KR101862007B1 - Novel gene promoting biosynthesis of hederagenin and 23-hydroxyursolic acid and uses thereof - Google Patents

Abstract

The present invention provides chaperone derived heterangenin and 23-hydroxy urusholic acid biosynthesis promotion genes and uses thereof. When the seedlings of hederagen and 23-hydroxy urusholic acid synthase gene described in the present invention are introduced into a plant, a plant including hederagenin and 23-hydroxyurosolic acid can be produced, and introduced into a microorganism It is effective to mass produce heparanin and 23-hydroxyurosolic acid.

Description

Novel gene promoting biosynthesis of hederagenin and 23-hydroxyursolic acid and uses thereof.

The present invention relates to novel herderagenin and 23-hydroxy-uricolylic acid biosynthesis promotion genes derived from picispidata and their use, and more particularly to a gene for promoting the synthesis of hederagenin and 23-hydroxyurosolic acid A protein encoded by the gene, a recombinant vector containing the gene, a host cell transformed with the recombinant vector, and a method for biosynthesizing heparanin and 23-hydroxyurosolic acid from the host cell.

While most plants accumulate oleanane-type saponins in their tissues, the major components of the houseplants are asiaticoside and madecassoside, which are ursane type, . These substances are excellent for treating skin diseases and wounds, and have been reported to be effective for wounds, gastric ulcers, mental diseases, tuberculosis, dementia and the like. In addition, the extracts of Cinnabar have excellent ability to regenerate skin, and cosmetic additives and ointments for wound healing are now available.

In the pathway of saponin biosynthesis in the seedlings, first, squalene is synthesized with 30 carbons by squalene synthase. In the next step, the reaction is completed with a cyclization reaction of 30 carbon oxoxacosqualene (2,3oxidosqualene), which is the crucial step in the biosynthesis of saponin and plant sterols. Oxidosqualene cyclase Depending on the type of synthesis, it may be divided into betaamyrin synthase, alphaamyrin synthase, dammarenediol synthase and cycloartenol synthase, And plant sterols (Fig. 1). As a next step, the cytochrome P450 (CYP) enzyme generates a wide variety of triterpene structures. The CYP gene involved in this process is a superfamily, which is a plant genome having about 300 different nucleotide sequences Lt; / RTI >

Recently, a report on the selection of CYP candidate genes related to triterpene biosynthesis has been reported through the next-generation sequencing technology. Although at least three CYP enzymes involved in the biosynthesis of Asian thiosicoids are predicted to be involved, an enzyme that binds hydroxyls at positions 2 and 23, respectively, and carboxyl at position 28, But there has been no report on the binding of hydroxy (hydoroxyl) at position 23 to carbon. According to recent experimental results (Fukushima et al. (2013) Combinatorial biosynthesis of legume natural and rare triterpenoids in engineered yeast. Plant Cell Physiol 54: 740749), genes encoding carbon 23 have been reported, A gene that binds to the carbon of the olefin and the uric acid type triterpene compound carbon No. 23 is not currently reported.

Therefore, the present inventors isolated and identified a gene effectively synthesizing hyderadenine and 23-hydroxy urusholic acid from a female centrum, and this gene was found to be CYP714E19.

Accordingly, an object of the present invention is to provide a gene for triterpene biosynthesis.

It is still another object of the present invention to provide a protein produced from the gene and a composition for stimulating triterpene comprising the protein, and also to provide a vector containing a triterpene biosynthetic gene, a host cell or a plant containing the vector , A method for producing a host cell or a plant comprising a triterpene biosynthesis gene, and a method for biosynthesizing heparanin and 23-hydroxyurusolic acid.

In order to achieve the above object, the present invention provides a gene for triterpene biosynthesis.

According to another preferred embodiment of the present invention, the triterpenes may be at least one selected from the group consisting of hederagenin and 23-hydroxyursolic acid.

According to another preferred embodiment of the present invention, the gene may be isolated from centella asiatica.

According to another preferred embodiment of the present invention, the gene may be one encoding a carbon 23 oxidase.

The present invention also provides a protein consisting of the amino acid sequence of SEQ ID NO: 2 inferred from the triterpene biosynthesis gene.

The present invention also provides a composition for promoting biosynthesis of heparanin and 23-hydroxy urusholic acid comprising the protein as an active ingredient.

The present invention also provides a recombinant vector comprising the triterpene biosynthetic gene.

According to another preferred embodiment of the present invention, the recombination vector may have a cleavage map as shown in FIG.

In order to achieve still another object of the present invention, there is provided a host cell transformed with a recombinant vector comprising a triterpene biosynthetic gene.

According to another preferred embodiment of the present invention, the transformed host cells may be further transformed with pYES / CaDDS and pAG423 / CYP716A83 recombinant vectors having the cleavage map set forth in FIG.

According to another preferred embodiment of the present invention, the host cell may be yeast or Escherichia coli.

(A) introducing the gene of claim 1 into a host cell; And (b) culturing the host cell. The present invention also provides a method for biosynthesizing heparanin and 23-hydroxyurusolic acid.

According to another preferred embodiment of the present invention, the step of culturing the host cells comprises culturing in a synthetic complete medium containing 0.1 to 5% of glucose, which does not contain uracil and histidine, To < RTI ID = 0.0 > 60 < / RTI >

In order to achieve still another object of the present invention, there is provided a plant transformed with a recombinant vector comprising a triterpene biosynthetic gene.

According to another preferred embodiment of the present invention, the transformed plant may be further transformed with a pYES / CaDDS, pAG423 / CYP716A83 recombinant vector having the cleavage map set forth in FIG.

In order to accomplish still another object of the present invention, the present invention provides a method for producing a transgenic plant in which hederagenin and 23-hydroxyureus acid are accumulated, which comprises introducing a triterpeps biosynthesis gene into a plant.

Thus, the present invention provides chaperone derived herderagenin and 23-hydroxy urusholic acid biosynthesis promotion genes and uses thereof. When the seedlings of hederagen and 23-hydroxy urusholic acid synthase gene described in the present invention are introduced into a plant, a plant including hederagenin and 23-hydroxyurosolic acid can be produced, and introduced into a microorganism It is effective to mass produce heparanin and 23-hydroxyurosolic acid.

Figure 1 shows the biosynthetic process of hederagenin and 23-hydroxyurosolic acid.
Figure 2 shows an analysis of the relationship between CYP714E19 and other plant CYPs based on amino acid sequences.
FIG. 3 shows a gas chromatography (GC-MS) analysis of a yeast extract into which a C-23 oxidase gene derived from a locus was introduced (A: CaDDS-inserted yeast extract, B: CaDDS and CYP714E19-inserted yeast extract C: yeast extract with CaDDS and CYP716A83, D: CaDDS, yeast extract with CYP716A83 and CYP714E19, E: authentic erythrodiol, uvaol, oleanolic acid, ursolic acid, heparanin and 23-hydroxy-uric acid.
Figure 4 shows the mass spectrum of the synthesized product through GC-MS analysis. The spectrum on the right shows the spectrum of the standard product and the spectrum for the corresponding peak. 5 and 6 can not be confirmed by the spectrum of the standard product, but considering the pattern, 23-hydroxylery throdiol and 23-hydroxyuvaol, which have been oxidized at position 23 of carbon, Respectively.
5 is a schematic diagram of a vector for overexpressing the CYP714E19 gene used in this experiment.
Figure 6 is a vector schematic diagram containing the CaDDS and CYP716A83 genes, respectively, used to make precursor material for the synthesis of hederagenin and 23-hydroxy-allergic precursors.

Hereinafter, the present invention will be described in more detail.

As described above, existing studies have failed to biosynthesize in microorganisms such as yeast, especially in the biosynthesis of hederagenin or 23-hydroxyurosolic acid among triterpenes.

On the other hand, the present invention provides a gene effectively synthesizing hederagenin and 23-hydroxyergic acid, and a method for effectively producing these two compounds at once. When the seedlings of the seedlings derived from the seedlings of the present invention are introduced into a plant, plants containing the seedlings of seedlings or seedlings can be produced. It is possible to produce hederagenin or 23-hydroxy-erosolic acid in a large amount.

Accordingly, the present invention provides a triterpene biosyntation gene encoding the amino acid sequence of SEQ ID NO: 2.

The gene of the present invention includes both genomic DNA encoding cDNA for heparanin or 23-hydroxy urusholic acid synthase protein and cDNA, and includes all the nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO: 2. Variants of the above base sequences are also included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI > Most preferably, the triterpene biosynthesis gene of the present invention may be a gene represented by SEQ ID NO: 1.

The triterpenes are generically called terpene hydrocarbons and alcohols having a carbon number of 30, and may be referred to as triterpenoids. Triterpenes are currently divided into six tribes. That is, 1) α-aminol group 2) β-aminol group 3) lupeol group 4) lanosterol group 5) squalane group 6) There are many other things that can not be categorized. Specific examples thereof include α-amylin, ubarol, pyranthol, ursolic acid, β-aminol, germanicol, oleanolic acid, echinocysteic acid, hederagenin, betulin, lupeol, betulanoic acid, lanosterol, Dihydrolanosterol, aginosterol, gamma -lanosterol, squalene and the like. In the present invention, triterpene is preferably selected from the group consisting of? -Amyrin, uvaol, pyranthol, ergolic acid,? -Amyrin, , Oleanolic acid, echinocysteic acid, and / or hederagenin, and more preferably hederagenin, 23-hydroxy-ergosteric acid. Specifically, the heparanin may be represented by the following formula (1), and the 23-hydroxy ergolic acid may be represented by the following formula (2).

[Chemical Formula 1]

(2)

The gene of the present invention may be isolated from Centella asiatica. It is also known as Asiatic Pennywort, and its specific name is Centella asiatica (L.) is Urbain. It is a perennial herbaceous herbaceous perennial plant of the dicotyledonous plant and is known to have an efficacy in wound healing.

In addition, the gene of the present invention may encode a carbon 23 oxidase. As shown in FIG. 2 of the present invention, the gene of the present invention was analyzed for the interrelationship between CYPs of other plants, and it was predicted to be clearly distinguished from the previously reported oxidase.

The present invention provides a protein consisting of the amino acid sequence of SEQ ID NO: 2 inferred from the gene of SEQ ID NO: 1.

The range of the hyderagensin or 23-hydroxyergosolic acid synthase protein according to the present invention includes a protein having the amino acid sequence shown in SEQ ID NO: 2 isolated from the centrum and the functional equivalent of the protein. Is at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, Quot; refers to a protein having a homology of at least 95% with a physiological activity substantially equivalent to that of the protein represented by SEQ ID NO: 2. By "substantially homogenous physiological activity" is meant the activity of converting oleanolic acid and uricolic acid into herderagenic or 23-hydroxyurosolic acid, respectively, in plants.

The present invention also provides a recombinant vector comprising the gene described in SEQ ID NO: 1. The vector may preferably be an over-expression vector pAG425GAL, more preferably a pAG425 / CYP714E19 vector having the vector map described in Fig. In addition, the recombinant vector may preferably be a yeast recombinant vector, but is not limited thereto.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed by using prokaryotic cells or eukaryotic cells as hosts. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (e.g., pL? Promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) It is common to include a ribosome binding site and a transcription / translation termination sequence for initiation of translation. When E. coli is used as the host cell, the promoter and operator site of the E. coli tryptophan biosynthesis pathway and the left promoter of the phage lambda (pL 貫 promoter) can be used as a regulatory region.

The vectors that can be used in the present invention include plasmids such as pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series and pUC19 which are frequently used in the art, phages such as λgt4 · λB ,? Kharon,?? z1, and M13) or a virus (e.g., SV40 or the like).

On the other hand, when the vector of the present invention is an expression vector and the eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a mammalian virus Virus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may be a selection marker and may include an antibiotic resistance gene commonly used in the art, for example, ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, Or resistance gene for tetracycline.

The present invention provides a host cell transformed with a recombinant vector comprising the triterpene biosynthesis gene described in SEQ ID NO: 1.

A host cell capable of continuously cloning and expressing the vector of the present invention in a stable and prokaryotic cell may be any host cell known in the art. For example, E. coli JM109, E. coli BL21, E. coli RR1 , E.coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus strains, and Salmonella typhimurium, Serratia marcesensus and various Pseudomonas species And enterobacteria and strains such as the species. The host cell is preferably E. coli.

When the vector of the present invention is transformed into eukaryotic cells, yeast (Saccharomyces cerevisiae), insect cells, human cells (e.g., Chinese hamster ovary, W138, BHK, COS7, 293, HepG2, 3T3, RIN and MDCK cell lines) and plant cells. The host cell is preferably yeast.

The method of delivering the vector of the present invention into a host cell can be carried out by the CaCl ₂ method, Hanahan, D., J. MoI. Biol., 166: 557580 (1983) A perforation method or the like. When the host cell is a eukaryotic cell, the vector may be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE dextran treatment, gene bombardment or the like .

As shown in one embodiment of the present invention, the host cell may be further transformed with pYES / CaDDS having the cleavage map set forth in FIG. 6 and a pAG423 / CYP716A83 recombinant vector. CaDDS is a gene for synthesizing? -Amyrin,? -Amyrin and damarenediol, and can be represented by SEQ ID NO: 5. In addition, CYP716A83 is a gene for synthesizing oleanolic acid and uricolic acid, and transformation can be carried out in order to further enhance the biosynthesis of hederagenin and 23-hydroxyurosolic acid. CYP716A83 can be represented by SEQ ID NO: 3.

When both the CaDDS, CYP716A83, and CYP714E19 genes were introduced into the transfected host cells, more efficient and large amounts of hyderaginin and 23-hydroxy urusholic acid were produced than when only the CYP714E19 or CaDDS and CYP714E19 genes were introduced alone.

(A) introducing the gene of claim 1 into a host cell; And (b) culturing the host cell. The present invention also provides a method for biosynthesizing heparanin and 23-hydroxyurusolic acid.

The gene introduced into the host may preferably be the gene of claim 1, and the CaDDS gene and the CYP716A83 gene may be further introduced.

In the method of biosynthesizing hederagenin and 23-hydroxyurosolic acid, the gene for hederagenin and the 23-hydroxy urusholic acid synthase gene, the recombinant vector, and the host cell are as described above. In addition, the host cell is preferably yeast or Escherichia coli.

The step of culturing the host cells of the present invention comprises culturing at 15 to 40 DEG C for 5 to 200 hours in SC synthetic medium containing 0.1 to 5% of glucose without containing uracil, histidine and leucine And more preferably in an SC medium containing 1 to 3% of glucose at a temperature of 20 to 35 占 폚 for 12 to 168 hours.

In addition, SC medium containing 1 to 3% of glucose should be used. However, when a medium containing no glucose is used, the carbon source is not supplied and the proliferation and growth of host cells can not be performed. When too much glucose is contained, There may be abnormal growth.

The cultivation of the host cell is carried out at 20 to 35 ° C. If the host cell is cultured at a temperature lower than 20 ° C, the host cell does not grow well. If the host cell is cultured at a temperature higher than 35 ° C, growth can be stopped by heat stress . The culture may be carried out for 12 to 168 hours. If the culture is performed for less than 12 hours, a sufficient amount of heparanin and 23-hydroxy urusholic acid may not be obtained. If the culture is performed for 168 hours or more, May not be synthesized.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Isolation of complete cDNA encoding C-23 oxidase enzyme

The female plants were cultured in MS liquid medium adjusted to pH 5.8 with 3% sucrose for 5 weeks. The leaves were excised and frozen in liquid nitrogen, and total RNA was extracted with Trizol reagent. Next Generation Sequencing was performed using Pratform 454 from Roche, Inc., in order to select the genes related to the trilterpene biosynthesis in the seedlings. As a result of the analysis, 13 complete gene sequences belonging to CYP were obtained. Based on the RPKM value as a statistical numerical value, a gene having the highest value and a gene having a high expression level in the leaf were regarded as candidate genes, and the expression vector was constructed as follows.

The centrilobular cDNA was cloned in a buffer containing 2 μg total RNA, 2 ng oligodT (15) primer, 10 mM dNTP, 30 units of AMV reverse transcriptase and 40 units of RNase inhibitor Deg.] C for 1 hour. (5'AAAAGCAGGCTTCATGGAGTTGGAAAATTATAGT 3 '; SEQ ID NO: 6) and the reverse primer (5'AGAAAGCTGGTCTCACACCTTCTTCACCATGAG3'; SEQ ID NO: 7) with the cDNA synthesized to amplify the complete C-23 oxidase (CYP714E19) ), The complete gene was amplified by DNA synthesis enzyme (ExTaq DNA polymerase, TAKARA). After confirming the nucleotide sequence and amino acid sequence, the gene was registered in NCBI and received accession number KT004520.

Amino acid sequence based CYP714E19 and  Other plant CYP  Analysis of liver-liver relationship

The flexible relationship is calculated using the web version CLUSTAL W program (http://clustalw.ddbj.nig.ac.jp/top-j.html), and this value is compared with the neighbor-joining method using MEGA5.2 software The intergenerational relationship was investigated. Protein distance was calculated using the Dayhoff PAM matrix method and protein interactions were calculated under 1,000 repeats. Based on these genes, we found that the CYP714E19 gene was clearly differentiated from other oxidase enzymes by a flexible system analysis with other plant oxidase enzymes known to function (Fig. 2).

Yeast overexpression vector production

Gateway system (Invitrogen) was used for gene vector construction. The pDONR / Zeo entry vector was inserted by PCR amplification of the ORFs of the target gene using the method described in Example 1, and the nucleotide sequence was confirmed by sequencing. Then, the pRAG425 (Invitrogen) / CYP714E19 vector (see FIG. 5). The completed vector was transformed into E. coli and the transformed cells were selected for 5 clones after incubation at 37 DEG C for 15 hours. The plasmid was extracted from the selected five clones, and the DNA base sequence was decoded to finally select one clone completely matching the base sequence of the C-23 oxidase enzyme gene, and the plasmid thus prepared was used for yeast transformation .

Yeast transformation and preparation of extract

In general, yeast WAT21, which has the activity of the baby pollen NADPH-CYP reductase used for plant CYP analysis, was distributed and used for transformation. Β-amyrin and β-amyrin as precursor synthesis genes reported by Moses et al. (2014, Natl Acad Sci USA, 111: 1634-1639) for the synthesis of final products hederagenin and 23-hydroxyurosolic acid in yeast, amyrin and damarenediol (GenBank accession no. AY520818, SEQ ID NO: 3) and CYP716A83 (gene synthesizing oleanolic acid and ursolic acid, GenBank accession no. KT004520, SEQ ID NO: 3) gene were used. This gene was inserted into the pYES2 vector and subjected to yeast transformation by the method performed by Kushiro et al. (1998, Eur J Biochem 238244). Additional transformations were carried out using the pAG425GAL-ccdB (Add gene) / CYP714E19 vector in yeast transformants in which the two genes pYES / CaDDS and pAG423GAL-ccdB (add gene) / CYP716A83 were inserted. For overexpression of three genes in yeast transformants with three vectors inserted, they were cultured in 20 mL of SC (synthetic complete) medium containing 2% glucose free of uracil, histidine and leucine for 2 days at 30 ° C and 220 rpm . After culturing, 2% of galactose was added to the same medium as described above to induce gene expression for 3 days. Ethyl acetate was added to the reaction solution and extracted twice. The supernatant was concentrated using nitrogen gas, and then dissolved in 400 μl chloroform: methanol = 1: 1. 100 μl was further treated with nitrogen gas After concentration again, derivatives were prepared by N, O-bis (trimethylsilyl) trifluoroacetamide (BSTFA) and pyridine and used for gas chromatography-mass spectrometer analysis.

A yeast transformant in which three genes are expressed simultaneously GC -MS analysis

The yeast extract described in Example 4 above was used to identify C-23 oxidase reacting compounds. (Agilent) column using a gas chromatograph equipped with a mass spectrometric detector (5973N), maintained at 50 ° C for 2 minutes after injection, up to 320 ° C per minute, up to 40 ° C per minute, 320 ° C per minute For 30 min to analyze the yeast extract. As a result, the yeast extract containing CaDDS and CYP716A83 gene as a control showed only α / β-amyrin, oleanolic acid and ursolic acid peaks, whereas the yeast extract containing the genes of CaDDS, CYP716A83 and CYP714E19 And 23-hydroxyerythrodiol, 23-hydroxyuvaol, and hederagenin and 23-hydroxyurosolic acid were observed. Furthermore, hederagenin and 23-hydroxy-ergolic acid were able to observe peaks consistent with the standard (Figure 3). These peaks were subjected to gas chromatography-mass spectrometer analysis to confirm more clearly. Mass spectrum analysis confirmed that the gene inserted into the yeast was a C-23 oxidase gene consistent with the mass spectrum of the standard sample (FIG. 4).

<110> REPUBLIC OF KOREA <120> Novel gene promoting biosynthesis of hederagenin and          23-hydroxyursolic acid and uses thereof <130> 1060433 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 1557 <212> DNA <213> Artificial Sequence <220> <223> CYP714E19 gene <400> 1 atggagttgg aaaattatag tagtgatatt gtgttgaaag tgatgatatc cataggtgtg 60 attggagtat tgggactggt aatggggttt tgtagagcat ttgtttggga accaaagagg 120 cttagatctt tgttgaagaa acaagggatt gatggaccag agccaaagat tgttgttggg 180 aatttactgg atatgaagaa tgcttctaag aacaaacctc ctgttgattc ttcttctggc 240 atctctcaca acggtttatc ttttcttttt cctattttca agaaatggaa agatcaatat 300 ggtccattat tcgtattttc acttgcaaac atgaacgtac tgtttgtaca caaacctgat 360 gtggtgaaag aaataaccac acacacatcc ttggacttgg gaaaaccatc ctatcaggaa 420 aaaaacctcg gccccttgct tggtcgaggc atattgacct ccaatggtga gtcttgggct 480 catcaaagga aaattcttgc tcctgaactg tacatggaca aagttaaggg gatgttacat 540 ataattacag aatctgcaat gacgttgata gacacatgga aaacacaaat agatgctcaa 600 gggggtgttg cagatataac agtcgatgag catatgagaa atttctccgg gagtgttata 660 tcaaaagctt gttttggtgg aagttatgcc aaaggagaaa aaatcttcac aaagctcaga 720 gatctccagg agctttacac taaaacgggt ttaccatttc aaattccggg aatgagacat 780 ttaccaacta agaaaaacag aaaatcttgg gcgttgcaga aggaaattgg agatttgatt 840 ctaaacgtgg tacatgaaag gaaagaagtt ggatatgaaa aggacttatt gcagatggta 900 ctggaaggtg ctgaacagag taaattcagc caagaagaaa caaacaggtt cattgttgat 960 aattgtaaaa acatctacct agctggatat gaaactactg cagtttcttt gacatggaca 1020 ctgatgcttt tggcttcaaa ccccgaatgg caaactcgcg ttcgcgacga ggcactcgag 1080 gtttgtaagg gccaaattcc aactaacgac atgcttctca agatgaaaca gctaacaatg 1140 gtcatttatg agtcactgcg gttgtattct ccggtgccag tgatttcgag ggaagccttt 1200 aaagacttga aatttgcaga tgtaaatgtc ccaaagggtg tgaatgtatg gggtgtaata 1260 tattcattgc acacagaccc tgaagtatgg gggccagatt ctttcgagtt caaccccaac 1320 agatttgaaa atggaacaag aaacgcatgc aagtatccac aatactattg cccattcgga 1380 gtcggacctc gggtatgtct cggacagaat ttggcaatag ttgagctgaa agcactagtg 1440 tctctcctcg tctctaactt ctctttcgct ctatcctcgg actacgtgca ctcccctgta 1500 atcaagctgg taatagagcc acaacatgga gttaaactca tggtgaagaa gctgtga 1557 <210> 2 <211> 518 <212> PRT <213> Artificial Sequence <220> <223> CYP714E19 amino acid <400> 2 Met Glu Leu Glu Asn Tyr Ser Ser Asp Ile Val Leu Lys Val Met Ile   1 5 10 15 Ser Ile Gly Val Ile Gly Val Leu Gly Leu Val Met Gly Phe Cys Arg              20 25 30 Ala Phe Val Trp Glu Pro Lys Arg Leu Arg Ser Leu Leu Lys Lys Gln          35 40 45 Gly Ile Asp Gly Pro Glu Pro Lys Ile Val Val Gly Asn Leu Leu Asp      50 55 60 Met Lys Asn Ala Ser Lys Asn Lys Pro Pro Val Asp Ser Ser Ser Gly  65 70 75 80 Ile Ser His Asn Gly Leu Ser Phe Leu Phe Pro Ile Phe Lys Lys Trp                  85 90 95 Lys Asp Gln Tyr Gly Pro Leu Phe Val Phe Ser Leu Ala Asn Met Asn             100 105 110 Val Leu Phe Val His Lys Pro Asp Val Val Lys Glu Ile Thr Thr His         115 120 125 Thr Ser Leu Asp Leu Gly Lys Pro Ser Tyr Gln Glu Lys Asn Leu Gly     130 135 140 Pro Leu Leu Gly Arg Gly Ile Leu Thr Ser Asn Gly Glu Ser Trp Ala 145 150 155 160 His Gln Arg Lys Ile Leu Ala Pro Glu Leu Tyr Met Asp Lys Val Lys                 165 170 175 Gly Met Leu His Ile Ile Thr Glu Ser Ala Met Thr Leu Ile Asp Thr             180 185 190 Trp Lys Thr Gln Ile Asp Ala Gln Gly Gly Val Ala Asp Ile Thr Val         195 200 205 Asp Glu His Met Arg Asn Phe Ser Gly Ser Val Ile Ser Lys Ala Cys     210 215 220 Phe Gly Gly Ser Tyr Ala Lys Gly Glu Lys Ile Phe Thr Lys Leu Arg 225 230 235 240 Asp Leu Gln Glu Leu Tyr Thr Lys Thr Gly Leu Pro Phe Gln Ile Pro                 245 250 255 Gly Met Arg His Leu Pro Thr Lys Lys Asn Arg Lys Ser Trp Ala Leu             260 265 270 Gln Lys Glu Ile Gly Asp Leu Ile Leu Asn Val Val His Glu Arg Lys         275 280 285 Glu Val Gly Tyr Glu Lys Asp Leu Leu Gln Met Val Leu Glu Gly Ala     290 295 300 Glu Gln Ser Lys Phe Ser Gln Glu Glu Thr Asn Arg Phe Ile Val Asp 305 310 315 320 Asn Cys Lys Asn Ile Tyr Leu Ala Gly Tyr Glu Thr Thr Ala Val Ser                 325 330 335 Leu Thr Trp Thr Leu Met Leu Leu Ala Ser Asn Pro Glu Trp Gln Thr             340 345 350 Arg Val Arg Asp Glu Ala Leu Glu Val Cys Lys Gly Gln Ile Pro Thr         355 360 365 Asn Asp Met Leu Leu Lys Met Lys Gln Leu Thr Met Val Ile Tyr Glu     370 375 380 Ser Leu Arg Leu Tyr Ser Pro Val Val Ser Ser Glu Ala Phe 385 390 395 400 Lys Asp Leu Lys Phe Ala Asp Val Asn Val Pro Lys Gly Val Asn Val                 405 410 415 Trp Gly Val Ile Tyr Ser Leu His Thr Asp Pro Glu Val Trp Gly Pro             420 425 430 Asp Ser Phe Glu Phe Asn Pro Asn Arg Phe Glu Asn Gly Thr Arg Asn         435 440 445 Ala Cys Lys Tyr Pro Gln Tyr Tyr Cys Pro Phe Gly Val Gly Pro Arg     450 455 460 Val Cys Leu Gly Gln Asn Leu Ala Ile Val Glu Leu Lys Ala Leu Val 465 470 475 480 Ser Leu Leu Val Ser Asn Phe Ser Phe Ala Leu Ser Ser Asp Tyr Val                 485 490 495 His Ser Pro Val Ile Lys Leu Val Ile Glu Pro Gln His Gly Val Lys             500 505 510 Leu Met Val Lys Lys Leu         515 <210> 3 <211> 1482 <212> DNA <213> Artificial Sequence <220> <223> CYP716A83 gene <400> 3 atggaactct tctttgttcc cctcttctcc tccttggttc tctttgtttt cttttgtttc 60 cttttgctct tctacaagaa caacaaatgg agatcctccg gcgcacctct ccccccgggc 120 caaacagggt ggcccttcat aggagagagt tacgagtttc tctccacagg atggaaaggc 180 tatccggaga aattcatatt tgaccggata gccaaacact cctccaacgt cttcaagacg 240 tccatcctgg gagagcacgc cgcagtattc tgcggcgcag cctgtaacaa gttcttgttc 300 tcgaacgaga acaagcttgt tcaggcctgg tggccagact ctgtaaacaa agtcttccca 360 tcttccacac agacttcttc caaagaagaa gccatcaaga tgagaaaaat gctgccaaac 420 ttcctcaaac cggacgcttt acaacgatac gttggaacca tggactccat cgccaggaga 480 catttcgagt ccggatggga caacaaaaac gaaattgtag tcttccctct ggccaaaacc 540 tacaccttct ggattgcttg taagcttttt gtaagtgtag aggaaccgtc tcaagtcgca 600 aaactcttgg aacccttcag tgccattgct tctgggatca tttctgtccc aatagatctg 660 cccggaacac cgttcaacag tgccataaag tcatccaaac gcatcaggga aatgctgtgg 720 aagatcataa agcagaggaa gattgatttg gcagagggca aagcctcccc aacacaagat 780 atattgtcac atatgctatt gacaagtgat gagaatggca agtttatgtc tgagttggat 840 attgctgata agatattagg attgttgatt ggtggacatg acactgctag ctctgcatgc 900 actttcgttg tcaagttcct tgccgagttg cccgaaatct atgatggtgt ctacaaagag 960 caaatggaga tagtgaaatc aaagggacct ggggagttat tgaactggga tgacattcag 1020 aagatgaaat attcatggaa tgtggcatgt gaagtactaa ggcttgcccc accccttcaa 1080 ggtggtttca gagaagtcct cactgatttt tcttacaatg gtttctccat ccccaagggc 1140 tggaagatat attggacagc aaattcgaca cacagaaatt cagaagtatt cccagaacca 1200 ttaaaatttg atccatcgag attcgaggga acggggccac ctccgttcac gttcgtgccg 1260 ttcggaggag gtccgagaat gtgccccggg aaggagtatg cccgattgga aatattagtg 1320 ttcatacaca acttggtgaa aaggtacaag tgggagaaaa ttattcctga tgagaagatt 1380 attgttaatc caatgccaat tccagctaaa ggacttccta ttcgtctatt tccacataaa 1440 gcctaattca tttgctttat atgtgtatgc atggactttt aa 1482 <210> 4 <211> 481 <212> PRT <213> Artificial Sequence <220> <223> CYP716A83 amino acid <400> 4 Met Glu Leu Phe Phe Val Pro Leu Phe Ser Ser Leu Val Leu Phe Val   1 5 10 15 Phe Phe Cys Phe Leu Leu Leu Phe Tyr Lys Asn Asn Lys Trp Arg Ser              20 25 30 Ser Gly Ala Pro Leu Pro Pro Gly Gln Thr Gly Trp Pro Phe Ile Gly          35 40 45 Glu Ser Tyr Glu Phe Leu Ser Thr Gly Trp Lys Gly Tyr Pro Glu Lys      50 55 60 Phe Ile Phe Asp Arg Ile Ala Lys His Ser Ser Asn Val Phe Lys Thr  65 70 75 80 Ser Ile Leu Gly Glu His Ala Ala Val Phe Cys Gly Ala Ala Cys Asn                  85 90 95 Lys Phe Leu Phe Ser Asn Glu Asn Lys Leu Val Gln Ala Trp Trp Pro             100 105 110 Asp Ser Val Asn Lys Val Phe Pro Ser Ser Thr Gln Thr Ser Ser Lys         115 120 125 Glu Glu Ala Ile Lys Met Arg Lys Met Leu Pro Asn Phe Leu Lys Pro     130 135 140 Asp Ala Leu Gln Arg Tyr Val Gly Thr Met Asp Ser Ile Ala Arg Arg 145 150 155 160 His Phe Glu Ser Gly Trp Asp Asn Lys Asn Glu Ile Val Val Phe Pro                 165 170 175 Leu Ala Lys Thr Tyr Thr Phe Trp Ile Ala Cys Lys Leu Phe Val Ser             180 185 190 Val Glu Glu Pro Ser Gln Val Ala Lys Leu Leu Glu Pro Phe Ser Ala         195 200 205 Ile Ala Ser Gly Ile Ile Ser Val Ile Asp Leu Pro Gly Thr Pro     210 215 220 Phe Asn Ser Ala Ile Lys Ser Ser Lys Arg Ile Arg Glu Met Leu Trp 225 230 235 240 Lys Ile Ile Lys Gln Arg Lys Ile Asp Leu Ala Glu Gly Lys Ala Ser                 245 250 255 Pro Thr Gln Asp Ile Leu Ser His Met Leu Leu Thr Ser Asp Glu Asn             260 265 270 Gly Lys Phe Met Ser Glu Leu Asp Ile Ala Asp Lys Ile Leu Gly Leu         275 280 285 Leu Ile Gly Gly His Asp Thr Ala Ser Ser Ala Cys Thr Phe Val Val     290 295 300 Lys Phe Leu Ala Glu Leu Pro Glu Ile Tyr Asp Gly Val Tyr Lys Glu 305 310 315 320 Gln Met Glu Ile Val Lys Ser Lys Gly Pro Gly Glu Leu Leu Asn Trp                 325 330 335 Asp Asp Ile Gln Lys Met Lys Tyr Ser Trp Asn Val Ala Cys Glu Val             340 345 350 Leu Arg Leu Ala Pro Pro Leu Gln Gly Gly Phe Arg Glu Val Leu Thr         355 360 365 Asp Phe Ser Tyr Asn Gly Phe Ser Ile Pro Lys Gly Trp Lys Ile Tyr     370 375 380 Trp Thr Ala Asn Ser Thr His Arg Asn Ser Glu Val Phe Pro Glu Pro 385 390 395 400 Leu Lys Phe Asp Pro Ser Arg Phe Glu Gly Thr Gly Pro Pro Pro Phe                 405 410 415 Thr Phe Val Pro Phe Gly Gly Gly Pro Arg Met Cys Pro Gly Lys Glu             420 425 430 Tyr Ala Arg Leu Glu Ile Leu Val Phe Ile His Asn Leu Val Lys Arg         435 440 445 Tyr Lys Trp Glu Lys Ile Ile Pro Asp Glu Lys Ile Ile Val Asn Pro     450 455 460 Met Pro Ile Pro Ala Lys Gly Leu Pro Ile Arg Leu Phe Pro His Lys 465 470 475 480 Ala     <210> 5 <211> 2283 <212> DNA <213> Artificial Sequence <220> <223> CaDDS gene sequence (AY520818) <400> 5 atgtggaagc tgaagatagc agagggtaat ggagcatact tgtacagcac caacaacttt 60 gtgggagag agatatggga gtatgatcct gatgctggaa ctcctgaaga gcgactagag 120 gtcgagaaac ttcgagaaac ttacaaatat aatctcatca acaatgggat tcacccttgt 180 ggtgatatgc tcatgaggtt gcagctgata aaggagagtg ggctggatct tttgagcata 240 ccgccggtga gacttggaga acaagaagaa gtgaattatc aagtagtgac gacggctgtt 300 aagaaagctc tgcggttaaa ccgcgcaatc caagctcacg acggtcactg gccagctgaa 360 aatgctggac ctatgttttt tacaccaccc ctcatcatag cgctatacat cagcggagca 420 attgacactc atctaacaat acaacacaag aaggagatga ttcgttttat ttacctccac 480 caaaacaaag atggaggatg gggattctat atagagggac atagcacgat gatagggtca 540 gcacttagct acgtggcgtt acgtttgctg ggagaagggc ctgatgacgg cgatggtgca 600 gtggagagag caagaaaatg gatccttgac catggtggtg ctgcttctat accctcctgg 660 ggtaagactt atcttgcggt tcttggggta tacgagtggg aagggtgtaa ccccctgccc 720 ccagaatttt ggcttttccc tgaagcttta ccttatcatc cagcaaaaat gtggtgttac 780 tgtcgcacaa catacatgcc gatgtcgtat ttgtatggga agaaatatca tggtccaatt 840 acggatcttg ttatatcttt aagaaaagaa atacacccca ttccttatga gaagataaat 900 tggaacaaac agcgccataa ctgtaacaag gaggatcttt actaccctca tagctttata 960 caggatttgc tatgggatgg tcttcactat tttactgaac ctatcattaa aatgtggccc 1020 ttcaataagt tgcgaaagaa agggatgaaa agagccattg aacttatgcg ctacggaggt 1080 tatgagagca gattcattac cattggatgt gtatccaaga gtctagatat gatgtgttgg 1140 tgggcagaga acccgaatgg tccagaattc aaacatcact tagctagagt acctgattac 1200 ttgtggcttg cagaggatgg aatgaagatg cagagttttg gtagtcaatt atgggactgt 1260 gttcttgcta ctcaagctgt catgtctact ggtatggttg atgaatatgg ggattgtctt 1320 aagaaagcac atttctatat taaagaatca cagtgcaaga aaaatccgtc aggagattat 1380 gcaagtatgt gccggtattt tacaaaagga tcatggacat tttctgatca agatcagggt 1440 tgggttgtct ctgattgcac agctgaagcg ctgaagtgtc tattagcact ttctcaaatg 1500 ccagaggaaa ttgcagggga aaaggcagat gttgagcgat tatatgatgc cgtaaacgtc 1560 ctcctctact tgcaaagccc tataagtggg ggttttgcca tttgggagcc accagttcca 1620 agaccatact tgcaggtgtt gaatccttcg gagatttttg ccgacatcgt tgtcgaaaaa 1680 gagcatacgg agtgcacagc atcaataata gcagctctgg tagcattcaa acgtttgcat 1740 ccgggtcatc ggtcgaaaga aataagtgtt gccatcgcaa aagctgtaca ttttcttgaa 1800 ggaaaacaat tggaagatgg ttcatggtat ggctactggg gaatatgctt tttgtatggc 1860 acattttttg cgttagctgg gttagcttct gtgggacaga cttatgaaaa cagtgaaacc 1920 gttcgtaaag ctgttaagtt tttcctttct acacaaaatg aagaaggtgg ttggggagaa 1980 agtcttgaat catgtccgag cgagatattc acaccattag aaggaaacag aacaaattta 2040 gtacaaacat catgggcaat gcttggtctc atgtttggtg gacaggccac gagagatcca 2100 actccattgc atagagcagc aaagttattg attaatgcac aattgaataa cggagatttc 2160 cctcagcagg aaacaactgg agtgtacatg aagaattgta tgttgcatta tgccgagtat 2220 agaaatgtat ttccgttatg ggcacttgga gagtaccgca aacgcttgtg gctctccaat 2280 tga 2283 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CYP714E19 forward primer <400> 6 aaaaagcagg cttcatggag ttggaaaatt atagt 35 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> CYP714E19 reverse primer <400> 7 agaaagctgg gtctcacagc ttcttcacca tgag 34 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> CYP716A83 forward primer <400> 8 aaaaagcagg cttcatggaa ctcttctttg ttccc 35 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> CYP716A83 reverse primer <400> 9 agaaagctgg gtcttaggct ttatgtggaa atag 34

Claims (12)

A triterpene biosynthetic gene encoding the amino acid sequence of SEQ ID NO: 2.
The gene according to claim 1, wherein the triterpene is at least one selected from the group consisting of hederagenin and 23-hydroxyursolic acid.
The gene according to claim 1, wherein the gene is isolated from Centella asiatica and is represented by SEQ ID NO: 1.
The gene according to claim 1, wherein the gene codes for a carbon-23 oxidase.
A protein consisting of the amino acid sequence of SEQ ID NO: 2 encoded from the gene of claim 1.
A recombinant vector comprising the gene of claim 1.
7. The recombinant vector according to claim 6, wherein said recombinant vector has the cleavage map set forth in FIG.
A host cell transformed with the recombinant vector of claim 6.
9. The transformed host cell of claim 8, wherein the transformed host cell is further transformed with a pYES / CaDDS and pAG423 / CYP716A83 recombinant vector having the cleavage map set forth in FIG.
10. The transformed host cell according to claim 8 or 9, wherein the host cell is yeast or Escherichia coli.
(a) introducing the gene of claim 1 into a host cell; And
(b) culturing the host cell. &lt; RTI ID = 0.0 &gt; 23. &lt; / RTI &gt;
12. The method according to claim 11, wherein the step of culturing the host cells comprises culturing in a synthetic complete medium containing 0.1 to 5% of glucose at 15 to 40 DEG C for 5 to 200 hours without containing uracil and histidine Wherein the hederagenin and the 23-hydroxyurusolic acid are biosynthesized.

Images