CN111575313A

CN111575313A - Method for performing site-directed mutagenesis and detection on rice TDR gene by using CRISPR \ Cas9 system

Info

Publication number: CN111575313A
Application number: CN202010401496.9A
Authority: CN
Inventors: 龙起樟; 黄永兰; 万建林; 王会民; 芦明; 唐秀英; 朱雪晶
Original assignee: JIANGXI SUPER-RICE RESEARCH AND DEVELOPMENT CENTER
Current assignee: JIANGXI SUPER-RICE RESEARCH AND DEVELOPMENT CENTER
Priority date: 2020-05-13
Filing date: 2020-05-13
Publication date: 2020-08-25

Abstract

The recessive male sterility has important utilization value in plant breeding, and the TDR gene function deletion in rice can cause thorough recessive male sterility, so the method is an important target for creating the recessive male sterility by genetic engineering. The invention discloses a method for carrying out site-directed mutagenesis on rice TDR gene by using a CRISPR \ Cas9 system, and the site-directed mutagenesis method provided by the invention can rapidly and efficiently create TDR gene mutant so as to obtain a recessive male sterile material; the invention further provides a method for detecting the specific TDR mutant genotype obtained by the site-specific mutagenesis method, which can be used for quickly identifying whether the target site in the contemporary transformant of the TDR site-specific mutagenesis has mutation or not and can also be used for genotyping identification of the specific mutant genotype of the progeny.

Description

Method for performing site-directed mutagenesis and detection on rice TDR gene by using CRISPR \ Cas9 system

Technical Field

The invention belongs to the technical field of rice molecular breeding, relates to a method for carrying out site-specific mutagenesis on a rice TDR gene by using a CRISPR \ Cas9 system, and further provides a high-resolution dissolution curve analysis method for detecting a specific TDR mutation genotype obtained by the site-specific mutagenesis method.

Background

Recessive male sterile line has important application value in rice breeding, has been successfully applied to recurrent selective breeding at present, and is also applied to SPT technology (Seed production technology, a plant male sterile line production technology). Many recessive male sterile genes are cloned in rice, wherein abortion caused by TDR gene inactivation is very thorough, so that pollen-free abortion is easy to observe and identify in the field, and agronomic characters except fertility are not influenced, thereby having important utilization value. Although the mutant of the TDR gene exists, the introduction of the mutant of the gene into a target variety by a backcross mode is time-consuming and labor-consuming, the genetic background is not easy to purify, the mutagenesis of the TDR gene by a site-specific gene mutation technology is more convenient, and the genetic background of a target material can be basically kept unchanged.

Site-directed mutagenesis of a gene can be performed by gene editing techniques. The gene editing system mainly comprises zinc lipoprotein nuclease (ZFN), transcription factor-like effector nuclease (TALEN), CRISPR system and the like [ Gaj, T, et al, ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. trends Biotechnol,2013,31(7):397-405], and the CRISPR \ Cas9 system is most widely applied in the technologies. Mutations created by the CRISPR \ Cas9 system are typically deletion/insertion (InDel) mutations of 1 to several bases, and are typically identified by DNA sequencing when it is desired to determine the specific sequence changes that occur in candidate gene editing plants. After determining the gene mutation situation, screening the unmarked homozygous mutant individual plant in the progeny of the gene editing strain is generally carried out, and finally, individual strains are generally selected for application. In particular, in the gene editing and application of a recessive male sterile gene, it is sometimes necessary to distinguish a heterozygous from a wild type in a fertile strain, but cannot be distinguished by a phenotype, and thus identification can be performed only on a gene level by a certain genotyping method.

The high resolution melting curve is a novel high throughput genotyping method, and the mutation which is different from the wild type sequence by a few bases is difficult to detect by combining the common PCR with the common electrophoresis method, while the high resolution melting curve analysis method can perform genotyping on some insertion/deletion mutations (InDel) and single base mutation (SNP). High resolution melting curve analysis based on PCR with specific nucleic acid fluorescent dyes and with specific instrumentation has found applications in many areas of genetic and breeding research.

Disclosure of Invention

Aiming at the defects that the backcross utilizes the rice ready-made recessive male sterile gene TDR, which is time-consuming and labor-consuming, and the genetic background is difficult to purify, the invention provides a method for carrying out site-specific mutation on a rice wild type TDR gene by utilizing a CRISPR \ Cas9 system, and further provides a method for detecting a specific TDR mutant genotype obtained by site-specific mutation.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention discloses a method for performing site-directed mutagenesis on a rice wild type TDR gene by using a CRISPR \ Cas9 system, wherein the TDR gene codes a rice protein sequence which is the same as or has more than 95% sequence similarity with a sequence shown in SEQ ID No.1, and an sgRNA guide sequence (guide sequence) adopted by the CRISPR \ Cas9 system comprises any sequence shown in SEQ ID No.2 or SEQ ID No.3 which is transferred and expressed in a DNA sequence form, or a sequence which has 1 to 3 base differences with the sequence shown in SEQ ID No.2 or SEQ ID No. 3.

Preferably, the functional components of the CRISPR \ Cas9 system are assembled in a binary Ti plasmid vector comprising pCUbi1390Cas9-U3 or pCUbi1390Cas 9-U6.

More preferably, when the binary Ti plasmid vector is pCUbi1390Cas9-U3, the sgRNA guide sequence of the CRISPR \ Cas9 system adopted is selected from a sequence which is transferred into a DNA sequence form and is shown as SEQ ID No.2, or a sequence which has 1 to 3 base differences with the sequence shown as SEQ ID No. 2; when the binary Ti plasmid vector is pCUbi1390Cas9-U6, the sgRNA guide sequence of the CRISPR \ Cas9 system is selected from a sequence which is transferred into a DNA sequence form and is shown as SEQ ID No.3, or a sequence which has 1 to 3 base differences with the sequence shown as SEQ ID No. 3.

Preferably, the above method comprises the steps of:

1) constructing a target CRISPR binary Ti plasmid vector;

2) transforming the vector into agrobacterium;

3) transforming rice callus by agrobacterium transformation method to obtain T₀Generating a transformant;

4) for T₀Detecting the target site mutation condition of the TDR gene in the generation transformant;

5) observing the fertility change of the transformant;

6) breeding transformants by generations and screening the offspring for a single plant from which the T-DNA component has been removed and the mutant genotype is a homozygous functionally inactivated mutant;

7) breeding the target homozygous single plant.

Preferably, the step 1) further comprises:

1-1) design of sgRNA guide sequences, synthesis of oligodeoxyribonucleic acids for cloning:

when the leader sequence is SEQ ID No.2, the oligodeoxyribonucleic acid sequence is

gTDRU3-F：ggcaGCACAGGTCTCAGCACTGC，

gTDRU3-R：aaacGCAGTGCTGAGACCTGTGC；

When the leader sequence is SEQ ID No.3, the oligodeoxyribonucleic acid sequence is

gTDRU6-F：cttgCTGCATTGAGGCCTCTAGT，

gTDRU6-R：aaacACTAGAGGCCTCAATGCAG；

1-2) annealing the oligodeoxyribonucleic acid synthesized in the step 1-1) to form a double-stranded oligonucleotide adaptor;

1-3) carrying out enzyme digestion and recovering a binary Ti plasmid vector;

1-4) connecting the binary Ti plasmid vector with a joint: the linker made by gTDRU3-F and gTDRU3-R was ligated to vector pCUbi1390Cas9-U3, and the linker made by gTDRU6-F and gTDRU6-R was ligated to vector pCUbi1390Cas 9-U6;

1-5) transforming the connected vector into escherichia coli, sequencing a monoclonal transformant of the escherichia coli, reproducing correct clone, and extracting plasmids for later use.

More preferably, in step 1-3), the CRISPR/Cas9 vector pCUbi1390Cas9-U3 or pCUbi1390Cas9-U6 is digested with the restriction enzyme AarI.

More preferably, in steps 1-5), the sequencing primers used comprise:

and (3) detecting the correctness of the clone, wherein the promoter is U3 and is OsU 3-F: GGCATGCATGGATCTTGGAGGAAT, respectively; the promoter is U6 and is added with OsU 6-F: TTGAGCGATTACAGGCGAAAGTG, respectively;

check vector integrity, 35S forward primer 35S-F: TGACGCACAATCCCACTATCCTTC, respectively; cas 95' end primer Cas 9-R-1: TCGAGCCTGCGGGACTTAGAG, respectively; cas 93' end primer C126: TCGTGAAGAAGACCGAGGTT are provided.

Preferably, in step 4), T is analyzed by DNA sequencing₀Detecting the mutation situation of the target site of the TDR gene in the generation transformant, wherein the mutation situation comprises: no mutation, homozygous mutation, heterozygous mutation, biallelic mutation, and chimeric mutation.

Preferably, the fertility change of the transformant is observed in step 5) by the following method: directly observing with naked eyes on the day of flowering or 1-3 days before flowering, wherein if yellow pollen exists in the anther chamber, the anther chamber is fertile, and if no pollen exists, the anther chamber is sterile; when the plant is sterile, the mutation type may be one of homozygous, biallelic, or chimeric, and when fertile, the mutation type may be, but is not limited to, one of no mutation or heterozygous mutation.

Preferably, in step 6), when T is₀When the transformant is sterile, it is used as female parent and hybridized with wild type to make propagation, and when T is used₀Transformation ofSelfing and breeding the seeds when the seeds are fertile and heterozygous and mutated; after obtaining self-bred or hybridized T₁After the generation of the plant, detecting whether the plant carries the T-DNA component or not in the generation; screening to remove T-DNA component, judging homozygous mutant plant according to fertility condition, wherein sterile plant is homozygous plant, and when T is₀T containing no T-DNA component obtained by crossing with wild type when transformant is sterile₁The generation plants do not have homozygous plants, so that T is required₁Plants were selfed, from the T obtained₂And (4) selecting sterile plants from the generation plants.

Preferably, step 7) further comprises: the obtained homozygous sterile single plant without T-DNA component is used as female parent to be hybridized with fertile plants which are separated from the same generation population and are removed of T-DNA component, the number of father plants is more than 4 during hybridization, and the father plants and the sterile plants are respectively hybridized separately in pairs, each combination is used for harvesting and breeding separately, the progeny can have two conditions, the first progeny population has separation of fertile plants and sterile plants, the second population is all fertile plants, the population which has the first condition is selected and kept, the sterile plants in the population are hybridized with the fertile plants continuously, and the operation is continuously carried out on each generation, so that the obtained progeny fertile plants and the sterile plants can keep unchanged in a 1:1 separation mode.

In a second aspect, the present invention provides a method for detecting site-directed mutations obtained by the method of the first aspect of the present invention, by high resolution melting curve analysis.

Preferably, the high resolution dissolution curve analysis comprises the steps of:

a) preparing DNA of a rice plant to be detected;

b) carrying out PCR amplification by using the DNA prepared in the step a) as a template;

c) transferring the PCR product to a PCR reaction plate adapted to a high-resolution dissolution curve analysis instrument for high-resolution dissolution curve analysis;

d) mutant genotypes were analyzed according to high resolution melting curves.

Preferably, in step b), the primer pair used for PCR amplification comprises: a primer pair consisting of sequences shown in SEQ ID No.4 and SEQ ID No.5, or a primer pair consisting of sequences shown in SEQ ID No.6 and SEQ ID No. 7.

More preferably, the primer pair consisting of the sequences shown in SEQ ID No.4 and SEQ ID No.5 is used for detecting the site-directed mutation obtained by the method of the first aspect of the present invention, and is only used under the condition that the CRISPR \ Cas9 system adopts the sequence shown in SEQ ID No.2 or the sequence which has 1 to 3 base differences with the sequence as the sgRNA guide sequence; the primer pair consisting of the sequences shown in SEQ ID No.6 and SEQ ID No.7 is used for detecting the site-directed mutation obtained by the method in the first aspect of the invention, and is only used under the condition that the CRISPR \ Cas9 system adopts the sequence shown in SEQ ID No.3 or the sequence which has 1 to 3 base differences with the sequence as an sgRNA guide sequence.

Preferably, in step b), the PCR amplification reaction components are shown in Table 1,

TABLE 1 PCR amplification reaction Components in HRM analysis

Preferably, in step b), the PCR amplification temperature program is: 94 ℃ for 2 min; 5s at 95 ℃,20 s at 65 ℃,20 s at 72 ℃ and 45 cycles; 1min at 72 ℃; 3min at 95 ℃; 2min at 16 ℃.

Preferably, step b) further comprises: after the PCR amplification is finished, a double-stranded oligonucleotide low-temperature internal standard which is generally used for high-resolution melting curve analysis is added into the PCR reaction solution, wherein the sense strand of the low-temperature internal standard is ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT, and the adding amount is 1 mu l when the prepared internal standard concentration is 2.5 pmol/mu l.

Preferably, in step c), the high resolution dissolution profile analysis instrument employs an Idaho light scanner96 system.

Preferably, in step d), the genotyping is performed according to a melting curve that is compared to a wild-type control to determine the mutation.

Advantageous effects

The invention provides a method for carrying out site-directed mutagenesis on a TDR gene by using a CRISPR \ Cas9 system, which is used for creating a recessive male sterile material with important application value. Compared with the traditional method of introducing ready-made mutant genes by backcross or performing de novo mutagenesis and screening target mutants by TILLING (directed induction of local mutation of genome), the method provided by the invention is more efficient and has less influence on the genetic background of an operation object, and compared with the method for inhibiting TDR expression by RNA interference, the method has thorough and permanent knockout on the function of the target genes and can finally obtain a gene mutation strain without any exogenous transgenic component.

The present invention further provides a method for detecting site-directed mutagenesis of a TDR gene, which method can be used to detect T obtained by the method of the first aspect by performing high resolution melting curve analysis₀The generation transformant is preliminarily tested for mutation of the TDR gene target site, and can be further used for screening obtained different mutant genotypes to identify a specific TDR mutant type which is easy to be genotyped with a wild type, and genotyping test is carried out on the specific TDR mutant type when needed, and particularly, for example, the situation that the heterozygous genotype is identified from fertile strains of a segregation population of selfed progeny of the heterozygous mutant which does not have the functional mutation of the TDR is needed. The method overcomes the defect that the conventional detection method for performing electrophoresis by using the conventional PCR product is difficult to directly type the short-segment InDel mutation, avoids the enzyme digestion process required by the traditional CAPS \ dCAPS labeling detection method, has simpler flow and higher efficiency, avoids the purification process of the PCR product compared with the conventional Sanger sequencing, has higher efficiency and lower cost, can detect less samples and 96 samples at one time by using the typing method provided by the invention, and has very flexible detection flux. In a word, the mutation typing method provided by the invention has the advantages of flexible and variable detection flux, high efficiency and low cost.

Drawings

Fig. 1 is a TDR gene mutation genotype created by CRISPR/Cas9 system in example 1. WT, wild type; number # plus, mutation type number of target site 1; # plus number, mutation type number of target site 2; the grey shading person in the wild-type sequence is a gene sequence site corresponding to a sgRNA guide sequence of a CRISPR/Cas9 system, wherein bold and underlined bases respectively represent a U3 or U6 promoter start transcription base A or G in a Cas9 system, a boxed base TGG represents a spCas9PAM site NGG, a black inverted triangle indicates a Cas9 nuclease cleavage site, and all sequence directions are 5 '-3'; the dash "-" in the mutant sequence indicates the deleted base, the underlined one indicates the inserted base after the base at the corresponding position is deleted, and the rest is the same as the wild type; the numbers on the right of the figure indicate the number of bases deleted (indicated by "-") or inserted (indicated by "+");

FIG. 2 shows the phenotype of the TDR gene mutant male sterile line created in example 1. The plots contain ears of wild type and mutant and anthers on one stamen. The wild type ear is normal in seed setting, and the anther chamber contains yellow pollen particles; the mutant ears are all empty and shrivelled grains, and no pollen exists in the anther chamber.

FIG. 3 is a high resolution melting curve map of the high resolution melting curve assay of the example. FIGS. A and B are site-directed mutagenesis of a portion of the TDR gene T₀The detection result of the plants shows that the TDR target site amplification fragment dissolution curves of all the detected plants are different from wild type, and the mutation of the target sites in the plants is revealed; FIGS. C and D are the results of typing tests on mutants obtained by screening which are easy to genotype with the wild type, showing that the three genotypes of the homozygous mutant, heterozygous mutant and wild type of the two mutant genes are well discriminated. FIGS. A and C are the results of detection using a primer set designed for target site 1, and FIGS. B and D are the results of detection using a primer set designed for target site 2; the characters marked on the melting curve in the figure show that the curve represents the genotype of the plant; mutant numbers refer to FIG. 1 for corresponding mutant sequences; the horizontal axis is temperature and the vertical axis is normalized and derivative fluorescence value curve.

Detailed Description

The following examples are further illustrative of the present invention as to the technical content of the present invention, but the essence of the present invention is not limited to the following examples, and one of ordinary skill in the art can and should understand that any simple changes or substitutions based on the essence of the present invention should fall within the protection scope of the present invention.

The practice of the present invention will employ, unless otherwise indicated, conventional biological and agricultural techniques. Unless otherwise indicated, terms used in the present application have meanings commonly understood by those skilled in the art.

The experimental procedures in the following examples, in which specific conditions are not specified, are generally performed under conventional conditions, such as those described in book "molecular cloning, laboratory Manual (3 rd edition) (J. SammBruk, D.W. Lassel, Huang Peyer et al, J. Paecio, science publishers, 2008), or under conditions recommended by manufacturers of manufacturing reagents or equipment.

Example 1 Generation of recessive Male sterile line in Rice by CRISPR \ Cas9 knockout of TDR Gene

The TDR gene (the gene number of MSU rice genome database is LOC _ Os02g 02820; the gene number of RAP rice genome database is Os02g 0120500; the protein sequence is shown as SEQ ID No. 1) is knocked out and a male sterile strain is obtained by the following steps:

1) design of sgRNA guide sequence of CRISPR \ Cas9 system

CRISPR-P (using an in-line tool)http://cbi.hzau.edu.cn/crispr/) According to the method provided by the developer, a guide sequence (also equal to a target site sequence) of a CRISPR \ Cas9 system for a TDR gene is designed, in this example, two guide sequences (namely, two target sites) are selected for implementation, namely, AGCACAGGTCTCAGCACTGC (namely, the sequence shown in SEQ ID No.2 corresponds to target site 1) and GCTGCATTGAGGCCTCTAGT (namely, the sequence shown in SEQ ID No.3 corresponds to target site 2).

2) Synthesis of oligonucleotides for cloning based on leader sequence and vector requirements

In the embodiment, CRISPR/Cas9 vector pCUbi1390Cas9-U3 and pCUbi1390Cas9-U6 (vector information references: Cinnamomum longum, Huang Yong lan, Thang, Wang Hui Min, Luming, Yun Lin and Wanjian forest) based on vector pCAMBIA1390 (constructed by a non-profit organization CAMBIA, vector sequence and map are http:// www.cambia.org/day/CAMBIA/585. html) are adopted, and the gene Osramp 5 is knocked out by using CRISPR/Cas9 to create low-cadmium indica rice, China Rice science, 2019, 33(5):407 and 420) which are all constructed in the laboratory of the applicant.

According to the designed sgRNA guide sequence and the vector construction requirement, the oligodeoxyribonucleic acid with reverse complementary base except the four terminal bases is synthesized:

in the case where the leader sequence is the sequence shown in SEQ ID No.2, the synthetic oligodeoxyribonucleotide sequence is: ggcaGCACAGGTCTCAGCACTGC (designated gTDRU3-F) and aaacGCAGTGCTGAGACCTGTGC (designated gTDRU3-R), while for the case where the leader sequence is that shown in SEQ ID No.3, the synthetic oligodeoxyribonucleic acid sequences are cttgCTGCATTGAGGCCTCTAGT (designated gTDRU6-F) and aaacACTAGAGGCCTCAATGCAG (designated gTDRU 6-R).

3) Annealing oligonucleotides to form linkers

The oligonucleotides were dissolved in 1-fold TE buffer to a final concentration of 100 pmol/. mu.L, and the complementary oligonucleotides were mixed together in equal amounts and 2% by volume of 5M NaCl (in this method the components of the annealing system and the final concentration were about 10mM Tris-Cl, 1mM EDTA, 100mM NaCl, 50 pmol/. mu.L of each of the two complementary oligonucleotides) and mixed together in a PCR instrument (Hangzhou lattice T960) at 95 ℃ for 2 minutes, cooled to room temperature, and the linker was prepared by diluting the linker 50-fold to 1 pmol/. mu.L for further use.

4) Digestion and recovery

The CRISPR/Cas9 vector pCUbi1390Cas9-U3 or pCUbi1390Cas9-U6 was digested with the restriction enzyme AarI (manufacturer: Thermo scientific; cat # ER 1581).

Enzyme digestion system: plasmid 5 μ g, AarI enzyme 3U, 10 xAarI buffer 4 μ L, 50 xoligonucleotide (0.025 mM; enzyme manufacturer provide) 0.8 μ L, water make up to 40 μ L;

enzyme cutting conditions are as follows: incubation at 37 ℃ for 10 hours;

recovery of vector plasmid DNA: directly precipitating and recovering ethanol, specifically, adding 4 μ L of 3MNaCl into an enzyme digestion system, adding 88 μ L of ethanol, keeping the temperature at minus 20 ℃ for 30min, centrifuging at 12000g/min for 10min, discarding supernatant, washing with 70% ethanol for 2 times, and dissolving plasmid DNA with 50 μ L of water after a sample is dried.

5) Connection of

The connection reaction system is as follows: t4 ligase1. mu.L of buffer, about 100ng of vector recovered by ethanol precipitation, 1pmol of linker, 1. mu.L of T4 ligase (manufacturer NEB, cat. No. M0202S), ddH₂O is complemented to 10 mu L of total volume;

the ligation reaction conditions were: ligation was carried out at 16 ℃ for 2 h.

When ligated, the linkers made by gTDRU3-F and gTDRU3-R were ligated to vector pCUbi1390Cas9-U3, and the linkers made by gTDRU6-F and gTDRU6-R were ligated to vector pCUbi1390Cas 9-U6.

6) And (3) transforming escherichia coli: mu.L of the total ligation products were inoculated into 100. mu.L of commercial E.coli DH 5. alpha. chemocompetent cells (product: MCC 001; product name: Changsheng Biotechnology Limited liability company, Beijing ancient China), and positive clones were selected using kanamycin-containing plates according to the method provided by the product.

7) Sequencing

Selecting a single clone, sequencing the single clone by using the following primers, selecting a correct clone, and amplifying, propagating and extracting plasmids. The sequencing primer is as follows:

OsU3-F (GGCATGCATGGATCGTGAGGAAT) (for checking the correctness of cloning, the promoter is U3);

OsU6-F (TTGAGCGATTACAGGGCGAAAGTG) (for checking the correctness of cloning, the promoter is U6);

35S-F (TGACGACAATCCACTATCCTTC) (35S forward primer, check vector integrity);

cas9-R-1(TCGAGCCTGCGGGACTTAGAG) (Cas 95' end primer, check vector integrity);

c126(TCGTGAAGAAGACCGAGGTT) (cas 93' end primer, check vector integrity).

8) Transformation of Agrobacterium

Transformation of correctly cloned plasmids into regular CaCl by conventional repeated freeze-thaw method₂In the EHA105 Agrobacterium chemocompetent cells prepared by the method, specifically, the preparation and transformation of Agrobacterium chemocompetent cells comprises the following steps:

i) EHA105 stored at-70 ℃ was streaked on plates containing 50. mu.g/ml rifampicin and cultured at 28 ℃.

ii) single colonies were picked and inoculated into 5ml of YEP liquid medium, and cultured with shaking at 220rpm and 28 ℃ for 12-16 hr.

iii) 2ml of the culture broth was transferred to 100ml of YEP liquid medium and cultured with shaking at 28 ℃ and 220rpm until OD600 became 0.5.

iv) transferring into a sterile centrifuge tube, centrifuging at 5000rpm for 5min, and removing supernatant.

v) Add 10ml of precooled 0.1M CaCl₂The solution was gently suspended from the cells, left on ice for 20min, centrifuged at 5000rpm at 4 ℃ for 5min, and the supernatant was removed.

vi) 4ml of precooled 0.1M CaCl containing 15% glycerol was added₂Solution, gently suspended.

vii) the Agrobacterium suspension was aliquoted into sterile 1.5ml centrifuge tubes, 200. mu.L per tube frozen at-70 ℃.

viii) binary vector transformation of Agrobacterium EHA105

About 1 μ g of plasmid DNA was added to 200 μ l of EHA105 competent cells, mixed well, ice-washed for 30min, liquid nitrogen was left for 5min, then water-washed at 37 ℃ for 5min, ice-washed for 2min, added with 800 μ LYEP liquid medium at 28 ℃ and shaking at 175rpm for 3h, and then spread on YEP plates containing 50 μ g/ml kanamycin, and cultured at 28 ℃ until single colonies were formed.

9) Transformation of callus

Agrobacterium transformation was used to transform calli of the japonica rice varieties Tainan 11 (transformation of both vectors for the target site) and Ning 7012 (transformation of only the vector for the target site 2) (methods are described in Toki S, Hara N, OnoK, et al, early infection of the genome with Agrobacterium strain high-speed transformation of rice plant J, 2006, 47(6): 969-.

10) Detection of target site of TDR Gene in transformant

The transformant DNA (seedling stage leaf in this example) was extracted, and the PCR product target fragment obtained by PCR of the target sequence containing the target site 1 and the target site 2 in the TDR gene DNA sequence was cloned into pMD-18-T vector (manufacturer Takara, cat # 1) by using primers TDRU3HM1-F (AATGGCAGGTTCTTGGAGATGACAG; SEQ ID No.4) and TDRU3HRM1-R (AGGAGGAGTCCAGTGGGATTGAAG; SEQ ID No.5) and TDRU6HM1-F (GGAGGTGGCACCAGTTTGGATG; SEQ ID No.6) and TDRU6HM1-R (ATCAGGAGAGAGCCTCCAGTAGATG; SEQ ID No.7), respectively, and the obtained PCR product target fragment was cloned into pMD-18-T vector (manufacturer Takara, cat # 1), transformed into E.coli, the transformant was selected, and the sequencing of 10 monoclones or more was performed to ensure that 5 or more positive clones were obtained.

The PCR reaction system was 5. mu.l of 10 × PCR Buffer (Mg)²⁺plus; takara), 4. mu.l dNTPMixture (2.5 mM each), 5. mu.l primer (mix forward and reverse, 5 pmol/. mu.l each), 0.5. mu.l Takara rTaq (5U/. mu.l), 2. mu.l DMSO ≧ 99.5%, 2. mu.l DNA, 31.5. mu. l H₂O, total volume 50. mu.l.

The temperature program for the PCR was: 2min at 95 ℃; 30s at 94 ℃, 30s at 58 ℃, 30s at 72 ℃ and 35 cycles; 72 ℃ for 1 min.

11) Mutation determination

The sequencing result is compared with the wild type sequence, and the analysis result shows that 6 strains with

mutant target sites

1 and 3 strains with mutant target sites 2 are obtained from the transformant of the

variety Tainan

11, and 3 strains with mutant target sites 2 are obtained from the variety Ning 7012. FIG. 1 summarizes all mutant sequence types, and Table 2 shows the mutant genotypes of each mutant line. Except the line L01 of Ning 7012 variety as chimeric body, all the other are double allele mutations. There are 9 mutation types in the

target site

1 and 10 mutation types in the target site 2.

TABLE 2 genotype of TDR target sites in Gene-editing strains

Note that "-" indicates that the item is not present.

12) Observing and breeding the mutant to obtain TDR homozygous mutant male sterile line

All lines T of the two varieties listed in Table 2₀All generation (transgenic contemporary) plants appeared male sterile with no pollen in the stamen anther chamber (as shown in FIG. 2). To propagate these mutant materials, part of the lines as female parents are crossed with the original parent, from T obtained by crossing₁Plants passed the leaf hygromycin resistance test (method references: Liuqiaoquan, Chenxiu flower, Wangzheng steady, Penlingtao, Guminghong, a rapid detection of transformation baseA simple method for obtaining the hygromycin resistance of paddy rice, the report on agricultural biotechnology 2001, 9(03):264-268) selects the individual plant without transgenic component for self-reproduction to obtain T₂The generation plants, theoretically, will later appear 1/4 sterile plants, 3/4 fertile plants, wherein the sterile plants are homozygous plants of a certain mutant type, and the fertile plants are 1/3 wild type, 2/3 heterozygous mutant, and the T is observed to be₂Sterile plants and fertile plants are separated from each other in the generation plants, wherein the sterile plants account for about 1/4, and the T is further analyzed by a high-resolution dissolution curve analysis method₂Sterile strains (i.e., homozygous mutant strains) in the generation population are analyzed against wild-type to screen for mutation types that are readily genotyped with wild-type.

Example 2 detection of TDR mutation types susceptible to typing with wild type and propagation thereof by high resolution dissolution Curve analysis

In example 1, after obtaining the sterile plants (homozygous mutant) of the progeny of different gene editing lines, the present invention is further utilized to analyze the sterile plants of the progeny of different lines and the wild type together by using a high resolution melting curve method, so as to screen out mutant genotypes which are easy to be typed with the wild type. The results showed that an easily typed mutation type was obtained from each of the mutant lines at target site 1 and target site 2, with the numbers #04 and #07, respectively. Further carrying out gene typing detection on fertile plants in the mutant strains easy to type, screening out heterozygous mutant strains (the analysis result of a high-resolution melting curve is shown in figures 3C and D), then hybridizing the heterozygous mutant fertile plants and the homologous sterile plants through rice stump propagation, separating the progeny sterile plants from the fertile plants in a ratio of 1:1, and then continuously propagating the sterile mutant strains obtained by screening in a mode of hybridizing the fertile plants and the sterile plants.

The high resolution dissolution curve analysis method used in this example is specifically as follows:

high resolution melting curve analysis was performed using the Idaholightscanner96 system using a small fragment amplification method. PCR primers and amplicons: PCR was carried out on the target sequences containing the target site 1 and the target site 2 in the DNA sequence of the transformant TDR gene using primer pairs consisting of the primers TDRU3HM1-F (AATGGCAGGTTCTTGGAGATGACAG; SEQ ID No.4) and TDRU3HRM1-R (AGGAGGAGTCCAGTGGGATTGAAG; SEQ ID No.5), and TDRU6HM1-F (GGAGGTGGCACCAGTTTGGATG; SEQ ID No.6) and TDRU6HM1-R (ATCAGGAGAGAGCCTCCAGTAGATG; SEQ ID No.7), respectively, and the amplification products were 106bp and 90bp, respectively.

The PCR reaction was performed in the following manner, 1. mu.l of 10 × PCR Buffer (Mg)²⁺plus; takara), 0.8. mu.l dNTP mix (2.5 mM each), 1. mu.l primer (forward mix, 5 pmol/. mu.l each), 0.1. mu.l Takara rTaq (5U/. mu.l), 0.4. mu.l DMSO (. gtoreq.99.5%), 1. mu.l DNA, 1. mu.l LC-Green fluorescent dye, 4.7. mu. l H₂O, total volume 10. mu.l, 20. mu.l mineral oil was added.

Temperature program of PCR: 94 ℃ for 2 min; 5s at 95 ℃,20 s at 65 ℃,20 s at 72 ℃ and 45 cycles; 1min at 72 ℃; 3min at 95 ℃; 2min at 16 ℃.

After the PCR is finished, 1 μ l of low-temperature internal standard (the concentration is 2.5pmol/μ l) is added into the reaction solution, and then the PCR system and paraffin oil are all transferred into a special PCR plate (Bio-rad, black shell/white well PCR plate, the product number hsp9665) for HRM analysis, and the analysis temperature range is 65-95 ℃. The data analysis and processing are carried out by using the self-contained software of the system, and the analysis mode selects a small fragment method.

The concentration of different sample melting curves with the same genotype can be improved by adding a low-temperature internal standard in the experiment so as to improve the accuracy of the analysis effect, the low-temperature internal standard is double-stranded oligonucleotide, the sequence of a sense strand of the double-stranded oligonucleotide is ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT, and the preparation method is the same as that used for preparing the guide sequence oligonucleotide adaptor.

Example 3 preliminary detection of TDR site-directed mutagenesis T by high resolution dissolution Curve analysis₀Mutation of target site gene of generation transformant

The TDR gene obtained in example 1 was subjected to site-directed knockout T by the same method as described in example 2₀The generation transformed seedlings were tested and compared with the sequencing results, and it was found that all the plants with gene mutation showed significant differences in their high resolution melting curves compared with the wild type (see FIG. 3A)&B) Therefore, the method provided by the invention is used for detecting the site-directed mutagenesis current generation transformation seedling, and whether a transformant target site is stored or not can be judged rapidlyIn gene mutation.

Sequence listing

<110> super rice research and development center in Jiangxi province

<120> method for carrying out site-directed mutagenesis and detection on rice TDR gene by using CRISPR \ Cas9 system

<130>1110000000

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>552

<212>PRT

<213>Oryza sativa

<400>1

Met Gly Arg Gly Asp His Leu Leu Met Lys Asn Ser Asn Ala Ala Ala

1 5 10 15

Ala Ala Ala Ala Val Asn Gly Gly Gly Thr Ser Leu Asp Ala Ala Leu

20 25 30

Arg Pro Leu Val Gly Ser Asp Gly Trp Asp Tyr Cys Ile Tyr Trp Arg

35 40 45

Leu Ser Pro Asp Gln Arg Phe Leu Glu Met Thr Gly Phe Cys Cys Ser

50 55 60

Ser Glu Leu Glu Ala Gln Val Ser Ala Leu Leu Asp Leu Pro Ser Ser

65 70 75 80

Ile Pro Leu Asp Ser Ser Ser Ile Gly Met His Ala Gln Ala Leu Leu

85 90 95

Ser Asn Gln Pro Ile Trp Gln Ser Ser Ser Glu Glu Glu Glu Ala Asp

100 105 110

Gly Gly Gly Gly Ala Lys Thr Arg Leu Leu Val Pro Val Ala Gly Gly

115 120 125

Leu Val Glu Leu Phe Ala Ser Arg Tyr Met Ala Glu Glu Gln Gln Met

130 135 140

Ala Glu Leu Val Met Ala Gln Cys Gly Gly Gly Gly Ala Gly Asp Asp

145 150 155 160

Gly Gly Gly Gln Ala Trp Pro Pro Pro Glu Thr Pro Ser Phe Gln Trp

165 170 175

Asp Gly Gly Ala Asp Ala Gln Arg Leu Met Tyr Gly Gly Ser Ser Leu

180 185 190

Asn Leu Phe Asp Ala Ala Ala Ala Asp Asp Asp Pro Phe Leu Gly Gly

195 200 205

Gly Gly Gly Asp Ala Val Gly Asp Glu Ala Ala Ala Ala Gly Ala Trp

210 215 220

Pro Tyr Ala Gly Met Ala Val Ser Glu Pro Ser Val Ala Val Ala Gln

225 230 235 240

Glu Gln Met Gln His Ala Ala Gly Gly Gly Val Ala Glu Ser Gly Ser

245 250 255

Glu Gly Arg Lys Leu His Gly Gly Asp Pro Glu Asp Asp Gly Asp Gly

260 265 270

Glu Gly Arg Ser Gly Gly Ala Lys Arg Gln Gln Cys Lys Asn Leu Glu

275 280 285

Ala Glu Arg Lys Arg Arg Lys Lys Leu Asn Gly His Leu Tyr Lys Leu

290 295 300

Arg Ser Leu Val Pro Asn Ile Thr Lys Met Asp Arg Ala Ser Ile Leu

305 310 315 320

Gly Asp Ala Ile Asp Tyr Ile Val Gly Leu Gln Lys Gln Val Lys Glu

325 330 335

Leu Gln Asp Glu Leu Glu Asp Asn His Val His His Lys Pro Pro Asp

340 345 350

Val Leu Ile Asp His Pro Pro Pro Ala Ser Leu Val Gly Leu Asp Asn

355 360 365

Asp Asp Ala Ser Pro Pro Asn Ser His Gln Gln Gln Pro Pro Leu Ala

370 375 380

Val Ser Gly Ser Ser Ser Arg Arg Ser Asn Lys Asp Pro Ala Met Thr

385 390 395 400

Asp Asp Lys Val Gly Gly Gly Gly Gly Gly Gly His Arg Met Glu Pro

405 410 415

Gln Leu Glu Val Arg Gln Val Gln Gly Asn Glu Leu Phe Val Gln Val

420 425 430

Leu Trp Glu His Lys Pro Gly Gly Phe Val Arg Leu Met Asp Ala Met

435 440 445

Asn Ala Leu Gly Leu Glu Val Ile Asn Val Asn Val Thr Thr Tyr Lys

450 455 460

Thr Leu Val Leu Asn Val Phe Arg Val Met Val Arg Asp Ser Glu Val

465 470 475 480

Ala Val Gln Ala Asp Arg Val Arg Asp Ser Leu Leu Glu Val Thr Arg

485 490 495

Glu Thr Tyr Pro Gly Val Trp Pro Ser Pro Gln Glu Glu Asp Asp Ala

500 505 510

Lys Phe Asp Gly Gly Asp Gly Gly Gln Ala Ala Ala Ala Ala Ala Ala

515 520 525

Ala Gly Gly Glu His Tyr His Asp Glu Val Gly Gly Gly Tyr His Gln

530 535 540

His Leu His Tyr Leu Ala Phe Asp

545 550

<210>2

<211>20

<212>DNA

<213>Artificial Sequence

<400>2

agcacaggtc tcagcactgc 20

<210>3

<211>20

<212>DNA

<213>Artificial Sequence

<400>3

gctgcattga ggcctctagt 20

<210>4

<211>25

<212>DNA

<213>Artificial Sequence

<400>4

aatggcaggt tcttggagat gacag 25

<210>5

<211>24

<212>DNA

<213>Artificial Sequence

<400>5

aggaggagtc cagtgggatt gaag 24

<210>6

<211>22

<212>DNA

<213>Artificial Sequence

<400>6

ggaggtggca ccagtttgga tg 22

<210>7

<211>25

<212>DNA

<213>Artificial Sequence

<400>7

atcaggagag agcctccagt agatg 25

Claims

1. The method for carrying out site-directed mutagenesis on a rice wild type TDR gene by using a CRISPR \ Cas9 system, wherein the TDR gene codes a rice protein sequence which is the same as the sequence shown in SEQ ID No.1 or has more than 95% sequence similarity, and an sgRNA guide sequence adopted by the CRISPR \ Cas9 system comprises any sequence shown in SEQ ID No.2 or SEQ ID No.3 in a DNA sequence mode or a sequence which has 1 to 3 base differences with the sequence shown in SEQ ID No.2 or SEQ ID No. 3.

2. The method for site-directed mutagenesis of rice wild-type TDR gene by using CRISPR \ Cas9 system according to claim 1, characterized in that the functional components of CRISPR \ Cas9 system are assembled in binary Ti plasmid vector, and the binary Ti plasmid vector comprises pCUbi1390Cas9-U3 or pCUbi1390Cas 9-U6.

3. The method for site-directed mutagenesis of a rice wild-type TDR gene by using a CRISPR \ Cas9 system according to claim 2, wherein when the binary Ti plasmid vector is pCUbi1390Cas9-U3, the sgRNA guide sequence of the CRISPR \ Cas9 system is selected from a sequence which is transferred into a DNA sequence form and is shown as SEQ ID No.2, or a sequence which has 1 to 3 base differences with the sequence shown as SEQ ID No. 2; when the binary Ti plasmid vector is pCUbi1390Cas9-U6, the sgRNA guide sequence of the CRISPR \ Cas9 system is selected from a sequence which is transferred into a DNA sequence form and is shown as SEQ ID No.3, or a sequence which has 1 to 3 base differences with the sequence shown as SEQ ID No. 3.

4. The method for site-directed mutagenesis of a rice wild-type TDR gene by using a CRISPR \ Cas9 system according to claim 1, which comprises the following steps:

1) constructing a target CRISPR binary Ti plasmid vector;

2) transforming the vector into agrobacterium;

5) observing the fertility change of the transformant;

7) breeding the target homozygous single plant.

5. The method for site-directed mutagenesis of rice wild-type TDR gene by using CRISPR \ Cas9 system according to claim 4, wherein the step 1) further comprises:

gTDRU3-F：ggcaGCACAGGTCTCAGCACTGC，

gTDRU3-R：aaacGCAGTGCTGAGACCTGTGC；

gTDRU6-F：cttgCTGCATTGAGGCCTCTAGT，

gTDRU6-R：aaacACTAGAGGCCTCAATGCAG；

1-3) carrying out enzyme digestion and recovering a binary Ti plasmid vector;

6. The method of detecting site-directed mutations obtained by the method of any one of claims 1 to 5, which is carried out by high resolution melting curve analysis.

7. The detection method according to claim 6, comprising the steps of:

a) preparing DNA of a rice plant to be detected;

d) mutant genotypes were analyzed according to high resolution melting curves.

8. The detection method according to claim 7, wherein in step b), the primer pair used for PCR amplification comprises: a primer pair consisting of sequences shown in SEQ ID No.4 and SEQ ID No.5, or a primer pair consisting of sequences shown in SEQ ID No.6 and SEQ ID No. 7.

9. The detection method according to claim 8, characterized in that the primer pair consisting of the sequences shown in SEQ ID No.4 and SEQ ID No.5 is used under the condition that the sequence shown in SEQ ID No.2 or the sequence which is 1 to 3 bases different from the sequence is adopted as the sgRNA guide sequence in the CRISPR \ Cas9 system; the primer pair consisting of the sequences shown in SEQ ID No.6 and SEQ ID No.7 is used under the condition that the sequence shown in SEQ ID No.3 or the sequence which is 1 to 3 bases different from the sequence is adopted as a sgRNA guide sequence in the CRISPR \ Cas9 system.

10. The detection method according to claim 7, wherein in the step b), the PCR amplification temperature program is as follows: 94 ℃ for 2 min; 5s at 95 ℃,20 s at 65 ℃,20 s at 72 ℃ and 45 cycles; 1min at 72 ℃; 3min at 95 ℃; 2min at 16 ℃.