cell 12:1619-1631).

“MYB protein” is a large-scale gene transcriptional regulator found in animals and plants. In plants, a protein family comprising the conserved MYB DNA binding domain from the MYB gene is expressed, which includes the MYB protein subfamily characterized by the R2R3 type MYB domain.

"bHLH (basic helix-loop-helix) protein" is a dimer transcription factor found in all eukaryotes, and is a protein structural motif as one of the largest families. It is 13 to 17 amino acids long and has a basic domain and loop that recognizes and binds to the CANNTG DNA sequence. The bHLH plays a wide variety of roles in plant growth and development through secondary metabolic regulation, cell differentiation and patterning, brassinosteroid and ABA hormone signaling pathway regulation, root iron absorption and phytochrome mediated optical signal transduction in plants.

“WD40 protein” is a short structural motif of approximately 40 amino acids, and proteins containing the WD40 domain have 4 to 16 repeat units. These repeat units form a circularized beta-propeller structure, which acts as a rigid scaffold for protein interaction. The basic function of the WD40 repeat protein is to regulate the combination of multiple protein complexes. It is also involved in various functions such as cell cycle regulation, autophagy and apoptosis in signal transduction and transcription regulation.

The present invention will be described in detail with respect to a molecular marker capable of selecting a white guppy color onion using the base sequence of AcWHITE.

In the present specification, the term "nucleic acid" includes DNA and RNA as one of biopolymers or small biomolecules essential for living organisms. Nucleic acids are composed of nucleotide units.

In the present specification, "nucleotide" refers to a molecule that is a unit constituting a nucleic acid. It plays a pivotal role in metabolism, plays a role as a chemical energy provider (ATP), and also plays a role as an important component of intracellular signaling and enzymatic reactions. The constituent components of nucleotides are composed of a base, sugar, and phosphoric acid. In the case of DNA, the base is composed of adenine, guanine, cytosine, and thymine, and in the case of RNA, it is composed of adenine, guanine, cytosine, and uracil. The sugar moiety is a pentose sugar, which is deoxyribose in the case of DNA and ribose in the case of RNA. Phosphoric acid is H ₃ PO _4, but usually two oxygens in a nucleic acid molecule bind to each sugar, and the remaining two oxygens have metal ions (usually magnesium divalent ions) attached. Because of this phosphoric acid, nucleic acids are strongly acidic.

The "DNA" used in the present invention may be substituted with an artificial base if necessary. Artificial bases are, for example, xeno nucleic acid (XNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), glycol nucleic acid (GNA), or tre It may be a three nucleic acid (TNA), but is not limited thereto.

When a single-stranded nucleic acid molecule can bind to another nucleic acid molecule under conditions of appropriate temperature and solution ionic strength, the nucleic acid molecule can hybridize to another nucleic acid molecule such as cDNA, genomic DNA or RNA. Hybridization and washing conditions are well known, and temperature and ionic strength conditions determine the stringency of hybridization.

Stringency conditions can be adjusted to select for moderately similar fragments, such as homologous sequences from distantly related organisms, or very similar fragments, such as genes replicating functional enzymes from closely related organisms.

Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible depending on the hybridization stringency. The case where two nucleic acids contain complementary sequences refers to cases in which nucleotides have base sequences capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present invention includes not only isolated nucleic acid fragments that are complementary to the entire sequences disclosed or used in the specification, but also nucleic acid sequences that are substantially similar.

In the present invention, as a result of researching molecular markers for identifying white guppy-colored onions, the white color represented by SEQ ID NO: 1 of onions was obtained by grafting bulked segregant analysis (BSA) and RNA-sequencing technology. The nucleotide sequence of AcWHITE, a transfer factor capable of identifying guppy-colored onions, was confirmed. In addition, a molecular marker capable of discriminating the genotype determining white guppy color was discovered using the nucleotide sequence.

In the present specification, the term "base sequence" refers to a sequence of bases, which is one of the constituents of the basic unit nucleotide of DNA. When three bases are collected in a line on DNA, one triplet code is formed to designate one amino acid. When these triplet codes are gathered together, they ultimately designate a single protein. In other words, when three bases are collected, a triplet code is formed, It is converted into sequence. Human proteins are produced by linking 20 kinds of amino acids through peptide bonds.

The "RNA sequencing (RNA-seq)" refers to a technology that analyzes the nucleotide sequence of all RNA transcriptomes transcribed from DNA using Next Generation Sequencing (NGS). . Through RNA sequencing technology, information such as RNA replacement splicing, gene expression level, nucleotide sequence variation, gene fusion, and single nucleotide polymorphism (SNP) can be obtained. have. In addition, it is possible to check the expression of not only messenger RNA but also small RNAs such as miRNA and tRNA, and can be used to check the boundary between exons and introns.

In the present invention, it was found that the presence of a non-irritant transfer factor named AcWHITE in the 5'untranslated region (UTR) of the B2 gene is related to the expression of bHLH.

In the present invention, "B2 gene" refers to a gene encoding the bHLH transcription factor in relation to the regulatory MBW complex. (See Fig. 8)

In the present invention, "AcWHITE" is a non-irritating DNA transfer factor, and refers to a nucleotide sequence of 577 bp included in the 5'upstream region of the white allele of the B2 gene. Both ends of the transfer factor have a sequence of 8bp target site replication (GTTATAAC) and 7bp terminal reverse repeat (CAAGGTT). (See Fig. 8)

In the present specification, "AcWHITE-B2 gene" refers to a gene cassette including a nucleotide sequence from the translation start site (TSS) upstream of AcWHITE to exon 1 of the B2 gene. (See Fig. 8)

In the present specification, "transposon" refers to a generic term for an array in which genetic information transcribed from DNA to RNA is synthesized into complementary DNA by reverse transcriptase and inserted again into the genome. The term "retrotransposon" refers to a transposon that can be replicated on the genome and inserted elsewhere, which essentially uses the process of starting with DNA, going through the intermediate stage of RNA, and then back into DNA. Retrotransposons include an LTR retrotransposon with a long terminal repeat (LTR) and a non-LTR retrotransposon without a long terminal repeat (LTR).

According to an embodiment of the present invention, when AcWHITE, which is the non-irritant transfer factor, is located in the 5'untranslated region (UTR) of the B2 gene, the B2 gene is inactivated, thereby inhibiting the transcription of the bHLH protein.

In the present specification, "molecular marker" refers to a molecule that can be used as a marker for a specific trait by using a molecule common to an organism such as a plant species, for example, a difference between molecules such as a DNA sequence. This refers to a marker molecule that can be used as a marker for a specific trait. Since it represents a physical location on a chromosome and encodes a specific phenotypic trait, it can be used as a genetic marker when introducing a specific trait into other crop varieties, such molecular markers can be composed of short DNA sequences, for example a single base. Polymorphism (SNP), restriction enzyme fragment length polymorphism (RFLP), simple sequence length polymorphism (SSLP), gene amplification product length polymorphism (AFLP), DNA polymorphism random amplification (RAPD), variable serial repetition (VNTR), microfractions Polymorphism, simple sequence repetition (SSR), single chain repetition (STR), single characteristic polymorphism (SFP), DArT, RAD markers, etc. may be present, but are not limited thereto.

"Polymorphism" refers to the case where two or more alleles exist in one locus, and among the polymorphic sites, only a single base is different depending on the individual, which is referred to as single base polymorphism (SNP). do. Preferred polymorphic markers have two or more alleles exhibiting an incidence of at least 1%, more preferably at least 5% or 10% in the selected population.

The "single nucleotide polymorphism (SNP)" refers to a general mutation that appears in one of several DNA bases in a single site of a chromosome.

The "locus" refers to a specific fixed position on a chromosome having a specific gene or genetic marker in genetics. Each chromosome has many genes, and each gene occupies a different location or locus.

There are a total of five loci known to determine the onion bulb color (I, C, G, R, L) (El-Shafie MW, Davis GN, (1967) Inheritance of bulb color in the onion (Allium cepa L.). Hilgardia 38:607-622). "I locus" is a color-inhibiting factor, and when it is a dominant homozygous, it exhibits a white guppy color regardless of the genotype of other loci, and is incomplete dominant inheritance. The "C locus" is a basic color factor, and when it is a recessive homozygous locus, it exhibits a white guppy color regardless of other loci. The "G locus" exhibits a chattelose guppy color when it is a recessive homozygous, but the causative gene has not yet been identified. The "R locus" and "L locus" are complementarily involved in the yellow and red guppy colors. Both loci must have a dominant allele to give a red guppy color, otherwise a yellow guppy color. The R locus encodes the enzyme Dihydroflavonol 4-reductase (DFR), and the L locus encodes the enzyme Anthocyanidin synthase (ANS).

In the present specification, the term "dominant" refers to a trait that is born by crossing two obediences having different alleles, and one of the parents (two obediences) of this hybrid in the first generation of hybrids. Conversely, a hidden trait that does not appear is called "recessive". "Completely dominant" refers to a case in which one of the parents and the first generation of hybrids have the same trait that is revealed on the surface if there are two identical genes even if there is one gene and has the same ability to express a trait. "Imperfect dominance" refers to the fact that one side acts in half, and the phenotype of the first hybrid generation appears as an intermediate form between a parent who is a dominant homo and a parent who is a recessive homo. In addition, the dominant relationship between genes is not clear, and it can be said that it is incomplete dominant inheritance when it is affected by other genes.

The "allele" refers to several types of one gene present at the same locus of a homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNP has two types of alleles.

As used herein, "Bulked segregant analysis (BSA)" refers to a technique used to identify genetic markers associated with a mutant phenotype. Through this, genes that confer disease resistance or susceptibility can be found. The analysis forms two groups that display opposite phenotypes for the trait to be investigated, and the DNA of all individuals in each group is collected to create two population DNA samples. These two population samples can be analyzed using techniques such as Restriction fragment length polymorphism (RFLP) or RAPD to detect similarities and differences at various loci in the genome. Both groups have a random distribution of alleles at all loci in the genome, except for the loci associated with the mutation. Consistent differences in loci between the two population samples mean that the locus is associated with the mutation of interest.

The "restriction fragment length polymorphism (RFLP)" refers to a difference between individuals in the size of a DNA fragment that occurs when DNA is cut with a specific restriction enzyme. The nucleotide sequence polymorphism is a sequence difference that occurs every 500 to 1,000 nucleotide sequences on average for each individual. Variations in base pairs can change the length of a gene cut with a restriction enzyme by causing a change in the site recognized by a specific restriction enzyme. Using this difference, restriction fragment length polymorphism is used for genetic identification or parental identification.

The term "RAPD (Randomly amplified polymorphic DNA)" refers to DNA of various lengths that appear when a very small amount of DNA coexisting in a population of the same species is randomly amplified. Since the length of the randomly amplified fragment is different for each individual, it can be used as a nucleic acid fingerprint to distinguish the individual.

In the present specification, "RPKM (Reads Per Kilobase Million)" refers to a value calculated from only the number of READs mapped to a gene in transcription, the length of the gene, and the total number of mapped READs. RPKM values were calculated as follows:

RPKM = (number of reads mapped to the gene) X10 ³ X10 ⁶ / (total number of reads mapped to a given library) X (gene length in bp)

In order to study and utilize the inheritance of specific traits in plants, the use of molecular markers is required. First, it is necessary to clearly assess what factors that indicate genetic diversity are between plant species or between cultivars. Thereafter, a specific nucleotide sequence, the position of a candidate causative gene, or a DNA mutation present upstream or downstream of the causative gene can be analyzed and confirmed, and finally a molecular marker can be developed. In addition, it can be used to create a quantitative trait map (QTL map) of a gene representing a specific trait. In addition, the diversity caused by mutations or modifications in the locus can be confirmed by analysis using the molecular marker.

Among the molecular markers, a genetic marker can be used to introduce useful traits into plants. Certain traits, such as the color of a plant, can be regulated by only a few genes, and qualitative characteristics, such as color, can be identified using marker assisted selection (MAS). Once genetically distinct molecular markers are developed, they can be associated with useful traits in other generations to develop new varieties into which the useful traits have been introduced.

In an embodiment of the present invention, a molecular marker based on AcWHITE of SEQ ID NO: 1 was used. Considering a mutation having biologically equivalent activity, the nucleic acid molecule of the present invention is interpreted as including a sequence exhibiting substantial identity with a sequence listed in the sequence listing. The substantial identity is at least 80 when the sequence of the present invention and any other sequence are aligned to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. % Homology, more preferably 90% homology, and most preferably 98% homology.

Hereinafter, a composition for selecting a white guppy-colored onion including a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1 will be described in detail.

The composition includes an agent capable of amplifying a nucleic acid molecule containing the nucleotide sequence (AcWHITE) of SEQ ID NO: 1 in order to select white guppy-colored onions.

In the present invention, "an agent capable of amplifying a nucleic acid molecule" refers to a composition capable of identifying a white guppy-colored onion by identifying a nucleic acid molecule containing the nucleotide sequence (AcWHITE) through amplification. The composition includes a primer capable of detecting at least a part of the nucleotide sequence of SEQ ID NO: 1 (AcWHITE), and preferably includes the primers of SEQ ID NO: 7 and SEQ ID NO: 8.

In the present invention, "Primer" refers to a single-stranded nucleotide sequence that is complementary to a nucleic acid strand to be replicated, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow the synthesis of the extension product to begin. The specific length and sequence of the primers depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the required DNA or RNA target.

Hereinafter, a kit for selecting a white guppy-colored onion including a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1 will be described in detail.

The kit for selecting a white guppy color onion includes a primer, a restriction enzyme, and a reagent for performing an amplification reaction.

In one embodiment of the present invention, the primer refers to a primer capable of detecting at least a part of the nucleotide sequence of SEQ ID NO: 1 (AcWHITE), and preferably includes a primer comprising the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8 do.

In the present specification, the "restriction enzyme" may be, for example, EcoRI, PstI, AluI, BamHI, HindIII, HaeIII, NotIII, DraIII, BglI, SfiI, AhdI, XcmI, or BstI. However, it is not limited thereto.

In one embodiment of the present invention, the reagent for performing the amplification reaction provides a kit for selecting white guppy-colored onions, characterized in that it comprises a DNA polymerase, dNTPs, and a buffer.

In addition, the kit of the present invention may further include a user's guide describing the optimum reaction performance conditions. The guide is a printout explaining how to use the kit, e.g., how to prepare PCR buffer, suggested reaction conditions, and so on. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

Hereinafter, a method for selecting white guppy-colored onions comprising the step of analyzing whether the nucleotide sequence (AcWHITE) of SEQ ID NO: 1 is present in the gDNA of onion according to the present invention will be described.

According to an embodiment of the present invention, a method for selecting white guppy-colored onions comprises the steps of obtaining gDNA (genomic DNA) from onions; Amplifying the gDNA of the obtained onion; Analyzing whether a nucleic acid molecule containing the nucleotide sequence of SEQ ID NO: 1 is present using the amplified gDNA and a molecular marker; And determining a white guppy-colored onion when a nucleic acid molecule containing the nucleotide sequence of SEQ ID NO: 1 is present in the analysis step.

According to the method of the present invention, gDNA is first obtained from onions.

The gDNA can be obtained from various organs of onions, for example, leaves, roots, stems, seeds, bulbs, guppies, flowers or flowers, and most preferably leaves or germinated guppies. Onions as a source of nucleic acid molecules can be used as a source of any stage of development.

A method for separating and/or obtaining gDNA from onions can be carried out through various methods known in the art (Murray MG, Thompson WF, Rapid isolation of high-molecular-weight plant DNA. Nucleic Acids Res 8:4321- 4326 (1980)).

The amplification step according to the present invention can be carried out by various known gene amplification methods. For example, methods of amplifying the base sequence include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, and transcription-based amplification system. amplification system), strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art.

According to an embodiment of the present invention, a nucleotide sequence was amplified by performing a polymerase chain reaction (PCR) using a primer.

The term "polymerase chain reaction (PCR)" refers to a method capable of amplifying a large amount of DNA sandwiched between two primers in a test tube through a polymerase chain reaction.

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-chain structure. Conditions for hybridization of a nucleic acid suitable for forming such a double-stranded structure may vary depending on the length of the nucleic acid, the composition of the nucleotide, and the like.

In an embodiment of the present invention, a polymerase chain reaction was performed using a primer including the nucleotide sequence of SEQ ID NO: 7 and/or SEQ ID NO: 8.

Various DNA polymerases can be used for the amplification of the present invention, and include the “Klenow” fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from various bacterial species, including Thermus aquaticus (Taq), Thermusthermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcusfuriosus (Pfu). .

When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with the components necessary for the reaction in excess. The excessive amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the component. Cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP are required to be provided to the reaction mixture to the extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approach optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

The analysis step according to the present invention can be carried out by a variety of known genetic analysis methods. For example, there are methods such as southern blot, DNA-sequencing, and fluorescence in situ hybridization. According to an embodiment of the present invention, the amplified gDNA and the molecular marker according to the present invention were analyzed for the presence of a target nucleotide sequence using a southern blot analysis method.

In the present invention, "DNA Sequencing" is a biochemical method for determining the order of linear nucleotide bases constituting DNA. The Maxam-Gilbert sequencing is a DNA sequencing method using chemical changes in DNA and cleavage at a specific base. It is called DNA chemical crystallization and uses purified double-stranded DNA. After radiolabeling the 5'end of the DNA, the part to be sequenced is purified, and the DNA is further cleaved using a base-specific chemical decomposition method. Thereafter, the base sequence is determined using gel electrophoresis and autoradiography. However, this method has not been widely used since the publication of the chain termination method due to the fact that it uses radioactive markers and is technically complex. Chain-termination methods: DNA fragments that determine base sequence are used as a template, DNA polymerase is used to form complementary DNA strands of template DNA fragments, and then analyzed by gel electrophoresis. That's how to do it. Compared to the Maxam-Gilbert method, it uses fewer types of hazardous chemicals and uses low levels of radioactive substances.

In the case of genetic analysis using the novel molecular markers of the present invention, it is possible to clearly select individuals with white guppy color from the F2 isolated group of onions more conveniently and reliably on a large scale compared to the prior art.

Hereinafter, a recombinant vector for producing white guppy-colored onions according to the present invention will be described.

In the present specification, the term "recombinant vector" refers to a vector prepared to express a protein of interest in a suitable host cell, and refers to a genetic construct comprising essential regulatory elements operably linked to express a gene insert.

As used herein, the term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein may be operably linked to affect the expression of the encoding nucleic acid sequence. The operative linkage with the recombinant vector can be prepared using gene recombination techniques known in the art, and site-specific DNA cleavage and linkage may be performed using enzymes generally known in the art.

Vectors that can be used in the present invention include plasmid vectors, cosmid vectors, bacteriophage vectors, and viral vectors such as adenovirus vectors, retroviral vectors, adeno-associated virus vectors, and the like. Suitable expression vectors may include, in addition to expression control elements such as promoters, initiation codons, stop codons, polyadenylation signals and enhancers, etc., signal sequences or leader sequences for membrane targeting or secretion, and may be variously prepared according to the purpose.

In one embodiment of the present invention, a recombinant plasmid containing a nucleotide sequence (AcWHITE) derived from a white guppy-colored onion to be recombined was prepared. Since the type of expression vector may affect the recombination efficiency of AcWHITE, the expression vector should be carefully selected in consideration of various factors such as the field of application and characteristics, as well as the variety of the expression onion.

Hereinafter, a method for producing a white guppy-colored onion according to the present invention will be described in detail. The manufacturing method includes transforming onions using the nucleotide sequence (AcWHITE) represented by SEQ ID NO: 1.

According to an embodiment of the present invention, a method for producing a white guppy-colored onion comprises the steps of preparing a recombinant vector comprising the nucleotide sequence (AcWHITE) of the guppy cells of the selected white guppy-colored onion; And transforming the onion with the recombinant vector.

Transformation of onion cells can be performed using the recombinant vector according to the present invention. As a method for producing a recombinant vector by extracting the nucleotide sequence (AcWHITE), a technique using genetic scissors may be used.

"Gene scissors" are used to cut the DNA of animal and plant genes, and include, for example, restriction enzymes, zinc pinker nucleases (ZFNs), TALENs, CRISPR/Cas9, and the like. Genetic shears can be used in gene editing techniques to solve problems by removing faulty parts of a gene. It can also be used in techniques to cut damaged DNA and replace it with normal DNA. However, it is not limited to the above use. In an embodiment of the present invention, a recombinant vector was prepared using CRISPR/Cas9 with genetic scissors.

The "CRISPR/Cas9" is a type of 3rd generation gene scissors, and consists of "guide RNA" made of RNA and "Cas9", an enzyme that cleaves DNA. CRISPR is a DNA sequence found in the genome of prokaryotic organisms such as bacteria and archaea. Cas9 is an enzyme that uses the CRISPR sequence as a guide to recognize and cut a specific stem of DNA that is complementary to the CRISPR sequence. The "guide RNA" serves as a guide for guiding which part of DNA to be cut. RNA is capable of complementary binding to the sequence of DNA. CRISPR uses these characteristics of RNA to find and combine DNA sequences that are complementary to the base sequence of his RNA.

The guide RNA forms a complex with Cas9, a restriction enzyme that cleaves the double helix of DNA. When you put this enzyme in the part where you want to manipulate the gene, it finds the target DNA sequence and Cas9 cuts the DNA. Cells have the ability to repair when DNA is cut. Therefore, when DNA is restored to its original sequence, Crispr/Cas9 works again and cuts it. If this process is repeated over and over, a "recovery error" will appear and there will be a difference between the original sequence and a few bases. When this difference occurs, CRISPR stops working, and the sequence that has been changed due to a repair error will not be able to exert its original function. In this way, it becomes possible to accurately find and knockout the gene to be cut.

You can also use this technique to not only cut, but also add genes wherever you want. When you insert the DNA sequence you want to add with Crispr/Cas9, the added DNA sequence is absorbed in the process of repairing the cut part of the cell.

In another embodiment of the present invention, transformation may be mediated by Agrobacterium tumefiaciens, but is not limited thereto.

In addition, in an embodiment of the present invention, the manufacturing method includes the step of regenerating transformed onion cells from the transformed onion cells. Any method known in the art may be used as a method for regenerating transformed onion cells from transformed onion cells (Perez-Garcia, P., Moreno-Risueno, MA (2018) Stem cells and plant regeneration. Developmental Biology , 442: 3-12, Ikeuchi, M., Ogawa, Y., Iwase, A. et al. (2016) Plant regeneration: cellular origins and molecular mechanisms. Development (Cambridge, England), 143: 1442-51).

Hereinafter, the transformed transgenic onion according to the present invention and its seeds will be described.

In the present invention, "transformation" refers to a DNA chain fragment containing a gene different from that of the original cell, or a vector such as a plasmid that penetrates and binds to the DNA existing in the original cell to change the genotype.

Plant transformation refers to any method of transferring DNA into a plant. In principle, any transformation method can be used to introduce the recombinant DNA according to the invention into suitable progenitor cells. For example, the calcium/polyethylene glycol method for protoplasts (Krenset al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373), electroporation of protoplasts. (Shillito et al., 1985, Bio/Technol. 3: 1099-1102), microinjection with plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202: 179-185), of various plant elements (DNA or RNA-coated) particle bombardment method (Klein et al., 1987, Nature 327: 70), in Agrobacterium tumerfaciens-mediated gene transfer by invasion of plants or transformation of mature pollen or vesicles ( Incomplete) can be appropriately selected from infection by a virus (EP 0 301 316) and the like.

The "plant cell" used for plant transformation may be any plant cell. Plant cells are cultured cells, cultured tissues, cultured organs or whole plants. “Plant tissue” refers to tissues of differentiated or undifferentiated plants, such as roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used in culture, ie single cells, protoplasts, shoots. And callus tissue. The plant tissue may be in planta, organ culture, tissue culture, or cell culture. In one embodiment of the present invention, onion cells were used as plant cells to be transformed. The onion cells may be, preferably, onion guppy cells.

Hereinafter, examples will be described in detail in order to describe the present invention in detail. This is only for describing the present invention in more detail, and the scope of the present invention is not limited thereto.

Example

Example 1. Materials and methods

1.1. Plant material

Recombinants between closely linked molecular markers and color phenotypes were examined using _{two F 2:3} populations derived from the same maternal line. All F _2:3 populations were generated through self-pollination of heterozygous yellow F _{2 onions. A total of 2491 F 2:3} onions were used to analyze the relationship between the molecular marker and the phenotype. The F _2:3 onion guppy color phenotype was visually confirmed after harvesting guppies. A total of 30 white, yellow or red onion leaf tissue samples were obtained from breeding lines maintained by the Onion Research Institute and the National Institute of Horticultural and Herbal Science. In addition, a total genomic DNA of 116 red or yellow varieties isolated in the previous study was used to analyze molecular markers representing causal characteristics for the C locus.

1.2. Experimental method

1.2.1. RNA-Seq analysis and identification of SNPs and DEGs between white and yellow populations

Total population RNA was extracted from grass leaf-covered tissues germinated from 10 white and 10 yellow onion guppies using the RNeasy Plant Mini Kit. Only yellow F plants whose genotypes for the GST1 and C46747 markers are homozygous dominant were included in the yellow population. The transcript was DNA sequenced using HiSeq 2000.

Sequences interpreted from white and yellow RNA were newly assembled into contigs using Trinity software. The interpreted sequences of the two populations of RNA were individually mapped onto the newly assembled contigs in this study to identify the reference transcript and the SNPs and differentially expressed genes (DEGs) between the two populations. SNP discovery and quantification of contig expression was performed using SAMTools software and RSEM software.

In the present specification, "contig" refers to a set of DNA fragments that overlap each other and are continuous. This is a small piece of DNA whose nucleotide sequence has been identified, and each contig contains the same nucleotide sequence as the other contigs.

The "differential gene expression (DEG)" refers to a phenomenon in which different genes are expressed according to different tissues, developmental stages, times, and stimuli even in the same organism.

1.2.2. Real-time RT-PCR and fast amplification of cDNA ends (RACE)

Real-time RT-PCR was performed by extracting RNA from leaf sheaths germinated from _{5 white and 5 yellow F 2:3} guppies using RNeasy Plant Mini Kit (QIAGEN). The Tubulincoding gene (TC125) retrieved from the DFCI Allium cepa gene index was used as an internal control. The primer sequences of the target and tubulin genes are as follows. (See Table 1)

RACE cDNA was prepared using the SMART RACE cDNA amplification kit. RACE PCR was performed according to the manufacturer's instructions. After staining with Ethidium bromide, the RACE PCR product was visualized on a 1.5% agarose gel. The PCR product was purified using the QIAquick PCR Purification Kit (QIAGEN). The primers used in RACE are as follows. (See Table 1)

Primer name Primer base sequence (5' to 3') apply C9860-F GACAGTGCACGGTAAGCAGA C9860 marker C9860-R ATTTGCAACCGAGCATCAAT B2-RT-F CGTGGAAAATACAAGAACTCGGATCACA Real-time RT-PCR B2-RT-R TTTGTCTTTGAACTTTGCCTGGTCTGAA Tubulin-F GGAAGCATGTGCCCCGTGCTATATTTG Tubulin-R TGGCGGTAAGTTCCAGTTCTCACTTCA B2-RACE-R1 TAAGCCAAACAGGCTGCTGCAGTTCAA 5'RACE PCR B2-RACE-R2 AGCCCATGACCTGGAGGAAAAGCAAAG

In the present invention, "RACE (Rapid amplication of cDNA ends)" refers to a method of amplifying and cloning cDNA to the end of mRNA according to PCR, without basically constructing a cDNA library when only a part of the cDNA nucleotide sequence is known. Say. 1.2.3. PCR amplification and genome walking

Whole genomic DNA was extracted from the leaves of germinated guppies or the tips of guppy scales using the Cetyl trimethylammonium bromide (CTAB) method. For identification of SNPs detected by RNA-seq and separation of full-length genomic DNA sequences of tightly linked contigs and B2 genes, 0.05 μg template, 2.5 μL 10×PCR buffer, 0.2 μL forward primer (10 μM), 0.2 PCR was performed in 25 μL of the reaction mixture containing μL reverse primer (10 μM), 0.2 μL dNTP (10 mM each) and 0.25 μL mixed polymerase. PCR amplification was performed at 95° C. for 4 minutes in the initial denaturation step, 10 cycles at 95° C. for 30 seconds, 65° C. for 30 seconds (0.8° C. decrease in each cycle), and 72° C. for 1 minute, 35° C. for 30 seconds at 95° C. Cycling, at 57° C. for 30 seconds, and 72° C. for 1 minute, and a final 10 minute extension at 72° C. consisted of. After staining with Ethidium bromide, the PCR product was visualized on a 1.5% agarose gel and sequenced as described above. (See Table 2)

For molecular marker analysis, 10 μL containing 0.05 μg template, 1.0 μL 10×PCR buffer, 0.2 μL forward primer (10 μM), 0.2 μL reverse primer (10 μM), 0.2 μL dNTP (10 mM each) and 0.25 U Taq polymerase. PCR amplification was performed in the reaction mixture. PCR amplification was performed at 95° C. for 4 minutes in the initial denaturation step, 10 cycles at 95° C. for 30 seconds, 65° C. for 30 seconds (0.8° C. decrease in each cycle), and 72° C. for 1 minute, 35° C. for 30 seconds at 95° C. Cycling, at 57° C. for 30 seconds, and 72° C. for 1 minute, and a final 10 minute extension at 72° C. consisted of. After staining with Ethidium bromide, genotyping of the B2 marker was performed on a 1.5% agarose gel. The primer sequence of the molecular marker is as follows. (See Table 2)

Primer name Primer base sequence (5' to 3') apply B2-F1-1 TGGGATACAAAAGGTTCATGG B2 marker B2-F1-2 TGGGATAGAAAAGGTTCATGG B2-F2 AAAATTTCAAAAATCGACCAAAA B2-R1 TGCCGTAAGTCCATTGAACA GST1-F TGTTTTAAGGACCCCCATGA GST1 marker GST1-R TTGGCATTCTACTTGTTTGCAT C46747-F TTGGACAATCTGTTCCACAAA C46747 C46747-R GCTACGTATCGTGCATCCTG

Long PCR and genome walking were performed to obtain intron 5 of the B2 gene. For long PCR, reactions were performed in a 50 μL mixture containing 0.25 μg template, 5 μL 10×PCR buffer, 0.2 μM forward primer, 0.2 μM reverse primer, 0.2 mM dNTP and 0.5 μL Taq polymerase. Long PCR amplification was performed with 40 cycles of 98° C. for 10 seconds and 68° C. for 15 minutes. Genome walking was performed using the Universal GenomeWalker kit (Clontech) according to the manufacturer's instructions. In the present invention, "Genome walking" is used to determine the DNA sequence of an unknown genomic region existing upstream of the known DNA sequence. Tell the way. It can capture a sequence of 6-7 kb in one run, and is useful for identifying promoter regions. It is also very useful for capturing homologous genes in new species when there is a region in the target gene with strong sequence conservation for a particular species.

1.2.4. Composition

The reduced amino acid sequence of the bHLH coding gene was aligned using BioEdit software. Differences in alignment were eliminated using Gblocks software. The phylogenetic tree was constructed using MEGA version 7 as a neighbor-joining method. Node support of the phylogenetic tree was evaluated by 1000 bootstrap replicates.

1.2.5. Measurement of copy number of non-irritating DNA transfer factor AcWHITE

In order to measure the copy number of AcWHITE, the total genomic DNA of three onion breeding lines (JNU1306, JNU1305 and JNU1101) was used to obtain a raw analysis value of a 150bp paired-end sequence using the Illumina NextSeq 500 platform. Raw analysis values were refined using Trimmomatic software version 0.38. The refined analysis values were mapped onto the white allele of the B2 gene.

Example 2. Experimental results

2.1. Molecular marker development through BSA and RNA-Seq analysis

2.1.1. BSA and RNA-Seq analysis

Population RNA of yellow F _2:3 individuals contained both homozygous dominant and heterozygous genotypes, resulting in a limited number of reliable SNPs between the yellow and white populations. _{To identify the candidate gene responsible for the C locus, the heterozygous yellow F 2:3} individuals were removed using the GST1 and C46747 markers located closely upstream and/or downstream of the C locus, followed by another round of BSA and RNA. -Seq analysis was performed.

The measurements were individually mapped to the reference transcript, and 214,961 contigs were assembled because the causative gene of the C locus may not be included in the reference transcript. Measurements of the white and yellow populations were used for the new contig combination. Approximately 10% more measurements compared to the reference transcript were mapped onto these newly assembled contigs. A total of 114 contigs containing homozygous SNPs between the white and yellow populations were analyzed using a step-by-step process. Of those, 33 contigs were detected in both the reference and newly assembled contigs. These 114 contigs containing homozygous SNPs were determined to be linked to the C locus. As a result, only 4 contigs showed greater than 95% nucleotide sequence identity with 4 loci ranging from 81.3 to 120.0 cM on chromosome 5, indicating that the C locus is located in the middle of chromosome 5.

2.1.2 Molecular Marker Development and Relevance Analysis

To identify candidate causative genes and develop molecular markers closely linked to the C locus, three F _2:3 populations of 1905 individuals were constructed. The percentage of segregation of the guppy phenotype in these populations was fitted to a single gene genetic pattern. Recombinants were analyzed using two molecular markers (C46747 and GST1). A total of 21 recombinants were identified between the C46747 and C loci, and only a single recombinant was identified between the GST1 and C loci.

Of the 114 analyzed contigs, 40 contigs containing multiple SNPs in the read of the white population were selected for PCR and sequencing. Of these, 34 contigs were confirmed to have homozygous SNPs between population DNAs through nucleotide sequence analysis of PCR products. Two selected recombinants were further analyzed to confirm the position at the C locus of the SNPs of these 34 contigs. As a result, only one Contig showed perfect association with the C locus. The full-length genomic DNA sequence of this closely linked contig was obtained from the white and yellow population DNA, respectively, and a simple PCR marker was developed using 53 bp InDel at Intron 10. However, no significant relationship between the marker genotype and the guppy phenotype was observed in various red, yellow or white sarcoma lineages, indicating that this contig may not be the causative gene of the C locus.

The "Indel" refers to the insertion or deletion of a base in the genome of an organism.

2.2. Concrete analysis and white guppy gene identification

2.2.1. Contig analysis of white and yellow populations

Expression levels of reference and newly assembled contigs in white and yellow population RNAs were evaluated using RPKM (Reads per kilobase of transcript per milion mapped reads) values. The correlation coefficient of the expression level of all contigs between the white and yellow population RNAs was as high as 0.957 compared to the reference and 0.964 compared to the freshly assembled contigs. DEGs showing both a 5-fold or more increase in the yellow population RNA and a 5 or more of the RPKM value were analyzed. A total of 84 and 90 DEGs were identified from the reference and newly assembled contigs, respectively, and 28 contigs were identified from both transcripts. Contigs of one of these DEGs were also identified from contigs containing SNPs. However, this contig's SNP was not completely associated with the C locus.

2.2.2. Discovery of AcWHITE, a non-irritating transfer factor

The levels of transcription of all structural genes encoding enzymes in the anthocyanin biosynthetic pathway were significantly reduced in the white population. Regarding the regulatory MBW complex, the B2 gene encoding the bHLH transcription factor had the most marked reduction in transcription in the white population, but relatively reduced expression levels of some other genes were also observed in the MYB and WD40 coding genes. Reduced transcription of the B2 gene in white F individuals was confirmed by real-time RT-PCR. And another gene encoding the WRKY transcription factor (AcWRKY1) also showed a significant decrease in transcription in the white population.

Since SNPs were not detected in the coding regions of these two genes (B2 and AcWRKY1), 1638bp and 1787bp putative promoter sequences of B2 and AcWRKY1 were obtained through genome walking, respectively. No SNP was detected in the 5'upstream region of the AcWRKY1 gene between the yellow and white population DNA, but a 577 bp insertion was found in the 5'upstream region of the white allele of the B2 gene. The sequence of the 5'RACE PCR product showed that this insertion was located at the 5'end of the 5'UTR region. (See Fig. 8) These inserted sequences did not show significant homology with any known sequence, but these sequences were assumed to belong to the non-irritating DNA transfer factor. 8bp target site replication (GTTATAAC) and 7bp terminal reverse repeat (CAAGGTT) were identified at both ends of this insertion. In addition, the number of copies of this insert was more than 500 times higher than the number of copies of the coding region of the B2 gene. This non-irritating DNA transfer factor was named AcWHITE.

2.2.3. Analysis of the B2 gene

The reduced amino acid sequence of the onion B2 gene showed high homology to the nucleotide sequence of corn IN1 and petunia AN1, which is well known as a major regulator of the anthocyanin biosynthetic pathway. In addition, the B2 gene contained a conserved bHLH domain among other bHLH proteins known to regulate the anthocyanin biosynthetic pathway. Full-length genomic DNA sequences of the white and yellow alleles of the B2 gene were obtained by long PCR and genome walking. The nucleotide sequences of the white and yellow alleles were deposited with GenBank under the accession numbers of MK636837 and MK636838, respectively. The exon-intron configuration of the B2 gene was similar to that of other orthologous genes. The exon-intron boundary of the B2 gene was the same as that of maize IN1 except for the junction between exon 6 and intron 6. On the other hand, the onion B2 gene uniquely possessed a very long (13,852 bp) intron 5. In intron 5, two 2516 bp repeat sequences showing 96% nucleotide sequence identity were identified, making sequence analysis of this long intron 5 difficult. (See Fig. 3) These repeats begin with 5'-TG-3' and end with 5'-CA-3' like other known long-terminal repeat (LTR) reverse transfer factors, and this putative LTR reverse transfer factor replicates the 5 bp target site. It is flanked by (GTAAA). In addition, thousands of reads were mapped to these repeats, and partial sequences were identified that showed homology with the gag/pol polyprotein between the repeats. Therefore, this factor seemed to be highly likely to be an inactive LTR reversing factor.

2.2.4. Preparation of AcWHITE marker and analysis using the same

18 SNPs were identified in the promoter region, but only 2 SNPs were identified in the intron between the yellow and white alleles. Therefore, a simple PCR marker was developed based on the AcWHITE insertion. (See Fig. 4) Primers tracking AcWHITE have low PCR amplification efficiency for an unknown reason, so to compensate for this, a single mismatch nucleotide was introduced at the 8th position of primer B2-F1-2, and two for heterozygous individuals. The strength of the PCR products could be made similar. The 8th nucleotide'cytosine' of the B2-F1-1 primer was changed to'guanine' of the B2-F1-2 primer and used. (See Fig. 5)

All 28 recombinants identified from the large F _2:3 population were analyzed with this marker. The results showed that this marker is completely linked to the C locus without recombinants, suggesting that this gene is related to the C locus. Moreover, AcWHITE insertion was not seen in the 20 red or yellow offspring, but in some white offspring. (See Fig. 5) The marker genotype of the white allele was not detected even in the additional 116 red or yellow onion varieties. White guppy progeny that do not contain AcWHITE indicate that they are caused by the I locus that controls dominant white or other B2 alleles containing other types of mutations.

Taken together, the results of this study imply that the white guppy color imparted by the C locus in onions is expressed by inactivation of the B2 gene encoding the bHLH transcription factor due to the insertion of the non-irritant DNA transfer factor, AcWHITE.

Argument

1. Identification of Recessive White Guppy Color Genes in Onions

The onion B2 gene, which encodes the bHLH transcription factor, was proposed in this study as the causative gene for the C locus that controls recessive white guppy color. Four putative bHLH coding genes (B1, B2, B3 and B4) that exhibit homology with other known regulatory factors of the anthocyanin biosynthetic pathway have been identified from onion transcripts in previous studies. Among them, the B1 and B2 genes had relatively high homology with the bHLH gene. The bHLH transcription factor family is the second largest family of transcription factors identified from yeast, animals and plants. The plant bHLH family is divided into 26 subgroups based on phylogenetic analysis of more than 500 bHLH genes. All known bHLH genes involved in the direct regulation of flavonoid biosynthetic pathways belong to subgroup IIIf. The bHLH gene of subgroup IIIf is subdivided into two subgroups in the phylogenetic tree. In general, the two bHLH genes belonging to each stage population are identified from a single plant species.

In onions, the B1 gene clusters with petunia JAF13 and Arabidopsis GL3, while the B2 gene is likely orthogonal to petunia AN1 and Arabidopsis TT8. Although two genes belonging to each stage control group are involved in the regulation of the flavonoid biosynthetic pathway, the genes of the AN1/TT8 stage control group are known to be essential for anthocyanin production in some species. The onion B2 gene responsible for the white guppy color also belongs to the AN1/TT8 stage group. Thus, the B2 gene appears to play an essential role in the production of anthocyanin pigments in onions. Complementary testing is difficult because onions are the majority of crops resistant to Agrobacterium-mediated transformation, but this study provides some evidence supporting the essential role of the B2 gene in anthocyanin production.

First, phylogenetic analysis revealed that the onion B2 gene is an ortholog to other essential bHLH transcription factors such as petunia AN1, Arabidopsis TT8 and Dahlia DvIVS. In addition, the exon-intron configuration of the B2 gene was almost the same as that of the maize IN1 gene. Analysis of 133 Arabidopsis genes containing the bHLH domain revealed that genes within the same subgroup share similar exon-intron tissues, and a relatively conserved location of the bHLH domain.

Second, molecular markers designed based on the insertion of AcWHITE within the B2 gene sequence showed a perfect association with the C locus in a large isolated population of 2491 individuals. Unlike C9860, another perfectly related marker, the white allele of the B2 gene, was not detected in 136 red or yellow sarcoma lineages or cultivars, which is an imbalance associated with the C locus where the B2 marker controls recessive white guppy color. Implies that it is in. (See Fig. 6)

Finally, damage to the B2 gene by the insertion of AcWHITE affects the mutations on the transcription levels of B2 and all structural genes in the anthocyanin biosynthetic pathway. AcWHITE, a non-irritating DNA transfer factor, is inserted 4bp downstream of the transcription start site. Although AcWHITE was inserted into the 5'UTR instead of the promoter region, the level of transcription of the B2 gene was significantly reduced in _{white RNA scale and white F 2:3 individuals.} An important role of 5'UTR in gene expression has been reported in some plant species. In addition to the B2 gene, transcription levels of all structural genes encoding enzymes from CHS to glucose flavonoid glucosyltransferase (UFGT) in the anthocyanin biosynthetic pathway were significantly reduced in white population RNA. This result implies that the expression of all structural genes can be under the control of the MBW complex in onions, and that the B2 gene is likely a member of the MBW complex.

2. Development of molecular markers for identification and analysis of AcWHITE DNA transfer factors

2.1. Identification of AcWHITE DNA transfer factors

Since there was no polymorphism in the coding region of the B2 gene, contigs corresponding to B2 were not detected by the SNP analysis process. Only two SNPs were identified in the intron, indicating that the white mutant allele was derived from the recent translocation of the AcWHITE DNA transfer factor. Since diploid onions contain approximately 16 Gb of genome, most of the onion genome can be made up of implantable elements. Although the non-irritating DNA transcription factor AcWHITE does not contain an open reading frame (ORF) encoding a transferase, it includes 7bp terminal reverse repeat and 8bp target site replication as typical features of the DNA transfer factor. The number of copies of non-irritating DNA transfer factors is generally higher than that of intact DNA transfer factors. In this study, the number of copies of AcWHITE was measured to be over 500. Similarly, the copy number of AcPINK, another onion's non-irritant DNA transfer factor, identified in the promoter region of the ANS gene was very high compared to the three other fully transferable elements.

2.2. Development of molecular markers for genotyping of the C locus

Since there are few polymorphisms in the exons and introns of the B2 allele, a simple PCR marker was developed based on the AcWHITE insertion in this study. As expected, no PCR product tracking AcWHITE was detected in the red or yellow breeding lines or varieties of this experiment.

Sequence list Contents One AcWHITE base sequence 2 B2 gene sequence of yellow guppy onion 3 B2 gene sequence of yellow guppy onion including AcWHITE 4 AcWHITE-B2 gene sequence 5 Forward primer B2-F1-1 base sequence for AcWHITE detection 6 Forward primer B2-F1-2 base sequence for AcWHITE detection 7 Forward primer B2-F2 base sequence for AcWHITE detection 8 Reverse primer B2-R1 nucleotide sequence for AcWHITE detection 9 Intron 5 base sequence of B2 gene 10 Inactive LTR retrotransposon sequence in intron 5

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> A molecular marker for selecting onion white bulb color and the use thereof <130> p10095 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 577 <212> DNA <213> Allium cepa <400> 1 caaggttcaa aattccggcg gaattccggt tattccggtg attccgttcc ggttccggtc 60 ataaccggaa cggaatccgg tcaaaattcc ggttccggtc taaattccgg atttaatttt 120 caaatattga aaaaaaatta taaaaaaata aaaaaattca acaaacatat agcaattaaa 180 aaagaaaagc aaattaaaca ggacaataaa taaattgaca aaaaatcatg tgtatgaata 240 aaaaaagttg ttatattttt gttaatttac gtcgaatcat aataaaaatt tcaaaaatcg 300 accaaaattt taaaatctta aatgagcaat acagactttt taaacaatgg ttttttaatc 360 aaagtgtatt ttacacgtaa tttaaataat gtactataaa tttatgattg tattgaatat 420 ttattagcga aatagcaaat taaagcaaaa aagtaccgga attagaaaac cggaattaaa 480 acggaacttc cgaaatttcc ggaacggaac cgaaatttta aaattaccaa tgaccgaaac 540 ggaaacggaa aacggaattt caaaccttgg ttataac 577 <210> 2 <211> 19374 <212> DNA <213> Allium cepa <400> 2 cggaccggat cgaaactgaa ccgtattaca ttcaaaccgg accgaaaccg aaccgtttaa 60 aggattggta taatggtttg tatttttgat taaccgttta atgcgatgcg gaagcggttt 120 ggactccaaa ccgcgccaaa ccgatccgcg ccacccataa gcaaaattag tttgagaatt 180 ttatcgtgtg tactacatat tataatcaaa acaaagttta gaatatgaca acctatcttt 240 attatataag gagtaaaaaa tgacgctata gtagtagatg cttttaagta gaaaggaata 300 ttagttacca ttagtgcagc atacggtctg aaagtcatat gcaattattt cccagcgatt 360 gaagatgtca aatactagat tggcagtttc tggttaaaca ttttcatgga aataattcct 420 aaatttggcc tgctatttat tacagattac cccagcattt atcacaattt ttaggcttac 480 gcaatgcatc tatcagtatc tgcagtaggt agcaagcacc aaatgacaca cccatatata 540 ctaacttttc aattgaagaa ttttgcaacg aatctggaaa tttttgtata aatttatttg 600 agaaatggga tacaaaaggt tcatggaaag atcaaatgtt tttattatga aactttgtta 660 tttgtattat cagttatatt aagtttaatg gtatttatga agagttctta ctggtgacac 720 actacaccaa ttaccaaatc ctcaattcca ttaacaaaca aataactgat tcgtgtggtt 780 ctataataaa ctataacaat ttacctaata ctctttacgt acgtattctc aatacacata 840 aagtactgac ctttattgac ataatagtaa aagagtacat gcgtttaaaa caggcatcag 900 ttcatacttc attttgttaa tacacgtgat aaatagattt gtcagtttat taccgacctg 960 tagaaccaac cattcaactc ataaacagtc catggcatgt agaatatcac tttctcattc 1020 ctattatctg tttccctcca catctattac cgaaccatat caaactgttt catcttatgt 1080 ggacaatatc acaaatgata taaaatgtag gaattcaatt aaaacgttac atgttataac 1140 ataaagcttt ggatatggca aaggactcga gtagtaatag caagcttcag gagatcctgc 1200 agctggctgt gcaaagtgtt caatggactt acggcatttt ttggcagctc tgcccaaatc 1260 aaaggtgtgt tggtttttct tgaaaagttt ccactaagcg ctcaactgac ctaattaata 1320 tggatttgaa atgggtaagg atgttaatat ggggagatgg atactacaat ggagcaataa 1380 agacaagaaa gacagtgcaa ggagttgaaa ttagcgcaga agatgtacct atacatagaa 1440 gccaacagtt aagagagctc tacgagtcac tttcaaatgc aggcgacgct gaacaaccca 1500 gtcataggtc gtgcacttct ttgtcccccg aagatttgtc tgagtatgaa tggttctacc 1560 tcatgtgttt ctcctttgct tttcctccag gtcatgggta tgtttatagt atctttgtta 1620 tttgtaattt tgaagtttta tttattttca ggtgttcaat ttatacctct aatgatttgt 1680 tttgttgccg cactacttaa ttgcaatcat gatcctcgac atcaaaacat taaaccaaag 1740 acacacatga aattttgttt tccaaagtag aaagatttga catgaaggat aggtattgat 1800 taactgttag caaccaaaat atttgaaaat attgaattgt ataaagatta tttataaaag 1860 aatcttaatt gtctgtatta aactttaatt aactacattt tctgcgaaaa gacattcttt 1920 gatgcctagg agtacgatgc attaactttt cgagatgttt aaatagtgtg atttgtttcc 1980 aggcatcttt tttccattcc tagaagtatg agatcctaat attttaactc aaaactgaag 2040 tatggattag aaagttgcca ttcaataata tgtaaatgaa tattttgcac tacgacaagg 2100 gatttggagc agtttactaa gtacttaatt aacgactgaa atcaattaga gcaagatccg 2160 tagagaagta atgtttgatg aagagagata cactcaatac taagaacgta agtgttacag 2220 tacctggtct ccaattcaag tcccagacac atatccgatt gaaaatttat caagagatga 2280 ttaatatagt accgagatct cttacagaag atacatgtta agcttttaag atatataaca 2340 tagtagtgtg tatagagaat agtcttacta cgtgatacca taataagttt cctatgttat 2400 agtgcaagag taatgtggtc gttttactgc atactgcata tgtgatacca taaatccaaa 2460 tagctccggt gtaaatgcta tataaggaag tagttggaga tgtctattac ataggaatat 2520 gtacgatgat aataatacac gttatattta caagtacagg ctaccaggaa aagcacttga 2580 actgcagcag cctgtttggc ttacaaaagc aaatggggca gacagtggaa tattcagcag 2640 ggccattctt gcaaaggtac ctcaattaaa tagaagtata gttttcttgt gggcccacaa 2700 accctacaaa ttaacagata attaagactg attttcggtg caaactattg aaacaaacat 2760 ttgaataatt ggtaatatca agtgatcaaa ttgtggaaga aactatcgca ataaagtaat 2820 gttggaaatt tcaagaggat ttttacgttc tgataccacc attgagaaat ttctatagaa 2880 agaagaaaga gaaagaagta acttctaatt tactaatgaa attgaaagaa tattttgtaa 2940 agaaggaaat atgacttatt ttctctttgt actttttttg cttgtatata attacatttt 3000 ccacatcaag tgagatagca catctcaagt tataataaag tatattatct gggcttttct 3060 atttctagac ttttttttca attttcaatt ttctaaattt ttcttgacaa accattttaa 3120 ttctccaaat tacatattat tcttaatttt aacattttct aaatataagg attaaatttg 3180 taacagaacc aatgttttct aaaaacaaag tttatttcaa acaagtaatg gtatagatgc 3240 attgcaacta tccaagtgtg ctctataaat atcacatcat aatagcgact aagcaataag 3300 tttcggtttc aaaaagtcct ttgtgccatc aaggttgatc attcagaact gagatagtaa 3360 acaaaattgt acataacaac aagaacaatc aacaaaagta tctaactatc atagaaccaa 3420 gaactccgtg atatttgtac tttttatcct tattctaact taatttctca ttcttttgtt 3480 tgtgatacat caatgtgacg aattaaaccg aattcggtat gcataatcag agcgcgcaca 3540 ttcaggttat attttttctc gaaaccaatc tccataattt tatttttttg ttcaaaagaa 3600 gaaaacgtct aaccataatg cttgatgttg cagacagtaa tctgcattcc tgtaatgcat 3660 ggggtatttg aacttggaac gctagaaaat gtgagttcaa atttgttatt tccgccaact 3720 atttttgtca ttacctattt ctgttaaagg tttaacttta gtgaaaaaga tctatcagtt 3780 atacataaag caagtaaact taagttacct tttattttca tccacggtct ctttcactta 3840 tccgcaaata taattccatt aagttattaa ctcaccaatt attctaaact aatccgcatg 3900 tgggttagct gacagaataa ttaaggtatt ctaattttca tttatttgct tactctttta 3960 ctttgctgtt tataattcta cttctattca tgaaatacaa aatctgtaca ttagagtcaa 4020 aattatgaga aaagctactc aaatagtcag ctaaaaaaca attgatacaa accaaacata 4080 ctaggtgtca taatataaga ttttagcaga aagattacac atttcttaca tatataaaat 4140 ctccaatcca tacaccattt aatgcgacta caataaaatc agaagatggt catttatctt 4200 tgtaagccta aatcattttc agatttgaac tgcagtggaa aagaaagagt gacttatatt 4260 acaagaagaa agaagtatac ttggtggata aactaatcat tttttcaaaa ttatataaaa 4320 gtttgaagac gctatttttg tgggcggatt agaagactaa aaatgttgat tcatgtaaaa 4380 cttaccgacc ttaaaaatac aacgagtatc aaatgaaagt atagagccgc agttatcgca 4440 gttatcaaat ataagcatca caatataatt gaaacgggtt gtgataatgg accatcccga 4500 agcccaattt tctttttata aatatcaagt tgtaaacagt tcactgtatt atcaaaagaa 4560 caaatacatt ctgtaactac agaatatttt tcttgttcac tgtttttcaa atattaatca 4620 ataaaatcaa gattcaaact ctctcatatt ctttcttggt atcaaagcgt gtacattgct 4680 taacagcaaa agaaaagttc atcagaaaat caacagagaa gaagagaaca gcaaaagaaa 4740 agctcatcag aaaatcaaca caaaaaggag gaaaacacaa atcgtgccat gtcattaacc 4800 tctcaaagaa gatctcatca cagagattag gctgcactta aaatcatcag aaaattaaaa 4860 ttttcatcat ctgattgtga atcatcagag aattaacatt ctcttcatct gattgtgaat 4920 atatttgtct aacctgggtt tttgtcaaat ctcctcctct ctgttcaaca tttctgatca 4980 cttcactcta ctgcctcgtc aagaaatcgg ttgtcagaga caatttcatc actcaattga 5040 tttctggctg cacttttctc taagtgtatt cattcccaca aatttttctg taaaaaattc 5100 tttaatccca taagttcttg aatatggttg aaggggatat taacaactca gcttcttctg 5160 aagcaagaac aaccaattca gcatcttaaa ctgccaatac ccaagatctc atcaaagcca 5220 tcataaagtc acaaagtcaa atagtcagtg ttcaactaga tgaaaacaat tacttgctct 5280 ggaaattcca gatagaaaca gcagtgagag gctatggcct tgaggatcat gttcttggaa 5340 cattaattac accatcaaaa tacactgcag ataaagatga caaattagtg agtaatcaag 5400 attatgttac acaccaatgg aaagacagtc taattagtgc ttggttactg tcttttataa 5460 gtgcaaacat tctaccatag ctaattgagt gcaagagtgc acatgaaata tagtcaacag 5520 tggagcagat ctttaacaca cagtctgctg caaaaatcat gtattacaaa agacaactac 5580 aaagcataag aaaagaaaac atgtcaatga gagagtacat gaccaagatc aagacactgt 5640 gtgatcaact tgcatcaatg ggtcataaaa tctcagacac tgggcaagtc ttatgcattc 5700 taggtggttt aaatgaagaa tatgaggcag tggtagcagt tatttcctcg aaggaaacaa 5760 caccaaatat acaatatgtt cactcaactc tactagccca tgaaggaaga atagaacaaa 5820 gaagatcaac aatttcatat cttattgtaa atgtgacgcc ccacctctat actcacgcta 5880 gtcaaggaca ctacaggata ataccgtcaa ctaacatgga gaataaggct gattaggagc 5940 gaccatctat atccttgctc taactatcta ttgaatacat caataataga cataccaagc 6000 aggtcgacat acccaattaa tacttaaaac aaaaccatag gtggttgaag gaactatcag 6060 aacataatat aacaactcaa atgtaatata catcacagaa cagtagatca tcatatacac 6120 atatattgat acataacaga atttacaaac tgatacacgt caagtggtat agcaaaccac 6180 aataaacagg caaatccaaa agaacgcata tatcagagtt acaacaaaaa ggactacaca 6240 taaagcttta acaaatagga gcaagctgaa tagtccatgc agaagcaaaa taggctaagt 6300 ccaaaagcac ctaacctgaa acatctcggt ctgacccgag tataatacac gagtcagtct 6360 agctaaacaa atcagttaga taaactgaac aacaataacc tgcaaagtta caaagtataa 6420 caaatatctc taaaagagat aacacaatca tctaacaaaa agatgaatca tatcataaca 6480 agcctcgtat catcggcaac tcagagaaac aaaggatagg aatatcccaa aacaagccat 6540 aaagacaaat aacaaatacc aatgaaggta acagaagttc ctcaaggtaa tcgctatata 6600 ttgtgcggct caaaaagacc aacaccgaag agtgatacct agggaatata catatcaatg 6660 aaacatcaga aaattttaat tgcaacaaac ccaaatatat catgagcggt ggtgaagaaa 6720 ccactccaat atctctcgag cggtggtgaa gaaaaaccac tccgaaagca atactaaagg 6780 taaccgacaa ccccaaatat ctctcgagcc ggggcaacgg accaactcca aaagcgatat 6840 taaaggcaac aagccagaag gagatagtct gaagacacta tcccaaaggc aacatgtgtc 6900 acaaactccc agaaaggaat ccgaaaagtg gtaacgtgag tctcataacc acccgttcgc 6960 attaaacggt ttactatccg ttagttaatt tcacactcaa agcagtacaa agtttacctc 7020 atctcatcgg taaaccagac acaaaggtca aaacgttcaa acgaatagat tgagaattaa 7080 ctgagaagat gaacgcacgt gttcattgca cgtgttttat ctaatcattt gattctcctc 7140 ccacttcgct cggagtgcga aaccgtgtgt gttttaaata gaatttataa attggagaaa 7200 cgagctttta atgcaattta aagggattat tttataaaaa acccgtggat gaagtcaaaa 7260 aggtatcatc aaggtcaaat atgcaaaaac aactaattgg aatcaatgtg gatcgataaa 7320 agttggaatc acagacaaat aggcaaagta ggaaaaacag gggaacatga gcaggtcggt 7380 tgaccggact ctgagctcgg tcgaccggcc caaaaacaga gaagtgctct ggtagcaggt 7440 cggtcaccgg cctactgagt tcgatcggcc gaaccctgtt tccagcactt cccagcctat 7500 caaaacgagg gccaatctcg accaaattgc aatcgttcga gcaacgacgc caagggttta 7560 tgtcaatcga ctacccgatg ctatatgctc ctcgatgcat caccaaaaac atgtttaaac 7620 atcaaagtta tgatctttaa agatttgaac ccaaaacact aaaaattggg atattcacca 7680 attcaatcca aatcaagagc aaatgcacat gaaaaagtgt taggaattca tatctgacaa 7740 tcaaagatag atataagcat agatgtaaga taaaaatccc acctttaacc ctaaaaaaaa 7800 gaagaagaag aagctcaatt gcaaggaaaa gatcaaccac tctctacttc aactcgacta 7860 gcttcaatct aagatcaaaa caagtatttc ctaagttagg tttaggaaac ttctgaaatt 7920 gaaggagaaa gagttggaga agatgaagag gaggcttacc aatagcttct tttgattttg 7980 gagcaagaat ttgagctagc aagagaaact agagcttaga gtttctaatt ccctttcctt 8040 tccaccattt tcagttagag cttgagtttg aggagtggga atgagtgaat ggagaggaga 8100 gagctgagtt agggtattaa gttagctagt gggttgaacc caaacccaaa acccaactag 8160 aaaaagtagc aaaattcaac ttactccaaa catatcaaag cttatactca aaaagatcac 8220 aaagccattt tggactcaat ggatgtggtc ttgagtccca attcgaccgt ttgcagaaag 8280 tagccttttg gactataatc cgacaaacga cgttatattt aagtaaaata tttaaatata 8340 caaccgataa atatgcgggt tgttacagac tcccctcctt aaaaaaattg cgtcctcgca 8400 attcttaaga agaaaataaa gagtaacaac ccaaaaacat atcaacacat aagaataaca 8460 gaataagaag ttcaccataa agtgcacgaa aggataagcc ctaacttgtt tgctcataga 8520 attttgtgga ttcctaagct caaaataatt cggaacaccg acatggcgca acaatacgtc 8580 aaatgaacca aagctcaaca aaatgaagta caacaaaacg tccgatgaac ttggtaaaaa 8640 gatcattcca ttcggacatc aacaaagaaa caatcacttg ttgcttacaa ctaaatgcat 8700 tggcaacacg atccccccttt caggaataaa aagaatgaga gtattggaaa agagttcttt 8760 taaataatca actttcccga aaagctaaaa ctttcaaaat cacaattatc tttatgtaat 8820 tatttttcta gaaaattttt cttatttcaa atcaattcac tgtgtctgat tgtctcatca 8880 aagctttagg tgattcctat cgataacgtt gattaagcgc atcgaccaga attcttaaag 8940 cacttaatgg gcaatacaat cacaaaacaa tcttctatat gataaacata tttctaaaaa 9000 cttttaaaaa ttatctttgt tttttttaag aataaaaatc ccatttatac ttataaataa 9060 atcttatgaa aaagatttgc aaaaattttg aattgctaat ttccatccaa aaccaataaa 9120 tgctaaaatg gaatcatcga gatattcaca aaatactcga ttcatacaat ggatgaaatg 9180 agctagacaa actgaatgac ataataaatc attcataaga atcacaacga gtgcggaatg 9240 cggtaagtgg agtgctaact tccgcaactc gtagccaaat caaaaccggt ggcaaggtcg 9300 agctgaaaag accttaatac cactcaaagg attgcttagg agataatcct aagactagac 9360 ccaaaatacc agaaaattct cgaactataa gaatgtgaga aacaacactt tcctcatcat 9420 gagggattaa agaaataaaa tgatgccatc aaattggaaa tcgaatcaca aagaaaagta 9480 gaaacctacc aaaatagatg gagacataac ttatccctga gaagaacctc cagaagcatt 9540 tgttacattt aacttaccag atggagaatt attcggagca atgggacaag tggaactacg 9600 atggtcttcg ttcttgcaat agcggcagaa gagaggctta ggacaagctc gaatcatatg 9660 atcaggagaa ccacaattga aacacttccg aatggaaggc gttccagcag gctgagactg 9720 agaatcagat tcaacggact ttttcttctt ggaagggaaa aattcccgct catccaatgg 9780 agactgcttt ttgttggggt tcttacgaac ctcaacatca tcaccactat cacaatcctt 9840 ctcgatggtt tcaagatgaa gtgcagaatc taccaactcc tcaaaagaaa gcttaaactg 9900 gagcaataaa gacttcttaa gatatttctt aagaccagaa acaaacttca aattcttctt 9960 ataagaagtg caaatgaatt catgaccata cttagataaa gcctcaaatg atgaaacata 10020 ctcagaaaca gaagacttcc cttacttcaa cacgaggaag cgacgggtca ataaaacttt 10080 ttcagattca ggaacaaact tgagttcgaa tcgtccccga aactgagtcc aaaaaagagt 10140 agactcatca atttcggcta caagaagctc ataccaatca agagcacgct attgtaataa 10200 gctagaagtt acaagaaccc tatcatgatc agaaagatcc atgcgagaga aaatacgctc 10260 gcacgtgcga agccaagctt ggacttcaag aacagactcg gagcctttaa acggctttcc 10320 accaagatga gaaaaatcac ttcacaggcg tgcaaaagta gacttgcgag gtggagatac 10380 acgagtagga gctggaggct gaatgctcct aaacaactcc ataaactgat cggcagacat 10440 ataaacgcca tccggatgtg agccactgga ttgcccagca tccgaacgtc gtcccctgcc 10500 tcttccagcc atacgttgaa agttaagata agaacaagat tattcacaag gcagatgatt 10560 caatatggaa tactacagga tttaaatgca ttcctagacg tattcccaca ttctatcaac 10620 caccaagaca caaaagaaat atagaggcat gatgattcaa agatttgtat cacttataca 10680 ctttgacgta ccggaatatg tgcgtctatt ctgtgtttat catattttgt tctaaacctc 10740 gctctgatac caagctgtga cgcctcacct ctatacccac gctagccaag gacactacag 10800 ggtaatgccg tcaactaaca cggagaataa ggctggttag gagcgaccat ctatagcctt 10860 gctctaacta tctattgaat acatcgacaa tagacatacc aagcaggtcg acgtacctaa 10920 tgaatactta aaacaaaacc ataggtggtt ggaggatcta tcagaacata atataacaac 10980 tcaaatgtaa tatacatcac agaacagtag atcatcatat acacatatat tgatacataa 11040 cagagtttac aaactgatac acgtcaagtg atatagcaaa ccacaataaa caggcaaatc 11100 caaaagaata catatatcag agttacaaca aaaaggacta cacataaagc tttaacaaaa 11160 aggagcaagc tgaatagtcc atgcggaagc aaaatagcta agtccaaaag cacctaacct 11220 gaaacatctc ggtctgaccc gagtataata cacgggtcag tctagctaaa caaatcagtt 11280 agataaactg aacaacaata acctgcaaag tcacaaagta taacaaatat ctctaaaaga 11340 gataacacaa tcatctaaca aaaagatgaa tcatatcata acaagcctcg tatcatcggc 11400 aactcataga aacaaaggat aggaatatcc caaaacaagc cataaaggca aataacaaat 11460 actagtgaag gtaacacaag ttccacaagg taatcgctat atatcgtgcg gctcaaaaag 11520 accaacaccg aagagcgata cctagggaat atacatatca atgaaacatc ataaaatttt 11580 aattgcaaca aacccaaata tctcatgagc ggtggtgaag aaaccagtcc aatatctctc 11640 gagcggtggt gaagaaaaac cactccgaaa gcaatactaa aggtaaccga caaccccaaa 11700 tatctctcga gccggggcaa aggaccaact ccaaaagcga tatttaaggc aacaagccag 11760 aaggagacag tccaaagaca ctatcccaaa ggcaacatgt gtcacaaact ctcagaaagg 11820 aatccgaaaa gtggtaacgt gagtctcata accacccgtt cgcactaaac ggtttcttat 11880 ccgttagtta atttcacact caaagcagta caaagtttac ctcatctcat cggtaaacca 11940 gacacaaagg tcaaaacgtt caaacgaata tattgggaat taactgagaa tatgaacgca 12000 cgtgttcatt gcacgcgttt tatctaatca tttgattctc ctcccacttc gctcggagtg 12060 cgaaaccgtg tgtgttttaa atagaattta taaattggag aaatgtgctt ttaatgcaac 12120 ttaaagggat tattttataa aaatcccgtg gatgaagtca aaaaggaatc atcaaggtca 12180 aatatgcata aacaactaat tggaatcaac gtgcatcgat aaaagttgga atcacagaca 12240 aataggcaaa gtagaaaaaa caggggaaca ggagcaggtc ggttgaccgg actttgagct 12300 cggtcgaccg gcccaaaaac agagaagtgc tctggtagca ggtcggtcga ccggcctact 12360 gagttcgatc ggccaaaccc tgtttccagc acttcccagc ctatcaaaac gagggccaat 12420 ctcgaccaaa ttgcaatcgt tcgagcaaag ccgccaaggg tttatgccaa tcgactaccc 12480 gacgctatat gctcctcgat gcatcaccaa aaacatgttt aaacatcaaa gttatgatct 12540 ttaaagattt gaacccaaaa cactaaaaat tgggatattc accaattcaa tccaaatcaa 12600 gagcaaatgc acatgaaaaa gtgttaggaa ttcatacctg acaatcaaag atagatataa 12660 gcatagatgt gtgataaaaa tctcaccttt aaccctaaaa aaagaagaag aagacgctca 12720 attgtaagga aaagatcaac cactctccac ttcaactcta ctagcttcaa tctaagatca 12780 aaacaagtat ttcttaagtt aggtttagga aacttctgaa attgaaggag aaagagttgg 12840 agaagatgaa gaggaggctt accaatagct tcttttgatt ttggagcaag aatttgagct 12900 agcaagagaa actagggctt ggagtttcta attccctttc ctttccacca ttttcagtta 12960 gagcttgagt ttgagaagtg ggaatgagtg aatggagagg agagagctga gttagggtat 13020 taagttagct agtgggctga acccaaaccc aaaacccaac tagaaaaagt agcaaaattt 13080 aacttactcc aaacatatca aagcttatat tcaaaaagat tgcaaacgcc attttggact 13140 caatggaggt ggtcttgagt cccaattcga ccgtttgcag aaagtagctt tttggactat 13200 aatccgacaa atgacgttat atttaaataa aatatttaaa tatgcaaccg ataaatatgc 13260 gggttgttac agtaaacttc gccagcaata acagattcaa gaatcaagaa agaagcaaca 13320 acaataaaaa tcagcctaat tttcaaagaa atggtcaatc ctctagatcc agaggaagaa 13380 atggaagata taacaacagc aataacagac tatggtgtca aatttgtgaa aagtttggtc 13440 atgcagccaa cgaatgttac ttcagatttg atgccaacta cattccatct cagcaaaata 13500 acaacagttc aagaaatcac aatctcaatg caaacatggt aaatacttat ccagattcta 13560 aagaacaagc agataccaaa agtacagaga ctgcaaagat tgatgatatc taggatgaaa 13620 gctagtatcc agattatgag gctaccaatc atgtaactaa taatctcaac aatctaaact 13680 tgggaagcag ggagtacaga ggtaggcaat taattcatat gggtaatggt gaatcagtaa 13740 aaattacaca tattggaaat gcaagtttca gtggcagaaa ataactcttt ctaaaaaatc 13800 tgctaagagt tccatctatt agaaaaacct tattgagtgt ttcgcatttt gcccaaggca 13860 atgatgtgta ttttatccca aatactgttt aattagagat attctaacta aggaaataat 13920 tttgcagggt aagaaattta aaggattgta caaattcgat gttgcaaaat caggaaattc 13980 cgaatttcat ggaaaatggt gtaatgttac tgaaattgaa catgaagata actataaaga 14040 ttttgatatt tgacattcca aacttggaca tccaagtgta agcattgtaa aaaaggtgtt 14 100 aagtaatgat aatatttctg ttaaagatgt tgcaatgcct tatgtatgta catattgtca 14160 aatgggcaaa agccataaac ttgcatttcc aatctcaaaa ataaactata caaaaccctt 14220 agattaattg cttgagatct atggggtcca tcttctgtta acactgatta tggctataaa 14280 tactttatat catttgtcga tgcatactct agatatgtat ggatttattt cttgaaatca 14340 aaatctgaaa cttatgatgc agtcttacag tttataactc aagctgagag gcaaacaaat 14400 tgccaattaa aagtcttgca gactgatggt ggaaccgagt ttcaaccact taaggaatac 14460 cttcaaaaga aaggtataat tcacagaaca aactgtccat acacatcaga acaaaatgga 14520 ctggttgaaa gaaaacacag acatattgtt gagactgggc ttactttact agcccaagca 14580 tctcttcctc taaagttttg accagatgcc tttgccacta ctgtgttttt aataaataga 14640 ttatccataa aagttttaca gttcaaaagt ccagtggaaa tcttatttaa agttaagcca 14700 gaatatcata gtttgaaagt ttttggatgt ttatgctttc cctatttaag gccatataat 14760 acacacaagt taagtttcag gtcatcacca tgtaccttct taggctatgc agccaataag 14820 aagggataca aatgcttgga tagcaatgaa ttttgttttt gtttctatac atgtggtgtt 14880 taatgaaaga atatttccct ttaatcaatc aaacataaaa acatcacaga aagtgtataa 14940 ttcaaaactt tctataccac cagtacctga gcaacttgat gtcataactc aagttgaaga 15000 tgaaagaatg cagcacaata taactttaga gtctcctgtc aaatccactt cacaatacac 15060 tgtgcccaga cctgagccag gtcatgaaga agatgaacaa gctggaagca caagtgaggc 15120 atctcatatg tgccccatct atcagtcaga ctgcagtcag tcattagatg attcacaatc 15180 atctaatgat caacaggaag tcacagctga agagccaagt caatcacctg cacaagctag 15240 acatcacatg ataacaaggg ccaagagtgg tatattcaca ccaaaaatat acagtgttgc 15300 tatgaacaca gaagagccag atacctatca tcaagctatg cagaatgaaa actggatgtc 15360 tgctatggaa gaagaataca atgcattgat aaaaaataaa acatgggatc taacttcatt 15420 gccaagcaat aaaaatgtca taggctgtaa acggacatat agaataaaga gaagtggtga 15480 tggttcggtt tctaaatata aggcaaggct agtagccgaa gggtattcat agcaaagtgg 15540 ctttgacttt actgaaactt tttcaccagt tgtgaaaccc tcaactatta gaattgttct 15600 tactattgcc ttacatacaa actgaaacat caagcaatta gatgtaaata atgccctttt 15660 gtggcatttt acaggaggaa gtctacatgt aacagcctct aggttttgaa caaaaaaggg 15720 gtggaaaact tgtatgcaaa ttgaacaaag cgatctatag actcaaacat gcaccaaggg 15780 tctggtttga aaagctgaag tcaatactaa tcagacttgg ctacagctca acaaaatcat 15840 acaattcttt atttacaaaa tttaaaaaca atgcaaccat gtatgtacta atatatgttg 15900 atgattttat tattacaagc agcagtgaac cagagatgaa taaactcaca gacctcttaa 15960 ataaagaatt ttcaatcaaa gacttgggga acttaaatta ctttcttggc attgaggtta 16020 aaagactttc acacatagaa atgcttctaa gtcaaaggaa atacatctca gaaatcttac 16080 agaaagcaaa aacggataaa gcaaatgcaa tatctactcc tatggcaagc aattcacatc 16140 tgtcaacgta taaaggagaa tccatatcac atggcaagca gtacagaagt attgtaggag 16200 cattacagta tgtaacaatc actaagccag aaatttcatt tagtatcaat aaagtgagtc 16260 aatatatgca aatttcactg gatgaacatt ggaaagcagt taagagaatt ctaagatatc 16320 tcaaaggaac tataaatcat ggattaaaga tgcaatcatg caaatctatc catataaaag 16380 ggtatgcaga tgcagattgg gccacagaca tggatgacag aagatctacc actggttatt 16440 gcatatttct aggcaacaat ccagtttcat ggtgctcaaa aaaacagcct acagtatctc 16500 ggtcaagtac tgaagccgag tacagaaacg ttgctaatgc aacagctgaa ataatatgga 16560 taatgtcctt gctcagtgaa cttcatatca agtttacaga aaaaccgaca atttggtgcg 16620 acaatctgag caccgttctg ccctcagcaa atctagttct acatgctaga accaagcaca 16680 tagaactgga tctgtatttt gtcagagaac aagtaacaga ggaaaaaatt aacataagtc 16740 atctaccatc atcttaccaa atcgctgatg ttatgataaa acctctatca aagaagaact 16800 ttgtttgatt taagcaagaa ttgaaggtta ctgagttcga cagcaacgaa aaaggcaaga 16860 tctatgataa ctcaacaaat tgaagcttga cagcatcgtc tactccaatt gaagagaaat 16920 tccacttgac aatcaagtga aatttcccct gatgaagaaa gcaagtctcg atatacggca 16980 atttaaccaa aatcgaaaca cgacagctta atctctccaa cttcagcaaa aagagggctt 17040 ccgtatcact gcaaggtcct gagtggtaaa tctacacact cgagaaaccg aagccatcat 17100 attttattcg tgcggctgaa gaaattgcaa accctaaccc taagttaggt gtgaggggag 17160 gtatcaaatg aaagtataga gccgcactta tcaaatataa gcatcacaat ataattggaa 17220 cgggttgtga taatggacca tcccgaagcc caattttctt tttataaata tcaagttgta 17280 aacagttcag tgtattatca aaagaacaaa aacattctgt aactacggaa tatttttctt 17340 gttttctgtt tttcaaatat taatcaataa aatcaagatt caaactctct caatattctt 17400 tttacgagct aaaaatatat catattttct gtgtccgaac gctgatattg ttttttactt 17460 tggactctga tacttagcta acattataca cgtgagaaat aggaaactta tatctagtga 17520 aaattaccca tgaatctgac aggttgctga agatataaat ttaatcagac atataaagag 17580 ccttttcgtg gatcattatg attgccatcc aaagcctgcc ctctcagaac agtcttcgtc 17640 taattcaaaa gcacatgcac agcatggccc ctttgatatt caagaaaaca taacaataat 17700 caagccaact cgtaacaacg caaataaaga aaacgaagat gaatgcatag gtgatgaaga 17760 aaatgggaat gatgaaacag aaggagaaac tgatactgaa acatatagca cacccataac 17820 gccagcagat attcaaccaa gcgagcatat gcaaatcgat acatgcgaaa atattccatt 17880 tggttcatct catgagtact attcaaacaa tttggataat gaaccacaga tgttagatag 17940 agtggatgat tcttccagag aatggcacca tttgaatgat gatacatgtg gtggtctacc 18000 agagctatcc ggtacgtacc aactgtgtta taacacataa taattgaagt gtctttcgga 18060 ccctaaccgt gcagggataa atcaataatt tcatatgttt gtacgtagct cctcggccag 18120 ttatatgtag cttgcaataa attcatcttt tacattcacc agttgcataa ttttctcctt 18180 aggttcaagt ttacttcaac agttatctgc agaggattcc cagtactcag aaacagtttc 18240 tacaattttg cataagacct caagtcaatg gactggacct attactcgaa atcatctggt 18300 ttgttctcag caatcagcat tctcaaaatg gaatgatact gatcatatac ttcacatttc 18360 atctgaggat acatcacaga aaactctgaa atatatcttg ctcagtgttc ccaagctata 18420 cagcaaggac aaaacaaaaa agttttcagc atctaaagat agaattactt ctcaagagga 18480 actatgtgct aaccatgtac ttgctgaacg taaacgtagg gagaagctta atgaaaagtt 18540 cattattctt cgatcgttgg ttccttttgt taccaaggta ttgatgactt gtagacatga 18600 cacaagttta aagtaagaaa atacatagag ctcagagtca aaacaacgca tgtttccata 18660 ataatttaat tattatttaa tctgtaatgt ggatcacgat ataagtatat aactgctgaa 18720 taatatatgg tcattgacgc aggtggataa agcttctata ttgggtgaca caattgagta 18780 tataaagcaa ttaacgtgga aaatacaaga actcggatca caaaacaagt ctactgaaag 18840 tgaaaacagt ttcagaccag gcaaagttca aagacaaact actactgcaa aaagcaaggt 18900 taaatcaaat gtgactgcga aatcaataga aaatcatcgc gttcatttgc aagtttcaat 18960 tattgaggca gacgcacttc tcgaaatgca gtgcccatac aaagaagggt tgatactgca 19020 aattatacag acactagata aacttgggct agaaattact tcgattcaat caacatcaaa 19080 caatggatta atgaaggcag aatttagggc taaggcaagt gtattccttc ttatatgcat 19140 ttttggttca atttatgcaa ttaatatgac tacatttgca acttatatgc aggttaaaga 19200 catcggagga agaaaggcca caattgtcaa agtgaagaaa gcaatttacc atattctctc 19260 acagtaattt ataatacata ctgatataac agtgacatta taatatatat atatatatat 19320 atatatatat atatatatat atatatatat atatatatat atatatatat atat 19374 <210> 3 <211> 19915 <212> DNA <213> Allium cepa <400> 3 cggaccggat cgaaactgaa ccgtattaca ttcaaaccga accgaaaccg aaccgtttaa 60 agaattggta taatagtttg tatttttgat taaccgttta atgcggtgcg gaagcggttt 120 ggactccaaa ccgcaccaaa ccgatccgcg ccacccataa gcaaaattag tttgagaatt 180 ttatcgtgtg tactacatat tataatcaaa acaaagttta gaatatgaca acctatcttt 240 attatataag gagtaaaaaa tgacgctata gtagtagatg cttttaagta gaaaggaata 300 ttagttacca ttagtgcagc atacggtctg aaagtcatat gcaattattt cccagcgatt 360 gaagatgtca aatactagat tggcagtttc tggttaaaca ttttcatgga aataattcct 420 aaatttggcc tgctatttat tacagattac cccagcattt atcacaattt ttaggcttac 480 gcaatgcatc tatcagtatc tgcagtaggt agcaagcacc aaatgacaca cccatatata 540 ctaacttttc aattgaagaa ttttgcaacg aatctggaaa tttttgtata aatttatttg 600 agaaatggga tacaaaaggt tcatggaaag atcaaatgtt tttattatga aactttgtta 660 tttgtattat cagttatgtt aagtttaatg gtatttatga agagttctta ctggtgacac 720 actacaccaa ttaccaaatc ctcaatttca ttaacaaaca aataactgat tcgtgtggtt 780 ttataataaa ctataacaat ttacctaata ctctttacgc acgtattctc aatacacata 840 aagtactgag ctttagtgac aaaatagtaa aagagtacat gcgtttaaaa caggcgtcag 900 ttcatacttc atattgttaa tacatgtgat aaatagattt gtcagtttat taccgacctg 960 tagaaccaac cattcaactc ataaacaatc catggcatgt agaatatcac tttctcattc 1020 ctattatttg tttccctcca cgtctattac cgaaccatat caaactgttt catcttatgt 1080 ggacaatatc acaaatgata taaaatgtag gaattcaatt aaaacgttac atgttataac 1140 caaggttcaa aattccggcg gaattccggt tattccggtg attccgttcc ggttccggtc 1200 ataaccggaa cggaatccgg tcaaaattcc ggttccggtc taaattccgg atttaatttt 1260 caaatattga aaaaaaatta taaaaaaata aaaaaattca acaaacatat agcaattaaa 1320 aaagaaaagc aaattaaaca ggacaataaa taaattgaca aaaaatcatg tgtatgaata 1380 aaaaaagttg ttatattttt gttaatttac gtcgaatcat aataaaaatt tcaaaaatcg 1440 accaaaattt taaaatctta aatgagcaat acagactttt taaacaatgg ttttttaatc 1500 aaagtgtatt ttacacgtaa tttaaataat gtactataaa tttatgattg tattgaatat 1560 ttattagcga aatagcaaat taaagcaaaa aagtaccgga attagaaaac cggaattaaa 1620 acggaacttc cgaaatttcc ggaacggaac cgaaatttta aaattaccaa tgaccgaaac 1680 ggaaacggaa aacggaattt caaaccttgg ttataacata aagctttgga tatggcaaag 1740 gactcgagta gtaatagcaa gcttcaggag atcctgcagc tggctgtgca aagtgttcaa 1800 tggacttacg gcattttttg gcagctctgc ccaaatcaaa ggtgtgttgg tttttcttga 1860 aaagtttcca ctaagcgctc aactgaacta attaatatgg atttgaaatg ggtaaggatg 1920 ttaatatggg gagatggata ctacaatgga gcaataaaga caagaaagac agtgcaagga 1980 gttgaaatta gcgcagaaga tgtacctata catagaagcc aacagttaag agagctctac 2040 gagtcacttt caaatgcagg cgacgctgaa caacccagtc ataggtcgtg cacttctttg 2100 tcccccgaag atttgtctga gtatgaatgg ttctacctca tgtgtttctc ctttgctttt 2160 cctccaggtc atgggtatgt ttatagtatc tttgttattt gtaattttga agttttattt 2220 attttcaggt gttcaattta tacctctaat gatttgtttt gttgccgcac tacttaattg 2280 caatcatgat cctcgacatc aaaacattaa accaaagaca cacatgaaat tttgttttcc 2340 aaagtagaaa gatttgacat gaaggatagg tattgattaa ctgttagcaa ccaaaatatt 2400 tgaaaatatt gaattgtata aagattattt ataaaagaat cttaattgtc tgtattaaac 2460 tttaattaac tacattttct gcgaaaagac attctttgat gcctaggagt acgatgcatt 2520 aacttttcga gatgtttaaa tagtgtgatt tgtttccagg catctttttt ccattcctag 2580 aagtatgaga tcctaatatt ttaactcaaa actgaagtat ggattagaaa gttgccattc 2640 aataatatgt aaatgaatat tttgcactac gacaagggat ttggagcagt ttactaagta 2700 cttaattaac gactgaaatc aattagagca agatccgtag agaagtaatg tttgatgaag 2760 agagatacac tcaatactaa gaacgtaagt gttacagtac ctggtctcca attcaagtcc 2820 cagacacata tccgattgaa aatttatcaa gagatgatta atatagtacc gagatctctt 2880 acagaagata catgttaagc ttttaagata tataacatag tagtgtgtat agagaatagt 2940 cttactacgt gataccataa taagtttcct atgttatagt gcaagagtaa tgtggtcgtt 3000 ttactgcata ctgcatatgt gataccataa atccaaatag ctccggtgta aatgctatat 3060 aaggaagtag ttggagatgt ctattacata ggaatatgta cgatgataat aatacacgtt 3120 atatttacaa gtacaggcta ccaggaaaag cacttgaact gcagcagcct gtttggctta 3180 caaaagcaaa tggggcagac agtggaatat tcagcagggc cattcttgca aaggtacctc 3240 aattaaatag aagtatagtt ttcttgtggg cccacaaacc ctacaaatta acagataatt 3300 aagactgatt ttcggtgcaa actattgaaa caaacatttg aataattggt aatatcaagt 3360 gatcaaattg tggaagaaac tatcgcaata aagtaatgtt ggaaatttca agaggatttt 3420 tacgttctga taccaccatt gagaaatttc tatagaaaga agaaagagaa agaagtaact 3480 tctaatttac taatgaaatt gaaagaatat tttgtaaaga aggaaatatg acttattttc 3540 tctttgtact ttttttgctt gtatataatt acattttcca catcaagtga gatagcacat 3600 ctcaagttat aataaagtat attatctggg cttttctatt tctagacttt tttttcaatt 3660 ttcaattttc taaatttttc ttgacaaacc attttaattc tccaaattac atattattct 3720 taattttaac attttctaaa tataaggatt aaatttgtaa cagaaccaat gttttctaaa 3780 aacaaagttt atttcaaaca agtaatggta tagatgcatt gcaactatcc aagtgtgctc 3840 tataaatatc acatcataat agcgactaag caataagttt cggtttcaaa aagtcctttg 3900 tgccatcaag gttgatcatt cagaactgag atagtaaaca aaattgtaca taacaacaag 3960 aacaatcaac aaaagtatct aactatcata gaaccaagaa ctccgtgata tttgtacttt 4020 ttatccttat tctaacttaa tttctcattc ttttgtttgt gatacatcaa tgtgacgaat 4080 taaaccgaat tcggtatgca taatcagagc gcgcacattc aggttatatt ttttctcgaa 4140 accaatctcc ataattttat ttttttgttc aaaagaagaa aacgtctaac cataatgctt 4200 gatgttgcag acagtaatct gcattcctgt aatgcatggg gtatttgaac ttggaacgct 4260 agaaaatgtg agttcaaatt tgttatttcc gccaactatt tttgtcatta cctatttctg 4320 ttaaaggttt aactttagtg aaaaagatct atcagttata cataaagcaa gtaaacttaa 4380 gttacctttt attttcatcc acggtctctt tcacttatcc gcaaatataa ttccattaag 4440 ttattaactc accaattatt ctaaactaat ccgcatgtgg gttagctgac agaataatta 4500 aggtattcta attttcattt atttgcttac tcttttactt tgctgtttat aattctactt 4560 ctattcatga aatacaaaat ctgtacatta gagtcaaaat tatgagaaaa gctactcaaa 4620 tagtcagcta aaaaacaatt gatacaaacc aaacatacta ggtgtcataa tataagattt 4680 tagcagaaag attacacatt tcttacatat ataaaatctc caatccatac accatttaat 4740 gcgactacaa taaaatcaga agatggtcat ttatctttgt aagcctaaat cattttcaga 4800 tttgaactgc agtggaaaag aaagagtgac ttatattaca agaagaaaga agtatacttg 4860 gtggataaac taatcatttt ttcaaaatta tataaaagtt tgaagacgct atttttgtgg 4920 gcggattaga agactaaaaa tgttgattca tgtaaaactt accgacctta aaaatacaac 4980 gagtatcaaa tgaaagtata gagccgcagt tatcgcagtt atcaaatata agcatcacaa 5040 tataattgaa acgggttgtg ataatggacc atcccgaagc ccaattttct ttttataaat 5100 atcaagttgt aaacagttca ctgtattatc aaaagaacaa atacattctg taactacaga 5160 atatttttct tgttcactgt ttttcaaata ttaatcaata aaatcaagat tcaaactctc 5220 tcatattctt tcttggtatc aaagcgtgta cattgcttaa cagcaaaaga aaagttcatc 5280 agaaaatcaa cagagaagaa gagaacagca aaagaaaagc tcatcagaaa atcaacacaa 5340 aaaggaggaa aacacaaatc gtgccatgtc attaacctct caaagaagat ctcatcacag 5400 agattaggct gcacttaaaa tcatcagaaa attaaaattt tcatcatctg attgtgaatc 5460 atcagagaat taacattctc ttcatctgat tgtgaatata tttgtctaac ctgggttttt 5520 gtcaaatctc ctcctctctg ttcaacattt ctgatcactt cactctactg cctcgtcaag 5580 aaatcggttg tcagagacaa tttcatcact caattgattt ctagctgcac ttttctctaa 5640 gtgtattcat tcccacaaat ttttctgtaa aaaattcttt aatcccataa gttcttgaat 5700 atggttgaag gggatattaa caactcagct tcttctgaag caagaacaac caattcagca 5760 tcttaaactg ccaataccca agatctcatc aaagccatca taaagtcaca aagtcaaata 5820 gtcagtgttc aactagatga aaacaattac ttgctctgga aattccagat agaaacagca 5880 gtgagaggct atggccttga ggatcatgtt cttggaacat taattacacc atcaaaatac 5940 actgcagata aagatgacaa attagtgagt aatcaagatt atgttacaca ccaatggaaa 6000 gacagtctaa ttagtgcttg gttactgtct tttataagtg caaacattct accatagcta 6060 attgagtgca agagtgcaca tgaaatatag tcaacagtgg agcagatctt taacacacag 6120 tctgctgcaa aaatcatgta ttacaaaaga caactacaaa gcataagaaa agaaaacatg 6180 tcaatgagag agtacatgac caagatcaag acactgtgtg atcaacttgc atcaatgggt 6240 cataaaatct cagacactgg gcaagtctta tgcattctag gtggtttaaa tgaagaatat 6300 gaggcagtgg tagcagttat ttcctcgaag gaaacaacac caaatataca atatgttcac 6360 tcaactctac tagcccatga aggaagaata gaacaaagaa gatcaacaat ttcatatctt 6420 attgtaaatg tgacgcccca cctctatact cacgctagtc aaggacacta caggataata 6480 ccgtcaacta acatggagaa taaggctgat taggagcgac catctatatc cttgctctaa 6540 ctatctattg aatacatcaa taatagacat accaagcagg tcgacatacc caattaatac 6600 ttaaaacaaa accataggtg gttgaaggaa ctatcagaac ataatataac aactcaaatg 6660 taatatacat cacagaacag tagatcatca tatacacata tattgataca taacagaatt 6720 tacaaactga tacacgtcaa gtggtatagc aaaccacaat aaacaggcaa atccaaaaga 6780 acgcatatat cagagttaca acaaaaagga ctacacataa agctttaaca aataggagca 6840 agctgaatag tccatgcaga agcaaaatag gctaagtcca aaagcaccta acctgaaaca 6900 tctcggtctg acccgagtat aatacacgag tcagtctagc taaacaaatc agttagataa 6960 actgaacaac aataacctgc aaagttacaa agtataacaa atatctctaa aagagataac 7020 acaatcatct aacaaaaaga tgaatcatat cataacaagc ctcgtatcat cggcaactca 7080 gagaaacaaa ggataggaat atcccaaaac aagccataaa gacaaataac aaataccaat 7140 gaaggtaaca gaagttcctc aaggtaatcg ctatatattg tgcggctcaa aaagaccaac 7200 accgaagagt gatacctagg gaatatacat atcaatgaaa catcagaaaa ttttaattgc 7260 aacaaaccca aatatatcat gagcggtggt gaagaaacca ctccaatatc tctcgagcgg 7320 tggtgaagaa aaaccactcc gaaagcaata ctaaaggtaa ccgacaaccc caaatatctc 7380 tcgagccggg gcaacggacc aactccaaaa gcgatattaa aggcaacaag ccagaaggag 7440 atagtctgaa gacactatcc caaaggcaac atgtgtcaca aactcccaga aaggaatccg 7500 aaaagtggta acgtgagtct cataaccacc cgttcgcatt aaacggttta ctatccgtta 7560 gttaatttca cactcaaagc agtacaaagt ttacctcatc tcatcggtaa accagacaca 7620 aaggtcaaaa cgttcaaacg aatagattga gaattaactg agaagatgaa cgcacgtgtt 7680 cattgcacgt gttttatcta atcatttgat tctcctccca cttcgctcgg agtgcgaaac 7740 cgtgtgtgtt ttaaatagaa tttataaatt ggagaaacga gcttttaatg caatttaaag 7800 ggattatttt ataaaaaacc cgtggatgaa gtcaaaaagg tatcatcaag gtcaaatatg 7860 caaaaacaac taattggaat caatgtggat cgataaaagt tggaatcaca gacaaatagg 7920 caaagtagga aaaacagggg aacatgagca ggtcggttga ccggactctg agctcggtcg 7980 accggcccaa aaacagagaa gtgctctggt agcaggtcgg tcaccggcct actgagttcg 8040 atcggccgaa ccctgtttcc agcacttccc agcctatcaa aacgagggcc aatctcgacc 8100 aaattgcaat cgttcgagca acgacgccaa gggtttatgt caatcgacta cccgatgcta 8160 tatgctcctc gatgcatcac caaaaacatg tttaaacatc aaagttatga tctttaaaga 8220 tttgaaccca aaacactaaa aattgggata ttcaccaatt caatccaaat caagagcaaa 8280 tgcacatgaa aaagtgttag gaattcatat ctgacaatca aagatagata taagcataga 8340 tgtaagataa aaatcccacc tttaacccta aaaaaaagaa gaagaagaag ctcaattgca 8400 aggaaaagat caaccactct ctacttcaac tcgactagct tcaatctaag atcaaaacaa 8460 gtatttccta agttaggttt aggaaacttc tgaaattgaa ggagaaagag ttggagaaga 8520 tgaagaggag gcttaccaat agcttctttt gattttggag caagaatttg agctagcaag 8580 agaaactaga gcttagagtt tctaattccc tttcctttcc accattttca gttagagctt 8640 gagtttgagg agtgggaatg agtgaatgga gaggagagag ctgagttagg gtattaagtt 8700 agctagtggg ttgaacccaa acccaaaacc caactagaaa aagtagcaaa attcaactta 8760 ctccaaacat atcaaagctt atactcaaaa agatcacaaa gccattttgg actcaatgga 8820 tgtggtcttg agtcccaatt cgaccgtttg cagaaagtag ccttttggac tataatccga 8880 caaacgacgt tatatttaag taaaatattt aaatatacaa ccgataaata tgcgggttgt 8940 tacagactcc cctccttaaa aaaattgcgt cctcgcaatt cttaagaaga aaataaagag 9000 taacaaccca aaaacatatc aacacataag aataacagaa taagaagttc accataaagt 9060 gcacgaaagg ataagcccta acttgtttgc tcatagaatt ttgtggattc ctaagctcaa 9120 aataattcgg aacaccgaca tggcgcaaca atacgtcaaa tgaaccaaag ctcaacaaaa 9180 tgaagtacaa caaaacgtcc gatgaacttg gtaaaaagat cattccattc ggacatcaac 9240 aaagaaacaa tcacttgttg cttacaacta aatgcattgg caacacgatc cccctttcag 9300 gaataaaaag aatgagagta ttggaaaaga gttcttttaa ataatcaact ttcccgaaaa 9360 gctaaaactt tcaaaatcac aattatcttt atgtaattat ttttctagaa aatttttctt 9420 atttcaaatc aattcactgt gtctgattgt ctcatcaaag ctttaggtga ttcctatcga 9480 taacgttgat taagcgcatc gaccagaatt cttaaagcac ttaatgggca atacaatcac 9540 aaaacaatct tctatatgat aaacatattt ctaaaaactt ttaaaaatta tctttgtttt 9600 ttttaagaat aaaaatccca tttatactta taaataaatc ttatgaaaaa gatttgcaaa 9660 aattttgaat tgctaatttc catccaaaac caataaatgc taaaatggaa tcatcgagat 9720 attcacaaaa tactcgattc atacaatgga tgaaatgagc tagacaaact gaatgacata 9780 ataaatcatt cataagaatc acaacgagtg cggaatgcgg taagtggagt gctaacttcc 9840 gcaactcgta gccaaatcaa aaccggtggc aaggtcgagc tgaaaagacc ttaataccac 9900 tcaaaggatt gcttaggaga taatcctaag actagaccca aaataccaga aaattctcga 9960 actataagaa tgtgagaaac aacactttcc tcatcatgag ggattaaaga aataaaatga 10020 tgccatcaaa ttggaaatcg aatcacaaag aaaagtagaa acctaccaaa atagatggag 10080 acataactta tccctgagaa gaacctccag aagcatttgt tacatttaac ttaccagatg 10140 gagaattatt cggagcaatg ggacaagtgg aactacgatg gtcttcgttc ttgcaatagc 10200 ggcagaagag aggcttagga caagctcgaa tcatatgatc aggagaacca caattgaaac 10260 acttccgaat ggaaggcgtt ccagcaggct gagactgaga atcagattca acggactttt 10320 tcttcttgga agggaaaaat tcccgctcat ccaatggaga ctgctttttg ttggggttct 10380 tacgaacctc aacatcatca ccactatcac aatccttctc gatggtttca agatgaagtg 10440 cagaatctac caactcctca aaagaaagct taaactggag caataaagac ttcttaagat 10500 atttcttaag accagaaaca aacttcaaat tcttcttata agaagtgcaa atgaattcat 10560 gaccatactt agataaagcc tcaaatgatg aaacatactc agaaacagaa gacttccctt 10620 acttcaacac gaggaagcga cgggtcaata aaactttttc agattcagga acaaacttga 10680 gttcgaatcg tccccgaaac tgagtccaaa aaagagtaga ctcatcaatt tcggctacaa 10740 gaagctcata ccaatcaaga gcacgctatt gtaataagct agaagttaca agaaccctat 10800 catgatcaga aagatccatg cgagagaaaa tacgctcgca cgtgcgaagc caagcttgga 10860 cttcaagaac agactcggag cctttaaacg gctttccacc aagatgagaa aaatcacttc 10920 acaggcgtgc aaaagtagac ttgcgaggtg gagatacacg agtaggagct ggaggctgaa 10980 tgctcctaaa caactccata aactgatcgg cagacatata aacgccatcc ggatgtgagc 11040 cactggattg cccagcatcc gaacgtcgtc ccctgcctct tccagccata cgttgaaagt 11100 taagataaga acaagattat tcacaaggca gatgattcaa tatggaatac tacaggattt 11160 aaatgcattc ctagacgtat tcccacattc tatcaaccac caagacacaa aagaaatata 11220 gaggcatgat gattcaaaga tttgtatcac ttatacactt tgacgtaccg gaatatgtgc 11280 gtctattctg tgtttatcat attttgttct aaacctcgct ctgataccaa gctgtgacgc 11340 ctcacctcta tacccacgct agccaaggac actacagggt aatgccgtca actaacacgg 11400 agaataaggc tggttaggag cgaccatcta tagccttgct ctaactatct attgaataca 11460 tcgacaatag acataccaag caggtcgacg tacctaatga atacttaaaa caaaaccata 11520 ggtggttgga ggatctatca gaacataata taacaactca aatgtaatat acatcacaga 11580 acagtagatc atcatataca catatattga tacataacag agtttacaaa ctgatacacg 11640 tcaagtgata tagcaaacca caataaacag gcaaatccaa aagaatacat atatcagagt 11700 tacaacaaaa aggactacac ataaagcttt aacaaaaagg agcaagctga atagtccatg 11760 cggaagcaaa atagctaagt ccaaaagcac ctaacctgaa acatctcggt ctgacccgag 11820 tataatacac gggtcagtct agctaaacaa atcagttaga taaactgaac aacaataacc 11880 tgcaaagtca caaagtataa caaatatctc taaaagagat aacacaatca tctaacaaaa 11940 agatgaatca tatcataaca agcctcgtat catcggcaac tcatagaaac aaaggatagg 12000 aatatcccaa aacaagccat aaaggcaaat aacaaatact agtgaaggta acacaagttc 12060 cacaaggtaa tcgctatata tcgtgcggct caaaaagacc aacaccgaag agcgatacct 12120 agggaatata catatcaatg aaacatcata aaattttaat tgcaacaaac ccaaatatct 12180 catgagcggt ggtgaagaaa ccagtccaat atctctcgag cggtggtgaa gaaaaaccac 12240 tccgaaagca atactaaagg taaccgacaa ccccaaatat ctctcgagcc ggggcaaagg 12300 accaactcca aaagcgatat ttaaggcaac aagccagaag gagacagtcc aaagacacta 12360 tcccaaaggc aacatgtgtc acaaactctc agaaaggaat ccgaaaagtg gtaacgtgag 12420 tctcataacc acccgttcgc actaaacggt ttcttatccg ttagttaatt tcacactcaa 12480 agcagtacaa agtttacctc atctcatcgg taaaccagac acaaaggtca aaacgttcaa 12540 acgaatatat tgggaattaa ctgagaatat gaacgcacgt gttcattgca cgcgttttat 12600 ctaatcattt gattctcctc ccacttcgct cggagtgcga aaccgtgtgt gttttaaata 12660 gaatttataa attggagaaa tgtgctttta atgcaactta aagggattat tttataaaaa 12720 tcccgtggat gaagtcaaaa aggaatcatc aaggtcaaat atgcataaac aactaattgg 12780 aatcaacgtg catcgataaa agttggaatc acagacaaat aggcaaagta gaaaaaacag 12840 gggaacagga gcaggtcggt tgaccggact ttgagctcgg tcgaccggcc caaaaacaga 12900 gaagtgctct ggtagcaggt cggtcgaccg gcctactgag ttcgatcggc caaaccctgt 12960 ttccagcact tcccagccta tcaaaacgag ggccaatctc gaccaaattg caatcgttcg 13020 agcaaagccg ccaagggttt atgccaatcg actacccgac gctatatgct cctcgatgca 13080 tcaccaaaaa catgtttaaa catcaaagtt atgatcttta aagatttgaa cccaaaacac 13 140 taaaaattgg gatattcacc aattcaatcc aaatcaagag caaatgcaca tgaaaaagtg 13200 ttaggaattc atacctgaca atcaaagata gatataagca tagatgtgtg ataaaaatct 13260 cacctttaac cctaaaaaaa gaagaagaag acgctcaatt gtaaggaaaa gatcaaccac 13320 tctccacttc aactctacta gcttcaatct aagatcaaaa caagtatttc ttaagttagg 13380 tttaggaaac ttctgaaatt gaaggagaaa gagttggaga agatgaagag gaggcttacc 13440 aatagcttct tttgattttg gagcaagaat ttgagctagc aagagaaact agggcttgga 13500 gtttctaatt ccctttcctt tccaccattt tcagttagag cttgagtttg agaagtggga 13560 atgagtgaat ggagaggaga gagctgagtt agggtattaa gttagctagt gggctgaacc 13620 caaacccaaa acccaactag aaaaagtagc aaaatttaac ttactccaaa catatcaaag 13680 cttatattca aaaagattgc aaacgccatt ttggactcaa tggaggtggt cttgagtccc 13740 aattcgaccg tttgcagaaa gtagcttttt ggactataat ccgacaaatg acgttatatt 13800 taaataaaat atttaaatat gcaaccgata aatatgcggg ttgttacagt aaacttcgcc 13860 agcaataaca gattcaagaa tcaagaaaga agcaacaaca ataaaaatca gcctaatttt 13920 caaagaaatg gtcaatcctc tagatccaga ggaagaaatg gaagatataa caacagcaat 13980 aacagactat ggtgtcaaat ttgtgaaaag tttggtcatg cagccaacga atgttacttc 14040 agatttgatg ccaactacat tccatctcag caaaataaca acagttcaag aaatcacaat 14100 ctcaatgcaa acatggtaaa tacttatcca gattctaaag aacaagcaga taccaaaagt 14160 acagagactg caaagattga tgatatctag gatgaaagct agtatccaga ttatgaggct 14220 accaatcatg taactaataa tctcaacaat ctaaacttgg gaagcaggga gtacagaggt 14280 aggcaattaa ttcatatggg taatggtgaa tcagtaaaaa ttacacatat tggaaatgca 14340 agtttcagtg gcagaaaata actctttcta aaaaatctgc taagagttcc atctattaga 14400 aaaaccttat tgagtgtttc gcattttgcc caaggcaatg atgtgtattt tatcccaaat 14460 actgtttaat tagagatatt ctaactaagg aaataatttt gcagggtaag aaatttaaag 14520 gattgtacaa attcgatgtt gcaaaatcag gaaattccga atttcatgga aaatggtgta 14580 atgttactga aattgaacat gaagataact ataaagattt tgatatttga cattccaaac 14640 ttggacatcc aagtgtaagc attgtaaaaa aggtgttaag taatgataat atttctgtta 14700 aagatgttgc aatgccttat gtatgtacat attgtcaaat gggcaaaagc cataaacttg 14760 catttccaat ctcaaaaata aactatacaa aacccttaga ttaattgctt gagatctatg 14820 gggtccatct tctgttaaca ctgattatgg ctataaatac tttatatcat ttgtcgatgc 14880 atactctaga tatgtatgga tttatttctt gaaatcaaaa tctgaaactt atgatgcagt 14940 cttacagttt ataactcaag ctgagaggca aacaaattgc caattaaaag tcttgcagac 15000 tgatggtgga accgagtttc aaccacttaa ggaatacctt caaaagaaag gtataattca 15060 cagaacaaac tgtccataca catcagaaca aaatggactg gttgaaagaa aacacagaca 15120 tattgttgag actgggctta ctttactagc ccaagcatct cttcctctaa agttttgacc 15180 agatgccttt gccactactg tgtttttaat aaatagatta tccataaaag ttttacagtt 15240 caaaagtcca gtggaaatct tatttaaagt taagccagaa tatcatagtt tgaaagtttt 15300 tggatgttta tgctttccct atttaaggcc atataataca cacaagttaa gtttcaggtc 15360 atcaccatgt accttcttag gctatgcagc caataagaag ggatacaaat gcttggatag 15420 caatgaattt tgtttttgtt tctatacatg tggtgtttaa tgaaagaata tttcccttta 15480 atcaatcaaa cataaaaaca tcacagaaag tgtataattc aaaactttct ataccaccag 15540 tacctgagca acttgatgtc ataactcaag ttgaagatga aagaatgcag cacaatataa 15600 ctttagagtc tcctgtcaaa tccacttcac aatacactgt gcccagacct gagccaggtc 15660 atgaagaaga tgaacaagct ggaagcacaa gtgaggcatc tcatatgtgc cccatctatc 15720 agtcagactg cagtcagtca ttagatgatt cacaatcatc taatgatcaa caggaagtca 15780 cagctgaaga gccaagtcaa tcacctgcac aagctagaca tcacatgata acaagggcca 15840 agagtggtat attcacacca aaaatataca gtgttgctat gaacacagaa gagccagata 15900 cctatcatca agctatgcag aatgaaaact ggatgtctgc tatggaagaa gaatacaatg 15960 cattgataaa aaataaaaca tgggatctaa cttcattgcc aagcaataaa aatgtcatag 16020 gctgtaaacg gacatataga ataaagagaa gtggtgatgg ttcggtttct aaatataagg 16080 caaggctagt agccgaaggg tattcatagc aaagtggctt tgactttact gaaacttttt 16140 caccagttgt gaaaccctca actattagaa ttgttcttac tattgcctta catacaaact 16200 gaaacatcaa gcaattagat gtaaataatg cccttttgtg gcattttaca ggaggaagtc 16260 tacatgtaac agcctctagg ttttgaacaa aaaaggggtg gaaaacttgt atgcaaattg 16320 aacaaagcga tctatagact caaacatgca ccaagggtct ggtttgaaaa gctgaagtca 16380 atactaatca gacttggcta cagctcaaca aaatcataca attctttatt tacaaaattt 16440 aaaaacaatg caaccatgta tgtactaata tatgttgatg attttattat tacaagcagc 16500 agtgaaccag agatgaataa actcacagac ctcttaaata aagaattttc aatcaaagac 16560 ttggggaact taaattactt tcttggcatt gaggttaaaa gactttcaca catagaaatg 16620 cttctaagtc aaaggaaata catctcagaa atcttacaga aagcaaaaac ggataaagca 16680 aatgcaatat ctactcctat ggcaagcaat tcacatctgt caacgtataa aggagaatcc 16740 atatcacatg gcaagcagta cagaagtatt gtaggagcat tacagtatgt aacaatcact 16800 aagccagaaa tttcatttag tatcaataaa gtgagtcaat atatgcaaat ttcactggat 16860 gaacattgga aagcagttaa gagaattcta agatatctca aaggaactat aaatcatgga 16920 ttaaagatgc aatcatgcaa atctatccat ataaaagggt atgcagatgc agattgggcc 16980 acagacatgg atgacagaag atctaccact ggttattgca tatttctagg caacaatcca 17040 gtttcatggt gctcaaaaaa acagcctaca gtatctcggt caagtactga agccgagtac 17100 agaaacgttg ctaatgcaac agctgaaata atatggataa tgtccttgct cagtgaactt 17160 catatcaagt ttacagaaaa accgacaatt tggtgcgaca atctgagcac cgttctgccc 17220 tcagcaaatc tagttctaca tgctagaacc aagcacatag aactggatct gtattttgtc 17280 agagaacaag taacagagga aaaaattaac ataagtcatc taccatcatc ttaccaaatc 17340 gctgatgtta tgataaaacc tctatcaaag aagaactttg tttgatttaa gcaagaattg 17400 aaggttactg agttcgacag caacgaaaaa ggcaagatct atgataactc aacaaattga 17460 agcttgacag catcgtctac tccaattgaa gagaaattcc acttgacaat caagtgaaat 17520 ttcccctgat gaagaaagca agtctcgata tacggcaatt taaccaaaat cgaaacacga 17580 cagcttaatc tctccaactt cagcaaaaag agggcttccg tatcactgca aggtcctgag 17640 tggtaaatct acacactcga gaaaccgaag ccatcatatt ttattcgtgc ggctgaagaa 17700 attgcaaacc ctaaccctaa gttaggtgtg aggggaggta tcaaatgaaa gtatagagcc 17760 gcacttatca aatataagca tcacaatata attggaacgg gttgtgataa tggaccatcc 17820 cgaagcccaa ttttcttttt ataaatatca agttgtaaac agttcagtgt attatcaaaa 17880 gaacaaaaac attctgtaac tacggaatat ttttcttgtt ttctgttttt caaatattaa 17940 tcaataaaat caagattcaa actctctcaa tattcttttt acgagctaaa aatatatcat 18000 attttctgtg tccgaacgct gatattgttt tttactttgg actctgatac ttagctaaca 18060 ttatacacgt gagaaatagg aaacttatat ctagtgaaaa ttacccatga atctgacagg 18120 ttgctgaaga tataaattta atcagacata taaagagcct tttcgtggat cattatgatt 18180 gccatccaaa gcctgccctc tcagaacagt cttcgtctaa ttcaaaagca catgcacagc 18240 atggcccctt tgatattcaa gaaaacataa caataatcaa gccaactcgt aacaacgcaa 18300 ataaagaaaa cgaagatgaa tgcataggtg atgaagaaaa tgggaatgat gaaacagaag 18360 gagaaactga tactgaaaca tatagcacac ccataacgcc agcagatatt caaccaagcg 18420 agcatatgca aatcgataca tgcgaaaata ttccatttgg ttcatctcat gagtactatt 18480 caaacaattt ggataatgaa ccacagatgt tagatagagt ggatgattct tccagagaat 18540 ggcaccattt gaatgatgat acatgtggtg gtctaccaga gctatccggt acgtaccaac 18600 tgtgttataa cacataataa ttgaagtgtc tttcggaccc taaccgtgca gggataaatc 18660 aataatttca tatgtttgta cgtagctcct cggccagtta tatgtagctt gcaataaatt 18720 catcttttac attcaccagt tgcataattt tctccttagg ttcaagttta cttcaacagt 18780 tatctgcaga ggattcccag tactcagaaa cagtttctac aattttgcat aagacctcaa 18840 gtcaatggac tggacctatt actcgaaatc atctggtttg ttctcagcaa tcagcattct 18900 caaaatggaa tgatactgat catatacttc acatttcatc tgaggataca tcacagaaaa 18960 ctctgaaata tatcttgctc agtgttccca agctatacag caaggacaaa acaaaaaagt 19020 tttcagcatc taaagataga attacttctc aagaggaact atgtgctaac catgtacttg 19080 ctgaacgtaa acgtagggag aagcttaatg aaaagttcat tattcttcga tcgttggttc 19140 cttttgttac caaggtattg atgacttgta gacatgacac aagtttaaag taagaaaata 19200 catagagctc agagtcaaaa caacgcatgt ttccataata atttaattat tatttaatct 19260 gtaatgtgga tcacgatata agtatataac tgctgaataa tatatggtca ttgacgcagg 19320 tggataaagc ttctatattg ggtgacacaa ttgagtatat aaagcaatta acgtggaaaa 19380 tacaagaact cggatcacaa aacaagtcta ctgaaagtga aaacagtttc agaccaggca 19440 aagttcaaag acaaactact actgcaaaaa gcaaggttaa atcaaatgtg actgcgaaat 19500 caatagaaaa tcatcgcgtt catttgcaag tttcaattat tgaggcagac gcacttctcg 19560 aaatgcagtg cccatacaaa gaagggttga tactgcaaat tatacagaca ctagataaac 19620 ttgggctaga aattacttcg attcaatcaa catcaaacaa tggattaatg aaggcagaat 19680 ttagggctaa ggcaagtgta ttccttctta tatgcatttt tggttcaatt tatgcaatta 19740 atatgactac atttgcaact tatatgcagg ttaaagacat cggaggaaga aaggccacaa 19800 ttgtcaaagt gaagaaagca atttaccata ttctctcaca gtaatttata atacatactg 19860 atataacagt gacattataa tatatatata tatatatata tatatatata tatat 19915 <210> 4 <211> 713 <212> DNA <213> Allium cepa <400> 4 acatgttata accaaggttc aaaattccgg cggaattccg gttattccgg tgattccgtt 60 ccggttccgg tcataaccgg aacggaatcc ggtcaaaatt ccggttccgg tctaaattcc 120 ggatttaatt ttcaaatatt gaaaaaaaat tataaaaaaa taaaaaaatt caacaaacat 180 atagcaatta aaaaagaaaa gcaaattaaa caggacaata aataaattga caaaaaatca 240 tgtgtatgaa taaaaaaagt tgttatattt ttgttaattt acgtcgaatc ataataaaaa 300 tttcaaaaat cgaccaaaat tttaaaatct taaatgagca atacagactt tttaaacaat 360 ggttttttaa tcaaagtgta ttttacacgt aatttaaata atgtactata aatttatgat 420 tgtattgaat atttattagc gaaatagcaa attaaagcaa aaaagtaccg gaattagaaa 480 accggaatta aaacggaact tccgaaattt ccggaacgga accgaaattt taaaattacc 540 aatgaccgaa acggaaacgg aaaacggaat ttcaaacctt ggttataaca taaagctttg 600 gatatggcaa aggactcgag tagtaatagc aagcttcagg agatcctgca gctggctgtg 660 caaagtgttc aatggactta cggcattttt tggcagctct gcccaaatca aag 713 <210> 5 <211> 21 <212> DNA <213> Allium cepa <400> 5 tgggatacaa aaggttcatg g 21 <210> 6 <211> 21 <212> DNA <213> Allium cepa <400> 6 tgggatagaa aaggttcatg g 21 <210> 7 <211> 23 <212> DNA <213> Allium cepa <400> 7 aaaatttcaa aaatcgacca aaa 23 <210> 8 <211> 20 <212> DNA <213> Allium cepa <400> 8 tgccgtaagt ccattgaaca 20 <210> 9 <211> 13852 <212> DNA <213> Allium cepa <400> 9 gtgagttcaa atttgttatt tccgccaact atttttgtca ttacctattt ctgttaaagg 60 tttaacttta gtgaaaaaga tctatcagtt atacataaag caagtaaact taagttacct 120 tttattttca tccacggtct ctttcactta tccgcaaata taattccatt aagttattaa 180 ctcaccaatt attctaaact aatccgcatg tgggttagct gacagaataa ttaaggtatt 240 ctaattttca tttatttgct tactctttta ctttgctgtt tataattcta cttctattca 300 tgaaatacaa aatctgtaca ttagagtcaa aattatgaga aaagctactc aaatagtcag 360 ctaaaaaaca attgatacaa accaaacata ctaggtgtca taatataaga ttttagcaga 420 aagattacac atttcttaca tatataaaat ctccaatcca tacaccattt aatgcgacta 480 caataaaatc agaagatggt catttatctt tgtaagccta aatcattttc agatttgaac 540 tgcagtggaa aagaaagagt gacttatatt acaagaagaa agaagtatac ttggtggata 600 aactaatcat tttttcaaaa ttatataaaa gtttgaagac gctatttttg tgggcggatt 660 agaagactaa aaatgttgat tcatgtaaaa cttaccgacc ttaaaaatac aacgagtatc 720 aaatgaaagt atagagccgc agttatcgca gttatcaaat ataagcatca caatataatt 780 gaaacgggtt gtgataatgg accatcccga agcccaattt tctttttata aatatcaagt 840 tgtaaacagt tcactgtatt atcaaaagaa caaatacatt ctgtaactac agaatatttt 900 tcttgttcac tgtttttcaa atattaatca ataaaatcaa gattcaaact ctctcatatt 960 ctttcttggt atcaaagcgt gtacattgct taacagcaaa agaaaagttc atcagaaaat 1020 caacagagaa gaagagaaca gcaaaagaaa agctcatcag aaaatcaaca caaaaaggag 1080 gaaaacacaa atcgtgccat gtcattaacc tctcaaagaa gatctcatca cagagattag 1140 gctgcactta aaatcatcag aaaattaaaa ttttcatcat ctgattgtga atcatcagag 1200 aattaacatt ctcttcatct gattgtgaat atatttgtct aacctgggtt tttgtcaaat 1260 ctcctcctct ctgttcaaca tttctgatca cttcactcta ctgcctcgtc aagaaatcgg 1320 ttgtcagaga caatttcatc actcaattga tttctggctg cacttttctc taagtgtatt 1380 cattcccaca aatttttctg taaaaaattc tttaatccca taagttcttg aatatggttg 1440 aaggggatat taacaactca gcttcttctg aagcaagaac aaccaattca gcatcttaaa 1500 ctgccaatac ccaagatctc atcaaagcca tcataaagtc acaaagtcaa atagtcagtg 1560 ttcaactaga tgaaaacaat tacttgctct ggaaattcca gatagaaaca gcagtgagag 1620 gctatggcct tgaggatcat gttcttggaa cattaattac accatcaaaa tacactgcag 1680 ataaagatga caaattagtg agtaatcaag attatgttac acaccaatgg aaagacagtc 1740 taattagtgc ttggttactg tcttttataa gtgcaaacat tctaccatag ctaattgagt 1800 gcaagagtgc acatgaaata tagtcaacag tggagcagat ctttaacaca cagtctgctg 1860 caaaaatcat gtattacaaa agacaactac aaagcataag aaaagaaaac atgtcaatga 1920 gagagtacat gaccaagatc aagacactgt gtgatcaact tgcatcaatg ggtcataaaa 1980 tctcagacac tgggcaagtc ttatgcattc taggtggttt aaatgaagaa tatgaggcag 2040 tggtagcagt tatttcctcg aaggaaacaa caccaaatat acaatatgtt cactcaactc 2100 tactagccca tgaaggaaga atagaacaaa gaagatcaac aatttcatat cttattgtaa 2160 atgtgacgcc ccacctctat actcacgcta gtcaaggaca ctacaggata ataccgtcaa 2220 ctaacatgga gaataaggct gattaggagc gaccatctat atccttgctc taactatcta 2280 ttgaatacat caataataga cataccaagc aggtcgacat acccaattaa tacttaaaac 2340 aaaaccatag gtggttgaag gaactatcag aacataatat aacaactcaa atgtaatata 2400 catcacagaa cagtagatca tcatatacac atatattgat acataacaga atttacaaac 2460 tgatacacgt caagtggtat agcaaaccac aataaacagg caaatccaaa agaacgcata 2520 tatcagagtt acaacaaaaa ggactacaca taaagcttta acaaatagga gcaagctgaa 2580 tagtccatgc agaagcaaaa taggctaagt ccaaaagcac ctaacctgaa acatctcggt 2640 ctgacccgag tataatacac gagtcagtct agctaaacaa atcagttaga taaactgaac 2700 aacaataacc tgcaaagtta caaagtataa caaatatctc taaaagagat aacacaatca 2760 tctaacaaaa agatgaatca tatcataaca agcctcgtat catcggcaac tcagagaaac 2820 aaaggatagg aatatcccaa aacaagccat aaagacaaat aacaaatacc aatgaaggta 2880 acagaagttc ctcaaggtaa tcgctatata ttgtgcggct caaaaagacc aacaccgaag 2940 agtgatacct agggaatata catatcaatg aaacatcaga aaattttaat tgcaacaaac 3000 ccaaatatat catgagcggt ggtgaagaaa ccactccaat atctctcgag cggtggtgaa 3060 gaaaaaccac tccgaaagca atactaaagg taaccgacaa ccccaaatat ctctcgagcc 3120 ggggcaacgg accaactcca aaagcgatat taaaggcaac aagccagaag gagatagtct 3180 gaagacacta tcccaaaggc aacatgtgtc acaaactccc agaaaggaat ccgaaaagtg 3240 gtaacgtgag tctcataacc acccgttcgc attaaacggt ttactatccg ttagttaatt 3300 tcacactcaa agcagtacaa agtttacctc atctcatcgg taaaccagac acaaaggtca 3360 aaacgttcaa acgaatagat tgagaattaa ctgagaagat gaacgcacgt gttcattgca 3420 cgtgttttat ctaatcattt gattctcctc ccacttcgct cggagtgcga aaccgtgtgt 3480 gttttaaata gaatttataa attggagaaa cgagctttta atgcaattta aagggattat 3540 tttataaaaa acccgtggat gaagtcaaaa aggtatcatc aaggtcaaat atgcaaaaac 3600 aactaattgg aatcaatgtg gatcgataaa agttggaatc acagacaaat aggcaaagta 3660 ggaaaaacag gggaacatga gcaggtcggt tgaccggact ctgagctcgg tcgaccggcc 3720 caaaaacaga gaagtgctct ggtagcaggt cggtcaccgg cctactgagt tcgatcggcc 3780 gaaccctgtt tccagcactt cccagcctat caaaacgagg gccaatctcg accaaattgc 3840 aatcgttcga gcaacgacgc caagggttta tgtcaatcga ctacccgatg ctatatgctc 3900 ctcgatgcat caccaaaaac atgtttaaac atcaaagtta tgatctttaa agatttgaac 3960 ccaaaacact aaaaattggg atattcacca attcaatcca aatcaagagc aaatgcacat 4020 gaaaaagtgt taggaattca tatctgacaa tcaaagatag atataagcat agatgtaaga 4080 taaaaatccc acctttaacc ctaaaaaaaa gaagaagaag aagctcaatt gcaaggaaaa 4140 gatcaaccac tctctacttc aactcgacta gcttcaatct aagatcaaaa caagtatttc 4200 ctaagttagg tttaggaaac ttctgaaatt gaaggagaaa gagttggaga agatgaagag 4260 gaggcttacc aatagcttct tttgattttg gagcaagaat ttgagctagc aagagaaact 4320 agagcttaga gtttctaatt ccctttcctt tccaccattt tcagttagag cttgagtttg 4380 aggagtggga atgagtgaat ggagaggaga gagctgagtt agggtattaa gttagctagt 4440 gggttgaacc caaacccaaa acccaactag aaaaagtagc aaaattcaac ttactccaaa 4500 catatcaaag cttatactca aaaagatcac aaagccattt tggactcaat ggatgtggtc 4560 ttgagtccca attcgaccgt ttgcagaaag tagccttttg gactataatc cgacaaacga 4620 cgttatattt aagtaaaata tttaaatata caaccgataa atatgcgggt tgttacagac 4680 tcccctcctt aaaaaaattg cgtcctcgca attcttaaga agaaaataaa gagtaacaac 4740 ccaaaaacat atcaacacat aagaataaca gaataagaag ttcaccataa agtgcacgaa 4800 aggataagcc ctaacttgtt tgctcataga attttgtgga ttcctaagct caaaataatt 4860 cggaacaccg acatggcgca acaatacgtc aaatgaacca aagctcaaca aaatgaagta 4920 caacaaaacg tccgatgaac ttggtaaaaa gatcattcca ttcggacatc aacaaagaaa 4980 caatcacttg ttgcttacaa ctaaatgcat tggcaacacg atcccccttt caggaataaa 5040 aagaatgaga gtattggaaa agagttcttt taaataatca actttcccga aaagctaaaa 5100 ctttcaaaat cacaattatc tttatgtaat tatttttcta gaaaattttt cttatttcaa 5160 atcaattcac tgtgtctgat tgtctcatca aagctttagg tgattcctat cgataacgtt 5220 gattaagcgc atcgaccaga attcttaaag cacttaatgg gcaatacaat cacaaaacaa 5280 tcttctatat gataaacata tttctaaaaa cttttaaaaa ttatctttgt tttttttaag 5340 aataaaaatc ccatttatac ttataaataa atcttatgaa aaagatttgc aaaaattttg 5400 aattgctaat ttccatccaa aaccaataaa tgctaaaatg gaatcatcga gatattcaca 5460 aaatactcga ttcatacaat ggatgaaatg agctagacaa actgaatgac ataataaatc 5520 attcataaga atcacaacga gtgcggaatg cggtaagtgg agtgctaact tccgcaactc 5580 gtagccaaat caaaaccggt ggcaaggtcg agctgaaaag accttaatac cactcaaagg 5640 attgcttagg agataatcct aagactagac ccaaaatacc agaaaattct cgaactataa 5700 gaatgtgaga aacaacactt tcctcatcat gagggattaa agaaataaaa tgatgccatc 5760 aaattggaaa tcgaatcaca aagaaaagta gaaacctacc aaaatagatg gagacataac 5820 ttatccctga gaagaacctc cagaagcatt tgttacattt aacttaccag atggagaatt 5880 attcggagca atgggacaag tggaactacg atggtcttcg ttcttgcaat agcggcagaa 5940 gagaggctta ggacaagctc gaatcatatg atcaggagaa ccacaattga aacacttccg 6000 aatggaaggc gttccagcag gctgagactg agaatcagat tcaacggact ttttcttctt 6060 ggaagggaaa aattcccgct catccaatgg agactgcttt ttgttggggt tcttacgaac 6120 ctcaacatca tcaccactat cacaatcctt ctcgatggtt tcaagatgaa gtgcagaatc 6180 taccaactcc tcaaaagaaa gcttaaactg gagcaataaa gacttcttaa gatatttctt 6240 aagaccagaa acaaacttca aattcttctt ataagaagtg caaatgaatt catgaccata 6300 cttagataaa gcctcaaatg atgaaacata ctcagaaaca gaagacttcc cttacttcaa 6360 cacgaggaag cgacgggtca ataaaacttt ttcagattca ggaacaaact tgagttcgaa 6420 tcgtccccga aactgagtcc aaaaaagagt agactcatca atttcggcta caagaagctc 6480 ataccaatca agagcacgct attgtaataa gctagaagtt acaagaaccc tatcatgatc 6540 agaaagatcc atgcgagaga aaatacgctc gcacgtgcga agccaagctt ggacttcaag 6600 aacagactcg gagcctttaa acggctttcc accaagatga gaaaaatcac ttcacaggcg 6660 tgcaaaagta gacttgcgag gtggagatac acgagtagga gctggaggct gaatgctcct 6720 aaacaactcc ataaactgat cggcagacat ataaacgcca tccggatgtg agccactgga 6780 ttgcccagca tccgaacgtc gtcccctgcc tcttccagcc atacgttgaa agttaagata 6840 agaacaagat tattcacaag gcagatgatt caatatggaa tactacagga tttaaatgca 6900 ttcctagacg tattcccaca ttctatcaac caccaagaca caaaagaaat atagaggcat 6960 gatgattcaa agatttgtat cacttataca ctttgacgta ccggaatatg tgcgtctatt 7020 ctgtgtttat catattttgt tctaaacctc gctctgatac caagctgtga cgcctcacct 7080 ctatacccac gctagccaag gacactacag ggtaatgccg tcaactaaca cggagaataa 7140 ggctggttag gagcgaccat ctatagcctt gctctaacta tctattgaat acatcgacaa 7200 tagacatacc aagcaggtcg acgtacctaa tgaatactta aaacaaaacc ataggtggtt 7260 ggaggatcta tcagaacata atataacaac tcaaatgtaa tatacatcac agaacagtag 7320 atcatcatat acacatatat tgatacataa cagagtttac aaactgatac acgtcaagtg 7380 atatagcaaa ccacaataaa caggcaaatc caaaagaata catatatcag agttacaaca 7440 aaaaggacta cacataaagc tttaacaaaa aggagcaagc tgaatagtcc atgcggaagc 7500 aaaatagcta agtccaaaag cacctaacct gaaacatctc ggtctgaccc gagtataata 7560 cacgggtcag tctagctaaa caaatcagtt agataaactg aacaacaata acctgcaaag 7620 tcacaaagta taacaaatat ctctaaaaga gataacacaa tcatctaaca aaaagatgaa 7680 tcatatcata acaagcctcg tatcatcggc aactcataga aacaaaggat aggaatatcc 7740 caaaacaagc cataaaggca aataacaaat actagtgaag gtaacacaag ttccacaagg 7800 taatcgctat atatcgtgcg gctcaaaaag accaacaccg aagagcgata cctagggaat 7860 atacatatca atgaaacatc ataaaatttt aattgcaaca aacccaaata tctcatgagc 7920 ggtggtgaag aaaccagtcc aatatctctc gagcggtggt gaagaaaaac cactccgaaa 7980 gcaatactaa aggtaaccga caaccccaaa tatctctcga gccggggcaa aggaccaact 8040 ccaaaagcga tatttaaggc aacaagccag aaggagacag tccaaagaca ctatcccaaa 8100 ggcaacatgt gtcacaaact ctcagaaagg aatccgaaaa gtggtaacgt gagtctcata 8160 accacccgtt cgcactaaac ggtttcttat ccgttagtta atttcacact caaagcagta 8220 caaagtttac ctcatctcat cggtaaacca gacacaaagg tcaaaacgtt caaacgaata 8280 tattgggaat taactgagaa tatgaacgca cgtgttcatt gcacgcgttt tatctaatca 8340 tttgattctc ctcccacttc gctcggagtg cgaaaccgtg tgtgttttaa atagaattta 8400 taaattggag aaatgtgctt ttaatgcaac ttaaagggat tattttataa aaatcccgtg 8460 gatgaagtca aaaaggaatc atcaaggtca aatatgcata aacaactaat tggaatcaac 8520 gtgcatcgat aaaagttgga atcacagaca aataggcaaa gtagaaaaaa caggggaaca 8580 ggagcaggtc ggttgaccgg actttgagct cggtcgaccg gcccaaaaac agagaagtgc 8640 tctggtagca ggtcggtcga ccggcctact gagttcgatc ggccaaaccc tgtttccagc 8700 acttcccagc ctatcaaaac gagggccaat ctcgaccaaa ttgcaatcgt tcgagcaaag 8760 ccgccaaggg tttatgccaa tcgactaccc gacgctatat gctcctcgat gcatcaccaa 8820 aaacatgttt aaacatcaaa gttatgatct ttaaagattt gaacccaaaa cactaaaaat 8880 tgggatattc accaattcaa tccaaatcaa gagcaaatgc acatgaaaaa gtgttaggaa 8940 ttcatacctg acaatcaaag atagatataa gcatagatgt gtgataaaaa tctcaccttt 9000 aaccctaaaa aaagaagaag aagacgctca attgtaagga aaagatcaac cactctccac 9060 ttcaactcta ctagcttcaa tctaagatca aaacaagtat ttcttaagtt aggtttagga 9120 aacttctgaa attgaaggag aaagagttgg agaagatgaa gaggaggctt accaatagct 9180 tcttttgatt ttggagcaag aatttgagct agcaagagaa actagggctt ggagtttcta 9240 attccctttc ctttccacca ttttcagtta gagcttgagt ttgagaagtg ggaatgagtg 9300 aatggagagg agagagctga gttagggtat taagttagct agtgggctga acccaaaccc 9360 aaaacccaac tagaaaaagt agcaaaattt aacttactcc aaacatatca aagcttatat 9420 tcaaaaagat tgcaaacgcc attttggact caatggaggt ggtcttgagt cccaattcga 9480 ccgtttgcag aaagtagctt tttggactat aatccgacaa atgacgttat atttaaataa 9540 aatatttaaa tatgcaaccg ataaatatgc gggttgttac agtaaacttc gccagcaata 9600 acagattcaa gaatcaagaa agaagcaaca acaataaaaa tcagcctaat tttcaaagaa 9660 atggtcaatc ctctagatcc agaggaagaa atggaagata taacaacagc aataacagac 9720 tatggtgtca aatttgtgaa aagtttggtc atgcagccaa cgaatgttac ttcagatttg 9780 atgccaacta cattccatct cagcaaaata acaacagttc aagaaatcac aatctcaatg 9840 caaacatggt aaatacttat ccagattcta aagaacaagc agataccaaa agtacagaga 9900 ctgcaaagat tgatgatatc taggatgaaa gctagtatcc agattatgag gctaccaatc 9960 atgtaactaa taatctcaac aatctaaact tgggaagcag ggagtacaga ggtaggcaat 10020 taattcatat gggtaatggt gaatcagtaa aaattacaca tattggaaat gcaagtttca 10080 gtggcagaaa ataactcttt ctaaaaaatc tgctaagagt tccatctatt agaaaaacct 10140 tattgagtgt ttcgcatttt gcccaaggca atgatgtgta ttttatccca aatactgttt 10200 aattagagat attctaacta aggaaataat tttgcagggt aagaaattta aaggattgta 10260 caaattcgat gttgcaaaat caggaaattc cgaatttcat ggaaaatggt gtaatgttac 10320 tgaaattgaa catgaagata actataaaga ttttgatatt tgacattcca aacttggaca 10380 tccaagtgta agcattgtaa aaaaggtgtt aagtaatgat aatatttctg ttaaagatgt 10440 tgcaatgcct tatgtatgta catattgtca aatgggcaaa agccataaac ttgcatttcc 10500 aatctcaaaa ataaactata caaaaccctt agattaattg cttgagatct atggggtcca 10560 tcttctgtta acactgatta tggctataaa tactttatat catttgtcga tgcatactct 10620 agatatgtat ggatttattt cttgaaatca aaatctgaaa cttatgatgc agtcttacag 10680 tttataactc aagctgagag gcaaacaaat tgccaattaa aagtcttgca gactgatggt 10740 ggaaccgagt ttcaaccact taaggaatac cttcaaaaga aaggtataat tcacagaaca 10800 aactgtccat acacatcaga acaaaatgga ctggttgaaa gaaaacacag acatattgtt 10860 gagactgggc ttactttact agcccaagca tctcttcctc taaagttttg accagatgcc 10920 tttgccacta ctgtgttttt aataaataga ttatccataa aagttttaca gttcaaaagt 10980 ccagtggaaa tcttatttaa agttaagcca gaatatcata gtttgaaagt ttttggatgt 11040 ttatgctttc cctatttaag gccatataat acacacaagt taagtttcag gtcatcacca 11100 tgtaccttct taggctatgc agccaataag aagggataca aatgcttgga tagcaatgaa 11160 ttttgttttt gtttctatac atgtggtgtt taatgaaaga atatttccct ttaatcaatc 11220 aaacataaaa acatcacaga aagtgtataa ttcaaaactt tctataccac cagtacctga 11280 gcaacttgat gtcataactc aagttgaaga tgaaagaatg cagcacaata taactttaga 11340 gtctcctgtc aaatccactt cacaatacac tgtgcccaga cctgagccag gtcatgaaga 11400 agatgaacaa gctggaagca caagtgaggc atctcatatg tgccccatct atcagtcaga 11460 ctgcagtcag tcattagatg attcacaatc atctaatgat caacaggaag tcacagctga 11520 agagccaagt caatcacctg cacaagctag acatcacatg ataacaaggg ccaagagtgg 11580 tatattcaca ccaaaaatat acagtgttgc tatgaacaca gaagagccag atacctatca 11640 tcaagctatg cagaatgaaa actggatgtc tgctatggaa gaagaataca atgcattgat 11700 aaaaaataaa acatgggatc taacttcatt gccaagcaat aaaaatgtca taggctgtaa 11760 acggacatat agaataaaga gaagtggtga tggttcggtt tctaaatata aggcaaggct 11820 agtagccgaa gggtattcat agcaaagtgg ctttgacttt actgaaactt tttcaccagt 11880 tgtgaaaccc tcaactatta gaattgttct tactattgcc ttacatacaa actgaaacat 11940 caagcaatta gatgtaaata atgccctttt gtggcatttt acaggaggaa gtctacatgt 12000 aacagcctct aggttttgaa caaaaaaggg gtggaaaact tgtatgcaaa ttgaacaaag 12060 cgatctatag actcaaacat gcaccaaggg tctggtttga aaagctgaag tcaatactaa 12120 tcagacttgg ctacagctca acaaaatcat acaattcttt atttacaaaa tttaaaaaca 12180 atgcaaccat gtatgtacta atatatgttg atgattttat tattacaagc agcagtgaac 12240 cagagatgaa taaactcaca gacctcttaa ataaagaatt ttcaatcaaa gacttgggga 12300 acttaaatta ctttcttggc attgaggtta aaagactttc acacatagaa atgcttctaa 12360 gtcaaaggaa atacatctca gaaatcttac agaaagcaaa aacggataaa gcaaatgcaa 12420 tatctactcc tatggcaagc aattcacatc tgtcaacgta taaaggagaa tccatatcac 12480 atggcaagca gtacagaagt attgtaggag cattacagta tgtaacaatc actaagccag 12540 aaatttcatt tagtatcaat aaagtgagtc aatatatgca aatttcactg gatgaacatt 12600 ggaaagcagt taagagaatt ctaagatatc tcaaaggaac tataaatcat ggattaaaga 12660 tgcaatcatg caaatctatc catataaaag ggtatgcaga tgcagattgg gccacagaca 12720 tggatgacag aagatctacc actggttatt gcatatttct aggcaacaat ccagtttcat 12780 ggtgctcaaa aaaacagcct acagtatctc ggtcaagtac tgaagccgag tacagaaacg 12840 ttgctaatgc aacagctgaa ataatatgga taatgtcctt gctcagtgaa cttcatatca 12900 agtttacaga aaaaccgaca atttggtgcg acaatctgag caccgttctg ccctcagcaa 12960 atctagttct acatgctaga accaagcaca tagaactgga tctgtatttt gtcagagaac 13020 aagtaacaga ggaaaaaatt aacataagtc atctaccatc atcttaccaa atcgctgatg 13080 ttatgataaa acctctatca aagaagaact ttgtttgatt taagcaagaa ttgaaggtta 13140 ctgagttcga cagcaacgaa aaaggcaaga tctatgataa ctcaacaaat tgaagcttga 13200 cagcatcgtc tactccaatt gaagagaaat tccacttgac aatcaagtga aatttcccct 13260 gatgaagaaa gcaagtctcg atatacggca atttaaccaa aatcgaaaca cgacagctta 13320 atctctccaa cttcagcaaa aagagggctt ccgtatcact gcaaggtcct gagtggtaaa 13380 tctacacact cgagaaaccg aagccatcat attttattcg tgcggctgaa gaaattgcaa 13440 accctaaccc taagttaggt gtgaggggag gtatcaaatg aaagtataga gccgcactta 13500 tcaaatataa gcatcacaat ataattggaa cgggttgtga taatggacca tcccgaagcc 13560 caattttctt tttataaata tcaagttgta aacagttcag tgtattatca aaagaacaaa 13620 aacattctgt aactacggaa tatttttctt gttttctgtt tttcaaatat taatcaataa 13680 aatcaagatt caaactctct caatattctt tttacgagct aaaaatatat catattttct 13740 gtgtccgaac gctgatattg ttttttactt tggactctga tacttagcta acattataca 13800 cgtgagaaat aggaaactta tatctagtga aaattaccca tgaatctgac ag 13852 <210> 10 <211> 2516 <212> DNA <213> Allium cepa <400> 10 tgtgacgccc cacctctata ctcacgctag tcaaggacac tacaggataa taccgtcaac 60 taacatggag aataaggctg attaggagcg accatctata tccttgctct aactatctat 120 tgaatacatc aataatagac ataccaagca ggtcgacata cccaattaat acttaaaaca 180 aaaccatagg tggttgaagg aactatcaga acataatata acaactcaaa tgtaatatac 240 atcacagaac agtagatcat catatacaca tatattgata cataacagaa tttacaaact 300 gatacacgtc aagtggtata gcaaaccaca ataaacaggc aaatccaaaa gaacgcatat 360 atcagagtta caacaaaaag gactacacat aaagctttaa caaataggag caagctgaat 420 agtccatgca gaagcaaaat aggctaagtc caaaagcacc taacctgaaa catctcggtc 480 tgacccgagt ataatacacg agtcagtcta gctaaacaaa tcagttagat aaactgaaca 540 acaataacct gcaaagttac aaagtataac aaatatctct aaaagagata acacaatcat 600 ctaacaaaaa gatgaatcat atcataacaa gcctcgtatc atcggcaact cagagaaaca 660 aaggatagga atatcccaaa acaagccata aagacaaata acaaatacca atgaaggtaa 720 cagaagttcc tcaaggtaat cgctatatat tgtgcggctc aaaaagacca acaccgaaga 780 gtgataccta gggaatatac atatcaatga aacatcagaa aattttaatt gcaacaaacc 840 caaatatatc atgagcggtg gtgaagaaac cactccaata tctctcgagc ggtggtgaag 900 aaaaaccact ccgaaagcaa tactaaaggt aaccgacaac cccaaatatc tctcgagccg 960 gggcaacgga ccaactccaa aagcgatatt aaaggcaaca agccagaagg agatagtctg 1020 aagacactat cccaaaggca acatgtgtca caaactccca gaaaggaatc cgaaaagtgg 1080 taacgtgagt ctcataacca cccgttcgca ttaaacggtt tactatccgt tagttaattt 1140 cacactcaaa gcagtacaaa gtttacctca tctcatcggt aaaccagaca caaaggtcaa 1200 aacgttcaaa cgaatagatt gagaattaac tgagaagatg aacgcacgtg ttcattgcac 1260 gtgttttatc taatcatttg attctcctcc cacttcgctc ggagtgcgaa accgtgtgtg 1320 ttttaaatag aatttataaa ttggagaaac gagcttttaa tgcaatttaa agggattatt 1380 ttataaaaaa cccgtggatg aagtcaaaaa ggtatcatca aggtcaaata tgcaaaaaca 1440 actaattgga atcaatgtgg atcgataaaa gttggaatca cagacaaata ggcaaagtag 1500 gaaaaacagg ggaacatgag caggtcggtt gaccggactc tgagctcggt cgaccggccc 1560 aaaaacagag aagtgctctg gtagcaggtc ggtcaccggc ctactgagtt cgatcggccg 1620 aaccctgttt ccagcacttc ccagcctatc aaaacgaggg ccaatctcga ccaaattgca 1680 atcgttcgag caacgacgcc aagggtttat gtcaatcgac tacccgatgc tatatgctcc 1740 tcgatgcatc accaaaaaca tgtttaaaca tcaaagttat gatctttaaa gatttgaacc 1800 caaaacacta aaaattggga tattcaccaa ttcaatccaa atcaagagca aatgcacatg 1860 aaaaagtgtt aggaattcat atctgacaat caaagataga tataagcata gatgtaagat 1920 aaaaatccca cctttaaccc taaaaaaaag aagaagaaga agctcaattg caaggaaaag 1980 atcaaccact ctctacttca actcgactag cttcaatcta agatcaaaac aagtatttcc 2040 taagttaggt ttaggaaact tctgaaattg aaggagaaag agttggagaa gatgaagagg 2100 aggcttacca atagcttctt ttgattttgg agcaagaatt tgagctagca agagaaacta 2160 gagcttagag tttctaattc cctttccttt ccaccatttt cagttagagc ttgagtttga 2220 ggagtgggaa tgagtgaatg gagaggagag agctgagtta gggtattaag ttagctagtg 2280 ggttgaaccc aaacccaaaa cccaactaga aaaagtagca aaattcaact tactccaaac 2340 atatcaaagc ttatactcaa aaagatcaca aagccatttt ggactcaatg gatgtggtct 2400 tgagtcccaa ttcgaccgtt tgcagaaagt agccttttgg actataatcc gacaaacgac 2460 gttatattta agtaaaatat ttaaatatac aaccgataaa tatgcgggtt gttaca 2516

Claims (15)

A gene consisting of the nucleotide sequence of SEQ ID NO: 1 (AcWHITE).
A composition for selecting white guppy-colored onions comprising a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.
The composition of claim 2, wherein the primer comprises a nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8.
A kit for selecting white guppy-colored onions, including a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1.
The kit of claim 4, wherein the primer comprises a nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8.
A method for selecting white guppy-colored onions comprising the step of analyzing whether the nucleotide sequence of SEQ ID NO: 1 (AcWHITE) is present in the onion gDNA.
The method of claim 6, wherein the analyzing comprises binding a primer capable of detecting at least a part of the nucleotide sequence (AcWHITE) of SEQ ID NO: 1 to the gDNA.
The method of claim 6, wherein the analyzing comprises amplifying a gene by polymerase chain reaction (PCR).
The method of claim 7 or 8, wherein the primer comprises a nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 8.
Recombinant vector for producing white guppy-colored onions comprising the nucleotide sequence of SEQ ID NO: 1 (AcWHITE).
A method for producing a white guppy-colored onion comprising the step of transforming the nucleotide sequence (AcWHITE) of SEQ ID NO: 1 into onions.
The method of claim 11, wherein the transformation step is performed using the recombinant vector of claim 10.
The method of claim 11, wherein the transformation step is transformed using CRISPR/Cas9.
A transformed onion transformed with the recombinant vector of claim 10.
Transformed seeds of onion according to claim 14.

Images