CN112852996B - SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof - Google Patents
SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof Download PDFInfo
- Publication number
- CN112852996B CN112852996B CN202110333103.XA CN202110333103A CN112852996B CN 112852996 B CN112852996 B CN 112852996B CN 202110333103 A CN202110333103 A CN 202110333103A CN 112852996 B CN112852996 B CN 112852996B
- Authority
- CN
- China
- Prior art keywords
- marigold
- petal
- primer
- lingua
- character
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SCAR molecular marker for identifying marigold lingua petal lobe cracking character, a detection primer and application thereof. The nucleotide sequence of the SCAR molecular marker in marigold tongue petal without splinters is shown in SEQ ID NO.1, and the nucleotide sequence of the marker in marigold tongue petal with splinters is shown in SEQ ID NO. 2. The invention further provides a detection primer and a detection kit for identifying the marigold lingua petal lobe cracking character. The SCAR molecular marker provided by the invention can accurately and efficiently distinguish whether the marigold has the lingulate petal lobe, the detection efficiency in an F2 separation population with the lingulate petal lobe of the marigold reaches 96.12%, the PCR product can be directly utilized to quickly screen the character of whether the lingulate petal lobe of the marigold, the marigold can be selected in the seedling stage, the breeding efficiency is obviously improved, and the breeding cost is reduced.
Description
Technical Field
The invention relates to a molecular marker of plant quality traits, in particular to an SCAR marker for identifying the marigold lingua petal lobe trait, a detection primer and application thereof, belonging to the field of SCAR molecular markers of marigold lingua petal lobe trait.
Background
Flower symmetry is a major factor defining inflorescence type and is also a typical characteristic of angiosperms. According to the different number of the symmetrical surfaces, the symmetrical inflorescence types can be divided into three types, namely radial symmetry, bilateral symmetry and asymmetry. The bilateral symmetry is evolved from radiation symmetry, which can effectively attract pollinators and promote the propagation of plant pollen. The method is characterized in that related key genes influencing petal symmetry are excavated by utilizing mutants in sunflower, goldfish grass and gerbera, and a high reference value is provided for disclosing symmetry development.
Marigold (Tagetes erecta) is an annual flower of Compositae, and its capitiform inflorescence comprises symmetric ligulate flower on both sides of periphery and symmetric tubular flower in interior radiation. A mutant strain JH 'is obtained in the early stage of a marigold subject group of university of Huazhong agriculture, and tongue-shaped petals which are symmetrical on two sides of the mutant strain JH' are converted into tubular petals which are symmetrical in radiation, namely, original non-cracked petals have five splits, so that the mutant strain JH has great research significance for researching the molecular mechanism of inflorescence symmetry.
With the improvement of living standard and the increase of demand for mental culture, consumers have higher and higher requirements on ornamental characteristics of flowers. The tongue-shaped flower petal has the character of split, can improve the ornamental property of the marigold, enhance the market value of the marigold and meet the public demand. Although the existence of marigold petal splinters is easy to be identified in the full-bloom stage, the marigold petal splinters cannot be distinguished in the early development stage of flowers, and the flower cultivation cost is greatly increased. At present, the genetic mapping of related genes of marigold ligulate petal splinters is not researched.
The BSA assay is a method for rapidly mapping and controlling a target trait gene using an F2 population having an extreme trait. BSR-seq is a method for carrying out mixed population analysis (BSR) through a second generation sequencing technology and RNA-seq, developing SNP molecular markers by using a sequencing result and accurately positioning target genes. Plants such as corn, wheat, rice and the like have successfully positioned target genes closely linked with target traits by utilizing a BSR-seq technology. BSR-seq is combined with comparative genomics, and a molecular marker closely linked with marigold ligulate petal shapes is developed by utilizing a sunflower genome and a marigold third-generation transcriptome, so that marigold can be selected in a seedling stage, and the breeding efficiency is improved.
Disclosure of Invention
One of the purposes of the invention is to provide an SCAR molecular marker for identifying the petal lobe character of marigold lingua;
the second purpose of the invention is to provide a detection primer for amplifying the molecular marker;
the third purpose of the invention is to apply the molecular marker or the detection primer to the identification of the marigold lingua petal lobe cracking character.
The above object of the present invention is achieved by the following technical solutions:
the invention firstly provides an SCAR marker for identifying the lobe cracking property of marigold lingua petals, which is named as T01.PB37003, the nucleotide sequence of the marker without lobe cracking in the lingulate petals of marigold is shown as SEQ ID NO.1, and the nucleotide sequence of the marker with lobe cracking in the lingulate petals of marigold is shown as SEQ ID NO. 2.
The SCAR molecular marker T01.PB37003 provided by the invention has a 203bp insertion sequence in a marigold sequence without split petals after 156bp, the SCAR marker T01.PB37003 of a large number of marigold varieties is compared, the result proves that the SCAR molecular marker T01.PB37003 is closely linked with the properties of the split petals of the marigold, and the specific molecular marker T01.PB37003 provided by the invention can be used for identifying whether the split petals of the marigold exist.
The invention further provides a detection primer for detecting the SCAR molecular marker T01. PB37003.
In a preferred embodiment, the detection primer consists of an upstream detection primer shown in SEQ ID NO.3 and a downstream detection primer shown in SEQ ID NO. 4.
The detection primer provided by the invention can be used as a primer group for amplifying an SCAR mark and further used for identifying the petal lobe morphology of marigold tongue-shaped flowers, so that the primer group is applied to identifying whether the marigold tongue-shaped flower petals have splits or not within the protection range of the invention.
The invention further provides a PCR detection kit for identifying whether marigold lingua petals have split pieces or not, which comprises: 2 XTaq PCR Mix (containing Taq enzyme, dNTP, Mg) 2+ ) Detecting a primer; the detection primer is designed by taking a SCAR molecular marker T01.PB37003 as a target; preferably, the detection primer consists of an upstream primer with a nucleotide sequence shown as SEQ ID NO.3 and two primers with a nucleotide sequence shown as SEQ ID NO. 4.
The invention further provides an application of the SCAR molecular marker T01.PB37003 in marigold tongue petal breeding, which comprises the following steps:
(1) extracting DNA of a sample to be detected; (2) designing upstream and downstream primers for PCR amplification by using the SCAR molecular marker T01.PB37003 as a target; (3) if the PCR product is a 185bp band or 185pb and 388pb bands, the marigold sample is a cracked tongue petal, wherein the marigold plant capable of amplifying the two bands is a hybrid; if a 388bp electrophoresis strip is obtained, the marigold sample has no crack on the lingulate petals.
As a preferred embodiment of the present invention, the reaction system of the PCR amplification is: 2 xTaq PCR mix12.5 mu L, DNA template 1 mu L, upstream primer 1 mu L, downstream primer 1 mu L, deionized water 9.5 mu L.
As a preferred embodiment of the present invention, the reaction procedure of PCR amplification is: 4min at 94 ℃; 30sec at 94 ℃, 30sec at 57 ℃ and 1min at 72 ℃ for 45s for 35 cycles; 10min at 72 ℃; keeping the temperature at 20 ℃ for 10 min.
In marigold nucleotide sequences with or without split petals, a 203bp insertion sequence exists in a specific SCAR marker T01.PB37003, homozygous DNA amplification products of marigold without split petals are shown as 1 strip of 388bp, and homozygous DNA amplification products of marigold with or without split petals are shown as 1 strip of 185 bp; the amplification product of heterozygous marigold DNA with split petals is represented by two bands of 185bp and 388bp, so the specific SCAR marker T01.PB37003 can also be used for detecting the purity of marigold materials about the genotype of the characters of the petals of the lingua flowers, and the specific SCAR marker T01.PB37003 is applied to the protection scope of the invention in identifying the purity of the characters of the petals of the lingua flowers.
According to the method, through constructing an F2 segregation population of marigold tongue flower petal lobe cracking properties, BSR-seq sequencing and a comparative genomics method, relevance analysis is carried out on a sequencing result, gene sequences of SNP sites which are relatively close to marigold tongue flower petal cracking are screened out, the total number is 319, and 16 pairs of primers are designed aiming at relatively common enzyme cutting sites. As a result, the molecular marker T01.PB37003 can effectively distinguish the existence of the petal crack of marigold, the marigold without petal crack can amplify a 388bp strip, and the marigold amplification product with petal crack of the tongue is 185 bp. The detection efficiency of the molecular marker in F2 segregation population with or without marigold lingua petal splinters reaches 96.12%. The invention aims to obtain the SCAR marker closely linked with the marigold lingua petal lobe character, the method can directly utilize a PCR product to quickly screen the character of existence of marigold lingua petal lobe, initial screening can be carried out in a seedling stage, the breeding period is greatly shortened, the expenditure is saved, and the method has great theoretical and practical significance for cultivating new marigold varieties.
The present invention relates to key term definitions and abbreviations
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices and materials are now described.
The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof, in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, and the like). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as the sequence explicitly specified. In particular, degenerate codon substitutions may be achieved by generating sequences in which the 3 rd position of one or more selected (or all) codons is substituted with mixed base and/or deoxyinosine residues (Batzer et al, Nucleic Acid Res.19:5081 (1991); Ohtsuka et al, J.biol.chem.260: 2605-S2608 (1985); and Cassol et al (1992); Rossolini et al, Mol cell. probes 8:91-98 (1994)).
SCAR: the sequence characterizes the amplified region.
SNP: single nucleotide polymorphisms.
Drawings
FIG. 1 shows the homologous gene positions of marigold on the sunflower genome.
FIG. 2 shows two marigold parents, the left is female parent of 'S5' and the right is male parent of 'JH'.
Fig. 3 is a schematic diagram showing that 'S5' and 'JH' F2 groups of lingulate petals have asexual shapes, and from left to right, petals have no crack, two cracks, three cracks, four cracks and five cracks.
FIG. 4 is a graph of the results of the validation of the specific SCAR molecular marker T01.PB37003 in marigold parents, generation F1 and population F2; 'S5' is female parent (no crack of ligulate petal), 'JH' is male parent (cracked of ligulate petal), 1-10 is tagetes erecta with no crack of ligulate petal in F2 population, 11-20 is tagetes erecta with crack of ligulate petal in F2 population; heterozygous plants are represented by 2 bands in the figure.
Detailed Description
The invention is further described below in conjunction with specific embodiments, the advantages and features of which will become apparent from the description. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.
Example 1 screening and preliminary identification of molecular markers linked to the Presence or absence of petals of marigold flower
1. Construction of marigold ligulate petal lobe cracking character segregation population
In this example, marigold 'S5' with non-split petals of tongue petals is used as a female parent, marigold 'JH' with split petals of tongue petals is used as a male parent, and the female parent and the male parent are hybridized to obtain F1, and F1 is selfed to obtain F2 segregation population.
2. Marigold single-multiple petal population genetic rule analysis
The F2 population with or without marigold ligulate petals split is subjected to character statistics, wherein 591 ligulate petals with splits and 205 ligulate petals without splits are obtained, and the ligulate petals have splits according to chi fang test: the method is characterized in that the crack-free tongue flower petal is 3:1, the Mendelian inheritance law is met, and the single gene is presumed to control the existence of petal cracks of marigold, wherein the crack of the tongue flower petal is dominant, and the crack of the tongue flower petal is recessive.
3. Mixed pool construction and BSR-seq sequencing
Through a stereomicroscope and a paraffin section, the development conditions of the parent 'JH' and 'S5' buds at different periods are respectively observed, the tongue-shaped flower and the tubular flower of the 1mm bud are found not to be differentiated, and the 1mm is determined as the BSR-seq sampling time point. Selecting 17 male parent plants and 17 female parent plants, wherein each plant has 12 1mm flower buds to respectively form a mixed pool of 'JH' and 'S5'; and selecting 17 strains of the F2 generation group with or without tongue flower petal splinters, wherein each strain has 12 1mm flower buds to form a mixed pool of 'F2-JH' and 'F2-S5', and sequencing the sample.
Sequencing was performed using the Illumina NovaSeq 6000 platform, yielding 311.24Mb reads in total. The number of clean reads obtained from each sample after sequencing is in the range of 66109078-90821192, and the sequencing quality is Q3098.75% -98.95%, which indicates that the sequencing base error rate is low and the obtained data is qualified. GC content obtained by sequencing was 42% -43%.
4. Development of molecular marker linked with marigold ligula petal lobe
Comparing the third-generation transcription group data of marigold with a sunflower genome, finding out the homologous gene position of the marigold on the sunflower genome according to the sequence similarity, drawing (a grey dot in figure 1), and screening points with the absolute value of a delta SNP index larger than 0.3 and the sequencing depth sum of each mixed pool reads larger than 50. The comparison shows that the difference genes between marigold pools are mostly converged on the sunflower chromosome 9.
5. SCAR markers developed based on sequence sequencing results
Under the condition of 'screening delta SNP index absolute value is more than 0.3', 319 genes containing SNP loci highly linked with characters are obtained on sunflower chromosome nine. Enzyme cutting sites are searched by SnapseGene software, primers are designed by Primer Premier5.0 software, the sequence of the gene of sunflower nine chromosomes and the sequence of the single plant exchange of 16 effective genes obtained by verification in 60 marigold F2 populations are combined, and the close correlation of T01.PB37003 and marigold tongue flower petal cracking properties is determined. The sequence of T01.PB37003 in the third generation transcriptome of marigold 'S5' is used for designing primers and sequencing, the parent 'S5' with non-cracked tongue petals is found to have a 203bp sequence more than the parent 'JH' with cracked tongue petals, and the SCAR marker is developed again according to the sequence difference of T01.PB37003 in 'S5' and 'JH', and is shown as SEQ ID NO 3 and SEQ ID NO 4. The SCAR marks indicate that after PCR amplification, a strip with one section of 388bp is the marigold without split petals of the tongue flower, and a strip with one section of 388bp or two sections of 388bp and 185bp is the marigold with split petals of the tongue flower.
SCAR marker and PCR amplification system and program
The total PCR reaction system is 25 mu L, and contains 1 mu L of template DNA of 100 ng/mu L and 12.5 mu L of 2 xTaq PCR mix (containing Taq enzyme, dNTP and Mg) 2+ ) 10. mu. mol/L of each of the forward primer and the reverse primer 1. mu. L, ddH 2 O 9.5μL。
The PCR reaction program is pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30S, annealing at 57 ℃ for 30S, extension at 72 ℃ for 1min for 45S, 35 cycles; 10min at 72 ℃; the temperature is kept at 20 ℃ for 10min, and the amplification product is detected by 1% agarose gel electrophoresis.
Test example 1 verification test of properties of split petals of a tongue-shaped flower of 541 parts of marigold F2 population by using SCAR molecular marker T01.PB37003
(1) Taking 4-5 fresh marigold young leaves, extracting genome DNA of the young leaves by adopting a 2 xCTAB method, detecting the quality of the DNA by using 1% agarose gel, and detecting the purity of the DNA by using an ultraviolet spectrophotometer. Then diluting the extracted DNA to 100ng/ul and subpackaging for later use.
(2) Designing upstream and downstream primers by using 541 parts of DNA of a marigold genome to be detected as a template and using a molecular marker T01.PB37003 as a target, wherein the base sequences of the upstream and downstream primers are respectively as follows:
PB37003-F (upstream primer): ATTTCAAGGAACTTTTAGTCACGAG
PB37003-R (downstream primer): ATCCAGGTACAAGTCACATGTCTGT
(3) The PCR reaction system is: DNA template of 100 ng/. mu.L 1. mu.L, 2 XTaq PCR Mix 12.5. mu.L (containing Taq enzyme, dNTP, Mg 2+ ) 1 uL upstream primer and 1 u L, ddH downstream primer 2 O 9.5μL。
(4) The PCR reaction procedure was: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30S, annealing at 56 ℃ for 30S, extension at 72 ℃ for 1min for 45S, 35 cycles; total extension at 72 ℃ for 10 min; keeping the temperature at 20 ℃ for 10 min.
(5) Detecting the amplified product by using 1% agarose gel electrophoresis, wherein if the PCR product can only detect one band of 388bp, the marigold with no split petals is determined, if the PCR product has one band of 185bp or two amplified bands of 185bp and 388bp after the agarose gel detection, the marigold with split petals is determined, and a plant capable of amplifying the two bands is a heterozygote.
The group of 541 marigold F2 was verified by the T01.PB37003 marker, 520 of 541 were matched with the molecular marker (FIG. 4), and 144 of them were exchanged for 14; the split 397 strain, 7 strains which are exchanged, and a total of 21 strains are exchanged individuals; the detection efficiency reaches 96.12 percent.
SEQUENCE LISTING
<110> university of agriculture in Huazhong
<120> SCAR molecular marker for identifying marigold lingua petal lobe, detection primer and application thereof
<130> HB-1004-210208A
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 388
<212> DNA
<213> Tagetes erecta
<400> 1
atttcaagga acttttagtc acgagctttc taaataaccc caagtacgaa taaaccagct 60
gggtttgtgt ctgctacaaa acctataaaa aaactattga tgtgattata tttaacaaca 120
tgaattttaa tgataattat ctgaaatcat aattaactag gtgtaaaccc gtgtggaaac 180
tcgggaagga cattcacaaa tatatgttag atttgtaagt ccgaagtttg tttgtgttac 240
aattgtaata tataacaaat ggtttaaact ttcattaaag tttcattaaa ctttaatgat 300
acaaaagtaa atctcaaaaa tatcatccaa gattagagtt tagacaattg cataattaat 360
gttacagaca tgtgacttgt acctggat 388
<210> 2
<211> 185
<212> DNA
<213> Tagetes erecta
<400> 2
atttcaagga acttttagtc acgagctttc taaataaccc taagtacgaa taaaccagct 60
gggtttgtgt atgctacaaa acctataaaa aaactattga tgtgattata tttaacaaga 120
tgaattttaa tgataattat ctgaaatcat aattaatgtt acagacatgt gacttgtacc 180
tggat 185
<210> 3
<211> 25
<212> DNA
<213> Artifical sequence
<400> 3
atttcaagga acttttagtc acgag 25
<210> 4
<211> 25
<212> DNA
<213> Artifical sequence
<400> 4
atccaggtac aagtcacatg tctgt 25
Claims (6)
1. The SCAR marker T01.PB37003 for identifying the petal lobe character of marigold lingua is shown in SEQ ID NO.1, and the nucleotide sequence of the petal lobe character of marigold lingua is shown in SEQ ID NO. 2.
2. Amplifying a detection primer of the SCAR marker T01.PB37003 of claim 1; the method is characterized in that the detection primer consists of an upstream primer with a nucleotide sequence shown as SEQ ID NO.3 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 4.
3. A PCR detection kit for identifying marigold lingua petal lobe character comprises: taq enzyme, dNTP, Mg 2+ Detecting a primer; wherein the detection primer is the detection primer according to claim 2.
4. The application of the detection primer of claim 2 in the breeding of marigold tongue petal lobe cracking character; the method comprises the following steps: (1) extracting DNA of a sample to be detected; (2) performing PCR amplification using the detection primer of claim 2; (3) if the PCR product is a band of 185bp or two bands of 185pb and 388pb, the marigold sample is marigold with split petals, wherein the marigold sample capable of amplifying the two bands is a heterozygote; if a 388bp electrophoresis strip is obtained, the marigold sample is marigold without split petals.
5. The use according to claim 4, wherein the reaction system for PCR amplification is: 2 XPCR mix12.5 u L, DNA template 1 u L, upstream primer 1 u L, downstream primer 1 u L, deionized water 9.5 u L.
6. The use according to claim 4, wherein the reaction sequence for PCR amplification is: 4min at 94 ℃; 30sec at 94 ℃, 30sec at 57 ℃ and 1min at 72 ℃ for 45s for 35 cycles; 10min at 72 ℃; keeping the temperature at 20 ℃ for 10 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110333103.XA CN112852996B (en) | 2021-03-29 | 2021-03-29 | SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110333103.XA CN112852996B (en) | 2021-03-29 | 2021-03-29 | SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112852996A CN112852996A (en) | 2021-05-28 |
| CN112852996B true CN112852996B (en) | 2022-08-30 |
Family
ID=75993085
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110333103.XA Active CN112852996B (en) | 2021-03-29 | 2021-03-29 | SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112852996B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AR081981A1 (en) * | 2010-06-24 | 2012-10-31 | Basf Plant Science Co Gmbh | PLANTS THAT HAVE BETTER FEATURES RELATED TO PERFORMANCE AND A METHOD FOR PRODUCING |
| CN105695479A (en) * | 2016-03-10 | 2016-06-22 | 北京林业大学 | Symmetry gene CmCYC2c of chrysanthemum morifolium and application of symmetry gene CmCYC2c |
| CN107858447A (en) * | 2017-12-22 | 2018-03-30 | 中国农业科学院郑州果树研究所 | For identifying single nucleotide polymorphism site, primer pair, kit and the application of peach blossom single-lobe/polyphyll character |
-
2021
- 2021-03-29 CN CN202110333103.XA patent/CN112852996B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AR081981A1 (en) * | 2010-06-24 | 2012-10-31 | Basf Plant Science Co Gmbh | PLANTS THAT HAVE BETTER FEATURES RELATED TO PERFORMANCE AND A METHOD FOR PRODUCING |
| CN105695479A (en) * | 2016-03-10 | 2016-06-22 | 北京林业大学 | Symmetry gene CmCYC2c of chrysanthemum morifolium and application of symmetry gene CmCYC2c |
| CN107858447A (en) * | 2017-12-22 | 2018-03-30 | 中国农业科学院郑州果树研究所 | For identifying single nucleotide polymorphism site, primer pair, kit and the application of peach blossom single-lobe/polyphyll character |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112852996A (en) | 2021-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3789506B1 (en) | Prunus mume pendulous trait snp molecular markers and use thereof | |
| US11473096B2 (en) | Method for differentiating cannabis plant cultivars based on cannabinoid synthase paralogs | |
| Yan et al. | Simultaneous identification of multiple causal mutations in rice | |
| EP2791325B1 (en) | Methods and compositions for analyzing ahasl genes in wheat | |
| KR20180077871A (en) | SNP markers for discrimination of Jubilee type or Crimson type watermelon cultivar | |
| Wu et al. | Genome-wide association studies for inflorescence type and remontancy in Hydrangea macrophylla | |
| Fitzgerald et al. | An assessment of heavy ion irradiation mutagenesis for reverse genetics in wheat (Triticum aestivum L.) | |
| Gozukirmizi et al. | Retrotransposon-based molecular markers; tools for variation analysis in plants | |
| CN109234423B (en) | Application of soybean molecular marker and polymorphism thereof in identification of soybean branch number traits | |
| Zhang et al. | Fine mapping of the male fertility restoration gene CaRf032 in Capsicum annuum L. | |
| CN114181950B (en) | Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof | |
| KR100753676B1 (en) | TRIM-Br1 and TRIM-Br2 DNA marker system using the same and classification method using the same | |
| TWI635182B (en) | Molecular marker and application for early determining sexes and sex-related traits of papaya | |
| CN110819732B (en) | Homozygous SNP molecular marker closely linked with plum blossom drooping branch character and detection method and application thereof | |
| CN112921112B (en) | CAPS molecular marker, detection primer and detection kit for identifying marigold petal type | |
| CN112852996B (en) | SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| Lu et al. | Genetic basis of maize kernel protein content revealed by high-density bin mapping using recombinant inbred lines | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| Huang et al. | Microarray expression analysis of the main inflorescence in Brassica napus | |
| CN113151572A (en) | InDel molecular marker closely linked with bitter gourd powdery mildew resistance major QTL Pm3.1 and application thereof | |
| TWI600768B (en) | Molecular marker and application for early determining sexes and sex-related traits of papaya | |
| Hu | Genetic linkage maps: strategies, resources and achievements | |
| CN111304360B (en) | Rice good taste gene REQ2 codominant molecular marker and amplification primer and application thereof | |
| CN114231660B (en) | SNP locus related to thousand grain weight characters of wheat and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |