CN114181950A - Gene for controlling characters of plum blossom single and double petals as well as molecular marker and application thereof - Google Patents

Gene for controlling characters of plum blossom single and double petals as well as molecular marker and application thereof Download PDF

Info

Publication number
CN114181950A
CN114181950A CN202111673715.XA CN202111673715A CN114181950A CN 114181950 A CN114181950 A CN 114181950A CN 202111673715 A CN202111673715 A CN 202111673715A CN 114181950 A CN114181950 A CN 114181950A
Authority
CN
China
Prior art keywords
plum blossom
petal
double
gene
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111673715.XA
Other languages
Chinese (zh)
Other versions
CN114181950B (en
Inventor
郑唐春
张启翔
刘伟超
程堂仁
王佳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Forestry University
Original Assignee
Beijing Forestry University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Forestry University filed Critical Beijing Forestry University
Priority to CN202111673715.XA priority Critical patent/CN114181950B/en
Publication of CN114181950A publication Critical patent/CN114181950A/en
Application granted granted Critical
Publication of CN114181950B publication Critical patent/CN114181950B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
    • Y02A40/81—Aquaculture, e.g. of fish

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Botany (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physiology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention provides a gene for controlling the single and double petal characters of plum blossom, a molecular marker and application thereof. Through BSA analysis, the PmAP2-like gene sequences in single-petal and double-petal plum blossom are different, so that the miR172 binding capacity is changed, the PmAP2-like gene is finally caused to be differentially expressed in single-petal flower buds and double-petal flower buds, the single-petal/double-petal character of plum blossom filial generations can be rapidly identified by utilizing the differential expression mode of the PmAP2-like gene in the single-petal and double-petal plum blossom buds and the InDel molecular marker related to the number of plum blossom petals, the rapid and accurate identification of the plum blossom type in the seedling stage of the plum blossom is realized, the breeding period is shortened, and the breeding workload is reduced.

Description

Gene for controlling characters of plum blossom single and double petals as well as molecular marker and application thereof
Technical Field
The invention relates to the technical field of plant genetic engineering and molecular biology, in particular to a gene for controlling plum blossom single and double petal characters, a molecular marker and application thereof.
Background
Plum blossom (Prunus mume Sieb. et Zucc.) is a Prunus plant of Rosaceae (Rosaceae), is one of ten traditional famous flowers in China, has high ornamental value, originates in southwest China, and has been introduced and cultivated for more than 3000 years to the present (Chen Jun. Chinese plum blossom variety image [ M ]. Chinese forestry publishing house, 2010). Under long-term natural evolution and artificial breeding, the plum blossom forms a variety with rich color, fragrance, taste and type, and simultaneously generates a series of transition types from single petals, multiple petals to multiple petals and the like. The plum blossom variety with the double petals accounts for more than 90 percent of the total plum blossom varieties, has high ornamental value and plays an important role in landscape construction.
Zhang jin Bo (Zhang jin Bo. plum blossom heavy petal F1 mapping population construction and molecular marker preliminary analysis [ D]University of agriculture in Huazhong, 2004) was constructed 'snow plum' x 'mealy' F1The possibility of the MADS-box gene existing in the plum blossom is preliminarily confirmed by ISSR and SSR primer extension. CN201711403494.8 discloses that 4063377 identified SNPs are used for carrying out whole-gene association analysis on the single-petal/double-petal traits of 129 peach germplasms, SNPs which are obviously associated with peach blossom types are found, and a specific PCR primer amplification pair and a single-base extension primer are designed. Furthermore, Zhang et al utilized 348 plum blossom cultivars to map the quantitative trait of plum blossom petals to the region of plum blossom chromosome 1 4058003-].Nature Communications,2018,9(1):1702)。
Since most of the previous studies have been in the presumed region, and since there are few reports of plum blossom duplication and no specific gene or deletion mutation is located, there is a long localization distance from the target trait, and identification cannot be performed in early stages of the filial generation. The gene function related to the plum blossom double petal character is researched, and the closely linked molecular markers are screened, so that an important basis is provided for molecular assisted breeding.
Disclosure of Invention
The invention aims to provide a gene for controlling plum blossom double petal character and application thereof.
The invention also aims to provide a molecular marker related to the plum blossom single and double petal traits and application thereof.
In order to achieve the object, the present invention provides, in a first aspect, a gene for controlling a plum blossom double petal trait, which is a gene encoding the following protein (a) or (b):
(a) a protein consisting of an amino acid sequence shown as SEQ ID NO. 2; or
(b) 2, protein which is derived from (a) and has the same function by substituting, deleting or adding one or more amino acids in the sequence shown in SEQ ID NO. 2.
The nucleotide sequence of the gene for controlling the plum blossom heavy valve character is as follows:
i) 4, the nucleotide sequence shown as SEQ ID NO; or
ii) a nucleotide sequence which is obtained by substituting, deleting and/or adding one or more nucleotides into the nucleotide sequence shown in SEQ ID NO. 4 and expresses the same functional protein.
In a second aspect, the present invention provides biological material containing said gene, wherein said biological material includes, but is not limited to, recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria or transgenic cell lines.
In a third aspect, the invention provides any one of the following uses of the gene or a biological material containing the gene:
(1) used for regulating and controlling the plum blossom double petal character;
(2) the method is used for plum blossom genetic breeding;
(3) for the preparation of transgenic plants.
Breeding methods include, but are not limited to, transgenic, hybrid, backcross, selfing, or vegetative propagation.
In a fourth aspect, the invention provides a molecular marker related to plum blossom single-petal and double-petal traits, which is an InDel marker and is positioned at 1261-1309 bp of a sequence shown in a plum blossom PmAP2-like gene as SEQ ID NO. 3;
when the 1261-1309 bp is ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG, corresponding to the plum blossom single-petal character; when 1261-1309 bp does not contain ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG, the plum blossom double petal trait is corresponded.
In a fifth aspect, the invention provides primers for amplifying the InDel marker, comprising an upstream primer shown as SEQ ID NO. 11 and a downstream primer shown as SEQ ID NO. 12.
In a sixth aspect, the invention provides a reagent or a kit for detecting plum blossom single-petal and double-petal traits, which comprises primers shown in SEQ ID NO. 11-12.
In a seventh aspect, the present invention provides any one of the following uses of the molecular marker, the primer or the detection reagent or kit:
1) the method is used for identifying the characters of the plum blossom single petals and the plum blossom double petals;
2) the method is used for early prediction of the plum blossom single-petal and double-petal flower types;
3) the method is used for plum blossom molecular marker assisted breeding;
4) is used for plum blossom PmAP2-like genotyping.
Wherein the nucleotide sequence of the plum blossom PmAP2-like gene is as follows:
i) 3, the nucleotide sequence shown in SEQ ID NO; or
ii) a nucleotide sequence which is obtained by substituting, deleting and/or adding one or more nucleotides into the nucleotide sequence shown in SEQ ID NO. 3 and expresses the same functional protein.
In an eighth aspect, the invention provides a method for identifying the plum blossom single-petal and double-petal traits, which comprises the following steps:
1) extracting total RNA of the plum blossom to be detected, and synthesizing cDNA through reverse transcription;
2) using cDNA as a template, and carrying out PCR amplification by using primers shown in SEQ ID NO. 5-6 or SEQ ID NO. 7-8;
3) analyzing the amplification product: if the amplification product contains the specific sequence 5'-ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG-3', the plum blossom to be detected is in a single-petal character, and if the amplification product does not contain the specific sequence, the plum blossom to be detected is in a double-petal character.
By the technical scheme, the invention at least has the following advantages and beneficial effects:
the PmAP2-like gene provided by the invention has sequence difference in single-petal/double-petal plum blossom, so that the PmAP2-like gene provided by the invention, a corresponding amplification primer thereof, an InDel molecular marker corresponding to the gene and a detection primer thereof can be used for identifying the single-petal/double-petal character of a hybrid population, the single-petal/double-petal plum blossom can be quickly and accurately identified in the seedling stage of the plum blossom, the breeding period is shortened, the breeding workload is greatly reduced, a foundation is laid for accelerating the screening and breeding of the plum blossom, and the method has guiding significance for the breeding of the plum blossom strain for landscaping.
Secondly, the differential expression conditions of the PmAP2-like gene in different flower types provided by the invention can quickly distinguish single-petal/double-petal plum blossom by utilizing the relative expression quantity of the PmAP2-like gene, thereby providing a theoretical basis for the quick breeding of the plum blossom.
And thirdly, identifying the plum blossom single-petal/double-petal character by using the detection primer of the InDel molecular marker related to the plum blossom single-petal/double-petal character, wherein the identification of the plum blossom single-petal/double-petal character has higher accuracy, and the quick early identification of the plum blossom pattern can be realized.
Drawings
FIG. 1 is a Manhattan plot of a BSA analysis in a preferred embodiment of the present invention.
FIG. 2 is the CDS sequence alignment result of plum blossom PmAP2-like gene in the preferred embodiment of the present invention.
FIG. 3 is the alignment result of the plum blossom PmAP2-like gene protein sequence in the preferred embodiment of the present invention.
FIG. 4 is a diagram showing the prediction of miRNA172 target sites in plum blossom PmAP2-like gene in a preferred embodiment of the present invention.
FIG. 5 is a diagram showing the alignment of miRNA172 target sites in plum blossom PmAP2-like gene in a preferred embodiment of the present invention.
FIG. 6 is a diagram showing the relative expression levels of the plum blossom PmAP2-like gene in different flower types according to the preferred embodiment of the present invention.
FIG. 7 is a diagram showing the alignment of the deleted plum blossom PmAP2-like gene segment in the preferred embodiment of the present invention.
Detailed Description
In order to solve the problems of long screening period, low efficiency and the like of plum blossom double-petal character varieties in the prior art, the invention provides a molecular marker related to plum blossom single-petal/double-petal characters and a molecular detection method for rapidly identifying the single-petal/double-petal characters by utilizing an SNP molecular marker generated by plum blossom AP2/ERF transcription factor deletion.
The invention adopts the following technical scheme:
the invention provides a plum blossom PmAP2-like protein sequence which specifically comprises any one of the following amino acid sequences:
1, an amino acid sequence shown as SEQ ID NO;
1 amino acid sequence obtained by deletion of a plurality of amino acids;
③ the amino acid sequence shown as SEQ ID NO. 2.
The sequence alignment shows that the PmAP2-like protein sequences in the single-petal and double-petal plum blossom are different, and the difference of the proteins is supposed to cause the formation of the plum blossom single-petal/double-petal character.
The invention also provides a gene for coding the plum blossom PmAP2-like protein.
Specifically, the gene for coding the plum blossom PmAP2-like protein has any one of the following nucleotide sequences A-B:
A. a nucleotide sequence shown as SEQ ID NO. 3;
B. the nucleotide sequence shown as SEQ ID NO. 4 is obtained by deleting 49 bp.
According to the invention, through sequence comparison, 49bp deletion difference exists between PmAP2-like genes in single-petal and double-petal plum blossom, and the sequence difference may cause miRNA172 to regulate and control the expression of PmAP2-like genes, so that the plum blossom single-petal/double-petal trait is formed.
It is understood that, according to the principle of codon degeneracy, one skilled in the art can design different gene sequences encoding the plum blossom PmAP2-like protein according to the codon preference of different species, and all genes encoding the plum blossom PmAP2-like protein are within the protection scope of the present invention.
The invention also provides a biological material containing a gene for coding the plum blossom PmAP2-like protein, and the biological material comprises an expression cassette, a vector, a host cell, an engineering bacterium or a transgenic plant cell line.
The vectors include but are not limited to cloning vectors, expression vectors, plasmid vectors, and all vectors containing the gene encoding the plum blossom PmAP2-like protein are within the scope of the present invention.
The host cell or the engineering bacterium can be a cell derived from microorganisms, plants or animals, and all host cells or engineering bacteria containing the gene for encoding the plum blossom PmAP2-like protein are within the protection scope of the invention.
Furthermore, the invention also provides a specific amplification primer of the gene for coding the plum blossom PmAP2-like protein, which has a sequence shown as SEQ ID NO. 5-6 or a sequence shown as SEQ ID NO. 7-8.
In another aspect, the invention also provides an InDel molecular marker related to the plum blossom single-petal/double-petal trait, which is located in the plum blossom PmAP2-like gene deletion segment.
The invention also provides specific PCR primers for amplifying the molecular marker.
The position of the plum blossom PmAP2-like gene deletion segment is positioned at 60366776-60366774 bp of plum blossom chromosome 1 with a Genome version of Prunus mumme Genome v1.0(http:// Prunus mumme Genome. bjfu. edu. cn /).
Furthermore, the invention also provides a detection primer of the InDel molecular marker, which has a sequence shown as SEQ ID NO. 11-12.
Experiments prove that the PmAP2-like gene sequences in the single-petal and double-petal plum blossom are different, so that the miR172 binding capacity is changed, the expression quantity difference of the PmAP2-like gene in a single-petal flower bud and a double-petal flower bud is finally caused, and the single-petal/double-petal character rapid identification of plum blossom hybrid offspring can be carried out by utilizing the differential expression mode of the PmAP2-like gene in the single-petal flower bud and the double-petal plum blossom bud.
In another aspect, the invention provides any of the following uses of the PmAP2-like protein and nucleic acid sequences encoded thereby:
(1) the application in regulating and controlling the plum blossom single-petal/double-petal character;
(2) the application in plum blossom genetic breeding.
Experiments prove that the InDel molecular marker related to the number of plum blossom petals can be used for identifying single-petal/double-petal plum blossom petals and has higher accuracy.
In another aspect, the invention provides the use of the gene encoding the PmAP2-like protein or its specific amplification primer or the SNP molecular marker or its detection primer as follows:
(1) the application in plum blossom single-petal/double-petal character identification;
(2) the application in the identification of the seedling stage of the plum blossom hybrid progeny.
Specifically, the application includes: detecting the regulation and control condition of the PmAP2-like gene in the plum blossom to be detected in the flower development process, and identifying the single-petal/double-petal character of the plum blossom according to the differential expression condition of the PmAP2-like gene in different flower types.
Alternatively, the application comprises: and (3) detecting the genotype of the InDel molecular marker related to the number of plum blossom petals by taking plum blossom genome DNA as a template, and identifying the plum blossom single-petal/double-petal character.
The invention provides a method for identifying plum blossom single-petal/double-petal traits, which is one of parallel technical schemes and comprises the following steps: extracting RNA of the plum blossom to be detected from the flower buds of the plum blossom to be detected, analyzing the differential expression condition of the PmAP2-like protein encoded in the plum blossom with different flower types, and judging the single-petal/double-petal character of the plum blossom to be detected.
As a second parallel technical solution, the identification method comprises: and (3) taking the genome DNA of the plum blossom to be detected as a template, carrying out PCR amplification by adopting the detection primer of the InDel molecular marker related to the plum blossom single-petal/double-petal character, analyzing the sequence of a PCR amplification product, and judging the genotype of the plum blossom to be detected.
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.
Example 1 mining of plum blossom heavy petal related SNP molecular markers based on BSA analysis
1. Experimental Material
The tested material is F obtained by hybridization of 'Mi Single Green' plum as female parent and 'Baixu Cinnabaris' as male parent1Isolating the population. The parent has obvious difference in the number of petals, the female parent is a single-petal variety, the number of petals is 5, the male parent is a double-petal variety, and the average number of the petals is 24.1. And (3) measuring 105 progeny plants in the full-bloom stage according to the target characters, wherein the number of the petals is 5, and the number of the petals is more than 15, so that the progeny plants are double petals. All the materials are fixedly planted in the plum blossom valley base of the Heile land of Fujian province.
2. Mixed population segregation method (BSA) whole genome resequencing
Selecting F1Extracting DNA from 41 single-petal character filial generations and 64 double-petal character filial generations in the population, and mixing the extracted DNA in equal quantity to respectively construct a single-petal gene pool and a double-petal gene pool. After random cleavage of gene pool DNA into short DNA fragments by enzymes, blunt end repair is performed. Then, dA tails are connected to both ends of the DNA fragment, and sequencing adapters are connected. The adaptor-added DNA fragment was purified by AMPure XP magnetic beads, and a fragment in the range of 300-400bp was selected for PCR amplification. The constructed library is subjected to purification, library inspection and machine sequencing on Hiseq X10 PE 150.
3. ED method-based BSA analysis
The Euclidean Distance (ED) algorithm is one of the methods for evaluating the region associated with a trait by using sequencing data to find a significant difference marker between mixed pools. Theoretically, the allele frequencies of other sites of two pools constructed by the BSA project tend to be consistent except for the difference of the allele frequencies of the sites related to the target traits, so the ED value of the non-target sites should tend to be 0. The equation for the ED method is shown below, where a larger ED value indicates a larger difference between the two pools. The results of BSA analysis by ED are shown in fig. 1.
A significant interval obtained by 99% quantile screening is on chromosome 1 through BSA analysis, wherein the significant interval comprises an AP2/ERF transcription factor, is involved in regulation and control of the characteristics of the calyx of the 1st round, and is used for controlling the formation of petals of the 2 nd round together with B genes AP3 and PI (PISTILLLATA) to meet the characteristics of petal characters.
Example 2 BSA localization Interval PmAP2-like Gene cloning and analysis
In the method, a plum blossom single-petal variety 'six petals', 'double petal' variety 'pink pluma weeping branch', 'dragon trip', 'Mi single green' plum is taken as a female parent, and 'white-whisker cinnabar' is taken as a male parent to obtain F obtained by hybridization1The total RNA extraction of a single-petal progeny and a double-petal progeny randomly selected from the segregating population is carried out according to the instruction of a plant total RNA extraction kit of Tiangen Biochemical technology (Beijing) Co.
The total RNA is reversely transcribed into cDNA by a kit, and the ORF of the PmAP2-like gene is cloned by PCR by taking the cDNA as a template. The reaction system comprises 100-150 ng of template (cDNA), 25 muL of PrimeSTAR HS (Premix), 0.3 muM of upstream primer (SEQ ID NO:5), 0.3 muM of downstream primer (SEQ ID NO:6), or 0.3 muM of upstream primer (SEQ ID NO:7), 0.3 muM of downstream primer (SEQ ID NO:8), ddH2The content of O is filled to 50 mu L. Reaction conditions are as follows: 2min at 98 ℃; 98 ℃ 10s, 56 ℃ 15s, 72 ℃ 60s (35 cycles); 5min at 72 ℃; storing at 4 ℃.
And recovering the target band through gel electrophoresis, connecting, transforming and sequencing to obtain the target sequence. The sequence comparison of the PmAP2-like gene ORF was performed by combining the DNAMAN software, and 49bp deletion was found in the double-petal plum blossom material compared with the single-petal plum blossom material (FIG. 2). Meanwhile, the protein structure analysis of the PmAP2-like gene shows that the PmAP2-like amino acid sequence in the single-flap and double-flap materials is changed due to 49bp deletion (figure 3).
The transcription regulation motif and miRNA binding site are predicted by using a RegRNA 2.0 online tool, and the miRNA target site prediction result shows that the PmAP2-like gene has the target site of miR172, which indicates that the PmAP2-like gene is probably regulated by miR 172. Due to the deletion of 49bp, the gene PmAP2-like in the single-flap and double-flap materials is combined with miR172 to have difference (figure 4), wherein the target site sequence in the single-flap plant material PmAP2-like is only different from the complementary sequence of miR172 by 2 bases, while the sequence of the double-flap material PmAP2-like is different from the complementary sequence of miR172 by 4 bases, the expression level of PmAP2-like is presumed to be regulated by miR172, and the expression amount difference can exist in the single-flap and double-flap materials (figure 5).
Example 3 analysis of expression level of PmAP2-like Gene in plum blossom bud
1. Sample collection
F obtained by hybridizing 'Mimonanglu' plum serving as female parent and 'Baixus cinnabar' serving as male parent1And respectively randomly selecting 9 single-petal filial generations and 9 double-petal filial generation flower buds in the segregating population. Sampling time was 9:00-11:00 am, 3 biological replicates were set for each 3 plants as a pool.
2. Analysis of PmAP2-like Gene expression level
The extraction of total RNA from plum blossom is carried out by using an RNAscope total RNA extraction kit of Tiangen Biotechnology (Beijing) Co., Ltd, and the extraction method is carried out by referring to the kit specification. cDNA Synthesis and real-time fluorescent quantitative PCR Using PrimeScript from Bao bioengineering (Dalian) LtdTMII 1st Strand cDNA Synthesis Kit and TB
Figure BDA0003453731970000071
Premix Ex TaqTM(Tli RNaseH Plus) kit, the assay being performed with reference to kit instructions.
A relative quantitative test is carried out on the PmAP2-like gene by utilizing a qPCR method, and a detection primer of the qPCR is shown as SEQ ID NO. 9-10. As a result, the expression amount of the PmAP2-like gene in the flower bud of the single-petal progeny is lower than that of the flower bud of the double-petal progeny, and the expression amount of the PmAP2-like gene in the flower bud of the single-petal progeny is inhibited presumably due to the reduction of the capacity of combining the miR172 with the PmAP2-like gene caused by the deletion of 49 bp.
The relative expression of the plum blossom PmAP2-like gene in different flower types is shown in FIG. 6.
EXAMPLE 4 cloning and analysis of PmAP2-like Gene deletion segment in the hybrid population
According to the deletion position sequence of the plum blossom PmAP2-like gene, a marker specific Primer is designed by using Primer Premier 5.0 software, wherein the used forward Primer is ATGAGAGGACGTTGCATTTCAC, and the used reverse Primer is AAAGAATCTGAAGACCACCGT.
Selecting F1In the population, 41 single-petal character filial generations and 64 double-petal character filial generations are subjected to young leaf DNA extraction according to the instruction of a plant genome DNA extraction kit of Tiangen Biochemical technology (Beijing) Co., Ltd, and are equivalently mixed after DNA extraction to respectively construct a single-petal gene pool and a double-petal gene pool.
PCR cloning is carried out on the PmAP2-like gene deletion segment by taking the genome DNA as a template. The reaction system is template (genome DNA) 100-150 ng, PrimeSTAR HS (Premix) 25. mu.L, upstream primer (SEQ ID NO:11) 0.3. mu.M, downstream primer (SEQ ID NO:12) 0.3. mu.M, ddH2The content of O is filled to 50 mu L. Reaction conditions are as follows: 2min at 98 ℃; 98 ℃ 10s, 56 ℃ 15s, 72 ℃ 60s (35 cycles); 5min at 72 ℃; storing at 4 ℃.
And recovering the target band through gel electrophoresis, connecting, transforming and sequencing to obtain the target sequence. Comparing the sequences of the PmAP2-like gene deletion segments by combining DNAMAN software, and finding that 49bp deletion exists in the double-petal plum blossom offspring compared with the single-petal plum blossom gene pool, namely 49bp deletion appears from 158 th position of the sequence shown in figure 7. Therefore, the primer sequence can be used for early identification of the single lobe/double lobe of the plum blossom in the hybridized population.
Example 5 application of PmAP2-like gene deletion position in plum blossom variety
According to the deletion position sequence of the plum blossom PmAP2-like gene, a marker specific Primer is designed by using Primer Premier 5.0 software, wherein the used forward Primer is ATGAGAGGACGTTGCATTTCAC, and the used reverse Primer is AAAGAATCTGAAGACCACCGT.
Randomly selecting 10 single-petal plum blossom varieties and 10 double-petal plum blossom varieties, extracting the DNA of young leaves according to the instruction of a plant genome DNA extraction kit of Tiangen Biochemical technology (Beijing) Co., Ltd, and equivalently mixing the extracted DNA to respectively construct a single-petal gene pool and a double-petal gene pool.
PCR cloning is carried out on the PmAP2-like gene deletion segment by taking the genome DNA as a template. The reaction system is template (genome DNA) 100-150 ng, PrimeSTAR HS (Premix) 25. mu.L, upstream primer (SEQ ID NO:11) 0.3. mu.M, downstream primer (SEQ ID NO:12) 0.3. mu.M, ddH2The content of O is filled to 50 mu L. Inverse directionThe conditions are as follows: 2min at 98 ℃; 98 ℃ 10s, 56 ℃ 15s, 72 ℃ 60s (35 cycles); 5min at 72 ℃; storing at 4 ℃.
And recovering the target band through gel electrophoresis, connecting, transforming and sequencing to obtain the target sequence. Comparing the sequences of the PmAP2-like gene deletion segments by combining DNAMAN software, and finding that 49bp deletion exists in the double-petal plum blossom variety gene pool compared with the single-petal plum blossom variety gene pool, namely 49bp deletion appears from 158 th position of the sequence shown in figure 7. Therefore, the primer sequence can be used for early identification of the single-petal/double-petal plum blossom of the plum blossom variety, and can be used as a molecular marker to be applied to auxiliary breeding of the single-petal/double-petal plum blossom.
In conclusion, the molecular biological method for rapidly identifying the plum blossom single petal/double petals is established, the molecular marker related to the single petal/double petal characters and the InDel molecular marker generated by utilizing the deletion of the plum blossom AP2/ERF transcription factor are used for rapidly identifying the single petal/double petal characters, early selection in the seedling stage can be realized, the workload is reduced, the breeding process of the plum blossom is accelerated, and the theoretical basis is laid for the seed selection, breeding and early identification of the plum blossom.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Beijing university of forestry
<120> gene for controlling plum blossom single and double petal traits and molecular marker and application thereof
<130> KHP211124812.2
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 479
<212> PRT
<213> plum blossom (Prunus mume)
<400> 1
Met Leu Asp Leu Asn Leu Asn Val Val Gly Ser Asp Pro Asn Asp Val
1 5 10 15
Glu Ser Cys Gly Thr Gln Met Asp Glu Ser Gly Thr Ser Asn Ser Ser
20 25 30
Val Val Asn Ala Asp Ala Ser Ser Thr Asn Asp Asp Ser Cys Ser Thr
35 40 45
Arg Ala Ala Arg Tyr Asp Ala Val Thr Thr Phe Asn Phe Asp Ile Leu
50 55 60
Lys Val Arg Gly Gly Glu Asp Glu Glu Asp Asp Val Val Val Thr Lys
65 70 75 80
Glu Leu Phe Pro Val Thr Gly Ala Leu Ser Asn Trp Pro Gly Gln Gly
85 90 95
Gln Ser Ser Ala Ser Ser Ser Leu Val Arg Lys Asn Leu Met Glu Leu
100 105 110
Gly Phe Asp His Gly Gly Ser Gly Glu Val Arg Leu Val Gln Gln Lys
115 120 125
Gln Gln Gln Pro Ala Ala Pro Pro Pro Gln Gln Gln Gln Val Lys Lys
130 135 140
Ser Arg Arg Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr
145 150 155 160
Phe Tyr Arg Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly
165 170 175
Lys Gln Val Tyr Leu Gly Gly Phe Asp Thr Ala His Ala Ala Ala Arg
180 185 190
Ala Tyr Asp Arg Ala Ala Ile Lys Phe Arg Gly Val Asp Ala Asp Ile
195 200 205
Asn Tyr Asn Leu Ser Asp Tyr Glu Glu Asp Leu Lys Gln Met Lys Asn
210 215 220
Leu Thr Lys Glu Glu Phe Val His Ile Leu Arg Arg Gln Ser Thr Gly
225 230 235 240
Phe Ser Arg Gly Ser Ser Arg Tyr Arg Gly Val Thr Leu His Lys Cys
245 250 255
Gly Arg Trp Glu Ala Arg Met Gly Gln Phe Leu Gly Lys Lys Tyr Ile
260 265 270
Tyr Leu Gly Leu Phe Asp Ser Glu Val Glu Ala Ala Arg Ala Tyr Asp
275 280 285
Lys Ala Ala Ile Lys Cys Asn Gly Arg Glu Ala Val Thr Asn Phe Glu
290 295 300
Pro Ser Thr Tyr Glu Gly Glu Met Ile Ser Glu Ala Gly Asn Glu Asp
305 310 315 320
Gly Asp His Asn Leu Asp Leu Asn Leu Gly Ile Ser Pro Pro Ser Phe
325 330 335
Gly Asn Cys Gln Lys Glu Val Glu Gly His Leu Gln Phe His Ser Gly
340 345 350
Pro Tyr Asp Gly His Asn Gly Lys Arg Met Glu His Asn Val Asn Ala
355 360 365
Thr Met Ser Asp Pro Pro Phe Lys Gly Leu Val Met Thr Ser Gln His
370 375 380
Pro Pro Leu Trp Asn Gly Val Tyr Pro Ser Tyr Phe Ser Asn Gln Glu
385 390 395 400
Arg Ala Thr Glu Lys Arg Ile Ala Leu Gly Ser Gln Gly Pro Pro Asn
405 410 415
Trp Ala Trp Gln Met His Gly Gln Val Ser Ala Thr Pro Met Pro Leu
420 425 430
Phe Ser Thr Ala Ala Ser Ser Gly Phe Ser Phe Ser Ala Thr Ala Pro
435 440 445
Ser Ala Ala Val His Pro Leu Gln Pro Ser Thr Pro Thr Ala Leu Asn
450 455 460
Leu Cys Phe Thr Ser Pro Ala Thr Ala Ala Ala Asn Thr Ser Gln
465 470 475
<210> 2
<211> 474
<212> PRT
<213> plum blossom (Prunus mume)
<400> 2
Met Leu Asp Leu Asn Leu Asn Val Val Gly Ser Asp Pro Asn Asp Val
1 5 10 15
Glu Ser Cys Gly Thr Gln Met Asp Glu Ser Gly Thr Ser Asn Ser Ser
20 25 30
Val Val Asn Ala Asp Ala Ser Ser Thr Asn Asp Asp Ser Cys Ser Thr
35 40 45
Arg Ala Ala Arg Tyr Asp Ala Val Thr Thr Phe Asn Phe Asp Ile Leu
50 55 60
Lys Val Arg Gly Gly Glu Asp Glu Glu Asp Asp Val Val Val Thr Lys
65 70 75 80
Glu Leu Phe Pro Val Thr Gly Ala Leu Ser Asn Trp Pro Gly Gln Gly
85 90 95
Gln Ser Ser Ala Ser Ser Ser Leu Val Arg Lys Asn Leu Met Glu Leu
100 105 110
Gly Phe Asp His Gly Gly Ser Gly Glu Val Arg Leu Val Gln Gln Lys
115 120 125
Gln Gln Gln Pro Ala Ala Pro Pro Pro Gln Gln Gln Gln Val Lys Lys
130 135 140
Ser Arg Arg Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr
145 150 155 160
Phe Tyr Arg Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly
165 170 175
Lys Gln Val Tyr Leu Gly Gly Phe Asp Thr Ala His Ala Ala Ala Arg
180 185 190
Ala Tyr Asp Arg Ala Ala Ile Lys Phe Arg Gly Val Asp Ala Asp Ile
195 200 205
Asn Tyr Asn Leu Ser Asp Tyr Glu Glu Asp Leu Lys Gln Met Lys Asn
210 215 220
Leu Thr Lys Glu Glu Phe Val His Ile Leu Arg Arg Gln Ser Thr Gly
225 230 235 240
Phe Ser Arg Gly Ser Ser Arg Tyr Arg Gly Val Thr Leu His Lys Cys
245 250 255
Gly Arg Trp Glu Ala Arg Met Gly Gln Phe Leu Gly Lys Lys Tyr Ile
260 265 270
Tyr Leu Gly Leu Phe Asp Ser Glu Val Glu Ala Ala Arg Ala Tyr Asp
275 280 285
Lys Ala Ala Ile Lys Cys Asn Gly Arg Glu Ala Val Thr Asn Phe Glu
290 295 300
Pro Ser Thr Tyr Glu Gly Glu Met Ile Ser Glu Ala Gly Asn Glu Asp
305 310 315 320
Gly Asp His Asn Leu Asp Leu Asn Leu Gly Ile Ser Pro Pro Ser Phe
325 330 335
Gly Asn Cys Gln Lys Glu Val Glu Gly His Leu Gln Phe His Ser Gly
340 345 350
Pro Tyr Asp Gly His Asn Gly Lys Arg Met Glu His Asn Val Asn Ala
355 360 365
Thr Met Ser Asp Pro Pro Phe Lys Gly Leu Val Met Thr Ser Gln His
370 375 380
Pro Pro Leu Trp Asn Gly Val Tyr Pro Ser Tyr Phe Ser Asn Gln Glu
385 390 395 400
Arg Ala Thr Glu Lys Arg Ile Ala Leu Gly Ser Gln Gly Pro Pro Asn
405 410 415
Trp Ala Trp Gln His His Gln Asp Ser His Phe Gln Leu Pro Leu Pro
420 425 430
Pro Leu Leu Ser Thr Pro Cys Asn Pro Gln Pro Gln Gln Pro Ser Ile
435 440 445
Ser Val Leu Leu Arg Gln Pro Arg Leu Pro Pro Ile Leu Leu Asn Ser
450 455 460
Arg Val Ser Pro Arg Glu Gly Arg Thr Ala
465 470
<210> 3
<211> 1440
<212> DNA
<213> plum blossom (Prunus mume)
<400> 3
atgctggatc ttaatctgaa cgtcgtcggt tctgacccaa acgacgtcga gtcatgtggc 60
acccaaatgg acgagtcggg gacgtcgaac tcgtccgtgg tcaatgccga cgcatccagc 120
accaacgacg actcgtgctc cacacgcgcc gccagatacg acgccgtcac gaccttcaac 180
ttcgatattc tcaaggtcag gggcggagaa gatgaagaag acgatgtcgt cgtgactaag 240
gagctgttcc cggtcaccgg ggccctgagc aattggcccg gccaggggca gtcgtcagcg 300
tcgtcgtctt tggtgaggaa gaacttgatg gagcttgggt tcgatcatgg cgggtccgga 360
gaggtcaggt tggttcaaca gaaacaacag caaccagccg caccgccacc acagcaacag 420
caggtgaaga agagcagaag agggccgagg tctcggagct ctcagtatag aggggtcacc 480
ttctatagaa gaactggtag atgggaatct catatttggg attgcgggaa acaagtgtat 540
ttgggtggat ttgacactgc tcatgctgcg gctagagcct acgatcgagc tgctattaag 600
ttcagaggag ttgatgctga tatcaattac aacctcagtg attatgagga ggatttgaaa 660
cagatgaaga atttgaccaa ggaagaattt gtgcacatac tacggaggca gagcactggt 720
ttctcgaggg ggagctcgag atatagaggg gttacgctgc acaaatgtgg ccgatgggaa 780
gctcgaatgg ggcagttcct tggcaaaaag tatatatatc ttgggctatt cgacagtgaa 840
gtagaagctg caagggctta tgacaaggca gcaatcaaat gtaatggaag ggaagcagtc 900
accaactttg agccaagcac atatgaaggg gagatgatat ctgaggctgg taatgaagat 960
ggcgatcaca atcttgatct gaatttgggg atatctcccc cttcatttgg caattgtcaa 1020
aaggaagtcg aggggcatct tcaattccat tccggccctt atgatgggca caatggaaag 1080
aggatggagc acaatgtaaa tgcaacgatg agcgatccac ctttcaaagg gctagtaatg 1140
acatcacagc acccaccatt gtggaatggt gtatatccta gttacttttc caatcaggaa 1200
agagcaacag agaagagaat tgcattagga tctcaaggac cccccaactg ggcttggcaa 1260
atgcatggcc aggtcagtgc taccccaatg ccactgttct ctactgcagc atcatcagga 1320
ttctcatttt cagctaccgc tccctccgct gctgtccacc ccttgcaacc ctcaacccca 1380
acagccctca atctctgttt tacttcgcca gccacggctg ccgccaatac ttctcaatag 1440
<210> 4
<211> 1425
<212> DNA
<213> plum blossom (Prunus mume)
<400> 4
atgctggatc ttaatctgaa cgtcgtcggt tctgacccaa acgacgtcga gtcatgtggc 60
acccaaatgg acgagtcggg gacgtcgaac tcgtccgtgg tcaatgccga cgcatccagc 120
accaacgacg actcgtgctc cacacgcgcc gccagatacg acgccgtcac gaccttcaac 180
ttcgatattc tcaaggtcag gggcggagaa gatgaagaag acgatgtcgt cgtgactaag 240
gagctgttcc cggtcaccgg ggccctgagc aattggcccg gccaggggca gtcgtcagcg 300
tcgtcgtctt tggtgaggaa gaacttgatg gagcttgggt tcgatcatgg cgggtccgga 360
gaggtcaggt tggttcaaca gaaacaacag caaccagccg caccgccacc acagcaacag 420
caggtgaaga agagcagaag agggccgagg tctcggagct ctcagtatag aggggtcacc 480
ttctatagaa gaactggtag atgggaatct catatttggg attgcgggaa acaagtgtat 540
ttgggtggat ttgacactgc tcatgctgcg gctagagcct acgatcgagc tgctattaag 600
ttcagaggag ttgatgctga tatcaattac aacctcagtg attatgagga ggatttgaaa 660
cagatgaaga atttgaccaa ggaagaattt gtgcacatac tacggaggca gagcactggt 720
ttctcgaggg ggagctcgag atatagaggg gttacgctgc acaaatgtgg ccgatgggaa 780
gctcgaatgg ggcagttcct tggcaaaaag tatatatatc ttgggctatt cgacagtgaa 840
gtagaagctg caagggctta tgacaaggca gcaatcaaat gtaatggaag ggaagcagtc 900
accaactttg agccaagcac atatgaaggg gagatgatat ctgaggctgg taatgaagat 960
ggcgatcaca atcttgatct gaatttgggg atatctcccc cttcatttgg caattgtcaa 1020
aaggaagtcg aggggcatct tcaattccat tccggccctt atgatgggca caatggaaag 1080
aggatggagc acaatgtaaa tgcaacgatg agcgatccac ctttcaaagg gctagtaatg 1140
acatcacagc acccaccatt gtggaatggt gtatatccta gttacttttc caatcaggaa 1200
agagcaacag agaagagaat tgcattagga tctcaaggac cccccaactg ggcttggcaa 1260
catcatcagg attctcattt tcagctaccg ctccctccgc tgctgtccac cccttgcaac 1320
cctcaacccc aacagccctc aatctctgtt ttacttcgcc agccacggct gccgccaata 1380
cttctcaata gtagagtatc accgagggaa ggccgcacgg cctaa 1425
<210> 5
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atgctggatc ttaatctgaa cg 22
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ctattgagaa gtattggcgg c 21
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
atgctggatc ttaatctgaa cgtcg 25
<210> 8
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ttaggccgtg cggccttc 18
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ctgaggctgg taatgaagat gg 22
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
taagggccgg aatggaattg 20
<210> 11
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
atgagaggac gttgcatttc ac 22
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aaagaatctg aagaccaccg t 21

Claims (10)

1. A gene for controlling a plum double petal trait, which is a gene encoding the following protein (a) or (b):
(a) a protein consisting of an amino acid sequence shown as SEQ ID NO. 2; or
(b) 2, protein which is derived from (a) and has the same function by substituting, deleting or adding one or more amino acids in the sequence shown in SEQ ID NO. 2.
2. The gene of claim 1, wherein the nucleotide sequence is:
i) 4, the nucleotide sequence shown as SEQ ID NO; or
ii) a nucleotide sequence which is obtained by substituting, deleting and/or adding one or more nucleotides into the nucleotide sequence shown in SEQ ID NO. 4 and expresses the same functional protein.
3. Biomaterial containing the gene according to claim 1 or 2, characterized in that it is a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector or an engineered bacterium.
4. Use of the gene according to claim 1 or 2 or the biomaterial according to claim 3 for any one of the following applications:
(1) used for regulating and controlling the plum blossom double petal character;
(2) the method is used for plum blossom genetic breeding;
(3) for the preparation of transgenic plants.
5. Use according to claim 4, characterized in that the breeding method comprises transgenesis, crossing, backcrossing, selfing or asexual propagation.
6. The molecular marker related to the plum blossom single-petal and double-petal traits is characterized by being an InDel marker and located at 1261-1309 bp of a sequence shown as SEQ ID NO. 3 of a plum blossom PmAP2-like gene;
when the 1261-1309 bp is ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG, corresponding to the plum blossom single-petal character; when 1261-1309 bp does not contain ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG, the plum blossom double petal trait is corresponded.
7. The primer for amplifying the molecular marker of claim 6, which comprises an upstream primer shown as SEQ ID NO. 11 and a downstream primer shown as SEQ ID NO. 12.
8. The reagent or the kit for detecting the plum blossom single-petal and double-petal character is characterized by comprising the primer of claim 7.
9. Any one of the following uses of the molecular marker of claim 6, the primer of claim 7, or the detection reagent or kit of claim 8:
1) the method is used for identifying the characters of the plum blossom single petals and the plum blossom double petals;
2) the method is used for early prediction of the plum blossom single-petal and double-petal flower types;
3) the method is used for plum blossom molecular marker assisted breeding;
4) used for plum blossom PmAP2-like genotyping;
wherein the nucleotide sequence of the plum blossom PmAP2-like gene is as follows:
i) 3, the nucleotide sequence shown in SEQ ID NO; or
ii) a nucleotide sequence which is obtained by substituting, deleting and/or adding one or more nucleotides into the nucleotide sequence shown in SEQ ID NO. 3 and expresses the same functional protein.
10. The identification method of the plum blossom single-petal and double-petal characters is characterized by comprising the following steps:
1) extracting total RNA of the plum blossom to be detected, and synthesizing cDNA through reverse transcription;
2) using cDNA as a template, and carrying out PCR amplification by using primers shown in SEQ ID NO. 5-6 or SEQ ID NO. 7-8;
3) analyzing the amplification product: if the amplification product contains the specific sequence 5'-ATGCATGGCCAGGTCAGTGCTACCCCAATGCCACTGTTCTCTACTGCAG-3', the plum blossom to be detected is in a single-petal character, and if the amplification product does not contain the specific sequence, the plum blossom to be detected is in a double-petal character.
CN202111673715.XA 2021-12-31 2021-12-31 Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof Active CN114181950B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111673715.XA CN114181950B (en) 2021-12-31 2021-12-31 Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111673715.XA CN114181950B (en) 2021-12-31 2021-12-31 Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof

Publications (2)

Publication Number Publication Date
CN114181950A true CN114181950A (en) 2022-03-15
CN114181950B CN114181950B (en) 2023-06-30

Family

ID=80545493

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111673715.XA Active CN114181950B (en) 2021-12-31 2021-12-31 Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof

Country Status (1)

Country Link
CN (1) CN114181950B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115820894A (en) * 2022-07-19 2023-03-21 华中农业大学 InDel molecular marker for identifying single and double petal characters of plum blossom, primer and application thereof
CN116042654A (en) * 2023-02-21 2023-05-02 华中农业大学 Application of cabbage type rape BnaA07.Douf-1 gene in creating heavy petal rape germplasm

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107858447A (en) * 2017-12-22 2018-03-30 中国农业科学院郑州果树研究所 For identifying single nucleotide polymorphism site, primer pair, kit and the application of peach blossom single-lobe/polyphyll character
CN110698550A (en) * 2019-11-11 2020-01-17 北京林业大学 Molecular detection method for rapidly identifying real plum/apricot plum strain

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107858447A (en) * 2017-12-22 2018-03-30 中国农业科学院郑州果树研究所 For identifying single nucleotide polymorphism site, primer pair, kit and the application of peach blossom single-lobe/polyphyll character
CN110698550A (en) * 2019-11-11 2020-01-17 北京林业大学 Molecular detection method for rapidly identifying real plum/apricot plum strain

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115820894A (en) * 2022-07-19 2023-03-21 华中农业大学 InDel molecular marker for identifying single and double petal characters of plum blossom, primer and application thereof
CN116042654A (en) * 2023-02-21 2023-05-02 华中农业大学 Application of cabbage type rape BnaA07.Douf-1 gene in creating heavy petal rape germplasm
CN116042654B (en) * 2023-02-21 2024-05-03 华中农业大学 Application of cabbage type rape BnaA07.Douf-1 gene in creating heavy petal rape germplasm

Also Published As

Publication number Publication date
CN114181950B (en) 2023-06-30

Similar Documents

Publication Publication Date Title
CN114181950B (en) Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof
CN108165554B (en) Corn leaf width control gene ZmNL4 and application thereof
CN108165653B (en) InDel molecular marker for identifying pepper maturity and application thereof
CN108048597B (en) SNP molecular marker related to drought resistance of rice and application thereof
CN111118053B (en) Rice fertility regulation and control construct, transformation event and application thereof
CN115942867A (en) Powdery mildew resistant cannabis plant
CN112195268B (en) Molecular marker, primer, application and variety breeding method closely linked with origin green peach aphid resistance character of cultivar
CN110698550B (en) Molecular detection method for rapidly identifying real plum/apricot plum strain
CN110819732B (en) Homozygous SNP molecular marker closely linked with plum blossom drooping branch character and detection method and application thereof
WO2024108862A1 (en) Rice white leaf and panicle gene wlp3 and application thereof in rice stress resistance and yield increase
CN106480062B (en) Recombinant nucleic acid fragment RecCR012080 and detection method thereof
CN106893769B (en) Recombinant nucleic acid fragment RecCR012602 and detection method thereof
CN112921112B (en) CAPS molecular marker, detection primer and detection kit for identifying marigold petal type
CN107287278B (en) Recombinant nucleic acid fragment RecCR010169 and detection method thereof
CN113265411A (en) Gene for controlling peach blossom/fruit peel color and application thereof
CN106480057B (en) Recombinant nucleic acid fragment RecCR012083 and detection method thereof
CN111575313A (en) Method for performing site-directed mutagenesis and detection on rice TDR gene by using CRISPR \ Cas9 system
CN106480058B (en) Recombinant nucleic acid fragment RecCR010380 and detection method thereof
Li et al. Fine mapping an AUXIN RESPONSE FACTOR, SmARF18, as a candidate gene of the PRICKLE LOCUS that controls prickle absence/presence on various organs in eggplant (Solanum melongena L.)
CN115820894B (en) InDel molecular marker and primer for plum blossom single and double valve character identification and application thereof
CN116042654B (en) Application of cabbage type rape BnaA07.Douf-1 gene in creating heavy petal rape germplasm
CN112852996B (en) SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof
CN108148846A (en) Rice blade profile mutator ZY103 and its application
CN106480048B (en) Recombinant nucleic acid fragment RecCR010382 and detection method thereof
JPWO2005003349A1 (en) Rice transposon gene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant