KR101828709B1 - Primer set for screening lightgreen pepper, method for screening lightgreen pepper, and kit for screening lightgreen pepper - Google Patents

Abstract

More particularly, the present invention relates to a primer set for screening a green pepper and a green pepper for early selection of green pepper, a green pepper screening kit, And red pepper selection kits.
The present invention can early select the green pepper and the pepper, and has the effect that it can be utilized for the green pepper and the pepper breeding through such a method.

Description

[0001] The present invention relates to a primer set, a method for screening lightchreen pepper, and a kit for screening lightgreen pepper,

More particularly, the present invention relates to a primer set for screening a green pepper and a green pepper for early selection of green pepper, a green pepper screening kit, And red pepper selection kits.

The quality of the pepper fruit is determined by shape, fragrance, constituents, nutrients, etc. Among them, color is one of the most important traits contributing to consumer preference. The color of red pepper fruit is determined by carotenoids, anthocyanins synthesized in chloroplasts synthesized in chloroplasts or in chromoplasts.

There are various variations in the immature and color of red pepper from white or lemon color having little chlorophyll content to pale green color having excess chlorophyll. In early studies, it was reported that pepper seed and color intensity were controlled by two genes. However, white and green were separated by a single genetic pattern, and green was dominant against white. Peterson reported a linkage gene that regulates the immature stage of the red pepper and later confirmed that the gene group was located on chromosome 10.

In addition to chlorophyll, there are carotenoids such as lutein, beta-carotene and lycopene, and anthocyanins. During the maturation of the fruit of the pepper, the chloroplast is converted to the pigment, and the carotenoid is synthesized in the pigment, resulting in red, orange, and yellow coloring. Genetic studies to control color in red pepper fruit are mainly focused on maturation, and many researches have been carried out, and the synthesis routes of carotenoids and anthocyanins are already known. However, Research is still lacking.

Chloroplasts are the sites where chlorophyll synthesis occurs. Several transcription factors have recently been reported that regulate the development of chloroplasts. Among them, GOLDEN2 -like ( GKL2 ) has been reported for the first time in corn and has been mainly studied for its role in controlling chloroplasts in maize, Arabidopsis and rice leaves.

In recent years, however, research has focused on the role of tomatoes and pepper fruits. The chili was a test for the role of identifying the SlGLK2 and ohsol log (ortholog) of tomatoes before proceeding CaGLK2 CaGLK2 has been identified that is responsible for regulating the chlorophyll content and immature and color. When PTC (premature termination codon) is generated or mutated in the nucleotide sequence of CaGLK2 and the nucleotide and amino acid sequence are changed, the function of the gene is lost and chloroplast development and chlorophyll synthesis are inhibited, resulting in a phenotype of immature and pale green.

Virus-Induced Gene Silencing (VIGS) is a useful method for rapidly analyzing the function of genes and is a method of using RNA-mediated plant defense mechanisms against viruses. VIGS is a kind of post-transcriptional gene silencing (PTGS). When a plant gene is inserted into a TRV vector and the plant is infected with Agrobacterium mediator, the endogenous gene expression of the gene introduced into the plant is inhibited and a mutation Have the same effect as when you wake up.

Single nucleotide polymorphism (SNP) is a single nucleotide difference in DNA between individuals that exists across a wide variety of species genomes. Frequent SNPs appearing in plant genomes enable gene mapping, marker assisted breeding, and map-based cloning. SNPs are the most common genomic markers, and various SNP detection methods and experimental equipments have been developed in consideration of the ease and cost of the experiment to detect such SNPs.

High resolution melt (HRM) analysis is a relatively new post-PCR analysis method used to identify mutations in nucleic acid sequences, based on the detection of small differences in the PCR dissociation curve, and the temperature at which duplex DNA is denatured into a single strand Quantitative analysis using different points can be called next-generation amplicon melting analysis. The basic principle of this method is that as the temperature rises, the PCR product is denatured into a single strand and the fluorescence value is decreased. The genetic variation due to the difference in the base sequence may have different Tm values.

Accordingly, the present inventors have developed and used a marker that can effectively identify the cultivars of green pepper and pepper in order to secure the difficulties of clearly distinguishing the green pepper cultivars from the conventional green pepper cultivars.

Brand A, Borovsky Y, Meir S, Rogachev I, Aharonie, Paran I (2012) pc8.1, major QTL for pigment content in plastid compartment size. Planta 235: 579-588 Brand A, Borovsky Y, Hil T, Rahman KAA, Bellalou A, Deynze AV, Paran I (2014) CaGLK2 regulates natural chlorophyll content and fruit color in pepper fruit. Theor Appl Genet 127: 2139-2148

It is therefore an object of the present invention to provide a SNP marker for screening for green pepper and pepper.

Another object of the present invention is to provide a composition for identifying green pepper and pepper comprising a preparation capable of detecting or amplifying SNP markers for screening of green pepper and green pepper.

It is another object of the present invention to provide a kit for screening a broth and pepper comprising the primer set, the restriction enzyme, and the reagent for performing an amplification reaction.

Another object of the present invention is to provide a primer set for screening for green pepper and pepper.

It is another object of the present invention to provide a method for selecting green pepper and red pepper using the primer set.

In order to achieve the above object, the present invention provides In the CaGLK2 gene (genomic DNA), the 126th, the 116th, the 7th, the 16th, the 57th, and 744th of the 4th, And a SNP marker for screening a green pepper with a polynucleotide or complementary polynucleotide consisting of 3 or more consecutive DNA sequences comprising at least one SNP site selected from the group consisting of SEQ ID NO: Lt; / RTI >

In addition, the present invention provides a composition for identifying green pepper and red pepper comprising a preparation capable of detecting or amplifying a SNP marker for screening the green pepper and red pepper.

The present invention also provides a primer set of SEQ ID NOs: 3 and 4, a primer set of SEQ ID NOs: 5 and 6, a primer set of SEQ ID NOs: 7 and 8, a primer set of SEQ ID NOs: 9 and 10, A primer set of SEQ ID NO: 11 and SEQ ID NO: 12, and at least one primer set selected from the group consisting of SEQ ID NO: 13 and SEQ ID NO: 14 primer set.

In addition, the present invention provides a kit for screening a broth and pepper comprising the primer set, the restriction enzyme, and the reagent for performing the amplification reaction.

In one embodiment of the present invention, the amplification reaction-performing reagent comprises a DNA polymerase, dNTPs, and a buffer.

In addition,

1) separating DNA from the pepper samples;

2) performing the PCR using the separated genomic DNA as a template and using the primer set; And

3) analyzing the expression pattern of the PCR amplification product using HRM (High Resolution Melting).

In one embodiment of the present invention, the step 3) may be an analysis of an expression pattern through identification of homology with a reference pattern for each of the varieties of green pepper by the primer set in the step 2).

Since the primer set for screening of green pepper and red pepper of the present invention can early select red pepper with immature color and pale green color, it can be usefully used for breeding green pepper and red pepper It is expected to be.

1A is a schematic diagram showing a single nucleotide polymorphism (SNP) gene structure of CaGLK2 , and PTC means a pretermination codon.
Fig. 1B is a photograph of a red pepper separated into six groups with mutations in the CaGLK2 gene and having the same genotype. PCT-A is a phenotype of Chilgaucle Ri Jo and PCT-B is a phenotype of Aji. PCT-C is a phenotype of Zavolgski 55, PCT-D is a phenotype of Goshiki, WEINNACHT SPFEFFER and FIESTA, PCT-E is a phenotype of Alena and Hungarian Wax, PCT-F is a phenotype of Dar Tashkent, Volzanin and Malishok, NON PCT is a Milyang The phenotype of.
Fig. 2 shows HRM primers (red letters) prepared for the analysis of six groups having the same genotype in the CaGLK2 gene.
FIG. 3 is a graph showing the results of melt curve analysis of CaGLK2 against 6 groups having the same genotype by mutation of CaGLK2 gene using HRM primer.
Fig. 4 is a photograph showing immature and amateur of hamanero orange and havanano pitch showing different pale colors.
5 shows HRM primer (red lettering) using the difference in base sequence between hamanero orange and habanero pitch.
6 is a graph showing a melt curve pattern of CaGLK2 using HRM primer of hamanero orange and habanero pitch.
FIG. 7 is a graph showing the results obtained by performing PCR using HRM GLK2-125 marker: A is a phenotype of Chilgauclei Ri Jo, B is a Milyang phenotype, and C is a perennial phenotype.
FIG. 8 is a graph showing the results of PCR analysis using HRM GLK2-412 marker: A is a phenotype of Aij, B is a Milyang phenotype, and C is a perennial phenotype.
FIG. 9 is a graph showing the results of analysis using PCR using HRM GLK2-439 marker: A is Zavolgsk55 phenotype, B is Milyang phenotype, and C is Perennial phenotype.
FIG. 10 is a graph showing the results of PCR analysis using HRM GLK2-448 marker: A is a phenotype of WEINNACHT SPFEFFER, B is a phenotype of FIESTA, C is a Goshiki phenotype, D is a phenotype of ATSAL, Milyang phenotype, F is Perennial phenotype.
11 is a graph showing the results of PCR performed using HRM GLK2-489 marker: A is Hungarian Wax, B is Moldova-118 expression, C is Alena phenotype, D is P. Cecei phenotype, E is Zlatna medalya phenotype, F Zhelty phenotype.
12 is a graph showing the results of PCR analysis using HRM GLK2-735 marker: A is a Dar Tashkent phenotype, B is a Malishok phenotype, C is a Dobrynya nikitich phenotype, D is a Volzanin phenotype, E The Lastochka phenotype, F the Dari Tashkenta phenotype, G the Milyang phenotype, and H the Perennial phenotype.
13 is a photograph showing the induction of silencing of the An2 and CaGLK2 / An2 genes, which are genes involved in anthocyanin synthesis using the VIGS system.

Hereinafter, the present invention will be described in detail.

The present invention relates to a SNP marker capable of screening a pale green pepper using the CaGLK2 gene represented by SEQ ID NO: 15 and its use.

The inventors of the present invention conducted a study to identify red pepper which has a pale green color and a pale green color. As a result, it was found that the CaGLK2 gene represented by SEQ ID NO: 15 in the pepper had the 126th, SNPs that can identify green peppers and red peppers were identified at positions 16, 3, 57, and 744 of intron 4, and primer sets were prepared for HRM analysis It was proved to be effective in distinguishing between green and red peppers.

The entire name " CaGLK2 gene" of the present invention is Capsicum annuum GOLDEN2 - like , having a total of 5859 bp nucleotide sequence, and the exon length is 942 bp. The sequence of the CaGLK2 gene can be obtained from a known database such as GenBank of NCBI (Sol Genomics Network. CA10g02900), preferably including the polynucleotide of SEQ ID NO: 15 and the cDNA of SEQ ID NO: 16 .

The term "SNP marker" of the present invention means a single base polymorphism allele base pair on the DNA sequence used to identify an individual or species. Because SNPs are relatively frequent and stable and distributed throughout the genome, and because of the genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity among individuals. SNP markers generally involve phenotypic changes associated with single nucleotide polymorphisms but may or may not be. In the case of the SNP marker of the present invention, the amino acid sequence or the phenotype of the individual such as the green pepper and the pepper can be different.

The term "polymorphism " of the present invention refers to a case where two or more alleles exist in one locus. Of the polymorphic sites, only a single base is different depending on the individual, Polymorphism (SNP). Preferred polymorphic markers have two or more alleles with a frequency of occurrence of 1% or more, more preferably 5% or 10% or more in the selected population.

The term "allele " of the present invention refers to various types of a gene existing on the same locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

In one embodiment of the present invention, the pepper is selected from the group consisting of Hungarian Wax, Aji, Fiesta, WEINNACHT SPFEFFER, Chilgaucru Ri Jo, Dar Tashkent, ATSAL, Picantnii, Zhelty, Malishok, Zavolgski 55, Moldova- 118, Astrakhanskii 147, Dobrynya nikitich, And may include at least one of the pepper varieties of the group consisting of Volzanin, Alena, P. Cecei, Zlatna medalya, Lastochka, Dari Tashkenta, Habanero-peach, Goshiki, Milyang and Perennial.

In another aspect of the present invention, there is provided a composition for identifying green pepper and red pepper comprising a preparation capable of detecting or amplifying SNP markers for selecting the green pepper and red pepper.

The term "agents capable of detecting or amplifying SNP markers" in the present invention means a composition capable of discriminating between the green pepper and the pepper by amplifying the polymorphic site of the above-mentioned gene, Quot; means a primer capable of specifically amplifying a polynucleotide of the present invention.

The primers used for the SNP marker amplification can be amplified using appropriate conditions in suitable buffers (for example, four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) and template-directed DNA Stranded oligonucleotide which can serve as a starting point of synthesis. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the SNP marker but should be sufficiently complementary to hybridize with the SNP marker, preferably the primer set of SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: The primer set of SEQ ID NO: 7 and SEQ ID NO: 8, the primer set of SEQ ID NO: 9 and SEQ ID NO: 10, the primer set of SEQ ID NO: 11 and SEQ ID NO: 12, and the primer set of SEQ ID NO: 13 and SEQ ID NO: 14 And a polynucleotide sequence consisting of at least one primer set selected from the group consisting of SEQ ID NOs.

The marker identifying the green pepper and red pepper of the present invention can be obtained by searching the coding sequence and the entire DNA sequence in red pepper, sorting the coding sequence, selecting the single base sequence (SNP) site, 3 ') sequence, confirming other SNPs or mutations, and then using Primer3 blast, a specific primer set for the nucleotide sequence located on both sides of the SNP site can be constructed (see Fig. 1).

The term "primer" in the present invention refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

As another aspect of the present invention,

1) separating the genomic DNA from the pepper samples;

2) carrying out PCR using the separated genomic DNA as a template and using the primer set of claim 1; And

3) analyzing the expression pattern of the PCR amplification product using HRM (High Resolution Melting).

In one embodiment of the present invention, the step 3) may be a step of analyzing an expression pattern through identification of homology with the reference pattern for each of the cultivars of green pepper by the primer set in the step 1).

The method of the present invention comprises isolating genomic DNA from red pepper. A method known in the art can be used as a method for separating the genomic DNA from the sample. Using the separated genomic DNA as a template, an oligonucleotide primer set according to an embodiment of the present invention may be used as a primer to perform an amplification reaction to amplify the target sequence. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, the polymerase chain reaction is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such polymerase chain reaction methods are well known in the art, and commercially available kits may be used.

The above "high resolution melting (HRM) analysis" technique is a relatively new post-PCR analysis method used to identify mutations in nucleic acid sequences, and this method is based on detecting small differences in the PCR dissociation curve do. This is made possible by the improved double-stranded DNA (dsDNA) with the dye used in conjunction with the PCR instrument. Data can be analyzed and processed using specially designed software for the HRM analysis of differences in the degree of dissociation of dsDNA with temperature. In the present invention, HRM analysis was used to select the green and red peppers.

In another aspect of the present invention, there is provided a kits for screening a green pepper and a red pepper comprising the primer set, the restriction enzyme, and an amplification reaction performing reagent.

In one embodiment of the present invention, the amplification reaction-performing reagent comprises a DNA polymerase, dNTPs, and a buffer.

In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer, and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The manual includes instructions on the surface of the package including a brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

[ Example  1] Materials and methods

1. Experimental material

 The peppers used in the present invention were 24 commercially available varieties and genotypic strains, and the genotypic strains were purchased from the National Center for Plant Genetic Resources (see Table 1).

number Species Accession One Capsicum annuum Hungarian Wax 2 Capsicum baccatum Aji 3 Capsicum annuum FIESTA 4 Capsicum annuum WEINNACHT SPFEFFER 5 Capsicum annuum Chilgaucle Ri Jo 6 Capsicum annuum Dar Tashkent 7 Capsicum annuum ATSAL 8 Capsicum annuum Picantnii 9 Capsicum annuum Zhelty 10 Capsicum annuum Malishok 11 Capsicum annuum Zavolgski 55 12 Capsicum annuum Moldova-118 13 Capsicum annuum Astrakhanskii 147 14 Capsicum annuum Dobrynya nikitich 15 Capsicum annuum Volzanin 16 Capsicum annuum Alena 17 Capsicum annuum P.Cecei 18 Capsicum annuum Zlatna medal 19 Capsicum annuum Lastochka 20 Capsicum annuum Dari Tashkenta 21 Capsicum chinense Habanero-peach 22 Capsicum frutescens Goshiki 23 Capsicum annuum Milyang 24 Capsicum annuum Perennial

2. RNA extraction and cDNA synthesis

For the extraction of red pepper RNA, a single-step RNA isolation method (Chomczynski & Sacchi, 1987) was used. Fresh leaves of 2 cm in length were collected from 4 to 5 leaves in a 2 ml tube and rapidly frozen with liquid nitrogen (LN2). After finely crushing with a mortar, add 1 mL of TRL REAGENT to 100 ng of sample, and mix well. 200 μl of chloroform was added and mixed well. Then, centrifugation was carried out at 4 ° C and 13,000 rpm for 15 minutes to induce layer separation. 500 μl of the supernatant was transferred to a new tube, 500 μl of pre-chilled 100% isopropanol was added, and the mixture was slowly mixed. Centrifugation at 13,000 rpm for 15 minutes at 4 ° C, leaving only the RNA pellet, and removing the liquid from the tube. After adding 1 ml of 70% ethanol, the mixture was slowly mixed as before and centrifuged at 13,000 rpm for 5 minutes. Then, the tube was dried at 25 ° C for 10 minutes to completely remove the liquid from the tube. Then, 50 μl of RNase-free water was added to the tube containing only the RNA pellet to dissolve the RNA pellet. Total RNA extracted was quantified using Nanodrop 1000 Spectrophotometer (Thermo Scientific, USA) and stored at -80 ° C. The extracted RNA was synthesized with cDNA using SolGent's DiaStar ™ RT Kit with RNase Inhibitor. cDNA synthesis was carried out by the manufacturer.

3. Chili's Genomic  DNA extraction

The pepper DNA was extracted with cetryltrimetylammonium bromide (CTAB) method (Murray and Thompson 1980). Young leaves less than 2 cm in length were collected in a 2 ml tube containing 2 glass beads and stored at 4 ° C. After adding 600 μl of CTAB buffer (2% CTAB, 1.42M NaCl, 20 mM EDTA, 100 mM Tris-Cl, ddH 2 O), 3 μl of β-mercaptoethanol and 10 μl of 100 mg / ml L-ascorbic acid to the tube containing the sample, And then treated for 15 minutes in a heat block at 65 ° C. Then, 600 μl of a solution in which chloroform and isoamyl alcohol were mixed at a ratio of 24: 1 (v / v) was added, and the mixture was well mixed and centrifuged at 13,000 rpm for 15 minutes in a centrifuge adjusted to 4 ° C. Separation was induced. 500 μl of the layered supernatant was transferred to a new 1.5 ml tube and 500 μl of pre-chilled 100% isopropanol was added and mixed slowly. The DNA pellet was precipitated by centrifugation at 4 ° C and 13,000 rpm for 15 minutes, and then the supernatant was removed. After adding 750 μl of 70% ethanol to the tube containing only DNA pellet, slowly mix and centrifuge for 5 minutes at 13,000 rpm. After removing the pellet, treat the supernatant and centrifuge for 1 minute at 13,000 rpm. . The DNA pellet was dissolved by adding 30 μl of 100 μg / ml RNase-treated ddH ₂ O to the tube containing only the pellet. The extracted genomic DNA was quantified using a Nanodrop 2000 Sperctrophotometer (Thermo Scientific, USA) and stored at -20 ° C.

4. target  To amplify the gene primer  making

A primer capable of amplifying the CaGLK2 gene in cDNA was prepared by using the sequence information of CaGLK2 gene (Sol Genomics Network. CA10g02900) reported as a gene involved in chlorophyll development in pepper for preparing a primer for amplifying a target gene See Table 2). DNA oligomers used as primers were synthesized by Neoprobe (Neoprobe, Korea).

Name of the primer The sequence (5'-3 ') SEQ ID NO: Tm (占 폚) GC% Amplification product
(bp) GLK2-CDS-F ATGATGCTTGTTGTATCTACACCA One 57.5
37.5
934
GLK2-CDS-R GAGGTATTTTGTAATCCCTTGAC 2

5. PCR  analysis

PCR was performed by mixing 1 μl of the cDNA, 2.5 μl of the buffer, 0.5 μl of the dNTP, 0.125 μl of the Taq polymerase, 18.875 μl of the ddH 2 O and 1 μl of the forward primer (SEQ ID NO: 1) and the reverse primer (SEQ ID NO: 2) PCR was performed using T-100 Thermal Cycler (BIO-RAD, USA) for PCR reaction. The PCR conditions for cloning the CaGLK2 gene were denatured at 95 ° C for 3 minutes, denaturation at 95 ° C for 30 seconds, Annealing at 57.5 ° C for 30 seconds, and extension at 72 ° C for 1 minute were repeated 35 times, followed by reaction at 72 ° C for 5 minutes.

6. CaGLK2 Cloning  And base sequence analysis

The amplified PCR product was cloned using a T-blunt PCR Cloning Kit (Solgent, Korea) and transformed by heat-shock method using T-Blunt ™ Chemically Competent Cell (Solgent, Korea) The experimental method was carried out according to the method provided by the manufacturer. Plasmid DNA was isolated using HiGene ™ Plasmid Mini Prep Kit (BIOFACT, Korea) after confirming the presence of inserts by electrophoresis. The nucleotide sequence was decoded by Solgent. Using the decoded base sequence, differences in base sequences from the start codon to the stop codon of CaGLK2 gene in green and red pepper were analyzed using the Aligment tool (http://multalin.toulouse.inra.fr/multalin/) Respectively.

7. HRM primer  Production and analysis conditions

HRM primers were primed using Applied Biosystems' Primer Express Software Version 3.0 Software, using the nucleotide sequences identified in each genetic source (see Table 3).

10 μl and 5 μM of the MeltDoctor ™ HRM Master Mix (Applied Biosystems, Korea), 1.2 μl of the forward and reverse primers described in Table 3 below, and 6.6 μl of ddH ₂ O were added to the final volume of 20 μl . 7500 Step One plus Real-time PCR System (Applied Biosystems, Korea) was used for real-time PCR reaction. The real-time PCR temperature conditions were initial denaturation at 95 ° C for 10 minutes, denaturation at 94 ° C for 15 seconds, annealing for 25 seconds at 58 ° C, extension at 35 ° C for 72 ° C After repeating 40 times, it is reacted at 95 ° C for 10 seconds at 60 ° C for 1 minute, then increased to 0.1 ° C at 95 ° C per 1 second, and then reacted at 60 ° C for 15 seconds.

After the reaction was completed, the melting curve graph was confirmed using High Resolution Melt Software (Applied Biosystems, Korea).

primer Sequence (5'-3`) order
number Tm (占 폚) GC (%) Product (bp) HRM GLK2-125-F GGGAATTTAATCGACACCATTGA 3 58.7 39 84 HRM GLK2-125-R CAAGGATTTTCAAATTTTGCAGC 4 58.8 35 HRM GLK2-412-F CAGAGCTGCACAGGAGATTTGTA 5 58.3 48 142 HRM GLK2-412-R CGAAGAAAATTTACTTGAAGATGGC 6 58.5 36 HRM GLK2-439-F CAAATTCTTATTATTATTACACATATGCAG 7 54.7 23 109 HRM GLK2-439-R CATACATTTGCTTCCTTTGGGTC 8 58.5 43 HRM GLK2-448-F CACATATGCAGAAATATCGAGCTCA 9 59.3 40 90 HRM GLK2-448-R CATACATTTGCTTCCTTTGGGTC 10 58.5 43 HRM GLK2-489-F CACATATGCAGAAATATCGAGCTCA 11 59.3 40 115 HRM GLK2-489-R TGCAGACCATGGGTTCATTATAAC 12 58.8 46 HRM GLK2-735-F CTTACAACCACGTGACTCGCC 13 59.2 43 102 HRM GLK2-735-R GATGCAAATGTGGAGTTTGTCCT 14 59 57

[ Example  2] CaGLK2 Sequencing

In the camp of the immature green peppers to cDNA using 24 strains of various CaGLK2 The nucleotide sequence differences of the genes were analyzed. Sequencing results CaGLK2 6 groups (PCT-A having the same genotype variation has blossomed in the gene; Chilgaucle Ri Jo, PCT-B ; Aji, PCT-C; Zavolgski 55, PCT-D; Goshiki, WEINNACHT SPFEFFER and FIESTA, PCT -E; Alena and Hungarian Wax, PCT-F; Dar Tashkent, Volzanin and Malishok, NON PCT; Milyang). CaGLK2 The gene consisted of 6 exons and 5 introns. The total length was 5459 bp, and the length of the exon was 942 bp (see FIG. 1).

The first identified mutation in the CaGLK2 gene was confirmed at the 126 bp position of exon 1, and the deletion of one of the cytosine (C) in the pepper with the pale green phenotype resulted in a change in the amino acid sequence thereafter. Of the total 313 amino acid sequences, 51 It was confirmed that Premature Termination Codon (PTC) was formed. The second variation In the second exon of the CaGLK2 gene, PTC was generated by the introduction of the GTAGACA sequence at the 116 bp position. In the third and fourth mutations, Cytosine (C) was transformed into Thymine (T) at the 7bp and 16bp positions of the third exon, respectively, and PTC was generated in the third mutant. In the fifth mutation, Guanine (G) (A) and it was confirmed that PTC occurred. Finally, in the sixth mutation, mutation of splice acceptor site was induced by modification of guanine (G) to Cytosine (C) at 744 bp position of the fourth intron, resulting in deletion of nucleotide sequence AG at the beginning of the fifth exon, PTC was formed in the amino acid sequence. CaGLK2 exon region of the gene mutation is in a position as animation sequences that directly involved in amino acid synthesis gene or CaGLK2 if the PTC is formed CaGLK2 It affects the expression of the gene, and it is presumed that the immature and the pale green color will represent the phenotype.

[ Example  3] Yanji and  Discrimination HRM Marker  Development and panel testing

Variations in the nucleotide sequence of the CaGLK2 gene were generated by Primer Express Software Version 3.0 Software program (Fig. 2). Using the primer set described in Table 3, the melange patterns of the mutant system (dark green) and mutation-free system (light green color) in the nucleotide sequence of the CaGLK2 gene were compared through HRM analysis and their melt curve patterns were different, (See FIG. 3).

In addition, the apricot habanero is similar to the orange habanero in characteristics such as size and shape, but unlike the habanero, which is immature, hue-colored, and orange-dyed, habanero has characteristics of immature, (See Fig. 4).

Sequence analysis of the CaGLK2 gene in these two lines confirmed that the orange hapanero had no mutation in the CaGLK2 gene base sequence while the apricot hapanero had the base sequence mutation belonging to the PTC-E group. Analysis of these nucleotide sequence differences through HRM primers revealed that the melt curve patterns of the two were different (see FIGS. 5 and 6).

In addition, 125 markers were developed using the cytosine deletion located in the first exon, 412 markers were developed using the second exon base sequence introduction, 439 markers, 448 markers and 489 markers were used for SNP of the third exon . And 735 markers were developed based on SNP of the sixth intron.

PCR was performed using primers of SEQ ID NO: 3 (HRM GLK2-125-F) and SEQ ID NO: 4 (HRM GLK2-125-R), and HRM analysis was performed. As a result, the nucleotide sequence difference by deletion of cytosine located in the first exon (B), Perennial (C) and Chilgauclei (A) and peppers (Figure 2 PTC-A and Figure 7 Reference).

HRM analysis was carried out by PCR using primers of SEQ ID NO: 5 (HRM GLK2-412-F) and SEQ ID NO: 6 (HRM GLK2-412-R), and as a result of the nucleotide sequence difference by introduction of the GTAGACA nucleotide sequence into the second exon (B), Perennial (C), and Aji (B) and red pepper (see Figure 2 PTC-B and Figure 8).

HRM analysis was carried out by PCR using primers of SEQ ID NO: 7 (HRM GLK2-439-F) and SEQ ID NO: 8 (HRM GLK2-439-R). As a result, (See FIG. 2 PTC-C and FIG. 9). In addition, the difference between the two types of red pepper can be distinguished from that of the green pepper (Milyang (B), Perennial (C)

HRM analysis was carried out by PCR using primers of SEQ ID NO: 9 (HRM GLK2-448-F) and SEQ ID NO: 10 (HRM GLK2-448-R). As a result, (E), Perennial (F), and WEINNACHT SPFEFFER (A), Atsal (B), Fiesta (C), and Goshiki (D) PTC-D and Fig. 10).

 HRM analysis was performed by PCR using primers of SEQ ID NO: 11 (HRM GLK2-489-F) and SEQ ID NO: 12 (HRM GLK2-489-R) (A), Moldova-118 (B), Alena (C), P.Cecei (D), Zlatna medalya (E), Zhelty (H) (F)) can be distinguished (see FIG. 2 PTC-E and FIG. 11).

HRM analysis was carried out by PCR using primers of SEQ ID NO: 13 (HRM GLK2-735-F) and SEQ ID NO: 14 (HRM GLK2-735-R). As a result, nucleotide sequences of SNPs showed different patterns of denaturation (B), Dobrynya nikitich (C), Volzanin (D), Lastochka (E), Dari Tashkenta (F), and Moriang (G) ) Can be distinguished (see Fig. 2 PTC-F and Fig. 12).

[ Example  4] CaGLK2 To identify gene functions VIGS  Analysis of color change of pepper through test

In order to verify the functionality of CaGLK2 gene makes a CaGLK2 / An2 construct a gene An2 a reporter gene involved in anthocyanin synthesis culminated in a purple throughout the plant An2 the immature and the color purple, sukgwa color orange of peppers silencing and Co-silencing of CaGLK2 / An2 was induced.

Specifically, the plaque-forming unit PCR was first performed for the VIGS test. To the PCR tube, 1 μl of the digested cDNA of Numex Halloween, 2.5 μl of the buffer, 0.5 μl of the dNTP, 0.125 μl of the Pfupolymerase, 18.875 μl of the ddH ₂ O and 1 μl of the forward primer (SEQ ID NO: 1) and the reverse primer And then PCR was performed using a T-100 Thermal Cycler (BIO-RAD, USA). PCR conditions for cloning the target gene CaGLK2 were initially denatured at 95 ° C. for 3 minutes and denaturation at 95 ° C. for 30 seconds, annealing at 58 ° C. for 30 seconds, extension at 72 ° C. for 1 minute Was repeated 35 times and then reacted at 72 ° C for 5 minutes. In order to link the reporter gene ( An2 ) with the target gene, 50 ng / ul of each PCR product was mixed and PCR was carried out under the same conditions as above. We used a lic method based on homology of vectors and inserts for cloning of genes of interest. The amplified PCR product and TRV2 were ligated with T4 polymerase at 25 ℃ for 1 hour. E. coli was transformed by heat shock method, and the experimental method was performed according to the method provided by the manufacturer. Plasmid DNA was isolated using HiGene ™ Plasmid Mini Prep Kit (BIOFACT, Korea) in order to confirm the correctness of the construct after confirming the presence of the insert through electrophoresis. Plasmids were then transformed by freeze thaw method (agrobacterium transformation). After that, 100 μl of 100 mM Acetosyringone, 5 ml of 100 mM MES and 25 ml of 100 mM MgCl ₂ were added to make a total of 50 ml of ddH ₂ O to prepare a buffer solution for cell suspension. Agrobacterium containing TRV1 and TRV2 was mixed with the buffer solution and allowed to react for 2 to 3 hours. The seeds were infected with a needle-free syringe at the back of the cotyledon of the 2-week-old plant after sowing. Agrobacterium infiltrated plants were grown in a growth chamber at 16 ℃ for 16 hours, then grown at 25 ℃ for 4 weeks and grown at 21 ℃.

As a result, immature and otherwise control and indicating a deep purple objects to induce silencing of An2 in this anthocyanin synthesis is inhibited showed the phenotype of green, CaGLK2 / objects induce co-silencing of An2 is An2 in the crude Were greenish rather than silenced. Therefore CaGLK2 peppers were able to confirm once again that involved in regulating the chlorophyll content in the immature, silencing the object in sukgwa only An2 is negligence, whereas CaGLK2 / An2 indicating a similar orange and control a co-silencing of control and An2 (Fig. 13). The results are shown in Fig.

These results are similar to the phenotypic difference between the habanero orange and the habanero pitch. If the difference in hyperchromaticity between the two groups is due to the mutation of the CaGLK2 gene, CaGLK 2 may affect not only the color of the fruit but also the color .

Therefore, it was confirmed that the combination of the primer set for selecting green pepper and pepper of the present invention, the method of selecting green pepper and pepper, and the green pepper and pepper selection kit can early select pepper and green pepper.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Primer set for screening lightgreen pepper, method for screening          lightgreen pepper, and kit for screening lightgreen pepper <130> PN1603-086 <150> KR 10-2015-0164670 <151> 2015-11-24 <160> 16 <170> KoPatentin 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GLK2-CDS-F <400> 1 atgatgcttg ttgtatctac acca 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GLK2-CDS-R <400> 2 gggtatttt tgtaatccct tgac 24 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-125-F <400> 3 gggaatttaa tcgacaccat tga 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-125-R <400> 4 caaggatttt caaattttgc agc 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-412-F <400> 5 cagagctgca caggagattt gta 23 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-412-R <400> 6 cgaagaaaat ttacttgaag atggc 25 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-439-F <400> 7 caaattctta ttattattac acatatgcag 30 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-439-R <400> 8 catacatttg cttcctttgg gtc 23 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-448-F <400> 9 cacatatgca gaaatatcga gctca 25 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-448-R <400> 10 catacatttg cttcctttgg gtc 23 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-489-F <400> 11 cacatatgca gaaatatcga gctca 25 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-489-R <400> 12 tgcagaccat gggttcatta taac 24 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-735-F <400> 13 cttacaacca cgtgactcgc c 21 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HRM GLK2-735-R <400> 14 gatgcaaatg tggagtttgt cct 23 <210> 15 <211> 5859 <212> DNA <213> Unknown <220> <223> Capsicum annuum Golden 2-like 2 transcription factor <400> 15 atgatgcttg ttgtatctac accattgagc tacaaaaatg aaaggggaaa ttatgattta 60 tttcaagatt ttcctgatgg gaatttaatc gacaccattg attttgatga cttttttgag 120 ggaatcaacg atggagattt gctgcaaaat ttgaaaatcc ttgatgaatt tgatattagc 180 aagaataata caactactaa tctaaatgtg aaaacaaagt caaaggaaaa tgataaatcc 240 aagaaatcgt caagccaaat caagaatcct gaagggaaga aaaaagtgaa ggtaattttt 300 tttttgttat attattatta tttttgaaaa aaaaaaagat aattcaaaaa tatcatctcc 360 atgcttcgga atttaggttt ttctgtaaga gtttaagtta tatacattat agcgtaatga 420 aattttgcat cattatataa cctttgtatg ttttagcaat tagtagtttg tctcactttt 480 aagattacaa atgtcacgtg ttaaagaggt tagattatat tacttgttga tcgatatctt 540 ttgactgact tgattatctg ttgtagcaaa gaataatgat ttacatgatg tcgatattct 600 ttgaatgacc tgatagtata aaaaaaaact tttatcatgc atgtaatcca tgaaactaaa 660 gatcactagc tagttatagt caatttctat gaagaattta agttatttat atggataatg 720 taataaattt ttaataaaaa tattgtgggt aattgacctt ttttcccaaa tgaaagttta 780 atttcttgaa gtatgttgtt gttgttcata ttgtctctct tcccaatttt gttcaacatg 840 gctgagacat tacattatta tattttccat acttgattta ttatgcttta tttaattcga 900 gaatctatca aaaatagatt tacgtatata ttttcatata ttttatttat gagattactc 960 tgaataagac gttgttgttg ttaaggttga ttggactcca gagctgcaca ggagatttgt 1020 aaaagcagta gagaaattag gtgtggataa agcagttcca tcaagacttt tagagcttat 1080 ggctactgat ggtctcacta gacataacat tgccagccat cttcaagtaa attttcttcg 1140 aaaaaaactc agtcattctt aattagagat tttgagttcg agttttgaat gtgaaattag 1200 tatcttatta ggaagtgctc tcctagatgt gaaagtttcc gattagcgtg aaacaggtac 1260 cgcacatcag acagagaacc aaaaagtaat gatgtgaaga aatatttata taatcatcct 1320 taatcagaaa tcttgagttt aaatcttgta tatggagtta tcttatagcg agcattctct 1380 ccgatataat gtgagaattt cgattggaag aatccaattt tttcccactt ttttcattaa 1440 aatgaaaaaa gaaaatcaga taaaagtgat gaaattctca tagtcaaatg cttatttagt 1500 ctccaataca actatcgaac atcgagcgaa gaaataaaaa aaaattatat ttaaaaaata 1560 atacttatat cgagggaaga actaaaaaaa tattaaacaa ttatacgtat tttcttgagt 1620 ttcaatacct tttaggttgt cattttccat atatgagaaa ggcaagaata ctaatttagt 1680 attttcttta aagagaaaag ataatttctt gcctgaaaat ttgctcataa tagaaacatg 1740 tgtgaacgaa aaaatgaaca attaggacct agttcaaatt tgcatcttct gaaggaaact 1800 cttatgaatc aatgagagat ttcgaatttg aatatcttaa aatgaaaaaa ataaattatt 1860 aggaccactg ccttttaact agaaatagac actacaatgc tagcatgtca cagtattgtt 1920 ttttcaaaag tattctagtt caattaaatt tagtttaatt tatttttgat gtctatgtcg 1980 aacaccagat gaaaaaaaga gaattatgaa actaataaga aaactatctc caaaaataga 2040 tcatacaatg ctagaatgtt acagtattat ttttttgtaa ttactctagt tcaattagat 2100 ttgattaata taataactct cttcatttaa aattttatat tttagtttta atctgtttta 2160 aaaaaaaaaa ttagctttat ctaattaaac ctagaaagtt ttcatactta cattcttttg 2220 attatattga aaggagggag tatcttttta aatcttattg ttatatgaga taagtgtttt 2280 tttatatata tatattatta gattctgttc acatataata ataagtaaat ttcctcaata 2340 agcatgatat agtaacttga aaaaagttat gatgatatta aatttgttta tattttttat 2400 gcatgtaact caaattctta ttattattac acatatgcag aaatatcgag ctcatcgaaa 2460 acatttatta gcaagggaag ctgaggcagc aagctggacc caaaggaagc aaatgtatga 2520 tggagccatt gcgatcggag gcggagggaa gagagttata atgaacccat ggtctgcacc 2580 accaaccatg ggttttccac ccatggctca tcatattaga cccttacatg tttgggggca 2640 tccatatgta aataattctt tttggcatcc acattatcaa ggagtgagtt ccttttatat 2700 atatattctt tattattttg ttttcttctt atcttatcgt atgactggac acaaagtttt 2760 aagttaaaaa ggagaaaaaa gtttgaaaat aaaatttgtt ataacacgct taaattttgc 2820 gggaattcta tgattcacct cgactattta ttatcgtact tctgtgtcat atatttgcct 2880 aactggacca ctatgtgaat actcatacac tgagcatgtg agggtttgaa gtggtccagt 2940 tggacaggta tatgccacaa aaatacgtaa taaatagtcg agggggtcat aggattcccg 3000 taaagttgag gcgtgttaca ataaatttcg tcaaaattta ggtatatttc tgaccctttt 3060 cccttaaaaa aaatgaaaat cttgaaaatt tatgattata taacatattt aacatttata 3120 cgattatatt attttgaatt tcttatgatc taaatatgat ataatatttg tgtggtggtt 3180 aagttagtgt aacaaatgat tttccctgtg agtggtactc aaggattgat tctcttgtta 3240 atcaatcgag ttcgtcacat caagcttctc ttagggttcc aaacaaatat annnnnnnnn 3300 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3360 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctca 3420 atcaaatatc gttacataaa ttgaaatatt tgttgcaggt accaaattct cttgcaccag 3480 gcactccttg ctttccttca ccaacggtag ctactttttc taagttttat tgtttcagtc 3540 tcgtactagt atttagcagt gttttaaaga gcgggggcgt aagttaaagc gttttattta 3600 acataggttt caaagcaatg aggcgtaagc cttatgaaac ttatttttta atttataatg 3660 tagtaaaata acatcataaa tatagacacc tatttttcct aagttttgtt agcgagcccc 3720 aagcattgac ggtttggcgt gcttagggtg tagaatcaga cgcttaaggt ataagtctca 3780 taaaattaag ccttttacct atgcctcgag gtgttttgcc agtgctttgc ttccaaagcg 3840 agcctcaaaa ctacctttta aaacactgat atttaggagg tgtttgacca agtaatttag 3900 agctcaagtt taaaatttta atctattagc gataagcaaa gaaattaaga aaatcaaatt 3960 tgagtaaagc atttagtacc cctttgaact atgaccaaat ttgttatgac acactttaac 4020 tttacgggga tcctattacc cctaaactaa attttagcgt atttttatca tcctttagtt 4080 gacgtgatac tttttgtcaa cctttttaac tgacatgaca actttaatgt ggactccatt 4140 ttatataaga aaaatatcac gtctgcacaa aagagtgaca gaaatacgtt aaaattgagt 4200 ttaagagagt aataggaccc tctaaagttg aagtgtgtca tatcaacttt gatcataatt 4260 caaaaaatta ttgaatactt atctcatcaa attttattat atataaataa aataataagn 4320 cccttacaac cacgtgactc gcctttgcag agatttgcag cagctcttat ggtccctggc 4380 gttccaccac cctttgcatc aggacaaact ccacatttgc atcctgtgag ccttttttgt 4440 ctctcaacaa ttataattat ttcccctacc tacattgact tgaaacaaaa tttaagaaaa 4500 taaagaatat ttttaaattt tatgacctta aattaaagtt acattaaata tatcaaaata 4560 ttctttaatc ttatgatcct aaatatgcca tgtgaaaaat agaaactaaa gtattgtcaa 4620 aaaaaaaaaa agttattttt tgaaacgaac taaaaataaa agcagatcat tctttttgaa 4680 actgagagag tattagtata tgatttattg ctataagaat atctatattt aaatatagag 4740 ttaggatttt aaattttaaa attaaatgac gattttaagt cttaataatt aagattgttt 4800 ggtttaaaag aacatgttag tttgaaaaat attttctact aacataagtg aattttactt 4860 attttcttat gtttgttatg taagcaaaaa tatttatcat aaagaatata caatgtcact 4920 tggaaaactt gtttttcata cttttactag agaagttatt tttttatttt ttaaatnttt 4980 cagagaaagt gtctttcaaa aattttgaca aatcaaacat gaaaattttt aacaaattga 5040 atacacccta cgttctaaat ttaatatttg tgtgcattta atgaattttt ttttgataca 5100 aatacattat ttaagcaaat gctattaaat ttgatcgaac aattatcttc agacttctag 5160 ctctgctcct gatatgattt ttttttttaa tatttattat aagttttaaa agtctttcct 5220 tgttttctaa atttatcgac ctagtggctt aagccaaatt ttacaccaac agagttcatc 5280 atctactata taaacattta aaaaaaaaaa aagacaaata atccagtact ccgtcgaact 5340 atgaccaaag ttgctacgac acactccaac atcacaagga tcctattacc ccctgagctc 5400 aaatttaaca tatttttgtc acccttttgt gctgatgtgg tatctttatt acataaaatg 5460 aggctcacat caaagatgtc acatcagcta aagaggttga taaaaggtat cacgtcagct 5520 aaaaagattg ataaaaatat gctaaaattt agtttggagg ggggaggggt taataggacc 5580 gtgaagttgg aatgtatcat agcaaatttg atcataattc agagatgtac tagatgcttt 5640 actcaaacaa aaaaaatgaa ccttatatat aggatgaaat tttactgaca tattatcttg 5700 atatttgtta cacagacaaa agagagcata gatgcagcaa ttgaagatgt tttatcaaag 5760 ccacaaacgc cacttcctat aggattgaaa cctccatcaa ttgatagtgt gttgaatgaa 5820 ttacaatgtc aagggattac aaaaatacct ccaacttga 5859 <210> 16 <211> 942 <212> DNA <213> Unknown <220> <223> CaGLK2 cDNA <400> 16 atgatgcttg ttgtatctac accattgagc tacaaaaatg aaaggggaaa ttatgattta 60 tttcaagatt ttcctgatgg gaatttaatc gacaccattg attttgatga cttttttgag 120 ggaatcaacg atggagattt gctgcaaaat ttgaaaatcc ttgatgaatt tgatattagc 180 aagaataata caactactaa tctaaatgtg aaaacaaagt caaaggaaaa tgataaatcc 240 aagaaatcgt caagccaaat caagaatcct gaagggaaga aaaaagtgaa ggttgattgg 300 actccagagc tgcacaggag atttgtaaaa gcagtagaga aattaggtgt ggataaagca 360 gttccatcaa gacttttaga gcttatggct actgatggtc tcactagaca taacattgcc 420 agccatcttc aaaaatatcg agctcatcga aaacatttat tagcaaggga agctgaggca 480 gcaagctgga cccaaaggaa gcaaatgtat gatggagcca ttgcgatcgg aggcggaggg 540 aagagagtta taatgaaccc atggtctgca ccaccaacca tgggttttcc acccatggct 600 catcatatta gacccttaca tgtttggggg catccatatg taaataattc tttttggcat 660 ccacattatc aaggagtacc aaattctctt gcaccaggca ctccttgctt tccttcacca 720 acgagatttg cagcagctct tatggtccct ggcgttccac caccctttgc atcaggacaa 780 actccacatt tgcatcctac aaaagagagc atagatgcag caattgaaga tgttttatca 840 aagccacaaa cgccacttcc tataggattg aaacctccat caattgatag tgtgttgaat 900 gaattacaat gtcaagggat tacaaaaata cctccaactt ga 942

Claims (7)

CaGLK2 ( Capsicum annuum &lt; RTI ID = 0.0 &gt; GOLDEN2 -like genomic DNA of the 126th, 116th, 2x , 7th, 16th, 3rd, 57th, and 4th introns of exon 1, Selecting a consensus polynucleotide or complementary polynucleotide consisting of three or more consecutive DNA sequences comprising at least one SNP (single nucleotide polymorphism) site selected from the group consisting of positions at position 744 &Lt; / RTI &gt; A composition for identifying green pepper and red pepper comprising the agent according to claim 1 capable of detecting or amplifying a SNP marker for screening for green pepper and red pepper. The primer set of SEQ ID NOS: 3 and 4, the primer set of SEQ ID NOS: 5 and 6, the primer set of SEQ ID NOS: 7 and 8, the primer set of SEQ ID NOS: 9 and 10, And a set of primers selected from the group consisting of primers set forth in SEQ ID NO: 13 and SEQ ID NO: 14, and a set of primers selected from the group consisting of primers set forth in SEQ ID NO: 13 and SEQ ID NO: A kit for screening a broth and pepper comprising the primer set of claim 3, a restriction enzyme, and a reagent for performing an amplification reaction. 5. The kit for screening of green pepper and red pepper according to claim 4, wherein the amplification reaction reagent comprises DNA polymerase, dNTPs, and a buffer. 1) separating the genomic DNA from the pepper samples;
2) carrying out PCR using the separated genomic DNA as a template and using the primer set of claim 3; And
3) analyzing the expression pattern of the PCR-amplified product using HRM (High Resolution Melting). The method according to claim 6,
Wherein the step 3) comprises analyzing an expression pattern by identifying the homology between the green color and the reference pattern for each of the pepper cultivars by the primer set in the step 2).

Images