CN114181950B - Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof - Google Patents
Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof Download PDFInfo
- Publication number
- CN114181950B CN114181950B CN202111673715.XA CN202111673715A CN114181950B CN 114181950 B CN114181950 B CN 114181950B CN 202111673715 A CN202111673715 A CN 202111673715A CN 114181950 B CN114181950 B CN 114181950B
- Authority
- CN
- China
- Prior art keywords
- plum blossom
- petal
- double
- gene
- pmap2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Botany (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Physiology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides a gene for controlling plum blossom single and double valve characters, a molecular marker and application thereof. Through BSA analysis, the difference exists between the sequences of the PmAP2-like genes in the single-petal plum blossom and the double-petal plum blossom, so that the miR172 binding capacity is changed, and finally, the PmAP2-like genes are caused to be differentially expressed in the single-petal flower buds and the double-petal flower buds, and the single-petal/double-petal character of plum blossom hybrid filial generation can be rapidly identified by utilizing the differential expression mode of the PmAP2-like genes in the single-petal plum blossom flower buds and the double-petal plum blossom flower buds and InDel molecular markers related to the number of plum blossom petals, so that the plum blossom flower type can be rapidly and accurately identified in the seedling stage of plum blossom, the breeding period is shortened, and the breeding workload is reduced.
Description
Technical Field
The invention relates to the technical fields of plant genetic engineering and molecular biology, in particular to a gene for controlling plum blossom single and double valve characters, and a molecular marker and application thereof.
Background
Plum blossom (Prunus mu Sieb. Et Zucc.) is a plant of the genus Prunus (Prunus) of the family Rosaceae (Rosaceae), is one of the ten traditional flowers of China, has extremely high ornamental value, originates from the southwest of China, and has a introduction and cultivation history of more than 3000 years from now (Chen Junyu. Chinese plum blossom variety, picture [ M ]. Chinese forestry Press, 2010). Under the long-term natural evolution and artificial breeding, the plum blossom forms a variety with rich colors, fragrance, taste and the like, and simultaneously generates a series of transition types from single petals, multiple petals, heavy petals and the like. The heavy plum blossom variety accounts for more than 90% of the total plum blossom variety, has high ornamental value and plays an important role in landscape architecture.
Zhang Jinbo (Zhang Jinbo. Quincuncial heavy petal F1 mapping population construction and molecular marker preliminary analysis [ D ]]Huazhongnong (Chinese pesticide)University of industry, 2004) construction of 'snow plum' × 'sheet jelly powder' F 1 The population, the possibility of existence of MADS-box genes in plum blossom is preliminarily confirmed by using ISSR and SSR primer extension. CN201711403494.8 discloses that full gene association analysis of single/double-petal traits of 129 peach germplasm with 4063377 SNPs identified, finding SNPs that are significantly associated with peach blossom patterns, and designing specific PCR primer amplification pairs and single base extension primers. In addition, zhang et al utilized 348 plum blossom varieties and mapped plum blossom petal quantitative traits to the 4058003-7693997 interval of plum blossom chromosome 1 by whole genome association analysis (Zhang Q, zhang H, sun L, et al genetic architecture of floral traits in the woody plant Prunus mume [ J ]].Nature Communications,2018,9(1):1702)。
Since many studies have been performed in the past in the presumed section, and there are few reports of the plum blossom double valve, and specific genes or deletion variations are not located, there is a long distance from the target trait, and identification cannot be performed in the early stage of the filial generation. Researching the gene function related to the plum blossom heavy valve character, screening the closely linked molecular marker, and providing an important foundation for molecular auxiliary breeding.
Disclosure of Invention
The invention aims to provide a gene for controlling plum blossom double valve character and application thereof.
The invention also aims to provide a molecular marker related to plum blossom single and double valve characters and application thereof.
To achieve the object of the present invention, in a first aspect, the present invention provides a gene controlling the plum blossom heavy valve trait, which is a gene encoding the following protein (a) or (b):
(a) A protein consisting of the amino acid sequence shown in SEQ ID NO. 2; or (b)
(b) And (b) a protein which is derived from (a) and has equivalent functions and is obtained by substituting, deleting or adding one or more amino acids in the sequence shown in SEQ ID NO. 2.
The nucleotide sequence of the gene for controlling the plum blossom double valve character is as follows:
i) A nucleotide sequence shown as SEQ ID NO. 4; or (b)
ii) the nucleotide sequence shown in SEQ ID No. 4 is substituted, deleted and/or added with one or more nucleotides and expresses the same functional protein.
In a second aspect, the invention provides a biological material comprising said gene, characterized in that said biological material comprises, but is not limited to, recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineering bacteria or transgenic cell lines.
In a third aspect, the invention provides any one of the following applications of the gene or of a biological material containing the gene:
(1) Is used for regulating and controlling the plum blossom heavy valve character;
(2) Is used for plum blossom genetic breeding;
(3) Used for preparing transgenic plants.
Methods of breeding include, but are not limited to, transgenesis, crosses, backcrosses, selfing, or asexual propagation.
In a fourth aspect, the invention provides a molecular marker related to single-petal and double-petal properties of plum blossom, which is an InDel marker and is positioned at 1261-1309 bp of a sequence shown in SEQ ID NO. 3 of a plum blossom PmAP2-like gene;
when the 1261-1309 bp is ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG, the single valve character corresponds to plum blossom; when the 1261-1309 bp does not contain ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG, the plum blossom heavy valve character is corresponding.
In a fifth aspect, the invention provides primers for amplifying the InDel marker, comprising an upstream primer as shown in SEQ ID NO. 11 and a downstream primer as shown in SEQ ID NO. 12.
In a sixth aspect, the invention provides a reagent or a kit for detecting single-petal and double-petal characters of plum blossom, which comprises primers shown in SEQ ID NO. 11-12.
In a seventh aspect, the invention provides any one of the following uses of the molecular marker, the primer or the detection reagent or kit:
1) The method is used for identifying the single-petal and double-petal characteristics of the plum blossom;
2) The method is used for early prediction of single petals and heavy petals of the plum blossom;
3) The method is used for plum blossom molecular marker assisted breeding;
4) Is used for the plum blossom PmAP2-like genotyping.
Wherein, the nucleotide sequence of the plum blossom PmAP2-like gene is as follows:
i) A nucleotide sequence shown in SEQ ID NO. 3; or (b)
ii) the nucleotide sequence shown in SEQ ID No. 3 is substituted, deleted and/or added with one or more nucleotides and expresses the same functional protein.
In an eighth aspect, the invention provides a method for identifying single-petal and double-petal traits of plum blossom, comprising the following steps:
1) Extracting total RNA of plum blossom to be detected, and synthesizing cDNA by reverse transcription;
2) Using cDNA as a template, and performing PCR amplification by using primers shown in SEQ ID NO. 5-6 or SEQ ID NO. 7-8;
3) Analyzing the amplified product: if the amplified product contains a specific sequence 5'-ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG-3', the plum blossom to be detected is of a single-petal character, and if the amplified product does not contain the specific sequence, the plum blossom to be detected is of a double-petal character.
By means of the technical scheme, the invention has at least the following advantages and beneficial effects:
the single-petal/double-petal plum blossom of the PmAP2-like gene has sequence difference, so that the PmAP2-like gene, the corresponding amplification primer and the InDel molecular marker and the detection primer thereof can be used for identifying the single-petal/double-petal character of a hybridization group, the single-petal/double-petal plum blossom can be rapidly and accurately identified in the seedling stage of the plum blossom, the breeding period is shortened, the breeding workload is greatly reduced, a foundation is laid for accelerating the screening and breeding of plum blossom patterns, and the method has guiding significance for the plum blossom strain breeding of landscaping.
And (II) the differential expression condition of the PmAP2-like gene in different flower types can rapidly distinguish single-petal/double-petal plum blossom by utilizing the relative expression quantity of the PmAP2-like gene, thereby providing a theoretical basis for rapid breeding of plum blossom.
And thirdly, the detection primer of the InDel molecular marker related to the single-petal/double-petal character of the plum blossom is utilized to identify the single-petal/double-petal character of the plum blossom, and the identification of the single-petal/double-petal character has higher accuracy, so that the rapid early identification of the plum blossom type can be realized.
Drawings
FIG. 1 is a Manhattan chart of BSA analysis in a preferred embodiment of the invention.
FIG. 2 shows the CDS sequence alignment of the plum blossom PmAP2-like gene in the preferred embodiment of the invention.
FIG. 3 shows the result of alignment of the protein sequences of the quincuncial PmAP2-like gene in the preferred embodiment of the invention.
FIG. 4 shows the prediction of the miRNA172 target site in the quincuncial PmAP2-like gene according to the preferred embodiment of the invention.
FIG. 5 shows the comparison result of miRNA172 target site in plum blossom PmAP2-like gene in the preferred embodiment of the invention.
FIG. 6 shows the relative expression levels of the plum blossom PmAP2-like gene in different flower types according to the preferred embodiment of the present invention.
FIG. 7 shows the sequence alignment of the deletion segment of the plum blossom PmAP2-like gene in the preferred embodiment of the invention.
Detailed Description
In order to solve the problems of long screening period, low efficiency and the like of plum blossom double valve character varieties in the prior art, the invention provides a molecular marker related to plum blossom single valve/double valve characters and a molecular detection method for rapidly identifying single valve/double valve characters by utilizing SNP molecular markers generated by plum blossom AP2/ERF transcription factor deletion.
The invention adopts the following technical scheme:
the invention provides a plum blossom PmAP2-like protein sequence, which specifically comprises any one of the following amino acid sequences (1) - (3):
(1) an amino acid sequence shown as SEQ ID NO. 1;
(2) SEQ ID NO. 1 amino acid sequence obtained by deletion of a plurality of amino acids;
(3) the amino acid sequence is shown as SEQ ID NO. 2.
Through sequence comparison, the sequence of the PmAP2-like protein in the single-petal plum blossom and the double-petal plum blossom is found to be different, and the difference of the protein is presumed to lead to the formation of single-petal/double-petal character of the plum blossom.
The invention also provides a gene for encoding the plum blossom PmAP2-like protein.
Specifically, the gene for encoding the plum blossom PmAP2-like protein has any one of the following nucleotide sequences A-B:
A. a nucleotide sequence shown as SEQ ID NO. 3;
B. the nucleotide sequence shown in SEQ ID NO. 4 is obtained by deleting 49 bp.
According to the invention, through sequence comparison, the PmAP2-like gene in single-petal and double-petal plum blossom has a 49bp deletion difference, and the sequence difference can cause miRNA172 to regulate and control the expression of the PmAP2-like gene, so that the single-petal/double-petal character of plum blossom is formed.
It is understood that, according to the principle of codon degeneracy, a person skilled in the art can design different gene sequences encoding the plum blossom PmAP2-like protein according to the codon preference of different species, and all genes capable of encoding the plum blossom PmAP2-like protein are within the protection scope of the present invention.
The invention also provides a biological material comprising a gene encoding the plum blossom PmAP2-like protein, wherein the biological material comprises an expression cassette, a vector, a host cell, an engineering bacterium or a transgenic plant cell line.
Such vectors include, but are not limited to, cloning vectors, expression vectors, plasmid vectors, all of which comprise a gene encoding the plum blossom PmAP2-like protein, and are within the scope of the present invention.
The host cell or engineering bacteria can be cells derived from microorganisms, plants or animals, and all host cells or engineering bacteria containing genes for encoding the plum blossom PmAP2-like protein are within the protection scope of the invention.
Furthermore, the invention also provides a specific amplification primer of the gene for encoding the plum blossom PmAP2-like protein, which has a sequence shown as SEQ ID NO. 5-6 or a sequence shown as SEQ ID NO. 7-8.
On the other hand, the invention also provides an InDel molecular marker related to the plum blossom single-valve/double-valve character, which is positioned in a plum blossom PmAP2-like gene deletion section.
The invention also provides specific PCR primers for amplifying the molecular markers.
The location of the deletion segment of the PmAP2-like gene of plum blossom is at 60366776 ～ 60366774bp of chromosome 1 of plum blossom with genome version Prunus mume Genome v 1.0.0 (http:// prunesmegmenoome. Bjfu. Edu. Cn /).
Furthermore, the invention also provides a detection primer of the InDel molecular marker, which has a sequence shown as SEQ ID NO. 11-12.
Experiments prove that the difference exists between the sequences of the PmAP2-like genes in the single-petal plum blossom and the double-petal plum blossom, so that the miR172 binding capacity is changed, and finally, the expression quantity difference of the PmAP2-like genes in the single-petal flower buds and the double-petal flower buds is caused, and the single-petal/double-petal character of plum blossom hybrid progeny can be rapidly identified by utilizing the differential expression mode of the PmAP2-like genes in the single-petal plum blossom flower buds and the double-petal plum blossom flower buds.
In another aspect, the invention provides any one of the following applications encoding the PmAP2-like protein sequence and nucleic acid sequence:
(1) The application in regulating and controlling the single-petal/double-petal character of plum blossom;
(2) The application in plum blossom genetic breeding.
Experiments prove that the InDel molecular marker related to the number of plum blossom petals can be used for identifying single-petal/double-petal plum blossom, and has higher accuracy.
In another aspect, the present invention provides the use of any one of the following genes encoding the PmAP2-like protein or its specific amplification primers or the SNP molecular markers or their detection primers:
(1) Application in single-petal/double-petal character identification of plum blossom;
(2) The application in the identification of the seedling stage of the plum blossom hybridization offspring.
Specifically, the application includes: detecting the regulation and control condition of the PmAP2-like gene in the plum blossom to be detected in the flower development process, and identifying the single-valve/double-valve character of the plum blossom according to the differential expression condition of the PmAP2-like gene in different flower types.
Alternatively, the application includes: and detecting genotypes of the InDel molecular markers related to the quantity of plum blossom petals by taking the plum blossom genome DNA as a template, and identifying the plum blossom single-petal/double-petal character.
The invention provides a method for identifying plum blossom single-valve/double-valve characters, which is used as one of parallel technical schemes, and comprises the following steps: extracting RNA of plum blossom bud to be detected, analyzing differential expression condition of encoding PmAP2-like protein in different flower type plum blossom, and judging single-petal/double-petal character of plum blossom to be detected.
As a second aspect of the parallel technique, the authentication method includes: and taking genomic DNA of the plum blossom to be detected as a template, adopting the detection primer of the InDel molecular marker related to the single-valve/double-valve character of the plum blossom to carry out PCR amplification, analyzing the sequence of a PCR amplification product, and judging the genotype of the plum blossom to be detected.
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or in accordance with the manufacturer's instructions.
Example 1 mining plum blossom double valve related SNP molecular markers based on BSA analysis
1. Experimental materials
The test material is F obtained by hybridization of 'Mi Dan Lu' plum as female parent and 'Bai Xu Zhu' as male parent 1 Isolating the population. The parent has obvious difference in the number of petals, the female parent is a single-petal variety, the number of petals is 5, the male parent is a heavy-petal variety, and the average number of petals is 24.1. And measuring 105 offspring strains according to the target characters in the full bloom stage, wherein the number of petals is 5 and is a single petal, and the number of petals is more than 15 and is a heavy petal. All materials were planted in plum blossom valley plot in the Liyu forest farm in Fujian province.
2. Mixed population separation (BSA) whole genome resequencing
Selecting F 1 41 single-petal character filial generation and 64 heavy-petal character filial generation in population, and equivalent amount after DNA extractionAnd mixing to respectively construct single-valve gene pools and double-valve gene pools. The gene pool DNA is randomly broken into short DNA fragments by enzyme, and blunt end repair is carried out. The dA tail was then ligated at both ends of the DNA fragment and sequencing adaptors were ligated. The DNA fragment added with the linker is purified by AMPure XP magnetic beads, and fragments in the range of 300-400bp are selected for PCR amplification. The built library was subjected to purification, library inspection and sequencing on the Hiseq X10 PE150 machine.
3. BSA analysis based on ED method
The Euclidean distance (Euclidean Distance, ED) algorithm is one of the methods for using sequencing data to find the presence of significant difference markers between pools and thereby evaluate regions associated with traits. Theoretically, the allele frequencies of other sites tend to be consistent except for the difference between the allele frequencies of the sites related to the target property between two mixed pools constructed by the BSA project, so the ED value of the non-target site should tend to be 0. The calculation formula of the ED method is shown below, and the larger the ED value is, the larger the difference between the two mixing pools is. The results of BSA analysis by ED are shown in FIG. 1.
Through BSA analysis, a significant interval obtained by screening according to 99% fraction is on chromosome 1, wherein the significant interval contains an AP2/ERF transcription factor, and the significant interval relates to regulation and control of the characteristics of the round 1 calyx, and also controls the formation of petals of round 2 together with class B genes AP3 and PI (PISTILLATA), so that the significant interval accords with the characteristics of petal characters.
EXAMPLE 2 BSA localization interval PmAP2-like Gene cloning and analysis
F obtained by hybridization of plum blossom single-petal variety 'six-petal', heavy-petal variety 'powder table vertical branch', 'Longzu', 'Mi single-green' plum as female parent and 'Bai-xu' as male parent 1 The total RNA extraction of one single-petal offspring and one double-petal offspring in the segregating group is randomly selected according to the plant total RNA extraction kit instruction of Tiangen biochemical technology (Beijing) limited company.
The total RNA is reversely transcribed into cDNA by a kit, and the cDNA is used as a template to carry out PCR cloning on the ORF of the PmAP2-like gene. The reaction system was 100 to 150ng,PrimeSTAR HS (Premix) 25. Mu.L of template (cDNA), 0.3. Mu.M of upstream primer (SEQ ID NO: 5), 0.3. Mu.M of downstream primer (SEQ ID NO: 6), orThe upstream primer (SEQ ID NO: 7) was 0.3. Mu.M, and the downstream primer (SEQ ID NO: 8) was 0.3. Mu.M, ddH 2 O was made up to 50. Mu.L. Reaction conditions: 98 ℃ for 2min;98℃10s,56℃15s,72℃60s (35 cycles); 72 ℃ for 5min; preserving at 4 ℃.
The target band is recovered through gel electrophoresis, connected, converted and sequenced to obtain the target sequence. Sequence comparison of PmAP2-like gene ORF is carried out by combining DNAMAN software, and 49bp deletion is found in the double-valve plum blossom material compared with the single-valve plum blossom material (figure 2). Meanwhile, the protein structure analysis of the PmAP2-like gene shows that the protein structure of the PmAP2-like gene is changed due to the 49bp deletion (figure 3).
And a regRNA 2.0 online tool is used for predicting a transcription regulation motif and a miRNA binding site, and the miRNA target site prediction result shows that a target site of miR172 exists in the PmAP2-like gene, so that the PmAP2-like gene can be regulated and controlled by the miR 172. Since the deletion of 49bp causes the difference of the combination of the PmAP2-like gene and miR172 in the single-valve material and the double-valve material (figure 4), the target site sequence in the single-valve plant material PmAP2-like is only 2 bases different from the complementary sequence of miR172, the complementary sequence of the double-valve material PmAP2-like and miR172 is 4 bases different, the expression level of the PmAP2-like is presumed to be regulated by miR172, and the difference of the expression amount can exist in the single-valve material and the double-valve material (figure 5).
Example 3 analysis of PmAP2-like Gene expression level in plum blossom buds
1. Sample collection
F obtained by hybridization with 'Mi Dan Lu' plum as female parent and 'Bai Xu Zhu' as male parent 1 And randomly selecting 9 single-petal offspring and 9 heavy-petal offspring flower buds in the segregating population respectively. Sampling time is 9:00 a.m. to 11:00 a.m., each 3 strains are mixed, and 3 biological replicates are set.
2. PmAP2-like gene expression analysis
The plum blossom total RNA extraction is carried out by using an RNAsimple total RNA extraction kit of Tiangen biochemical technology (Beijing) limited company, and the extraction method is carried out by referring to the kit instruction. cDNA Synthesis and real-time fluorescence quantitative PCR PrimeScript, by Takara Bio Inc TM II 1st Strand cDNA Synthesis Kit and TB
Premix Ex Taq TM (Tli RNaseH Plus) kit, test is performed with reference to kit instructions.
A relative quantitative test is carried out on the PmAP2-like gene by a qPCR method, and a qPCR detection primer is shown as SEQ ID NO. 9-10. The result shows that the expression level of the PmAP2-like gene in the single-petal progeny flower buds is lower than that of the double-petal progeny flower buds, and the expression level of the double-petal progeny flower buds is higher than that of the single-petal flower buds, and the expression of the PmAP2-like gene in the single-petal flower buds is inhibited presumably because the capacity of miR172 combined with the PmAP2-like gene is reduced due to the deletion of 49 bp.
The relative expression amounts of the plum blossom PmAP2-like gene in different flower types are shown in figure 6.
EXAMPLE 4 cloning and analysis of PmAP2-like Gene deletion segment in hybrid populations
According to the deletion position sequence of the plum blossom PmAP2-like gene, a Primer Premier 5.0 software is used for designing a marker specific Primer, wherein the forward Primer is ATGAGAGGACGTTGCATTTCAC, and the reverse Primer is AAAGAATCTGAAGACCACCGT.
Selecting F 1 The method comprises the steps of extracting young leaf DNA from 41 single-leaf character filial generations and 64 heavy-leaf character filial generations in a population according to a plant genome DNA extraction kit instruction of Tiangen biochemical technology (Beijing) limited company, and respectively constructing a single-leaf gene pool and a heavy-leaf gene pool by mixing the extracted DNA in equal quantity.
PCR cloning of the deletion segment of the PmAP2-like gene is carried out by taking the genomic DNA as a template. The reaction system was 100 to 150ng,PrimeSTAR HS (Premix) 25. Mu.L of template (genomic DNA), 0.3. Mu.M of upstream primer (SEQ ID NO: 11), 0.3. Mu.M of downstream primer (SEQ ID NO: 12), ddH 2 O was made up to 50. Mu.L. Reaction conditions: 98 ℃ for 2min;98℃10s,56℃15s,72℃60s (35 cycles); 72 ℃ for 5min; preserving at 4 ℃.
The target band is recovered through gel electrophoresis, connected, converted and sequenced to obtain the target sequence. By combining DNAMAN software to carry out sequence comparison on the PmAP2-like gene deletion section, the fact that 49bp deletion exists in the heavy plum blossom filial generation compared with the single plum blossom gene pool is found, namely 49bp deletion appears from 158 th position of the sequence shown in figure 7. Therefore, the primer sequence can be used for early identification of single petals/double petals of plum blossom in a hybridization group.
Example 5 application of PmAPp 2-like Gene deletion position in plum blossom variety
According to the deletion position sequence of the plum blossom PmAP2-like gene, a Primer Premier 5.0 software is used for designing a marker specific Primer, wherein the forward Primer is ATGAGAGGACGTTGCATTTCAC, and the reverse Primer is AAAGAATCTGAAGACCACCGT.
10 single-petal plum blossom varieties and 10 double-petal plum blossom varieties are randomly selected, young leaf DNA extraction is carried out according to a plant genome DNA extraction kit instruction book of Tiangen biochemical technology (Beijing) limited company, and after DNA extraction, equal amounts of the extracted DNA are mixed to respectively construct a single-petal gene pool and a double-petal gene pool.
PCR cloning of the deletion segment of the PmAP2-like gene is carried out by taking the genomic DNA as a template. The reaction system was 100 to 150ng,PrimeSTAR HS (Premix) 25. Mu.L of template (genomic DNA), 0.3. Mu.M of upstream primer (SEQ ID NO: 11), 0.3. Mu.M of downstream primer (SEQ ID NO: 12), ddH 2 O was made up to 50. Mu.L. Reaction conditions: 98 ℃ for 2min;98℃10s,56℃15s,72℃60s (35 cycles); 72 ℃ for 5min; preserving at 4 ℃.
The target band is recovered through gel electrophoresis, connected, converted and sequenced to obtain the target sequence. By combining DNAMAN software to perform sequence comparison on the PmAP2-like gene deletion section, the fact that 49bp deletion exists in the heavy plum blossom variety gene pool compared with the single plum blossom variety gene pool is found, namely 49bp deletion appears from 158 th position of the sequence shown in figure 7. Therefore, the primer sequence can be used for early identification of single-valve/double-valve plum blossom varieties, and can be used as a molecular marker for single-valve/double-valve plum blossom auxiliary breeding.
In conclusion, the molecular biological method for rapidly identifying the single-valve/double-valve of the plum blossom is established, and the molecular markers related to the single-valve/double-valve characters and the InDel molecular markers generated by the deletion of the plum blossom AP2/ERF transcription factors can rapidly identify the single-valve/double-valve characters to realize early seedling stage selection, so that the workload is reduced, the breeding process of the plum blossom is accelerated, and theoretical basis is laid for plum blossom seed selection, breeding and early identification.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Beijing university of forestry
<120> gene for controlling plum blossom single and double valve character, molecular marker and application thereof
<130> KHP211124812.2
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 479
<212> PRT
<213> plum blossom (Prunus name)
<400> 1
Met Leu Asp Leu Asn Leu Asn Val Val Gly Ser Asp Pro Asn Asp Val
1 5 10 15
Glu Ser Cys Gly Thr Gln Met Asp Glu Ser Gly Thr Ser Asn Ser Ser
20 25 30
Val Val Asn Ala Asp Ala Ser Ser Thr Asn Asp Asp Ser Cys Ser Thr
35 40 45
Arg Ala Ala Arg Tyr Asp Ala Val Thr Thr Phe Asn Phe Asp Ile Leu
50 55 60
Lys Val Arg Gly Gly Glu Asp Glu Glu Asp Asp Val Val Val Thr Lys
65 70 75 80
Glu Leu Phe Pro Val Thr Gly Ala Leu Ser Asn Trp Pro Gly Gln Gly
85 90 95
Gln Ser Ser Ala Ser Ser Ser Leu Val Arg Lys Asn Leu Met Glu Leu
100 105 110
Gly Phe Asp His Gly Gly Ser Gly Glu Val Arg Leu Val Gln Gln Lys
115 120 125
Gln Gln Gln Pro Ala Ala Pro Pro Pro Gln Gln Gln Gln Val Lys Lys
130 135 140
Ser Arg Arg Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr
145 150 155 160
Phe Tyr Arg Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly
165 170 175
Lys Gln Val Tyr Leu Gly Gly Phe Asp Thr Ala His Ala Ala Ala Arg
180 185 190
Ala Tyr Asp Arg Ala Ala Ile Lys Phe Arg Gly Val Asp Ala Asp Ile
195 200 205
Asn Tyr Asn Leu Ser Asp Tyr Glu Glu Asp Leu Lys Gln Met Lys Asn
210 215 220
Leu Thr Lys Glu Glu Phe Val His Ile Leu Arg Arg Gln Ser Thr Gly
225 230 235 240
Phe Ser Arg Gly Ser Ser Arg Tyr Arg Gly Val Thr Leu His Lys Cys
245 250 255
Gly Arg Trp Glu Ala Arg Met Gly Gln Phe Leu Gly Lys Lys Tyr Ile
260 265 270
Tyr Leu Gly Leu Phe Asp Ser Glu Val Glu Ala Ala Arg Ala Tyr Asp
275 280 285
Lys Ala Ala Ile Lys Cys Asn Gly Arg Glu Ala Val Thr Asn Phe Glu
290 295 300
Pro Ser Thr Tyr Glu Gly Glu Met Ile Ser Glu Ala Gly Asn Glu Asp
305 310 315 320
Gly Asp His Asn Leu Asp Leu Asn Leu Gly Ile Ser Pro Pro Ser Phe
325 330 335
Gly Asn Cys Gln Lys Glu Val Glu Gly His Leu Gln Phe His Ser Gly
340 345 350
Pro Tyr Asp Gly His Asn Gly Lys Arg Met Glu His Asn Val Asn Ala
355 360 365
Thr Met Ser Asp Pro Pro Phe Lys Gly Leu Val Met Thr Ser Gln His
370 375 380
Pro Pro Leu Trp Asn Gly Val Tyr Pro Ser Tyr Phe Ser Asn Gln Glu
385 390 395 400
Arg Ala Thr Glu Lys Arg Ile Ala Leu Gly Ser Gln Gly Pro Pro Asn
405 410 415
Trp Ala Trp Gln Met His Gly Gln Val Ser Ala Thr Pro Met Pro Leu
420 425 430
Phe Ser Thr Ala Ala Ser Ser Gly Phe Ser Phe Ser Ala Thr Ala Pro
435 440 445
Ser Ala Ala Val His Pro Leu Gln Pro Ser Thr Pro Thr Ala Leu Asn
450 455 460
Leu Cys Phe Thr Ser Pro Ala Thr Ala Ala Ala Asn Thr Ser Gln
465 470 475
<210> 2
<211> 474
<212> PRT
<213> plum blossom (Prunus name)
<400> 2
Met Leu Asp Leu Asn Leu Asn Val Val Gly Ser Asp Pro Asn Asp Val
1 5 10 15
Glu Ser Cys Gly Thr Gln Met Asp Glu Ser Gly Thr Ser Asn Ser Ser
20 25 30
Val Val Asn Ala Asp Ala Ser Ser Thr Asn Asp Asp Ser Cys Ser Thr
35 40 45
Arg Ala Ala Arg Tyr Asp Ala Val Thr Thr Phe Asn Phe Asp Ile Leu
50 55 60
Lys Val Arg Gly Gly Glu Asp Glu Glu Asp Asp Val Val Val Thr Lys
65 70 75 80
Glu Leu Phe Pro Val Thr Gly Ala Leu Ser Asn Trp Pro Gly Gln Gly
85 90 95
Gln Ser Ser Ala Ser Ser Ser Leu Val Arg Lys Asn Leu Met Glu Leu
100 105 110
Gly Phe Asp His Gly Gly Ser Gly Glu Val Arg Leu Val Gln Gln Lys
115 120 125
Gln Gln Gln Pro Ala Ala Pro Pro Pro Gln Gln Gln Gln Val Lys Lys
130 135 140
Ser Arg Arg Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr
145 150 155 160
Phe Tyr Arg Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly
165 170 175
Lys Gln Val Tyr Leu Gly Gly Phe Asp Thr Ala His Ala Ala Ala Arg
180 185 190
Ala Tyr Asp Arg Ala Ala Ile Lys Phe Arg Gly Val Asp Ala Asp Ile
195 200 205
Asn Tyr Asn Leu Ser Asp Tyr Glu Glu Asp Leu Lys Gln Met Lys Asn
210 215 220
Leu Thr Lys Glu Glu Phe Val His Ile Leu Arg Arg Gln Ser Thr Gly
225 230 235 240
Phe Ser Arg Gly Ser Ser Arg Tyr Arg Gly Val Thr Leu His Lys Cys
245 250 255
Gly Arg Trp Glu Ala Arg Met Gly Gln Phe Leu Gly Lys Lys Tyr Ile
260 265 270
Tyr Leu Gly Leu Phe Asp Ser Glu Val Glu Ala Ala Arg Ala Tyr Asp
275 280 285
Lys Ala Ala Ile Lys Cys Asn Gly Arg Glu Ala Val Thr Asn Phe Glu
290 295 300
Pro Ser Thr Tyr Glu Gly Glu Met Ile Ser Glu Ala Gly Asn Glu Asp
305 310 315 320
Gly Asp His Asn Leu Asp Leu Asn Leu Gly Ile Ser Pro Pro Ser Phe
325 330 335
Gly Asn Cys Gln Lys Glu Val Glu Gly His Leu Gln Phe His Ser Gly
340 345 350
Pro Tyr Asp Gly His Asn Gly Lys Arg Met Glu His Asn Val Asn Ala
355 360 365
Thr Met Ser Asp Pro Pro Phe Lys Gly Leu Val Met Thr Ser Gln His
370 375 380
Pro Pro Leu Trp Asn Gly Val Tyr Pro Ser Tyr Phe Ser Asn Gln Glu
385 390 395 400
Arg Ala Thr Glu Lys Arg Ile Ala Leu Gly Ser Gln Gly Pro Pro Asn
405 410 415
Trp Ala Trp Gln His His Gln Asp Ser His Phe Gln Leu Pro Leu Pro
420 425 430
Pro Leu Leu Ser Thr Pro Cys Asn Pro Gln Pro Gln Gln Pro Ser Ile
435 440 445
Ser Val Leu Leu Arg Gln Pro Arg Leu Pro Pro Ile Leu Leu Asn Ser
450 455 460
Arg Val Ser Pro Arg Glu Gly Arg Thr Ala
465 470
<210> 3
<211> 1440
<212> DNA
<213> plum blossom (Prunus name)
<400> 3
atgctggatc ttaatctgaa cgtcgtcggt tctgacccaa acgacgtcga gtcatgtggc 60
acccaaatgg acgagtcggg gacgtcgaac tcgtccgtgg tcaatgccga cgcatccagc 120
accaacgacg actcgtgctc cacacgcgcc gccagatacg acgccgtcac gaccttcaac 180
ttcgatattc tcaaggtcag gggcggagaa gatgaagaag acgatgtcgt cgtgactaag 240
gagctgttcc cggtcaccgg ggccctgagc aattggcccg gccaggggca gtcgtcagcg 300
tcgtcgtctt tggtgaggaa gaacttgatg gagcttgggt tcgatcatgg cgggtccgga 360
gaggtcaggt tggttcaaca gaaacaacag caaccagccg caccgccacc acagcaacag 420
caggtgaaga agagcagaag agggccgagg tctcggagct ctcagtatag aggggtcacc 480
ttctatagaa gaactggtag atgggaatct catatttggg attgcgggaa acaagtgtat 540
ttgggtggat ttgacactgc tcatgctgcg gctagagcct acgatcgagc tgctattaag 600
ttcagaggag ttgatgctga tatcaattac aacctcagtg attatgagga ggatttgaaa 660
cagatgaaga atttgaccaa ggaagaattt gtgcacatac tacggaggca gagcactggt 720
ttctcgaggg ggagctcgag atatagaggg gttacgctgc acaaatgtgg ccgatgggaa 780
gctcgaatgg ggcagttcct tggcaaaaag tatatatatc ttgggctatt cgacagtgaa 840
gtagaagctg caagggctta tgacaaggca gcaatcaaat gtaatggaag ggaagcagtc 900
accaactttg agccaagcac atatgaaggg gagatgatat ctgaggctgg taatgaagat 960
ggcgatcaca atcttgatct gaatttgggg atatctcccc cttcatttgg caattgtcaa 1020
aaggaagtcg aggggcatct tcaattccat tccggccctt atgatgggca caatggaaag 1080
aggatggagc acaatgtaaa tgcaacgatg agcgatccac ctttcaaagg gctagtaatg 1140
acatcacagc acccaccatt gtggaatggt gtatatccta gttacttttc caatcaggaa 1200
agagcaacag agaagagaat tgcattagga tctcaaggac cccccaactg ggcttggcaa 1260
atgcatggcc aggtcagtgc taccccaatg ccactgttct ctactgcagc atcatcagga 1320
ttctcatttt cagctaccgc tccctccgct gctgtccacc ccttgcaacc ctcaacccca 1380
acagccctca atctctgttt tacttcgcca gccacggctg ccgccaatac ttctcaatag 1440
<210> 4
<211> 1425
<212> DNA
<213> plum blossom (Prunus name)
<400> 4
atgctggatc ttaatctgaa cgtcgtcggt tctgacccaa acgacgtcga gtcatgtggc 60
acccaaatgg acgagtcggg gacgtcgaac tcgtccgtgg tcaatgccga cgcatccagc 120
accaacgacg actcgtgctc cacacgcgcc gccagatacg acgccgtcac gaccttcaac 180
ttcgatattc tcaaggtcag gggcggagaa gatgaagaag acgatgtcgt cgtgactaag 240
gagctgttcc cggtcaccgg ggccctgagc aattggcccg gccaggggca gtcgtcagcg 300
tcgtcgtctt tggtgaggaa gaacttgatg gagcttgggt tcgatcatgg cgggtccgga 360
gaggtcaggt tggttcaaca gaaacaacag caaccagccg caccgccacc acagcaacag 420
caggtgaaga agagcagaag agggccgagg tctcggagct ctcagtatag aggggtcacc 480
ttctatagaa gaactggtag atgggaatct catatttggg attgcgggaa acaagtgtat 540
ttgggtggat ttgacactgc tcatgctgcg gctagagcct acgatcgagc tgctattaag 600
ttcagaggag ttgatgctga tatcaattac aacctcagtg attatgagga ggatttgaaa 660
cagatgaaga atttgaccaa ggaagaattt gtgcacatac tacggaggca gagcactggt 720
ttctcgaggg ggagctcgag atatagaggg gttacgctgc acaaatgtgg ccgatgggaa 780
gctcgaatgg ggcagttcct tggcaaaaag tatatatatc ttgggctatt cgacagtgaa 840
gtagaagctg caagggctta tgacaaggca gcaatcaaat gtaatggaag ggaagcagtc 900
accaactttg agccaagcac atatgaaggg gagatgatat ctgaggctgg taatgaagat 960
ggcgatcaca atcttgatct gaatttgggg atatctcccc cttcatttgg caattgtcaa 1020
aaggaagtcg aggggcatct tcaattccat tccggccctt atgatgggca caatggaaag 1080
aggatggagc acaatgtaaa tgcaacgatg agcgatccac ctttcaaagg gctagtaatg 1140
acatcacagc acccaccatt gtggaatggt gtatatccta gttacttttc caatcaggaa 1200
agagcaacag agaagagaat tgcattagga tctcaaggac cccccaactg ggcttggcaa 1260
catcatcagg attctcattt tcagctaccg ctccctccgc tgctgtccac cccttgcaac 1320
cctcaacccc aacagccctc aatctctgtt ttacttcgcc agccacggct gccgccaata 1380
cttctcaata gtagagtatc accgagggaa ggccgcacgg cctaa 1425
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
atgctggatc ttaatctgaa cg 22
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
ctattgagaa gtattggcgg c 21
<210> 7
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atgctggatc ttaatctgaa cgtcg 25
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
ttaggccgtg cggccttc 18
<210> 9
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
ctgaggctgg taatgaagat gg 22
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
taagggccgg aatggaattg 20
<210> 11
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
atgagaggac gttgcatttc ac 22
<210> 12
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
aaagaatctg aagaccaccg t 21
Claims (3)
1. The molecular marker related to the single-petal and double-petal characteristics of plum blossom is characterized in that the molecular marker is an InDel marker and is positioned at 1261-1309 bp of a sequence shown in SEQ ID NO. 3 of a plum blossom PmAP2-like gene;
when the 1261-1309 bp is ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTT CTCTACTGCAG, the single valve character corresponds to plum blossom; when the 1261-1309 bp does not contain ATGCATGGCCA GGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG, the plum blossom heavy valve character is corresponding.
2. The use of any one of the molecular markers of claim 1:
1) The method is used for identifying the single-petal and double-petal characteristics of the plum blossom;
2) The method is used for early prediction of single petals and heavy petals of the plum blossom;
3) The method is used for plum blossom molecular marker assisted breeding;
4) The method is used for plum blossom PmAP2-like genotyping;
wherein the nucleotide sequence of the plum blossom PmAP2-like gene is shown as SEQ ID NO. 3.
3. The identification method of the single-petal and double-petal characteristics of the plum blossom is characterized by comprising the following steps of:
1) Extracting total RNA of plum blossom to be detected, and synthesizing cDNA by reverse transcription;
2) Using cDNA as a template, and performing PCR amplification by using primers shown in SEQ ID NO. 5-6 or SEQ ID NO. 7-8;
3) Analyzing the amplified product: if the amplified product contains a specific sequence 5'-ATGCATGGCCAGGTCAGTG CTACCCCAATGCCACTGTTCTCTACTGCAG-3', the plum blossom to be detected is of a single-petal character, and if the amplified product does not contain the specific sequence, the plum blossom to be detected is of a double-petal character.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111673715.XA CN114181950B (en) | 2021-12-31 | 2021-12-31 | Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111673715.XA CN114181950B (en) | 2021-12-31 | 2021-12-31 | Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114181950A CN114181950A (en) | 2022-03-15 |
| CN114181950B true CN114181950B (en) | 2023-06-30 |
Family
ID=80545493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111673715.XA Active CN114181950B (en) | 2021-12-31 | 2021-12-31 | Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114181950B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820894A (en) * | 2022-07-19 | 2023-03-21 | 华中农业大学 | InDel molecular marker for identifying single and double petal characters of plum blossom, primer and application thereof |
| CN116042654B (en) * | 2023-02-21 | 2024-05-03 | 华中农业大学 | Application of cabbage type rape BnaA07.Douf-1 gene in creating heavy petal rape germplasm |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858447A (en) * | 2017-12-22 | 2018-03-30 | 中国农业科学院郑州果树研究所 | For identifying single nucleotide polymorphism site, primer pair, kit and the application of peach blossom single-lobe/polyphyll character |
| CN110698550A (en) * | 2019-11-11 | 2020-01-17 | 北京林业大学 | Molecular detection method for rapidly identifying real plum/apricot plum strain |
-
2021
- 2021-12-31 CN CN202111673715.XA patent/CN114181950B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858447A (en) * | 2017-12-22 | 2018-03-30 | 中国农业科学院郑州果树研究所 | For identifying single nucleotide polymorphism site, primer pair, kit and the application of peach blossom single-lobe/polyphyll character |
| CN110698550A (en) * | 2019-11-11 | 2020-01-17 | 北京林业大学 | Molecular detection method for rapidly identifying real plum/apricot plum strain |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114181950A (en) | 2022-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zafar et al. | Precise CRISPR-Cas9 mediated genome editing in super basmati rice for resistance against bacterial blight by targeting the major susceptibility gene | |
| Nguyen et al. | GmKIX8‐1 regulates organ size in soybean and is the causative gene for the major seed weight QTL qSw17‐1 | |
| Carraro et al. | Diversification and expression of the PIN, AUX/LAX, and ABCB families of putative auxin transporters in Populus | |
| CN107304428B (en) | Wheat fertility restorer gene and application thereof | |
| CN114181950B (en) | Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof | |
| CN112575012B (en) | Wheat susceptible gene plant editing and application thereof in breeding disease-resistant varieties | |
| Vogel et al. | Brachypodium distachyon, a new model for the Triticeae | |
| CN108165653B (en) | InDel molecular marker for identifying pepper maturity and application thereof | |
| US20220154202A1 (en) | Gene Regulating Seed Weight in Improving Seed Yield in Soybean | |
| CN115942867A (en) | Powdery mildew resistant cannabis plant | |
| WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
| CN111118053B (en) | Rice fertility regulation and control construct, transformation event and application thereof | |
| CN111172294A (en) | Codominant SSR marker closely linked with tobacco nicotine synthesis major regulatory gene nic1 and application thereof | |
| CN112195268B (en) | Molecular marker, primer, application and variety breeding method closely linked with origin green peach aphid resistance character of cultivar | |
| CN110698550B (en) | Molecular detection method for rapidly identifying real plum/apricot plum strain | |
| Ramamurthy et al. | Mapping and characterization of the fefe gene that controls iron uptake in melon (Cucumis melo L.) | |
| CN106480062B (en) | Recombinant nucleic acid fragment RecCR012080 and detection method thereof | |
| Chen et al. | Portrait of a genus: the genetic diversity of Zea | |
| CN112921112B (en) | CAPS molecular marker, detection primer and detection kit for identifying marigold petal type | |
| AU2022206708A1 (en) | Methods For Increasing Powdery Mildew Resistance In Cannabis | |
| CN112522290B (en) | Sea island cotton fiber quality related calcineurin B-like interaction protein kinase gene | |
| Markussen et al. | Positioning of sex-correlated markers for Populus in a AFLP-and SSR-marker based genetic map of Populus tremula x tremuloides | |
| CN107287278B (en) | Recombinant nucleic acid fragment RecCR010169 and detection method thereof | |
| CN112852996B (en) | SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof | |
| Li et al. | Fine mapping an AUXIN RESPONSE FACTOR, SmARF18, as a candidate gene of the PRICKLE LOCUS that controls prickle absence/presence on various organs in eggplant (Solanum melongena L.) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |