CN112575012B

CN112575012B - Wheat susceptible gene plant editing and application thereof in breeding disease-resistant varieties

Info

Publication number: CN112575012B
Application number: CN202011531114.0A
Authority: CN
Inventors: 王晓杰; 王宁; 汤春蕾; 樊昕; 何梦颖; 胡泽宇; 王建锋; 康振生
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2020-12-22
Filing date: 2020-12-22
Publication date: 2022-08-09
Anticipated expiration: 2040-12-22
Also published as: CN112575012A

Abstract

The invention belongs to the technical field of disease-resistant variety cultivation, and discloses a wheat susceptible gene plant editing method and application thereof in disease-resistant variety cultivation, wherein three copies of B, D and A are available in wheat. Two genetic background RNAi mutants of tariripk 1 were obtained. The invention adopts an agrobacterium-mediated genetic transformation method and utilizes CRISPR-Cas9 gene editing technology to obtain a gene editing plant of TaRIPK 1. The wheat stripe rust is inoculated to discover that TaRIPK1 RNAi plant strains with two genetic backgrounds have obvious resistance to stripe rust toxicity race CYR32, and the resistance to disease is identified for TaRIPK1 gene editing technology, and the result discovers that the resistance to disease of a plant edited by the TaRIPK1 gene is obviously improved. Has obvious resistance to main epidemic microspecies of wheat stripe rust and leaf rust and can be used for new germplasm materials for genetic improvement of wheat rust resistance.

Description

Wheat susceptible gene plant editing and application thereof in breeding disease-resistant varieties

Technical Field

The invention belongs to the technical field of disease-resistant variety cultivation, and particularly relates to a wheat susceptible gene plant editing method and application thereof in disease-resistant variety cultivation.

Background

Wheat is currently used as one of the most widely cultivated cereal crops to provide a staple food for over 25 billion people worldwide (http:// www.fao.org/faostat /). Wheat rust caused by three rust fungi, i.e., Puccinia striiformis, Puccinia graminis and Puccinia graminis, is the most notoriously encountered disease in wheat production (McIntosh et al, 1995; Ellis et al, 2014). Is widespread and prevalent worldwide, causes severe yield losses and seriously threatens wheat production and safety (Chen et al, 2014; Park et al, 2015; Han and Kang, 2018). Planting disease-resistant varieties is the most economic, effective and environment-friendly strategy for preventing wheat rust. Although breeders have developed a large number of resistance genes, most are race-specific resistance genes and the persistence of resistance is limited. And the biggest obstacle in the control of wheat rust races is the constant emergence of new virulent variant races (Fu et al, 2009; Zhao et al, 2013; Wang et al, 2016). Therefore, the cultivation of broad-spectrum rust-resistant wheat varieties still faces certain challenges. In severe cases even more than 90% yield loss on wheat production (Ellis et al, 2014). In addition, the need to produce enough wheat to meet the ever-increasing population demands, climate change and its associated drought and high temperature stresses, as well as emerging reduced yield diseases, all pose significant challenges to wheat production and global food safety. Therefore, how to make wheat capable of meeting the production requirement and resisting the attack of rust fungi is the key of breeding for disease resistance.

Plant susceptibility genes are essential for successful invasion of pathogenic bacteria and are essential for the establishment of an affinity interaction between plants and pathogenic bacteria. These three mechanisms of susceptibility have been reported mainly for susceptibility genes, (1) to help pathogen recognition and invasion into hosts, e.g., mlo (susceptibility genes); (2) is helpful for the growth and proliferation of pathogenic bacteria, such as SWEET family gene. (3) Negative regulators of immune signals. Disruption of these susceptible genes can interfere with the host and pathogen avidity interactions, thereby conferring broad spectrum and durable disease resistance to plants. In recent years, improvement of disease resistance has been achieved by editing disease-sensitive genes on some important crops through gene manipulation. Some recent studies have implemented transgene-free editing of disease-sensitive genes using CRISPR gene editing techniques. At present, broad-spectrum disease resistance is achieved on a variety of important commercial crops by disrupting the S gene.

In summary, the problems of the prior art are as follows:

(1) the discovery and utilization of the wheat susceptibility gene are the most economic and effective measures for improving wheat crops, the screening time is long by using the traditional genetic improvement method, and the important challenge on how to quickly discover the disease resistance and the regulatory gene thereof is faced.

(2) Can successfully interfere the affinity interaction between pathogenic bacteria and hosts, successfully realizes the successful editing of the destroyed S gene on important economic crops such as rice and the like by using a gene editing means, successfully realizes the broad-spectrum resistance of the crops, and then can successfully realize the editing on wheat by using the identified disease-sensitive gene?

(3) Although the edited S gene mutant can realize broad-spectrum resistance of crops to diseases, most of the mutants excessively consume all nutrients in the growth and development process of plants under the potential of disease resistance, and how can wheat materials capable of resisting diseases and maintaining growth be obtained?

The difficulty of solving the technical problems is as follows: the primarily identified gene silencing plant of the susceptibility gene TaRIPK1 is created by utilizing RNAi technology, and the phenotype identification is carried out on TaRIPK1-RNAi plants with different genetic backgrounds, so that the RNAi plant of TaRIPK1 shows that the resistance to the rust stripe is changed from wild susceptibility to high resistance or near immunity. Then, a CRISPR-Cas9-gRNA vector of 3 gRNAs in series connection is constructed, and then a wheat material for gene editing is created, so that the novel material for creating wheat rust resistance mediated by a disease-sensitive gene is obtained.

The significance of solving the technical problems is as follows: the research on the gene susceptible to the TaRIPK1 adds new content for clarifying the biological function of the gene susceptible to the wheat, provides beneficial theoretical guidance and gene resources for the molecular improvement of the wheat, reveals the function of the gene susceptible to the TaRIPK1 in the interaction of the wheat and the stripe rust, and provides theoretical basis and technical support for the reasonable utilization of rust-resistant varieties, genetic improvement and the lasting control of the stripe rust.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a wheat susceptible gene plant editing method and application thereof in breeding of disease-resistant varieties.

The invention is realized in such a way, the disease-resistant gene is TaRIPK1 gene, the TaRIPK1 gene has three copies of B, D and A in wheat, and the coding ORF sequence is SEQ ID NO: 1-SEQ ID NO: 3.

the invention also aims to provide application of the disease-resistant gene in simultaneously improving wheat stripe rust and leaf rust resistant varieties.

The invention also aims to provide application of the disease-resistant gene in simultaneously improving the stripe rust resistance and the leaf rust resistance of wheat in breeding of wheat disease-resistant varieties.

The invention also aims to provide application of the disease-resistant gene in simultaneously improving the stripe rust resistance and the leaf rust resistance of wheat in the cultivation of disease-resistant varieties of crops.

The invention also aims to provide a screening method of the disease-resistant gene, which comprises the following steps:

firstly, silencing an initially identified disease-susceptible gene TaRIPK1 by using a gene gun-mediated genetic transformation method to obtain RNAi plants of TaRIPK1 of wheat materials with two genetic backgrounds, and screening and identifying phenotypes of the RNAi plants to find that the obtained RNAi plants of TaRIPK1 generate obvious disease-resistant reaction;

secondly, after the function of the susceptibility gene TaRIPK1 is defined, a wheat transgenic plant edited by TaRIPK1 is obtained by a CRISPR-Cas9 gene editing technology, and the phenotype of the wheat transgenic plant is finally identified, so that the wheat transgenic plant edited by TaRIPK1 has resistance to main epidemic microspecies of the stripe rust and field epidemic microspecies of the leaf rust, and the susceptibility gene TaRIPK1 in wheat has the same function in the interaction of wheat and rust.

Another object of the present invention is to provide a plant edited by the disease-resistant gene.

Further, the method for creating the plant comprises the following steps:

firstly, designing an RNA target: according to the genome sequence of the wheat TaRIPK1 gene and the requirements of CRISPR-Cas9 technology design targets, 5 gRNA sequences which contain NGG sequences at the tail ends and are simultaneously contained on the wheat Ta RIPK1 genes B, D and A are designed;

secondly, detecting enzyme digestion activity in vitro, and selecting gRNA1, g RNA3 and gRNA5 according to the result of activity detection;

thirdly, establishing gRNAs in series on a gene editing vector VK005 in an in-vitro tower bridge manner;

fourthly, agrobacterium-mediated wheat callus genetic transformation: transforming the CRSPR-C as9-gRNA vector constructed in the third step into a receptor variety Fielder to obtain a positive plant of the CRSPR-Cas 9-gRNA.

And fifthly, detecting and sequencing the progeny of the transgenic positive plant to obtain a mutant plant successfully edited on TaRIPK 1A, B and D.

Further, the sequence of the first step gRNA is gRNA1-ATTGTATTAATATCACCAGG G, gRNA2-CAATAAGATACACTTATAAGG, gRNA3-ATCTGTAGAATCAAG ACAAGG, gRNA4-TCCACACAATAGCCATAAAGG, gRNA5-TCAAGGTAAT TGTAGACAAGG.

Further, the first step targeting site is designed on the second and third exons.

Further, in the fifth step, successfully targeted gRNA3 was located on the third exon as found by detection analysis; the gRNA sequence is:

gRNA3-ATCTGTAGAATCAAGACAAGG。

by combining all the technical schemes, the invention has the advantages and positive effects that: in wheat, there are three copies of B, D and a, each copy having the sequence shown in SEQ ID NO: 1-3. The total length of the ORF of TaRIPK1 in three copies of A, B and D is 1206bp, and the coded amino acid sequence is 401 amino acids. The coding ORF sequences of wheat TaRIPK1 gene TaRIPK1-6B, TaRIPK1-6D and TaRIPK1-6A are SEQ ID NO: 1-3. The coding amino acid sequence of wheat TaRIPK1 gene TaRIPK1-6B, TaRIPK1-6D and TaRIPK1-6A is SEQ ID NO: 4-6. The gene can be manipulated and utilized by a key pathogenic factor, namely, the septium-promoting GTP-binding protein 1 of the rust fungi. The invention adopts genetic transformation mediated by a gene gun to obtain RNAi mutants of TaRIPK1 with two genetic backgrounds. The invention adopts an agrobacterium-mediated genetic transformation method and utilizes CRISPR-Cas9 gene editing technology to obtain a gene editing plant of TaRIPK 1. The puccinia striiformis is inoculated to find that two TaRIPK1 RNAi strains with genetic backgrounds have obvious resistance to puccinia striiformis virulence microspecies CYR 32. The disease resistance of the TaRIPK1 gene editing technology is identified, and the result shows that the disease resistance of the TaRIPK1 gene editing plant is obviously improved. The wheat TaRIPK1 gene is used as a susceptible gene to participate in wheat stripe rust, the resistance of a wheat editing plant of the gene to main epidemic microspecies of wheat stripe rust and leaf rust is obviously improved, and the gene can be used as a new germplasm material for genetic improvement of wheat rust resistance.

The invention simultaneously edits three alleles of TaRIPK1 in wheat by using a CRISPR-Cas9 gene editing technology, and discovers that a TaRIPK1 gene editing plant has no possibility of off-targeting other genes through detection of a possible off-target gene predicted by a Cas-OFFinder, thereby successfully obtaining a TaRIPK1 gene knockout mutant plant. The main dominant race and the rust of the stripe rust are inoculated on the TaRIPK1 gene knockout mutant, the stripe rust and the rust show broad-spectrum resistance, and the evaluation result of the main agronomic characters proves that the TaRIPK1 gene knockout mutant still maintains the main agronomic characters. The TaRIPK1 gene knockout mutant and the wild type still show resistance to the field stripe rust fungus population in the field with serious stripe rust fungus, and the main agronomic characters are not different from the wild type Fielder. Thus, wheat plants with potential for the prevention and control of wheat stripe rust are obtained.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments of the present application will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present application, and it is obvious for those skilled in the art that other drawings can be obtained from the drawings without creative efforts.

FIG. 1 is a flow chart of a method for screening and obtaining susceptibility genes for wheat stripe rust and leaf rust resistant variety improvement, which is provided by the embodiment of the invention.

FIG. 2 is a flow chart of a method for creating a plant edited by a TaRIPK1 gene for improving a wheat rust-resistant variety provided by the embodiment of the invention.

FIG. 3 is a schematic diagram of the resistance analysis of TaRIPK1 RNAi plants (genetic background of water source 11) against Puccinia striiformis provided by the embodiments of the present invention.

FIG. 4 is a schematic diagram of the resistance analysis of TaRIPK1 RNAi plants (1376 genetic background) against Puccinia striiformis provided by the embodiments of the present invention.

FIG. 5 is a schematic diagram of the alignment analysis of the cDNA sequences of three copies of TaRIPK1 provided in the examples of the present invention.

FIG. 6 is a schematic diagram of the alignment analysis of the protein sequences of three copies of TaRIPK1 provided in the examples of the present invention.

Fig. 7 is a schematic diagram of an editing vector CRISPR-Cas9 for editing a wheat gene tariripk 1 provided by an embodiment of the invention.

FIG. 8 is a schematic diagram of TaRIPK1-CRISPR-Cas9-gRNAs vectors provided by the embodiments of the present invention.

Fig. 9 is a schematic diagram of the guide rna (grna) sequence and in vitro activity of TaRIPK1 gene provided in the present invention.

FIG. 10 is a diagram of the process of obtaining TaRIPK1 transgenic plant by Agrobacterium-mediated transformation of TaRIPK1-CRISPR-Cas 9-gRNAs.

FIG. 11 is a schematic diagram of the PCR detection result of TaRIPK1 transgenic plants provided by the embodiment of the invention.

FIG. 12 is a schematic diagram showing the results of TaRIPK1 transgene sequencing analysis provided by the embodiments of the present invention.

FIG. 13 is a schematic diagram of the detection of possible off-target in plants edited by the TaRIPK1 gene provided by the embodiments of the present invention.

FIG. 14 is a schematic diagram showing that a plant edited by the TaRIPK1 gene shows broad-spectrum resistance to the main epidemic microspecies of Puccinia striiformis provided by the embodiment of the invention.

FIG. 15 is a schematic diagram of the phenotype of Puccinia plantlets inoculated with TaRIPK1 gene-edited plants and wild-type plants provided by the embodiments of the present invention.

FIG. 16 is a schematic diagram of the TaRIPK1 gene editing plant provided by the embodiment of the invention maintaining the main agronomic traits.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Aiming at the problems in the prior art, the invention provides a wheat susceptible gene plant editing method and application thereof in breeding of disease-resistant varieties, and the invention is described in detail below with reference to the accompanying drawings.

The invention utilizes CRISPR-Cas9 to edit wheat susceptible gene TaRIPK1 to simultaneously improve the stripe rust resistance and the leaf rust resistance of wheat, the wheat susceptible gene used for improving the wheat variety with the rust resistance is TaRIPK1, the coded protein is typical serine/threonine protein kinase, and TaRIPK1 contains typical ATP binding site, activation loop and conserved Ser/Thr protein kinase conserved structural domain of the protein kinase;

tariripk 1 has 1 copy on each of wheat B, D and a chromosomes and encodes an ORF sequence of SEQ ID NO: 1-3.

The amino acid sequences of TaRIPK1 coded by wheat B, D and A chromosomes are SEQ ID NO: 4-6.

The guide RNA sequence used to edit the TaRIPK1 gene is SEQ ID NO: 7-9.

As shown in figure 1, the screening and obtaining method of the susceptibility genes for wheat stripe rust resistance and leaf rust resistance variety improvement provided by the invention comprises the following steps:

s101, silencing the initially identified disease-susceptible gene TaRIPK1 by utilizing a gene gun-mediated genetic transformation method, finally obtaining two RNAi plants of TaRIPK1 of wheat material with genetic background, screening and identifying the phenotypes of the RNAi plants, and finding that the obtained RNAi plants of TaRIPK1 generate obvious disease-resistant reaction;

s102, after the function of a susceptible gene TaRIPK1 is determined, a wheat transgenic plant edited by TaRIPK1 is obtained through a CRISPR-Cas9 gene editing technology, and the phenotype of the wheat transgenic plant is finally identified, the wheat transgenic plant edited by TaRIPK1 has resistance to main epidemic microspecies of stripe rust and field epidemic microspecies of leaf rust, and the fact that the susceptible gene TaRIPK1 in wheat has the same function in the interaction of wheat and rust is shown.

As shown in FIG. 2, the method for creating TaRIPK1 gene editing plant for improving wheat variety resisting rust disease provided by the invention comprises the following steps:

s201, RNA target design: according to the genome sequence of wheat TaRIPK1 gene and the requirement of CRISPR-C as9 technical design target spot, 5 guide RNA (gRNA) sequences which contain NGG sequence at the tail end and are simultaneously contained on wheat TaRI PK1 genes B, D and A are designed, and the sequences are gRNA 1-ATTGTATTAATATCACCAGGG, gRNA2-CAATAAGATACACTTATAAGG, gRNA3-ATCTGTAGAATCAAGACAAGG, gRNA4-TCCACACAATAGCCATAA AGG, gRNA 5-TCAAGGTAATTGTAGACAAGG;

s202, detecting enzyme digestion activity in vitro, and selecting gRNA1, gRNA3 and gRNA5 according to the result of activity detection;

s203, constructing gRNAs in series on a gene editing vector VK005 in an in-vitro tower bridge manner;

s204, agrobacterium-mediated genetic transformation of wheat callus: the CRSPR-Cas9-gRNA vector constructed in S203 is transformed into a receptor variety Fielder to obtain a positive plant of the CRSPR-Cas 9-gRNA.

S205, carrying out detection and sequencing analysis on the transgenic positive plant progeny to finally obtain the mutant plants successfully edited on TaRIPK 1B, D and A.

The technical solution of the present invention is further described below with reference to the accompanying drawings.

The invention utilizes CRISPR-Cas9 to edit wheat susceptible gene TaRIPK1, and the coding ORF sequence on the 6B chromosome is SEQ ID NO: 1.

atgggttgttctcctttcttctgctataaaagtggggcaacacgccagcaaatttctacgcatactgaagacctccctg gtgatattaatacaataagatacacttataaggagctagcaagggcaacagaaaattttaacccatccaacaagattggtga ggggggttttggatctgtatataaggggcggctaaggaatggaaaacttattgctgtcaaggtgttatctgtagaatcaagac aaggactaaaggagtttctgaatgaactgatgtcaatttccaacatatctcatggcaatcttgtcagcctttatggctattgtgtg gaaggaaaccagaggatccttgtctacaattaccttgagaataatagccttgcacaaacacttctaggttctggccgcagca atatccagttcaattggagaagtagagtaaatatttgccttggtatcgcccgaggattagcatacctccatgatgatgtcaatc cccacattgttcatcgggatatcaaagcaagcaatatacttcttgataaggatctcacccccaaaatttctgatttcggtttagc aaagcttctacctccaaatgcgtcacatattagcacacgggttgcaggaacattaggttacttggctcctgagtacgccattc gaggacaagtgacacggaagtcagatgtttatagttttggtgttttgcttctggaaatagtcagtgggagatccaacaccagt tcaagattaccctatgaagatcagatacttctggaaaagttcccagaggttaccaacggggttctcctcttgcagacatggat gtattatgagcagggagatttggcgaaaatcatagacagttctgcgggtgatgatttggatattgaacaagcctgcaggttc ctgaaagttggacttctctgtacacaagatgtcacaagacatcgacccactatgtcaactgtcgtcagcatgctaacaggcg aaaaggatgttgactcggagaagatcagcaagcccgctacaattagcgactttatggaccttaagatcaggagcatgagg agagaaaataacattgctttcgcttcatcctccacgttgctatccactatcatggcacactcttctcctttgttgtcacaagagac gacacaagcctccataacattcaccgcaatatcagagcgtgagtga

the wheat susceptible gene TaRIPK1 edited by using CRISPR-Cas9 has the coding ORF sequence on the 6D chromosome as shown in SEQ ID NO: 2.

atgggttgttctcctttcttctgctataaaagtggggcaacacgccagcaaatttctactcatactgaagacctccctg gtgatattaatacaataagatacacttatagggagctagcaagggcaacagaaaattttaacccatccaacaagattggtga gggtggttttggatcggtatataaggggcggctaaggaatggaaaacttattgctgtcaaggtgttatctgtagaatcaagac aaggactaaaggagtttctgaatgaactgatgtcaatttccaacatatctcatggcaatcttgtcagcctttatggctattgtgtg gaaggaaaccagaggatccttgtctacaattaccttgagaataatagccttgcacaaacacttctaggttctggccgcagca atatccagttcaattggagaagtagagtaaatatttgccttggtatcgcccgaggattagcatacctccatgatgatgtcaatc cccacattgttcatcgggatatcaaagcaagcaatatacttcttgataaggatctcacccccaaaatttctgatttcggtttagc aaagcttctacctccaaatgcgtcacatattagcacacgggttgcaggaacattaggttacttggctcctgagtatgccattc gaggacaagtgacacggaagtcagatgtttatagttttggtgttttgcttcttgaaatagtcagtgggagatccaacaccagtt caagattaccctatgaagaccagatacttctggaaaagttcccagaggttaccaatggggttctcctcttgcagacatggat gtattatgagcagggagatttggcgaaaatcatagacagttctgcgggtgatgatatggatattgaacaagcctgcaggttc ctgaaagttggacttctctgtacacaagatgtcacaagacatcgacccactatgtcaactgtcgtcagcatgctaacaggcg aaaaggatgttgactcggagaagatcagcaagcccgctacaattagcgactttatggaccttaagatcaggagcatgagg agagaaaataacattgcattcgcttcatcctccacgttgctatccactatcatggcacactcttctcctttgttgtcgcaagaga cgacacaagcctccatcacattcaccgcaatatcagagcgtgagtga

the wheat susceptible gene TaRIPK1 edited by using CRISPR-Cas9 has the coding ORF sequence on the 6A chromosome as shown in SEQ ID NO: 3.

atgggttgttctcctttcttctgctataaaagtggggcaacacgccagcaaatttctacgcatactgaagacctccctg gtgatattaatacaataagatacacttataaggagctagcaagggcaacagaaaatttcaacccatccaacaagattggcga ggggggttttggatctgtatataaggggcggctaaggaatggaaaacttattgctgtcaaggtgttatctgtagaatcaagac aaggactaaaggagtttctgaatgaactgatgtcaatttccaacatatctcatggcaatcttgtcagcctttatggctattgtgtg gaaggaaaccagaggatccttgtctacaattaccttgagaataatagccttgctcaaacacttctaggttctggccgcagca atatccagttcaattggagaagtagagtaaatatttgccttggtatcgcccgaggattagcatacctccatgatgatgtcaatc cccacattgttcatcgggatatcaaagcaagcaatatacttcttgataaggatctcacccccaaaatttctgatttcggtttagc aaagcttctacctccaaatgcgacacatattagcacacgggttgcaggaacattaggttacttggctcctgagtatgctattc gaggacaagtgacacggaagtcagatgtttatagttttggtgttttgcttctggaaatagtcagtgggagatccaacaccagt tcaagattaccctatgaagaccagatactactggaaaagttcccagaggttaccaatggggttctcctcttgcagacatggat gtattatgagcagggagatttggcgaaaatcatagacagttctgcgggtgatgatttggatattgaacaagcctgcaggttc ctgaaagttggacttctctgtacacaagatgtcacaagacatcgacccactatgtcaactgtcgtcagcatgctaacaggcg aaaaggatgttgactcggagaagatcagcaagcccgctacaattagcgactttatgaaccttaagatcaggagcatgagg agagaaaataacattgctttcgcttcatcctccacgttgctatccactatcatggcacactcttctcctttgttgtcgcaagaga cgacacaagcctccatcacattcaccacaatatcagagcgtgagtga

the invention utilizes CRISPR-Cas9 to edit wheat susceptible gene TaRIPK1, and the coded amino acid sequence of the gene on 6B chromosome is SEQ ID NO: 4.

Met Gly Cys Ser Pro Phe Phe Cys Tyr Lys Ser Gly Ala Thr Arg Gln Gln Ile Ser Thr His Thr Glu Asp Leu Pro Gly Asp Ile Asn Thr Ile Arg Tyr Thr Tyr Lys Glu Leu Ala Arg Ala Thr Glu Asn Phe Asn Pro Ser Asn Lys Ile Gly Glu Gly Gly Phe Gly Ser Val Tyr Lys Gly Arg Leu Arg Asn Gly Lys Leu Ile Ala Val Lys Val Leu Ser Val Glu Ser Arg Gln Gly Leu Lys Glu Phe Leu Asn Glu Leu Met Ser Ile Ser Asn Ile Ser His Gly Asn Leu Val Ser Leu Tyr Gly Tyr Cys Val Glu Gly Asn Gln Arg Ile Leu Val Tyr Asn Tyr Leu Glu Asn Asn Ser Leu Ala Gln Thr Leu Leu Gly Ser Gly Arg Ser Asn Ile Gln Phe Asn Trp Arg Ser Arg Val Asn Ile Cys Leu Gly Ile Ala Arg Gly Leu Ala Tyr Leu His Asp Asp Val Asn Pro His Ile Val His Arg Asp Ile Lys Ala Ser Asn Ile Leu Leu Asp Lys Asp Leu Thr Pro Lys Ile Ser Asp Phe Gly Leu Ala Lys Leu Leu Pro Pro Asn Ala Ser His Ile Ser Thr Arg Val Ala Gly Thr Leu Gly Tyr Leu Ala Pro Glu Tyr Ala Ile Arg Gly Gln Val Thr Arg Lys Ser Asp Val Tyr Ser Phe Gly Val Leu Leu Leu Glu Ile Val Ser Gly Arg Ser Asn Thr Ser Ser Arg Leu Pro Tyr Glu Asp Gln Ile Leu Leu Glu Lys Phe Pro Glu Val Thr Asn Gly Val Leu Leu Leu Gln Thr Trp Met Tyr Tyr Glu Gln Gly Asp Leu Ala Lys Ile Ile Asp Ser Ser Ala Gly Asp Asp Leu Asp Ile Glu Gln Ala Cys Arg Phe Leu Lys Val Gly Leu Leu Cys Thr Gln Asp Val Thr Arg His Arg Pro Thr Met Ser Thr Val Val Ser Met Leu Thr Gly Glu Lys Asp Val Asp Ser Glu Lys Ile Ser Lys Pro Ala Thr Ile Ser Asp Phe Met Asp Leu Lys Ile Arg Ser Met Arg Arg Glu Asn Asn Ile Ala Phe Ala Ser Ser Ser Thr Leu Leu Ser Thr Ile Met Ala His Ser Ser Pro Leu Leu Ser Gln Glu Thr Thr Gln Ala Ser Ile Thr Phe Thr Ala Ile Ser Glu Arg Glu

the invention discloses a method for editing a wheat susceptible gene TaRIPK1 by using CRISPR-Cas9, wherein the coded amino acid sequence of the gene on a 6D chromosome is SEQ ID NO: 5.

Met Gly Cys Ser Pro Phe Phe Cys Tyr Lys Ser Gly Ala Thr Arg Gln Gln Ile Ser Thr His Thr Glu Asp Leu Pro Gly Asp Ile Asn Thr Ile Arg Tyr Thr Tyr Arg Glu Leu Ala Arg Ala Thr Glu Asn Phe Asn Pro Ser Asn Lys Ile Gly Glu Gly Gly Phe Gly Ser Val Tyr Lys Gly Arg Leu Arg Asn Gly Lys Leu Ile Ala Val Lys Val Leu Ser Val Glu Ser Arg Gln Gly Leu Lys Glu Phe Leu Asn Glu Leu Met Ser Ile Ser Asn Ile Ser His Gly Asn Leu Val Ser Leu Tyr Gly Tyr Cys Val Glu Gly Asn Gln Arg Ile Leu Val Tyr Asn Tyr Leu Glu Asn Asn Ser Leu Ala Gln Thr Leu Leu Gly Ser Gly Arg Ser Asn Ile Gln Phe Asn Trp Arg Ser Arg Val Asn Ile Cys Leu Gly Ile Ala Arg Gly Leu Ala Tyr Leu His Asp Asp Val Asn Pro His Ile Val His Arg Asp Ile Lys Ala Ser Asn Ile Leu Leu Asp Lys Asp Leu Thr Pro Lys Ile Ser Asp Phe Gly Leu Ala Lys Leu Leu Pro Pro Asn Ala Ser His Ile Ser Thr Arg Val Ala Gly Thr Leu Gly Tyr Leu Ala Pro Glu Tyr Ala Ile Arg Gly Gln Val Thr Arg Lys Ser Asp Val Tyr Ser Phe Gly Val Leu Leu Leu Glu Ile Val Ser Gly Arg Ser Asn Thr Ser Ser Arg Leu Pro Tyr Glu Asp Gln Ile Leu Leu Glu Lys Phe Pro Glu Val Thr Asn Gly Val Leu Leu Leu Gln Thr Trp Met Tyr Tyr Glu Gln Gly Asp Leu Ala Lys Ile Ile Asp Ser Ser Ala Gly Asp Asp Met Asp Ile Glu Gln Ala Cys Arg Phe Leu Lys Val Gly Leu Leu Cys Thr Gln Asp Val Thr Arg His Arg Pro Thr Met Ser Thr Val Val Ser Met Leu Thr Gly Glu Lys Asp Val Asp Ser Glu Lys Ile Ser Lys Pro Ala Thr Ile Ser Asp Phe Met Asp Leu Lys Ile Arg Ser Met Arg Arg Glu Asn Asn Ile Ala Phe Ala Ser Ser Ser Thr Leu Leu Ser Thr Ile Met Ala His Ser Ser Pro Leu Leu Ser Gln Glu Thr Thr Gln Ala Ser Ile Thr Phe Thr Ala Ile Ser Glu Arg Glu

the invention utilizes CRISPR-Cas9 to edit wheat susceptible gene TaRIPK1, and the coded amino acid sequence of the gene on the 6A chromosome is SEQ ID NO: 6.

Met Gly Cys Ser Pro Phe Phe Cys Tyr Lys Ser Gly Ala Thr Arg Gln Gln Ile Ser Thr His Thr Glu Asp Leu Pro Gly Asp Ile Asn Thr Ile Arg Tyr Thr Tyr Lys Glu Leu Ala Arg Ala Thr Glu Asn Phe Asn Pro Ser Asn Lys Ile Gly Glu Gly Gly Phe Gly Ser Val Tyr Lys Gly Arg Leu Arg Asn Gly Lys Leu Ile Ala Val Lys Val Leu Ser Val Glu Ser Arg Gln Gly Leu Lys Glu Phe Leu Asn Glu Leu Met Ser Ile Ser Asn Ile Ser His Gly Asn Leu Val Ser Leu Tyr Gly Tyr Cys Val Glu Gly Asn Gln Arg Ile Leu Val Tyr Asn Tyr Leu Glu Asn Asn Ser Leu Ala Gln Thr Leu Leu Gly Ser Gly Arg Ser Asn Ile Gln Phe Asn Trp Arg Ser Arg Val Asn Ile Cys Leu Gly Ile Ala Arg Gly Leu Ala Tyr Leu His Asp Asp Val Asn Pro His Ile Val His Arg Asp Ile Lys Ala Ser Asn Ile Leu Leu Asp Lys Asp Leu Thr Pro Lys Ile Ser Asp Phe Gly Leu Ala Lys Leu Leu Pro Pro Asn Ala Thr His Ile Ser Thr Arg Val Ala Gly Thr Leu Gly Tyr Leu Ala Pro Glu Tyr Ala Ile Arg Gly Gln Val Thr Arg Lys Ser Asp Val Tyr Ser Phe Gly Val Leu Leu Leu Glu Ile Val Ser Gly Arg Ser Asn Thr Ser Ser Arg Leu Pro Tyr Glu Asp Gln Ile Leu Leu Glu Lys Phe Pro Glu Val Thr Asn Gly Val Leu Leu Leu Gln Thr Trp Met Tyr Tyr Glu Gln Gly Asp Leu Ala Lys Ile Ile Asp Ser Ser Ala Gly Asp Asp Leu Asp Ile Glu Gln Ala Cys Arg Phe Leu Lys Val Gly Leu Leu Cys Thr GlnAsp Val Thr Arg His Arg Pro Thr Met Ser Thr Val Val Ser Met Leu Thr Gly Glu Lys Asp Val Asp Ser Glu Lys Ile Ser Lys Pro Ala Thr Ile Ser Asp Phe Met Asn Leu Lys Ile Arg Ser Met Arg Arg Glu Asn Asn Ile Ala Phe Ala Ser Ser Ser Thr Leu Leu Ser Thr Ile Met Ala His Ser Ser Pro Leu Leu Ser Gln Glu Thr Thr Gln Ala Ser Ile Thr Phe Thr Thr Ile Ser Glu Arg Glu

the guide RNA sequence gRNA1 for editing TaRIPK1 gene is SEQ ID NO: 7. attgtattaatatcaccaggg

The guide RNA sequence gRNA3 for editing TaRIPK1 gene is SEQ ID NO: 8. atctgtagaatcaagacaagg

The guide RNA sequence gRNA9 for editing TaRIPK1 gene is SEQ ID NO: 9. tcaaggtaattgtagacaagg

The plants according to the invention, preferably monocotyledonous plants, are capable of being successfully infected by wheat stripe rust in customized cereal crops, particularly preferably wheat.

The embodiment of the invention provides a method for simultaneously improving stripe rust resistance and leaf rust resistance of wheat by editing a wheat susceptible gene TaRIPK1 by using CRISPR-Cas9, which comprises the following steps:

(1) in vitro transcribed gRNAs are obtained, primers of T7-gRNA-FPg and gRNA-RP are synthesized, a system of a solidPfu Mix (fashion only) kit specification is added into a reaction system (shown in the specification), a PCR product of the gRNAs is obtained through a PCR program, and then the gRNAs are constructed on a fragment containing a Cas9 enzyme cutting site in a bridging mode.

(2) And adding the obtained product into a reaction system for enzyme digestion activity detection, wherein a standard substance which also comprises a standard positive control and a standard negative control is also subjected to the same reaction. After being fully and uniformly mixed, the mixture is placed in a PCR instrument and set at 37 ℃ for 30min and 65 ℃ for 5min, and then agarose gel electrophoresis detection is carried out, and the activity of the gRNAs is evaluated according to positive and negative control standards. The construction of TaRIP K1-CRISPR/Cas9 vector with the highest in vitro activity is selected. The reaction system is as follows:

(3) the field der variety is used as a receptor variety to transform immature wheat embryos through agrobacterium-mediated genetic transformation, and then the immature wheat embryos are differentiated, screened, regenerated and rooted to finally obtain regenerated plants.

(4) Whether the regeneration plant of TaRIPK1 is a transgenic positive plant or not is detected, and whether the obtained regeneration plant contains three elements of Cas9 gene (fragment), Hyg and 35S is analyzed through PCR detection.

The detection primers are as follows:

(5) and further analyzing whether the two lines are strains with successful gene editing, detecting the three genes for the descendants of the lines, dividing the plants of the T2 generation into A, B and D, and respectively performing sequencing analysis on the three copies.

(6) Resistance of the TaRIPK1 gene-edited plants to stripe rust was defined and the main prevalent species exhibiting toxicity on wheat recipient variety F ielder, CYR34, CYR32 and CYR33, were selected to inoculate the edited plants and wild type plants.

(7) Off-target analysis, the present invention analyzed three gRNAs for possible off-target genes by Cas-OFFinder (http:// www.rgenome.net/ca s-offder /) (Bae et al, 2014), edited plants by detecting differences in these genes in wild-type and TaRIPK1, and performed sequencing analysis.

(8) The resistance of the plants edited by the TaRIPK1 gene to the puccinia is clarified, and the puccinia is inoculated by the plants edited by the TaRIPK1 gene, and the puccinia strain uses an SHTK strain which shows toxicity on wild type variety Fielder of wheat.

The wheat susceptible gene TaRIPK1 edited by the CRISPR-Cas9 provided by the embodiment of the invention simultaneously improves the stripe rust resistance and the leaf rust resistance of wheat, main epidemic species CYR34, CYR32 and CYR33 which show toxicity on a wheat receptor variety Fielder are selected, after the three stripe rust are inoculated, the TaRIPK1 gene editing is obviously enhanced in the resistance to the stripe rust compared with a wild type (Fielder), a large amount of spore piles (UR) are generated on the leaf surface of the wild type plant, and a large amount of allergic necrosis reaction (H R) is generated on the leaf surface edited by the TaRIPK1 gene, so that the disease resistance is obviously enhanced. In addition, when three races, CYR34, CYR32 and CYR33, 14d were inoculated, the biomass of rust in the gene editing of TaRIPK1 was reduced by 40.87%, 48.14% and 60.75% compared with the wild type. The above results show that the TaRIPK1 gene-edited plant shows significant resistance to stripe rust, the level of resistance is changed from high susceptibility to wild type to high resistance, and the TaRIPK1 gene-edited plant has broad-spectrum resistance to major prevalent races of stripe rust.

The invention inoculates the puccinia to the TaRIPK1 gene editing plant, and the puccinia strain uses the SHTK strain which shows toxicity on the wild type variety Fielder of wheat. After inoculation, the mixture is placed in a moisture preservation box for 24 hours in the dark, and then is placed in a growth incubator with the light of 16 hours, the temperature of 20 ℃ and the dark of 8 hours and the temperature of 18 ℃. And observing sporulation conditions 12d after inoculation, and detecting the biomass of the puccinia striiformis by adopting the inoculated DNA sample. Phenotypic identification results show that the plants edited by the gene of TaRIPK1 become obviously resistant to the transformation of the puccinia striiformis SHTK (Pt), the wild type of the leaves of the plants edited by the gene of TaRIPK1 generates typical anaphylactic necrosis reaction (HR), sporadic sporangium is generated on the leaf surface, and in contrast, the wild type plants have no HR reaction on the surface and generate a large amount of sporangium. Meanwhile, the invention carries out detection and analysis on the biomass of the rust of the TaRIPK1 gene editing plant and the wild plant inoculated with the rust, and the result shows that the biomass of the rust is obviously reduced after the TaRIPK1 gene editing plant is inoculated with the rust (Pt) compared with the wild plant. In addition, the number of sporophytes on the leaf surface was analyzed by ImageJ and it was found that the leaf rust inoculated TaRIPK1 gene edited plants were significantly reduced compared to wild type leaf surface sporophytes. Therefore, the TaRIPK1 gene edited plant has strong resistance to the rust, and the mechanism of the resistance is that whether the secretory protein of the rust can interact with the disease-sensitive gene of the host plant or not, and the interaction established by the secretory protein of the rust is interrupted to ensure that the host generates broad-spectrum resistance.

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

<110> northwest agriculture and forestry science and technology university

<120> disease-resistant gene, screening method, plant and application in breeding disease-resistant variety

<160> 5

<210> 1

<211> 1206

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgggttgttctcctttcttctgctataaaagtggggcaacacgccagcaaatttctacgcatactgaagacctccctggtgatattaatacaataagatacacttataaggagctagcaagggcaacagaaaattttaacccatccaacaagattggtgaggggggttttggatctgtatataaggggcggctaaggaatggaaaacttattgctgtcaaggtgttatctgtagaatcaagacaaggactaaaggagtttctgaatgaactgatgtcaatttccaacatatctcatggcaatcttgtcagcctttatggctattgtgtggaaggaaaccagaggatccttgtctacaattaccttgagaataatagccttgcacaaacacttctaggttctggccgcagcaatatccagttcaattggagaagtagagtaaatatttgccttggtatcgcccgaggattagcatacctccatgatgatgtcaatccccacattgttcatcgggatatcaaagcaagcaatatacttcttgataaggatctcacccccaaaatttctgatttcggtttagcaaagcttctacctccaaatgcgtcacatattagcacacgggttgcaggaacattaggttacttggctcctgagtacgccattcgaggacaagtgacacggaagtcagatgtttatagttttggtgttttgcttctggaaatagtcagtgggagatccaacaccagttcaagattaccctatgaagatcagatacttctggaaaagttcccagaggttaccaacggggttctcctcttgcagacatggatgtattatgagcagggagatttggcgaaaatcatagacagttctgcgggtgatgatttggatattgaacaagcctgcaggttcctgaaagttggacttctctgtacacaagatgtcacaagacatcgacccactatgtcaactgtcgtcagcatgctaacaggcgaaaaggatgttgactcggagaagatcagcaagcccgctacaattagcgactttatggaccttaagatcaggagcatgaggagagaaaataacattgctttcgcttcatcctccacgttgctatccactatcatggcacactcttctcctttgttgtcacaagagacgacacaagcctccataacattcaccgcaatatcagagcgtgagtga

<210> 2

<211> 1206

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgggttgttctcctttcttctgctataaaagtggggcaacacgccagcaaatttctactcatactgaagacctccctggtgatattaatacaataagatacacttatagggagctagcaagggcaacagaaaattttaacccatccaacaagattggtgagggtggttttggatcggtatataaggggcggctaaggaatggaaaacttattgctgtcaaggtgttatctgtagaatcaagacaaggactaaaggagtttctgaatgaactgatgtcaatttccaacatatctcatggcaatcttgtcagcctttatggctattgtgtggaaggaaaccagaggatccttgtctacaattaccttgagaataatagccttgcacaaacacttctaggttctggccgcagcaatatccagttcaattggagaagtagagtaaatatttgccttggtatcgcccgaggattagcatacctccatgatgatgtcaatccccacattgttcatcgggatatcaaagcaagcaatatacttcttgataaggatctcacccccaaaatttctgatttcggtttagcaaagcttctacctccaaatgcgtcacatattagcacacgggttgcaggaacattaggttacttggctcctgagtatgccattcgaggacaagtgacacggaagtcagatgtttatagttttggtgttttgcttcttgaaatagtcagtgggagatccaacaccagttcaagattaccctatgaagaccagatacttctggaaaagttcccagaggttaccaatggggttctcctcttgcagacatggatgtattatgagcagggagatttggcgaaaatcatagacagttctgcgggtgatgatatggatattgaacaagcctgcaggttcctgaaagttggacttctctgtacacaagatgtcacaagacatcgacccactatgtcaactgtcgtcagcatgctaacaggcgaaaaggatgttgactcggagaagatcagcaagcccgctacaattagcgactttatggaccttaagatcaggagcatgaggagagaaaataacattgcattcgcttcatcctccacgttgctatccactatcatggcacactcttctcctttgttgtcgcaagagacgacacaagcctccatcacattcaccgcaatatcagagcgtgagtga

<210>3

<211> 1206

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgggttgttctcctttcttctgctataaaagtggggcaacacgccagcaaatttctacgcatactgaagacctccctggtgatattaatacaataagatacacttataaggagctagcaagggcaacagaaaatttcaacccatccaacaagattggcgaggggggttttggatctgtatataaggggcggctaaggaatggaaaacttattgctgtcaaggtgttatctgtagaatcaagacaaggactaaaggagtttctgaatgaactgatgtcaatttccaacatatctcatggcaatcttgtcagcctttatggctattgtgtggaaggaaaccagaggatccttgtctacaattaccttgagaataatagccttgctcaaacacttctaggttctggccgcagcaatatccagttcaattggagaagtagagtaaatatttgccttggtatcgcccgaggattagcatacctccatgatgatgtcaatccccacattgttcatcgggatatcaaagcaagcaatatacttcttgataaggatctcacccccaaaatttctgatttcggtttagcaaagcttctacctccaaatgcgacacatattagcacacgggttgcaggaacattaggttacttggctcctgagtatgctattcgaggacaagtgacacggaagtcagatgtttatagttttggtgttttgcttctggaaatagtcagtgggagatccaacaccagttcaagattaccctatgaagaccagatactactggaaaagttcccagaggttaccaatggggttctcctcttgcagacatggatgtattatgagcagggagatttggcgaaaatcatagacagttctgcgggtgatgatttggatattgaacaagcctgcaggttcctgaaagttggacttctctgtacacaagatgtcacaagacatcgacccactatgtcaactgtcgtcagcatgctaacaggcgaaaaggatgttgactcggagaagatcagcaagcccgctacaattagcgactttatgaaccttaagatcaggagcatgaggagagaaaataacattgctttcgcttcatcctccacgttgctatccactatcatggcacactcttctcctttgttgtcgcaagagacgacacaagcctccatcacattcaccacaatatcagagcgtgagtga

<210> 4

<211> 401

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

<210> 5

<211> 401

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

<210> 6

<211> 401

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Met Gly Cys Ser Pro Phe Phe Cys Tyr Lys Ser Gly Ala Thr Arg Gln Gln Ile Ser Thr His Thr Glu Asp Leu Pro Gly Asp Ile Asn Thr Ile Arg Tyr Thr Tyr Lys Glu Leu Ala Arg Ala Thr Glu Asn Phe Asn Pro Ser Asn Lys Ile Gly Glu Gly Gly Phe Gly Ser Val Tyr Lys Gly Arg Leu Arg Asn Gly Lys Leu Ile Ala Val Lys Val Leu Ser Val Glu Ser Arg Gln Gly Leu Lys Glu Phe Leu Asn Glu Leu Met Ser Ile Ser Asn Ile Ser His Gly Asn Leu Val Ser Leu Tyr Gly Tyr Cys Val Glu Gly Asn Gln Arg Ile Leu Val Tyr Asn Tyr Leu Glu Asn Asn Ser Leu Ala Gln Thr Leu Leu Gly Ser Gly Arg Ser Asn Ile Gln Phe Asn Trp Arg Ser Arg Val Asn Ile Cys Leu Gly Ile Ala Arg Gly Leu Ala Tyr Leu His Asp Asp Val Asn Pro His Ile Val His Arg Asp Ile Lys Ala Ser Asn Ile Leu Leu Asp Lys Asp Leu Thr Pro Lys Ile Ser Asp Phe Gly Leu Ala Lys Leu Leu Pro Pro Asn Ala Thr His Ile Ser Thr Arg Val Ala Gly Thr Leu Gly Tyr Leu Ala Pro Glu Tyr Ala Ile Arg Gly Gln Val Thr Arg Lys Ser Asp Val Tyr Ser Phe Gly Val Leu Leu Leu Glu Ile Val Ser Gly Arg Ser Asn Thr Ser Ser Arg Leu Pro Tyr Glu Asp Gln Ile Leu Leu Glu Lys Phe Pro Glu Val Thr Asn Gly Val Leu Leu Leu Gln Thr Trp Met Tyr Tyr Glu Gln Gly Asp Leu Ala Lys Ile Ile Asp Ser Ser Ala Gly Asp Asp Leu Asp Ile Glu Gln Ala Cys Arg Phe Leu Lys Val Gly Leu Leu Cys Thr Gln Asp Val Thr Arg His Arg Pro Thr Met Ser Thr Val Val Ser Met Leu Thr Gly Glu Lys Asp Val Asp Ser Glu Lys Ile Ser Lys Pro Ala Thr Ile Ser Asp Phe Met Asn Leu Lys Ile Arg Ser Met Arg Arg Glu Asn Asn Ile Ala Phe Ala Ser Ser Ser Thr Leu Leu Ser Thr Ile Met Ala His Ser Ser Pro Leu Leu Ser Gln Glu Thr Thr Gln Ala Ser Ile Thr Phe Thr Thr Ile Ser Glu Arg Glu

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

attgtattaatatcaccaggg

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

atctgtagaatcaagacaagg

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

tcaaggtaattgtagacaagg

Claims

1. The application of a susceptible gene in simultaneous improvement of wheat stripe rust resistant and leaf rust resistant varieties is characterized in that the susceptible gene is a TaRIPK1 gene, the TaRIPK1 gene has three copies of B, D and A in wheat, and an encoding ORF sequence is SEQ ID NO: 1-SEQ ID NO: 3; the application is realized by simultaneously knocking out three copies of B, D and A of TaRIPK1 gene in wheat.