KR20170076504A - Novel gene promoting biosynthesis of oleanolic acid and ursolic acid and uses thereof - Google Patents
Novel gene promoting biosynthesis of oleanolic acid and ursolic acid and uses thereof Download PDFInfo
- Publication number
- KR20170076504A KR20170076504A KR1020150186824A KR20150186824A KR20170076504A KR 20170076504 A KR20170076504 A KR 20170076504A KR 1020150186824 A KR1020150186824 A KR 1020150186824A KR 20150186824 A KR20150186824 A KR 20150186824A KR 20170076504 A KR20170076504 A KR 20170076504A
- Authority
- KR
- South Korea
- Prior art keywords
- gene
- acid
- transformed
- host cell
- present
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y504/00—Intramolecular transferases (5.4)
- C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
Abstract
The present invention provides genes for promoting biosynthesis of oleanolic acid and uricolic acid from picispidum and uses thereof. When the oleanolic acid and the urosolic acid synthetase gene derived from the picispans described in the present invention are introduced into a plant, plants containing oleanolic acid and uricolic acid can be produced, and they can be introduced into microorganisms to produce oleanolic acid and uricolic acid in a large amount It is effective.
Description
The present invention relates to a gene for promoting biosynthesis of oleanolic acid and uricolic acid from a picnic center, and a use thereof. More particularly, the present invention relates to a gene capable of synthesizing an oleanolic acid and a uricolic acid derived from a picnic center, a protein encoded by the gene, A recombinant vector containing the recombinant vector, a host cell transformed with the recombinant vector, and a method of biosynthesizing oleanolic acid and urosolic acid from the host cell.
While most plants accumulate oleanane-type saponins in their tissues, the major components of the houseplants are asiaticoside and madecassoside, which are ursane type, . These substances are excellent for treating skin diseases and wounds, and have been reported to be effective for wounds, gastric ulcers, mental diseases, tuberculosis, dementia and the like. In addition, the extracts of Cinnabar have excellent ability to regenerate skin, and cosmetic additives and ointments for wound healing are now available.
In the pathway of saponin biosynthesis in the seedlings, first, squalene is synthesized with 30 carbons by squalene synthase. In the next step, the reaction is completed with a cyclization reaction of 30 carbon oxoxacosqualene (2,3oxidosqualene), which is the crucial step in the biosynthesis of saponin and plant sterols. Oxidosqualene cyclase Depending on the type of synthesis, it may be divided into betaamyrin synthase, alphaamyrin synthase, dammarenediol synthase and cycloartenol synthase, And plant sterols (Fig. 1). As a next step, the cytochrome P450 (CYP) enzyme generates a wide variety of triterpene structures. The CYP gene involved in this process is a superfamily, which is a plant genome having about 300 different nucleotide sequences Lt; / RTI >
Recently, a report on the selection of CYP candidate genes related to triterpene biosynthesis has been reported through the next-generation sequencing technology. Although at least three CYP enzymes involved in the biosynthesis of Asian thiosicoids are predicted to be involved, an enzyme that binds hydroxyls at
On the other hand, in the prior art including Chinese patent publication CN102433347A, there is described a method for biosynthesizing carbon 28-oxidase enzyme gene and a triterpene compound using the same, but not all of the prior art documents have originated from a domestic flowerpot, and, among the triterpenes, The biosynthesis of ricin acid could not be sufficiently efficiently biosynthesized. Or one substance efficiently, but did not effectively produce both of the oleanolic acid and the uronic acid.
Thus, the present inventors isolated and identified a gene that effectively synthesizes oleanolic acid and uricolic acid from the centipede, and this gene was identified as CYP716A83.
Accordingly, an object of the present invention is to provide a gene for triterpene biosynthesis.
It is still another object of the present invention to provide a protein produced from this gene and a composition for promoting triterpene comprising the protein, wherein the triterpene biosynthesis gene is expressed by a vector, a host cell containing the vector, A method for producing a host cell or a plant comprising a plant, a triterpene biosynthesis gene, and a method for biosynthesizing an oleanolic acid and an uricolic acid.
In order to achieve the above object, the present invention provides a gene for triterpene biosynthesis.
According to another preferred embodiment of the present invention, the triterpene may be at least one selected from the group consisting of oleanolic acid and ursolic acid.
According to another preferred embodiment of the present invention, the gene may be isolated from centella asiatica.
According to another preferred embodiment of the present invention, the gene may be one encoding a
The present invention also provides a protein consisting of the amino acid sequence of SEQ ID NO: 2 inferred from the triterpene biosynthesis gene.
The present invention also provides a composition for promoting biosynthesis of an oleanolic acid and an uricolic acid, which comprises the protein as an active ingredient.
The present invention also provides a recombinant vector comprising the triterpene biosynthetic gene.
According to another preferred embodiment of the present invention, the recombination vector may have a cleavage map as shown in FIG.
In order to achieve still another object of the present invention, there is provided a host cell transformed with a recombinant vector comprising a triterpene biosynthetic gene.
According to another preferred embodiment of the present invention, the transformed host cell may be further transformed with a pYES / CaDDS recombinant vector having the cleavage map set forth in FIG.
According to another preferred embodiment of the present invention, the host cell may be yeast or Escherichia coli.
(A) introducing the gene of
According to another preferred embodiment of the present invention, the step of culturing the host cells comprises culturing in a synthetic complete medium containing 0.1 to 5% of glucose, which does not contain uracil and histidine, To < RTI ID = 0.0 > 60 < / RTI >
In order to achieve still another object of the present invention, there is provided a plant transformed with a recombinant vector comprising a triterpene biosynthetic gene.
According to another preferred embodiment of the present invention, the transformed plant may be further transformed with a pYES / CaDDS recombinant vector having a cleavage map as shown in FIG.
In order to accomplish still another object of the present invention, the present invention provides a method for producing transgenic plants in which oleanolic acid and ergolic acid are accumulated, which comprises introducing a gene for triterpep biosynthesis into a plant.
Accordingly, the present invention provides genes for promoting biosynthesis of oleanolic acid and uricolic acid derived from picispidata and uses thereof. When the oleanolic acid and the urosolic acid synthetase gene derived from the picispans described in the present invention are introduced into a plant, plants containing oleanolic acid and uricolic acid can be produced, and they can be introduced into microorganisms to produce oleanolic acid and uricolic acid in a large amount It is effective.
Figure 1 shows the biosynthesis process of oleanolic acid and uricolic acid.
Figure 2 shows an analysis of the relationship between CYP716A83 and other plant CYPs based on amino acid sequences.
FIG. 3 shows a gas chromatography (GC-MS) analysis of a yeast extract into which a C-28 oxidase gene derived from a locus was introduced (A: yeast extract transformed with an empty vector, B: yeast extract with CaDDS inserted , C: yeast extract with CaDDS and CYP716A83 inserted, D: authentic erythrodiol, uvaol, oleanolic acid and uricolic acid).
Figure 4 shows the mass spectrum of the synthesized product through GC-MS analysis.
Hereinafter, the present invention will be described in more detail.
As described above, the existing researches have failed to sufficiently biosynthesize effectively in the biosynthesis of oleanolic acid or urosolic acid, among triterpenes. Or one substance efficiently, but did not effectively produce both of the oleanolic acid and the uronic acid.
On the other hand, the present invention provides a gene for effectively synthesizing oleanolic acid and uricolic acid, and a method for effectively producing these two compounds at once. When the oleanolic acid and the urosolic acid synthetase gene derived from the picispans described in the present invention are introduced into a plant, plants containing oleanolic acid and uricolic acid can be produced, and they can be introduced into microorganisms to produce oleanolic acid and uricolic acid in a large amount It is effective.
Accordingly, the present invention provides a triterpene biosyntation gene encoding the amino acid sequence of SEQ ID NO: 2.
The gene of the present invention includes both the genomic DNA encoding the oleanolic acid and the synthetic enzyme protein of urosolic acid and cDNA, and includes all the nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO: 2. Variants of the above base sequences are also included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI > Most preferably, the triterpene biosynthesis gene of the present invention may be a gene represented by SEQ ID NO: 1.
The triterpenes are generically called terpene hydrocarbons and alcohols having a carbon number of 30, and may be referred to as triterpenoids. Triterpenes are currently divided into six tribes. That is, 1) α-aminol group 2) β-aminol group 3) lupeol group 4) lanosterol group 5) squalane group 6) There are many other things that can not be categorized. Specific examples thereof include α-amylin, ubarol, pyranthol, ursolic acid, β-aminol, germanicol, oleanolic acid, echinocysteic acid, hederagenin, betulin, lupeol, betulanoic acid, lanosterol, Dihydrolanosterol, aginosterol, gamma -lanosterol, squalene and the like. In the present invention, triterpene is preferably selected from the group consisting of? -Amyrin, uvaol, pyranthol, ergolic acid,? -Amyrin, , Oleanolic acid, echinocysteic acid and / or hederagenic acid, more preferably oleanolic acid and / or ergolic acid. Specifically, the oleanolic acid may be represented by the following formula (1), and the ergolic acid may be represented by the following formula (2).
[Chemical Formula 1]
(2)
The gene of the present invention may be isolated from Centella asiatica . It is also known as Asiatic Pennywort, and its specific name is Centella asiatica (L.) is Urbain. It is a perennial herbaceous herbaceous perennial plant of the dicotyledonous plant and is known to have an efficacy in wound healing.
In addition, the gene of the present invention may encode a
The present invention provides a protein consisting of the amino acid sequence of SEQ ID NO: 2 inferred from the gene of SEQ ID NO: 1.
The range of the oleanolic acid and the urolonic acid synthetase protein according to the present invention includes a protein having the amino acid sequence shown in SEQ ID NO: 2 isolated from the clover and a functional equivalent of the protein. Is at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, Quot; refers to a protein having a homology of at least 95% with a physiological activity substantially equivalent to that of the protein represented by SEQ ID NO: 2. "Substantially homogenous physiological activity" means an activity of converting α / β-amyrin into an oleanolic acid and a uricolic acid, respectively, in a plant.
The present invention also provides a recombinant vector comprising the gene described in SEQ ID NO: 1. The vector may preferably be an over-expression vector pAG423GAL, more preferably a pAG423 / CYP716A83 vector having the vector map described in Fig. In addition, the recombinant vector may preferably be a yeast recombinant vector, but is not limited thereto.
The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.
The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.
The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed by using prokaryotic cells or eukaryotic cells as hosts. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (e.g., pL? Promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) It is common to include a ribosome binding site and a transcription / translation termination sequence for initiation of translation. When E. coli is used as the host cell, the promoter and operator site of the E. coli tryptophan biosynthesis pathway and the left promoter of the phage lambda (pL 貫 promoter) can be used as the regulatory region.
The vectors that can be used in the present invention include plasmids such as pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series and pUC19 which are frequently used in the art, phages such as λgt4 · λB ,? Kharon,?? z1, and M13) or a virus (e.g., SV40 or the like).
On the other hand, when the vector of the present invention is an expression vector and the eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a mammalian virus Virus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.
The vector of the present invention may be a selection marker and may include an antibiotic resistance gene commonly used in the art, for example, ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, Or resistance gene for tetracycline.
The present invention provides a host cell transformed with a recombinant vector comprising the triterpene biosynthesis gene described in SEQ ID NO: 1.
Any host cell known in the art may be used as the host cell capable of continuously cloning and expressing the vector of the present invention in a stable and prokaryotic cell, for example, E. coli JM109, E. coli BL21, E. coli RR1 , E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, Bacillus subtilis, Bacillus strains, and Salmonella typhimurium, Serratia marcesensus and various Pseudomonas species And enterobacteria and strains such as the species. The host cell is preferably E. coli .
When the vector of the present invention is transformed into eukaryotic cells, yeast ( Saccharomyces cerevisiae ), insect cells, human cells (e.g., Chinese hamster ovary, W138, BHK, COS7, 293, HepG2, 3T3, RIN and MDCK cell lines) and plant cells. The host cell is preferably yeast.
The method of delivering the vector of the present invention into a host cell can be carried out by the CaCl 2 method, Hanahan, D., J. MoI. Biol., 166: 557580 (1983) A perforation method or the like. When the host cell is a eukaryotic cell, the vector may be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE dextran treatment, gene bombardment or the like .
As shown in one embodiment of the present invention, the host cell may be further transformed with a pYES / CaDDS recombinant vector having the cleavage map set forth in FIG. CaDDS is a gene for synthesizing? -Amyrin,? -Amyrin and damarenediol, and transformation can be carried out to more effectively synthesize the biosynthesis of oleanolic acid and uricolic acid. When both the CaDDS gene and the CYP716A83 gene were introduced into the transfected host cells, they produced more effective and larger amounts of oleanolic acid and uricolic acid than when only the CYP716A83 gene was introduced.
(A) introducing the gene of
In the method of biosynthesizing the oleanolic acid and the uricolic acid, the oleanolic acid and the synthetic gene of the uricolic acid, the recombinant vector, and the host cell are as described above. In addition, the host cell is preferably yeast or Escherichia coli.
The step of culturing the host cell of the present invention may include culturing in a synthetic complete medium (SC) medium containing 0.1 to 5% of glucose at 15 to 40 ° C for 5 to 200 hours without containing uracil and histidine , More preferably 1 to 3% of glucose in an SC medium containing 20 to 35 DEG C for 12 to 168 hours.
When uracil and / or histidine is contained in the medium in the step of culturing the host cells, there is a side effect of < side effect ", so that the oleanolic acid and the uricolic acid can not effectively be biosynthesized.
In addition, SC medium containing 1 to 3% of glucose should be used. However, when a medium containing no glucose is used, the carbon source is not supplied and the proliferation and growth of host cells can not be performed. When too much glucose is contained, There may be abnormal growth.
The cultivation of the host cell is carried out at 20 to 35 ° C. If the host cell is cultured at a temperature lower than 20 ° C, the host cell does not grow well. If the host cell is cultured at a temperature higher than 35 ° C, growth can be stopped by heat stress . The cultivation may be performed for 12 to 168 hours. If the culture is performed for less than 12 hours, sufficient amounts of oleanolic acid and uricolic acid may not be obtained. If cultured for 168 hours or more, have.
The present invention provides a plant transformed with a recombinant vector comprising a triterpene biosynthetic gene.
The expression vector preferably comprises one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, Bleomycin, hygromycin, ), Chloramphenicol (chloramphenicol), but are not limited thereto.
In the expression vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto.
The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Constructive promoters of the present invention do not limit selectivity.
In the expression vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) Octopine gene terminator, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.
The expression vector containing the nucleic acid according to the present invention can be introduced into cells using methods known in the art. The cells may be plant cells.
Transformation of a plant means any method of transferring DNA to a plant. Such transfection methods do not necessarily have regeneration and / or tissue culture periods. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of mature pollen or vesicles into Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.
The plant according to the present invention is selected from the group consisting of food crops selected from the group consisting of rice, wheat, barley, corn, soybean, potato, wheat, red bean, oats and millet; Vegetable crops selected from the group consisting of Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Ginseng, tobacco, cotton, sesame, sugar cane, beet, perilla, peanut and rapeseed; Apple trees, pears, jujubes, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots and banana; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And feed crops selected from the group consisting of Ryegrass, Red Clover, Orchardgrass, Alpha Alpha, Tall Fescue, and Fereniallaigrus.
The transformed plant of the present invention may further be transformed with a pYES / CaDDS recombinant vector having the cleaved map set forth in FIG. CaDDS is a gene for synthesizing? -Amyrin,? -Amyrin and damarenediol, and transformation can be carried out to more effectively synthesize the biosynthesis of oleanolic acid and uricolic acid. When both the CaDDS gene and the CYP716A83 gene were introduced into the transfected host cells, they produced more effective and larger amounts of oleanolic acid and uricolic acid than when only the CYP716A83 gene was introduced.
The present invention provides a method for producing transgenic plants in which oleanolic acid and ergolic acid are accumulated, which comprises introducing the triterpepes biosynthesis gene into a plant.
In a specific example of the present invention, the present inventors isolated a novel CYP716A83 gene from a clove and produced an overexpression vector containing the gene (see FIG. 5) to prepare a CYP716A83 gene-infected Arabidopsis. The content of triterpenes (see FIG. 3) in the transformed Arabidopsis thaliana was confirmed, and it was confirmed that a large amount of oleanolic acid and ergolic acid were accumulated in the transformed Arabidopsis thaliana.
Therefore, the plant transformed with the vector containing the novel CYP716A83 gene of the present invention significantly increases the synthesis of the oleanolic acid and the uricolic acid in the plant body, which is useful for the continuous and stable production and supply of oleanolic acid and uricolic acid Can be used.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.
Isolation of complete cDNA encoding C-28 oxidase enzyme
The female plants were cultured in MS liquid medium adjusted to pH 5.8 with 3% sucrose for 5 weeks. The leaves were excised and frozen in liquid nitrogen, and total RNA was extracted with Trizol reagent. Next Generation Sequencing was performed using Pratform 454 from Roche, Inc., in order to select the genes related to the trilterpene biosynthesis in the seedlings. Analysis revealed three complete sequences (CYP716A83, CYP716A84, CYP716A85) belonging to the CYP716 family. 2, the CYP716A83 gene was closest to C28 oxidase of other plants. Therefore, this gene was considered as a strong candidate gene, and the following procedure was carried out to construct an expression vector.
The centrilobular cDNA was cloned in a buffer containing 2 μg total RNA, 2 ng oligodT (15) primer, 10 mM dNTP, 30 units of AMV reverse transcriptase and 40 units of RNase inhibitor Deg.] C for 1 hour. (5'AAAAGCAGGCTTCATGGAACTCTTCTTTGTTCCC3 '; SEQ ID NO: 3) and the reverse primer (5'AGAAAGCTGGGTCTTAGGCTTTATGTGGAAATAG3'; SEQ ID NO: 4) using the cDNA synthesized to amplify the complete C-28 oxidase (CYP716A83) ), The complete gene was amplified by DNA synthesis enzyme (ExTaq DNA polymerase, TAKARA). After confirming the nucleotide sequence and amino acid sequence, the gene was registered in NCBI and accession number KT004519 was given.
Amino acid sequence based CYP716A83 And other plants CYP Analysis of liver-liver relationship
The flexible relationship is calculated using the web version CLUSTAL W program (http://clustalw.ddbj.nig.ac.jp/top-j.html), and this value is compared with the neighbor-joining method using MEGA5.2 software The intergenerational relationship was investigated. Protein distance was calculated using the Dayhoff PAM matrix method and protein interactions were calculated under 1,000 repeats. As a result, it was confirmed that CYP716A83 was grouped with the C-28 oxidase gene reported in other plants (Fig. 2)
Yeast overexpression vector production
Gateway system (Invitrogen) was used for gene vector construction. The ORFs of the target genes were PCR-amplified by the method described in Example 1 to insert the pDONR / Zeo entry vector. After confirming the base sequence by sequencing, the yeast expression vector was constructed using the LR reaction mixture (Invitrogen) / CYP716A83 vector (see FIG. 5). The completed vector was transformed into E. coli and the transformed cells were selected for 5 clones after incubation at 37 ° C for 15 hours. The plasmid was extracted from the selected 5 clones and the DNA base sequence was decoded to finally select one clone completely matching the nucleotide sequence of the C-28 oxidase enzyme gene, and the plasmid thus prepared was used for yeast transformation .
Yeast transformation and preparation of extract
In general, yeast WAT21, which has the activity of the baby pollen NADPH-CYP reductase used for plant CYP analysis, was distributed and used for transformation. The synthesis of CaDDS (α-amyrin, β-amyrin, and damarenediol) as a precursor synthesis gene reported by Moses et al. (2014, Natl Acad Sci USA, 111: 1634-1639) for the synthesis of the final products, oleanolic acid and uricolic acid, Gene, GenBank accession no. AY520818, SEQ ID NO: 5) was used. This gene was inserted into the pYES2 vector and subjected to yeast transformation by the method performed by Kushiro et al. (1998, Eur J Biochem 238244). The pYES / CaDDS-inserted yeast transformants were further transformed using the pAG423GAL-ccdB (Add gene) / CYP716A83 vector. For the overexpression of the two genes in yeast transformants with two vectors inserted, 20 mL of SC (synthetic complete) medium containing 2% glucose without uracil and histidine was cultured at 220 rpm at 30 ° C for 2 days. After culturing, 2% of galactose was added to the same medium as described above to induce gene expression for 3 days. Ethyl acetate was added to the reaction solution and extracted twice. The supernatant was concentrated using nitrogen gas, and then dissolved in 400 μl chloroform: methanol = 1: 1. 100 μl was further treated with nitrogen gas After concentration again, derivatives were prepared by N, O-bis (trimethylsilyl) trifluoroacetamide (BSTFA) and pyridine and used for gas chromatography-mass spectrometer analysis.
A yeast transformant in which two genes are expressed GC -MS analysis
The yeast extract described in Example 4 above was used to identify the C-28 oxidase reacting compound. (Agilent) column using a gas chromatograph equipped with a mass spectrometric detector (5973N), maintained at 50 ° C for 2 minutes after injection, up to 320 ° C per minute, up to 40 ° C per minute, 320 ° C per minute For 30 min to analyze the yeast extract. As a result, only α / β-amyrin peaks were observed in the yeast extract containing the CaDDS gene as a control, whereas in the yeast extract containing the CaDDS and CYP716A83 genes, the intermediate products erythrodiol and yubaol uvaol) with oleanolic acid and ergolic acid were observed (Fig. 3). These peaks were subjected to gas chromatography-mass spectrometer analysis to confirm more clearly. As a result of mass spectrum analysis, it was confirmed that the gene inserted into the yeast was a C-28 oxidase gene in accordance with the mass spectrum of the standard sample (FIG. 4).
<110> REPUBLIC OF KOREA <120> Novel gene promoting biosynthesis of oleanolic acid and ursolic acid and uses thereof <130> 1042618 <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 1482 <212> DNA <213> Artificial Sequence <220> <223> CYP716A83 <400> 1 atggaactct tctttgttcc cctcttctcc tccttggttc tctttgtttt cttttgtttc 60 cttttgctct tctacaagaa caacaaatgg agatcctccg gcgcacctct ccccccgggc 120 caaacagggt ggcccttcat aggagagagt tacgagtttc tctccacagg atggaaaggc 180 tatccggaga aattcatatt tgaccggata gccaaacact cctccaacgt cttcaagacg 240 tccatcctgg gagagcacgc cgcagtattc tgcggcgcag cctgtaacaa gttcttgttc 300 tcgaacgaga acaagcttgt tcaggcctgg tggccagact ctgtaaacaa agtcttccca 360 tcttccacac agacttcttc caaagaagaa gccatcaaga tgagaaaaat gctgccaaac 420 ttcctcaaac cggacgcttt acaacgatac gttggaacca tggactccat cgccaggaga 480 catttcgagt ccggatggga caacaaaaac gaaattgtag tcttccctct ggccaaaacc 540 tacaccttct ggattgcttg taagcttttt gtaagtgtag aggaaccgtc tcaagtcgca 600 aaactcttgg aacccttcag tgccattgct tctgggatca tttctgtccc aatagatctg 660 cccggaacac cgttcaacag tgccataaag tcatccaaac gcatcaggga aatgctgtgg 720 aagatcataa agcagaggaa gattgatttg gcagagggca aagcctcccc aacacaagat 780 atattgtcac atatgctatt gacaagtgat gagaatggca agtttatgtc tgagttggat 840 attgctgata agatattagg attgttgatt ggtggacatg acactgctag ctctgcatgc 900 actttcgttg tcaagttcct tgccgagttg cccgaaatct atgatggtgt ctacaaagag 960 caaatggaga tagtgaaatc aaagggacct ggggagttat tgaactggga tgacattcag 1020 aagatgaaat attcatggaa tgtggcatgt gaagtactaa ggcttgcccc accccttcaa 1080 ggtggtttca gagaagtcct cactgatttt tcttacaatg gtttctccat ccccaagggc 1140 tggaagatat attggacagc aaattcgaca cacagaaatt cagaagtatt cccagaacca 1200 ttaaaatttg atccatcgag attcgaggga acggggccac ctccgttcac gttcgtgccg 1260 ttcggaggag gtccgagaat gtgccccggg aaggagtatg cccgattgga aatattagtg 1320 ttcatacaca acttggtgaa aaggtacaag tgggagaaaa ttattcctga tgagaagatt 1380 attgttaatc caatgccaat tccagctaaa ggacttccta ttcgtctatt tccacataaa 1440 gcctaattca tttgctttat atgtgtatgc atggactttt aa 1482 <210> 2 <211> 481 <212> PRT <213> Artificial Sequence <220> <223> CYP716A83 <400> 2 Met Glu Leu Phe Phe Val Pro Leu Phe Ser Ser Leu Val Leu Phe Val 1 5 10 15 Phe Phe Cys Phe Leu Leu Leu Phe Tyr Lys Asn Asn Lys Trp Arg Ser 20 25 30 Ser Gly Ala Pro Leu Pro Pro Gly Gln Thr Gly Trp Pro Phe Ile Gly 35 40 45 Glu Ser Tyr Glu Phe Leu Ser Thr Gly Trp Lys Gly Tyr Pro Glu Lys 50 55 60 Phe Ile Phe Asp Arg Ile Ala Lys His Ser Ser Asn Val Phe Lys Thr 65 70 75 80 Ser Ile Leu Gly Glu His Ala Ala Val Phe Cys Gly Ala Ala Cys Asn 85 90 95 Lys Phe Leu Phe Ser Asn Glu Asn Lys Leu Val Gln Ala Trp Trp Pro 100 105 110 Asp Ser Val Asn Lys Val Phe Pro Ser Ser Thr Gln Thr Ser Ser Lys 115 120 125 Glu Glu Ala Ile Lys Met Arg Lys Met Leu Pro Asn Phe Leu Lys Pro 130 135 140 Asp Ala Leu Gln Arg Tyr Val Gly Thr Met Asp Ser Ile Ala Arg Arg 145 150 155 160 His Phe Glu Ser Gly Trp Asp Asn Lys Asn Glu Ile Val Val Phe Pro 165 170 175 Leu Ala Lys Thr Tyr Thr Phe Trp Ile Ala Cys Lys Leu Phe Val Ser 180 185 190 Val Glu Glu Pro Ser Gln Val Ala Lys Leu Leu Glu Pro Phe Ser Ala 195 200 205 Ile Ala Ser Gly Ile Ile Ser Val Ile Asp Leu Pro Gly Thr Pro 210 215 220 Phe Asn Ser Ala Ile Lys Ser Ser Lys Arg Ile Arg Glu Met Leu Trp 225 230 235 240 Lys Ile Ile Lys Gln Arg Lys Ile Asp Leu Ala Glu Gly Lys Ala Ser 245 250 255 Pro Thr Gln Asp Ile Leu Ser His Met Leu Leu Thr Ser Asp Glu Asn 260 265 270 Gly Lys Phe Met Ser Glu Leu Asp Ile Ala Asp Lys Ile Leu Gly Leu 275 280 285 Leu Ile Gly Gly His Asp Thr Ala Ser Ser Ala Cys Thr Phe Val Val 290 295 300 Lys Phe Leu Ala Glu Leu Pro Glu Ile Tyr Asp Gly Val Tyr Lys Glu 305 310 315 320 Gln Met Glu Ile Val Lys Ser Lys Gly Pro Gly Glu Leu Leu Asn Trp 325 330 335 Asp Asp Ile Gln Lys Met Lys Tyr Ser Trp Asn Val Ala Cys Glu Val 340 345 350 Leu Arg Leu Ala Pro Pro Leu Gln Gly Gly Phe Arg Glu Val Leu Thr 355 360 365 Asp Phe Ser Tyr Asn Gly Phe Ser Ile Pro Lys Gly Trp Lys Ile Tyr 370 375 380 Trp Thr Ala Asn Ser Thr His Arg Asn Ser Glu Val Phe Pro Glu Pro 385 390 395 400 Leu Lys Phe Asp Pro Ser Arg Phe Glu Gly Thr Gly Pro Pro Pro Phe 405 410 415 Thr Phe Val Pro Phe Gly Gly Gly Pro Arg Met Cys Pro Gly Lys Glu 420 425 430 Tyr Ala Arg Leu Glu Ile Leu Val Phe Ile His Asn Leu Val Lys Arg 435 440 445 Tyr Lys Trp Glu Lys Ile Ile Pro Asp Glu Lys Ile Ile Val Asn Pro 450 455 460 Met Pro Ile Pro Ala Lys Gly Leu Pro Ile Arg Leu Phe Pro His Lys 465 470 475 480 Ala <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CYP716A83 forward primer <400> 3 aaaaagcagg cttcatggaa ctcttctttg ttccc 35 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> CYP716A83 reverse primer <400> 4 agaaagctgg gtcttaggct ttatgtggaa atag 34 <210> 5 <211> 2283 <212> DNA <213> Artificial Sequence <220> <223> CaDDS gene sequence <400> 5 atgtggaagc tgaagatagc agagggtaat ggagcatact tgtacagcac caacaacttt 60 gtgggagag agatatggga gtatgatcct gatgctggaa ctcctgaaga gcgactagag 120 gtcgagaaac ttcgagaaac ttacaaatat aatctcatca acaatgggat tcacccttgt 180 ggtgatatgc tcatgaggtt gcagctgata aaggagagtg ggctggatct tttgagcata 240 ccgccggtga gacttggaga acaagaagaa gtgaattatc aagtagtgac gacggctgtt 300 aagaaagctc tgcggttaaa ccgcgcaatc caagctcacg acggtcactg gccagctgaa 360 aatgctggac ctatgttttt tacaccaccc ctcatcatag cgctatacat cagcggagca 420 attgacactc atctaacaat acaacacaag aaggagatga ttcgttttat ttacctccac 480 caaaacaaag atggaggatg gggattctat atagagggac atagcacgat gatagggtca 540 gcacttagct acgtggcgtt acgtttgctg ggagaagggc ctgatgacgg cgatggtgca 600 gtggagagag caagaaaatg gatccttgac catggtggtg ctgcttctat accctcctgg 660 ggtaagactt atcttgcggt tcttggggta tacgagtggg aagggtgtaa ccccctgccc 720 ccagaatttt ggcttttccc tgaagcttta ccttatcatc cagcaaaaat gtggtgttac 780 tgtcgcacaa catacatgcc gatgtcgtat ttgtatggga agaaatatca tggtccaatt 840 acggatcttg ttatatcttt aagaaaagaa atacacccca ttccttatga gaagataaat 900 tggaacaaac agcgccataa ctgtaacaag gaggatcttt actaccctca tagctttata 960 caggatttgc tatgggatgg tcttcactat tttactgaac ctatcattaa aatgtggccc 1020 ttcaataagt tgcgaaagaa agggatgaaa agagccattg aacttatgcg ctacggaggt 1080 tatgagagca gattcattac cattggatgt gtatccaaga gtctagatat gatgtgttgg 1140 tgggcagaga acccgaatgg tccagaattc aaacatcact tagctagagt acctgattac 1200 ttgtggcttg cagaggatgg aatgaagatg cagagttttg gtagtcaatt atgggactgt 1260 gttcttgcta ctcaagctgt catgtctact ggtatggttg atgaatatgg ggattgtctt 1320 aagaaagcac atttctatat taaagaatca cagtgcaaga aaaatccgtc aggagattat 1380 gcaagtatgt gccggtattt tacaaaagga tcatggacat tttctgatca agatcagggt 1440 tgggttgtct ctgattgcac agctgaagcg ctgaagtgtc tattagcact ttctcaaatg 1500 ccagaggaaa ttgcagggga aaaggcagat gttgagcgat tatatgatgc cgtaaacgtc 1560 ctcctctact tgcaaagccc tataagtggg ggttttgcca tttgggagcc accagttcca 1620 agaccatact tgcaggtgtt gaatccttcg gagatttttg ccgacatcgt tgtcgaaaaa 1680 gagcatacgg agtgcacagc atcaataata gcagctctgg tagcattcaa acgtttgcat 1740 ccgggtcatc ggtcgaaaga aataagtgtt gccatcgcaa aagctgtaca ttttcttgaa 1800 ggaaaacaat tggaagatgg ttcatggtat ggctactggg gaatatgctt tttgtatggc 1860 acattttttg cgttagctgg gttagcttct gtgggacaga cttatgaaaa cagtgaaacc 1920 gttcgtaaag ctgttaagtt tttcctttct acacaaaatg aagaaggtgg ttggggagaa 1980 agtcttgaat catgtccgag cgagatattc acaccattag aaggaaacag aacaaattta 2040 gtacaaacat catgggcaat gcttggtctc atgtttggtg gacaggccac gagagatcca 2100 actccattgc atagagcagc aaagttattg attaatgcac aattgaataa cggagatttc 2160 cctcagcagg aaacaactgg agtgtacatg aagaattgta tgttgcatta tgccgagtat 2220 agaaatgtat ttccgttatg ggcacttgga gagtaccgca aacgcttgtg gctctccaat 2280 tga 2283
Claims (15)
(b) culturing the host cell, wherein the oleanolic acid and the uricolic acid are biosynthesized.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150186824A KR101771969B1 (en) | 2015-12-24 | 2015-12-24 | Novel gene promoting biosynthesis of oleanolic acid and ursolic acid and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150186824A KR101771969B1 (en) | 2015-12-24 | 2015-12-24 | Novel gene promoting biosynthesis of oleanolic acid and ursolic acid and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20170076504A true KR20170076504A (en) | 2017-07-04 |
| KR101771969B1 KR101771969B1 (en) | 2017-08-28 |
Family
ID=59357280
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020150186824A KR101771969B1 (en) | 2015-12-24 | 2015-12-24 | Novel gene promoting biosynthesis of oleanolic acid and ursolic acid and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101771969B1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111205993A (en) * | 2020-01-22 | 2020-05-29 | 天津大学 | Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof |
| CN111235047A (en) * | 2020-02-12 | 2020-06-05 | 天津大学 | Recombinant yarrowia lipolytica for heterogeneously synthesizing α -coumarol and ursolic acid and construction method |
| CN116732060A (en) * | 2023-05-25 | 2023-09-12 | 四川农业大学 | CYP716C oxidase gene in camptotheca acuminata, carrier, microsomal protein and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090178160A1 (en) | 2005-10-25 | 2009-07-09 | Joon-Hyun Park | Modulation of Triterpenoid Content in Plants |
-
2015
- 2015-12-24 KR KR1020150186824A patent/KR101771969B1/en active IP Right Grant
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111205993A (en) * | 2020-01-22 | 2020-05-29 | 天津大学 | Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof |
| CN111205993B (en) * | 2020-01-22 | 2021-11-02 | 天津大学 | Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof |
| CN111235047A (en) * | 2020-02-12 | 2020-06-05 | 天津大学 | Recombinant yarrowia lipolytica for heterogeneously synthesizing α -coumarol and ursolic acid and construction method |
| CN116732060A (en) * | 2023-05-25 | 2023-09-12 | 四川农业大学 | CYP716C oxidase gene in camptotheca acuminata, carrier, microsomal protein and application thereof |
| CN116732060B (en) * | 2023-05-25 | 2024-05-03 | 四川农业大学 | CYP716C oxidase gene in camptotheca acuminata, carrier, microsomal protein and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101771969B1 (en) | 2017-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2014342939B2 (en) | Recombinant production of steviol glycosides | |
| KR101771969B1 (en) | Novel gene promoting biosynthesis of oleanolic acid and ursolic acid and uses thereof | |
| JP2023514687A (en) | Glycosyltransferases, polynucleotides encoding them and methods of use | |
| KR20160039867A (en) | Composition for Promoting Biosysthesis of Oleanane-Type Ginsenoside | |
| KR101862007B1 (en) | Novel gene promoting biosynthesis of hederagenin and 23-hydroxyursolic acid and uses thereof | |
| KR101854961B1 (en) | Use of novel genes for increasing malonyl-ginsenoside Rb2 syntheis in Ginseng | |
| KR20220125407A (en) | LCYB2 mutant from Daucus carota and uses thereof | |
| KR102053089B1 (en) | Gene encoding recombinant UGTase protein increasing coniferin synthesis in plant and uses thereof | |
| KR101164923B1 (en) | Delta-6 desaturase gene from Sparus aurata and uses thereof | |
| KR101788038B1 (en) | Natural rubber polymerase gene and uses thereof | |
| KR101594985B1 (en) | A RcLPAT299 genes derived from Ricinus communis L. and their uses in ricinoleic fatty acid | |
| KR102169650B1 (en) | Method for producing transgenic plant with increased syringin content using multiple gene expression system and plant thereof | |
| KR102450489B1 (en) | STA1 gene from Arabidopsis thaliana regulating seed development and pollen viability under high temperature stress conditions in plant and uses thereof | |
| KR101594988B1 (en) | RcLPAT376 genes specific to Ricinus communis L. anther and their uses in hydroxy fatty acid | |
| KR102542508B1 (en) | α1-COP gene controlling abiotic stress of plant and uses thereof | |
| KR102385599B1 (en) | Cytochrome P450 gene from Spinacia oleracea increasing 20-hydroxyecdysone content of plant and uses thereof | |
| JP2006501859A (en) | Phagopyritol synthase gene and method of use | |
| KR102116432B1 (en) | OsSIRP3 gene from Oryza sativa for controlling salt stress tolerance of plant and uses thereof | |
| KR101985321B1 (en) | Method for producing transgenic plant with increased heavy metal stress tolerance using OsAIR2 gene from Oryza sativa and plant thereof | |
| KR101707032B1 (en) | OsMYB5P gene improving phosphate uptake efficiency in plant and uses thereof | |
| KR101815737B1 (en) | Gene for promoting plant growth and a transgenic plant comprising the same | |
| KR20110068292A (en) | Dammarenediol synthase gene from centella asiatica l. urban and uses thereof | |
| KR20150050642A (en) | Nucleotide for modify the content of fatty acid in seeds and uses thereof | |
| KR20110063920A (en) | Fatty acid elongase gene from sparus aurata and uses thereof | |
| KR20150005749A (en) | RcLPAT376 genes specific to Ricinus communis L. anther and their uses in hydroxy fatty acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant |