KR20220125407A

KR20220125407A - LCYB2 mutant from Daucus carota and uses thereof

Info

Publication number: KR20220125407A
Application number: KR1020210029174A
Authority: KR
Inventors: 조혜선; 조승희; 박현지
Original assignee: 한국생명공학연구원
Priority date: 2021-03-05
Filing date: 2021-03-05
Publication date: 2022-09-14
Also published as: KR102525540B1

Abstract

The present invention relates to a variant of lycopene β-cyclase2 (LCYB2) which is a protein derived from Daucus carota and uses thereof. By using the LCYB2 variant according to the present invention, which can increase the lycopene content by inhibiting carotene biosynthesis, it is possible to develop a high-quality plant with increased lycopene content, so that the developed high-quality plant with increased lycopene content is expected to be widely used as a material for as functional foods, cosmetics, and animal feeds.

Description

Carrot-derived LCYB2 protein variant and uses thereof {LCYB2 mutant from Daucus carota and uses thereof}

본 발명은 당근(Daucus carota) 유래 LCYB2(lycopene β-cyclase 2) 단백질의 140번째에 세린(serine)이 삽입된 LCYB2 변이체 및 이의 용도에 관한 것이다.The present invention relates to a LCYB2 variant in which serine is inserted at the 140th position of lycopene β-cyclase 2 (LCYB2) protein derived from carrot ( Daucus carota ) and its use.

라이코펜(lycopene)은 밝은 적색을 띠는 카로티노이드계 색소로, 토마토, 당근, 수박, 붉은 고추 등의 붉은색 채소와 딸기, 감, 붉은 포도, 석류, 자몽, 구아바 등의 붉은색 과일에 풍부하게 포함되어 있으며, 붉은색이 진할수록 라이코펜의 함유량이 많은 것으로 알려져 있다. 라이코펜은 세포의 대사에서 생기는 활성산소(세포를 손상시켜 질병과 노화를 유발)를 몸 밖으로 배출하는 작용을 하며, 이러한 라이코펜의 항산화 작용은 β-카로틴(비타민 A)의 2배, 비타민 E의 100배 이상으로 강력한 항산화 작용을 보인다. 또한, 라이코펜은 그 자체로 항암 효과가 있으며, 특히 호르몬 대사에 문제가 있을 때 발생하는 전립선암과 유방암에 대한 예방 효과가 큰 것으로 알려져 있다. 따라서 항산화 및 항암 효과가 우수한 라이코펜은 식품 산업, 사료 산업 또는 코스메틱 산업 등 그 활용 분야가 매우 다양하다. Lycopene is a bright red carotenoid pigment and is abundantly contained in red vegetables such as tomatoes, carrots, watermelons, and red peppers and red fruits such as strawberries, persimmons, red grapes, pomegranates, grapefruit, and guava. It is known that the darker the red color, the higher the content of lycopene. Lycopene has the effect of discharging free radicals generated in the metabolism of cells (damaging cells and causing disease and aging) out of the body. It has more than twice the antioxidant activity. In addition, lycopene has an anticancer effect on its own, and is known to have a large preventive effect on prostate cancer and breast cancer, which occur when there is a problem in hormone metabolism in particular. Therefore, lycopene, which has excellent antioxidant and anticancer effects, has a wide range of applications, such as the food industry, feed industry, or cosmetic industry.

화학 합성법을 이용하여 라이코펜을 합성할 수 있으나 화학 합성으로 제조된 라이코펜은 천연 라이코펜에 비해 생체 흡수율이 낮고, 식품 첨가제로서의 안전성에 문제가 되고 있어 일부 국가에서만 사용이 허가된 상태이다. 이로 인해 천연 라이코펜의 생산법에 대한 관심이 높아지고 있으며, 이 중 대장균과 같은 박테리아를 이용한 라이코펜의 제조에 상업적 관심이 일고 있다. 또한, 라이코펜과 같은 고부가가치 생리활성 물질을 보다 경제적으로 대량 생산하기 위해서 식물배양세포 및 식물체 자체를 이용하여 생산비를 낮추는 방법이 유용하게 이용될 수 있으며, 유용물질을 고생산하는 식물체를 개발하여 다시 식물배양세포를 유도하면 유용물질을 생산하고 대량생산까지의 시간이 적게 소요되며 배양 세포의 스케일 업 배양이 용이한 장점이 있다.Although lycopene can be synthesized using chemical synthesis, lycopene produced by chemical synthesis has a lower bioabsorption rate compared to natural lycopene and is a problem in safety as a food additive, so it is only licensed in some countries. Due to this, interest in the production method of natural lycopene is increasing, and among them, there is a commercial interest in the production of lycopene using bacteria such as E. coli. In addition, in order to more economically mass-produce high value-added physiologically active substances such as lycopene, a method of lowering the production cost using plant cultured cells and the plant itself can be usefully used. Induction of plant cultured cells has advantages in that it takes less time to produce useful substances and mass production, and facilitates scale-up culture of cultured cells.

한편, 한국등록특허 제1515152호에 고구마 유래의 'LCY-β 유전자를 이용한 환경 스트레스에 대한 내성이 증진된 형질전환 식물체의 제조방법 및 그에 따른 식물체'가 개시되어 있고, 한국등록특허 제2068678호에 라이코펜 생산을 향상시킬 수 있는 'crtE 또는 crtB 돌연변이 유전자 및 이의 용도'가 개시되어 있으나, 본 발명의 당근 유래 LCYB2 단백질 변이체 및 이의 용도에 대해서는 기재된 바가 없다.On the other hand, Korean Patent No. 1515152 discloses 'a method for producing a transgenic plant with improved tolerance to environmental stress using the LCY-β gene and a plant according thereto' derived from sweet potato, and Korean Patent No. 2068678 Although the 'crtE or crtB mutant gene and use thereof' capable of enhancing lycopene production has been disclosed, there is no description of the carrot-derived LCYB2 protein mutant of the present invention and its use.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 당근의 홍색 형질 유전자 교정을 위한 표적 유전자 발굴을 위해 홍색 당근과 주황색 당근 유래 LCYB2(lycopene β-cyclase 2)의 아미노산 서열을 비교한 결과, 주황색 당근과 달리 홍색 당근의 LCYB2 단백질 아미노산 서열은 140번째에 세린(serine)이 삽입된 것을 확인하였다. 그 후, E. coli 시스템을 통해 주황색 당근의 LCYB2 단백질 아미노산 서열 140번째 위치에 세린을 삽입시킨 변이체를 발현시킨 결과, 주황색이 아닌 홍색의 생성물이 관찰되었고, 분자기전을 규명한 결과, 14번째에 세린이 삽입된 LCYB2 변이체는 LCYB2의 활성이 저해되어 라이코펜이 카로틴으로 전환되지 않아 라이코펜의 함량이 증가하는 것을 확인함으로써, 본 발명을 완성하였다.The present invention was derived from the above needs, and the present inventors compared the amino acid sequences of LCYB2 (lycopene β-cyclase 2) derived from red and orange carrots to discover a target gene for correcting the red trait gene in carrots. , It was confirmed that serine was inserted at the 140th position in the LCYB2 protein amino acid sequence of red carrots, unlike orange carrots. Then, as a result of expressing a mutant in which serine was inserted at the 140th position of the LCYB2 protein amino acid sequence of orange carrots through the E. coli system, a red product was observed instead of orange. As a result of identifying the molecular mechanism, the 14th The present invention was completed by confirming that the LCYB2 mutant into which serine was inserted did not convert lycopene to carotene due to inhibition of LCYB2 activity, thereby increasing the content of lycopene.

상기 과제를 해결하기 위해, 본 발명은 서열번호 1의 아미노산 서열로 이루어진 당근(Daucus carota) 유래 LCYB2(lycopene β-cyclase 2) 변이체를 제공한다.In order to solve the above problems, the present invention provides a carrot ( Daucus carota ) derived LCYB2 (lycopene β-cyclase 2) variant consisting of the amino acid sequence of SEQ ID NO: 1.

또한, 본 발명은 상기 LCYB2 변이체를 코딩하는 유전자를 제공한다.In addition, the present invention provides a gene encoding the LCYB2 variant.

또한, 본 발명은 상기 유전자를 포함하는 재조합 벡터를 제공한다.In addition, the present invention provides a recombinant vector comprising the gene.

또한, 본 발명은 상기 재조합 벡터로 형질전환된 숙주세포를 제공한다.In addition, the present invention provides a host cell transformed with the recombinant vector.

또한, 본 발명은 상기 재조합 벡터로 식물세포를 형질전환하는 단계; 및 상기 형질전환된 식물세포로부터 식물을 재분화하는 단계;를 포함하는 라이코펜(lycopene) 함량이 증가된 형질전환 식물체의 제조방법을 제공한다.In addition, the present invention comprises the steps of transforming plant cells with the recombinant vector; and re-differentiating the plant from the transformed plant cells; provides a method for producing a transgenic plant comprising an increased content of lycopene.

또한, 본 발명은 상기 방법에 의해 제조된 라이코펜 함량이 증가된 형질전환 식물체 및 상기 식물체의 형질전환된 종자를 제공한다.In addition, the present invention provides a transgenic plant having an increased lycopene content produced by the method and a transformed seed of the plant.

또한, 본 발명은 서열번호 1의 아미노산 서열로 이루어진 당근 유래 LCYB2 변이체를 코딩하는 유전자를 유효성분으로 포함하는 식물체의 라이코펜 함량 증진용 조성물을 제공한다.In addition, the present invention provides a composition for enhancing the lycopene content of plants comprising a gene encoding a carrot-derived LCYB2 mutant consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

본 발명에 따른 LCYB2 변이체는 라이코펜을 카로틴으로 전환시키는 LCYB2의 활성을 억제시켜 라이코펜 함량을 증가시킬 수 있으므로, 본 발명의 LCYB2 변이체를 활용하여 라이코펜 함량이 증진된 고품질의 식물체를 개발하여 기능성 식품, 화장품, 사료 등의 소재로 다양하게 활용할 수 있을 것으로 기대된다.The LCYB2 variant according to the present invention can increase the lycopene content by inhibiting the activity of LCYB2 that converts lycopene into carotene. It is expected that it can be used in a variety of materials such as , feed, etc.

도 1은 카로티노이드(carotenoid) 합성 과정에서 라이코펜을 α-카로틴(carotene) 또는 β-카로틴으로 전환시키는 효소인, 홍색 당근(Daucus carota) 계통(D802, D903, D904, 19-1284)과 주황색 당근 계통(GD2002, GD2003) 유래 LCYB2(lycopene β-cyclase 2) 단백질의 아미노산 서열을 비교 분석한 결과이다. 빨간색 박스는 당근 계통별 LCYB2 아미노산 서열 간의 아미노산 잔기 차이를 표시한 것이다.
도 2는 홍색 당근 계통(D802, D903, D904, 19-1284)과 주황색 당근 계통(GD2002, GD2003) 유래 DcLCYB1, DcLCYB2, DcLCYE, DcSGR1 및 DcOR 단백질의 아미노산 서열을 비교하여 일치도를 나타낸 표이다. 각각의 단백질 결과에서 당근 계통별로 같은 색으로 표시된 것은 아미노산 서열이 100% 일치하는 것을 의미하고, 다른색으로 표시된 것은 아미노산 서열에 차이가 있음을 의미한다. *: 효소 활성 측정에 사용된 유전자 표시.
도 3A는 근색에 따른 당근 계통별 LCYB2 효소 활성을 분석하기 위해 라이코펜 생합성에 관여하는 에르위니아 허비콜라(Erwinia herbicola) 균주 유래의 crtE, crtI 및 crtB 유전자가 클로닝된 pAC-LYC 벡터와, D903, GD2003 또는 19-1284 계통 유래 DcLCYB2 유전자가 클로닝된 pET28a-DcLCYB2 벡터로 대장균(E. coli)을 공동 형질전환(co-tranformation)시킨 후 E. coli 세포색을 관찰한 사진이고, 도 3B는 상기 형질전환된 E. coli 세포로부터 RNA를 추출하고 PCR을 수행하여 LCYB2의 발현 수준을 확인한 결과이다. 음성대조군: 에르위니아 허비콜라(Erwinia herbicola) 유래의 crtE, crtI 및 crtB 유전자가 클로닝되어 있는 pAC-LYC 벡터로 형질전환된 E. coli 세포. 양성대조군: pAC-LYC 벡터와 애기장대 유래 LCYB가 클로닝되어 있는 pLCYbsk 벡터로 공동 형질전환된 E. coli 세포, AtLCYbsk: 애기장대(Arabidopsis thaliana) 유래 LCYB 유전자가 클로닝된 벡터.
도 4는 홍색 당근 D903 및 19-1284 계통과 주황색 당근 GD2003 계통의 LCYB2 아미노산 서열을 비교 분석한 결과이다.
도 5는 홍색 당근 19-1284 계통 유래 LCYB2 아미노산 서열의 140번째 세린(serine)을 삽입한 구조체(PM1) 또는 344번째 발린(valine)을 이소류신(isoleucine)으로 치환(V344I)시킨 구조체(PM2)가 클로닝된 벡터와, 에르위니아 허비콜라 균주 유래의 crtE, crtI 및 crtB 유전자가 클로닝된 pAC-LYC 벡터로 공동 형질전환된 E. coli 세포의 색을 관찰한 사진이다. 음성대조군(-): 에르위니아 허비콜라 유래의 crtE, crtI 및 crtB 유전자가 클로닝되어 있는 pAC-LYC 벡터로 형질전환된 E. coli 세포, 양성대조군(+): pAC-LYC 벡터와 애기장대 유래 LCYB가 클로닝되어 있는 pLCYbsk 벡터로 공동 형질전환된 E. coli 세포, D903: 홍색 당근 D903 계통 유래 LCYB2 유전자가 클로닝된 벡터로 형질전환된 E. coli 세포, 19-1284: 홍색 당근 19-1284 계통 유래 LCYB2 유전자가 클로닝된 벡터로 형질전환된 E. coli 세포.
도 6은 주황색 당근 GD2003 계통 유래 LCYB2 아미노산 서열의 140번째 세린(serine)을 삽입한 구조체(PM1) 또는 344번째 발린(valine)을 이소류신(isoleucine)으로 치환(V344I)시킨 구조체(PM2)가 클로닝된 벡터와 에르위니아 허비콜라 균주 유래의 crtE, crtI 및 crtB 유전자가 클로닝된 pAC-LYC 벡터로 공동 형질전환된 E. coli 세포의 색을 관찰한 사진이다. 음성대조군(-): 에르위니아 허비콜라 유래의 crtE, crtI 및 crtB 유전자가 클로닝되어 있는 pAC-LYC 벡터로 형질전환된 E. coli 세포, 양성대조군(+): pAC-LYC 벡터와 애기장대 유래 LCYB가 클로닝되어 있는 pLCYbsk 벡터로 공동 형질전환된 E. coli 세포, D903: 홍색 당근 D903 계통 유래 LCYB2 유전자가 클로닝된 벡터로 형질전환된 E. coli 세포, 19-1284: 홍색 당근 19-1284 계통 유래 LCYB2 유전자가 클로닝된 벡터로 형질전환된 E. coli 세포.
도 7A는 홍색 당근 D903 계통 또는 주황색 당근 GD2003 계통 유래의 LCYB1 또는 LCYE 유전자가 클로닝된 벡터와 pAC-LYC 벡터로 공동 형질전환된 E. coli 세포의 색을 관찰한 사진이고, 도 7B는 상기 형질전환된 E. coli 세포로부터 RNA를 추출하고 PCR을 수행하여 LCYB1 또는 LCYE의 발현 수준을 확인한 결과이다. 음성대조군(-): 에르위니아 허비콜라 유래의 crtE, crtI 및 crtB 유전자가 클로닝되어 있는 pAC-LYC 벡터로 형질전환된 E. coli 세포.
도 8은 홍색 당근 D904 또는 19-1284 계통과 주황색 당근 GD2003 계통 유래 SGR1-1 유전자가 클로닝된 벡터와 pAC-LYC 벡터 또는 pAC-BETA 벡터가 공동 형질전환된 E. coli 세포의 색을 관찰한 결과이다. pAC-LYC 또는 pAC-BETA: 에르위니아 허비콜라 유래의 crtE, crtI 및 crtB 유전자가 클로닝된 벡터. 1 is an enzyme that converts lycopene into α-carotene or β-carotene in the carotenoid synthesis process, red carrot ( Daucus carota ) strains (D802, D903, D904, 19-1284) and orange carrot strains (GD2002, GD2003) is the result of comparative analysis of the amino acid sequence of LCYB2 (lycopene β-cyclase 2) protein. Red boxes indicate amino acid residue differences between LCYB2 amino acid sequences by carrot strains.
2 is a table showing the degree of agreement by comparing the amino acid sequences of DcLCYB1, DcLCYB2, DcLCYE, DcSGR1 and DcOR proteins derived from red carrot lines (D802, D903, D904, 19-1284) and orange carrot lines (GD2002, GD2003). In each protein result, the same color for each carrot line means that the amino acid sequence is 100% identical, and the different color means there is a difference in the amino acid sequence. *: Indicates the gene used to measure enzyme activity.
3A is a pAC-LYC vector in which the crtE , crtI and crtB genes are cloned from Erwinia herbicola strains involved in lycopene biosynthesis in order to analyze LCYB2 enzyme activity by carrot lineage according to root color, D903, GD2003 Or 19-1284 line-derived DcLCYB2 gene is cloned pET28a-DcLCYB2 vector E. coli ( E. coli ) after co-transformation (co-transformation) is a photograph of observing the E. coli cell color, Figure 3B is the transformation This is the result of confirming the expression level of LCYB2 by extracting RNA from E. coli cells and performing PCR. Negative control: E. coli cells transformed with the pAC-LYC vector into which the crtE , crtI and crtB genes derived from Erwinia herbicola were cloned. Positive control: E. coli cells co-transformed with pAC-LYC vector and pLCYbsk vector in which Arabidopsis thaliana-derived LCYB was cloned, AtLCYbsk: Arabidopsis thaliana -derived LCYB gene cloned vector.
4 is a result of comparative analysis of LCYB2 amino acid sequences of red carrot D903 and 19-1284 strains and orange carrot GD2003 strains.
5 is a construct (PM1) in which serine at position 140 of the LCYB2 amino acid sequence derived from red carrot 19-1284 line is inserted (PM1) or a structure in which valine at position 344 is substituted with isoleucine (V344I) (PM2) This is a photograph of observing the color of the cloned vector and the E. coli cells co-transformed with the pAC-LYC vector in which the crtE , crtI and crtB genes derived from the Erwinia herbivola strain were cloned. Negative control (-): E. coli cells transformed with pAC-LYC vector into which crtE , crtI and crtB genes derived from Erwinia herbivola were cloned, positive control group (+): pAC-LYC vector and LCYB derived from Arabidopsis thaliana E. coli cells co-transformed with the pLCYbsk vector into which was cloned, D903: E. coli cells transformed with the vector cloned with the LCYB2 gene derived from the red carrot D903 line, 19-1284: LCYB2 from the red carrot 19-1284 line E. coli cells transformed with the gene cloned vector.
6 shows a structure (PM1) in which serine at position 140 of the LCYB2 amino acid sequence derived from orange carrot GD2003 line is inserted (PM1) or a structure in which valine at position 344 is replaced with isoleucine (V344I) is cloned (PM2) This is a photograph of observing the color of E. coli cells co-transformed with the vector and the pAC-LYC vector in which the crtE , crtI and crtB genes derived from the Erwinia Herbicola strain were cloned. Negative control (-): E. coli cells transformed with pAC-LYC vector into which crtE , crtI and crtB genes derived from Erwinia herbivola were cloned, positive control group (+): pAC-LYC vector and LCYB derived from Arabidopsis thaliana E. coli cells co-transformed with the pLCYbsk vector into which was cloned, D903: E. coli cells transformed with the vector cloned with the LCYB2 gene derived from the red carrot D903 line, 19-1284: LCYB2 from the red carrot 19-1284 line E. coli cells transformed with the gene cloned vector.
7A is a photograph of observing the color of E. coli cells co-transformed with a vector in which the LCYB1 or LCYE gene derived from the red carrot D903 line or the orange carrot GD2003 line was cloned and the pAC-LYC vector, and FIG. 7B is the transformation. This is the result of confirming the expression level of LCYB1 or LCYE by extracting RNA from E. coli cells and performing PCR. Negative control (-): E. coli cells transformed with the pAC-LYC vector into which the crtE , crtI and crtB genes derived from Erwinia herbivola were cloned.
8 is a result of observing the color of E. coli cells co-transformed with a vector cloned with the SGR1-1 gene derived from a red carrot D904 or 19-1284 line and an orange carrot GD2003 line, and a pAC-LYC vector or a pAC-BETA vector. to be. pAC-LYC or pAC-BETA: A vector into which the crtE , crtI and crtB genes derived from Erwinia herbivola are cloned.

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 1의 아미노산 서열로 이루어진 당근(Daucus carota) 유래 LCYB2(lycopene β-cyclase 2) 변이체를 제공한다.In order to achieve the object of the present invention, the present invention provides a carrot ( Daucus carota ) derived LCYB2 (lycopene β-cyclase 2) variant consisting of the amino acid sequence of SEQ ID NO: 1.

상기 LCYB2 단백질은 라이코펜의 말단 부분을 고리화(cyclization)하여 β-카로틴(carotene)으로 전환시키는 반응을 촉매하는 효소를 의미한다.The LCYB2 protein refers to an enzyme that catalyzes a reaction of cyclizing the terminal portion of lycopene into β-carotene.

본 발명에 따른 LCYB2 변이체는 근색이 홍색인 당근 D903 계통에서 유래된 서열번호 1의 LCYB2 단백질로, 근색이 주황색인 당근 계통의 LCYB2 단백질 아미노산 서열과 비교하여 140번째 위치에 세린(serine) 잔기가 삽입되어 있다. 따라서, 본 발명의 LCYB2 변이체는 세린 잔기 삽입에 의해 라이코펜에서 카로틴으로의 전환을 억제시키므로, 서열번호 1의 아미노산 서열로 이루어진 당근 유래 LCYB2 변이체가 과발현된 형질전환된 식물체는 라이코펜 함량이 증가될 수 있다.The LCYB2 variant according to the present invention is the LCYB2 protein of SEQ ID NO: 1 derived from the carrot D903 line with a red root color, and a serine residue is inserted at the 140th position compared to the LCYB2 protein amino acid sequence of the carrot line with an orange root color. has been Therefore, since the LCYB2 mutant of the present invention inhibits the conversion of lycopene to carotene by insertion of a serine residue, the transformed plant in which the carrot-derived LCYB2 mutant comprising the amino acid sequence of SEQ ID NO: 1 is overexpressed may increase the lycopene content. .

본 발명은 또한, 당근 유래 LCYB2 단백질의 140번째에 세린이 삽입된 LCYB2 변이체를 코딩하는 유전자를 제공한다. 상기 유전자는 폴리뉴클레오티드와 같은 의미이다. 본 발명에 따른 상기 단백질 변이체를 코딩하는 유전자는 서열번호 2의 염기서열을 포함할 수 있다. 또한, 상기 염기서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로는, 상기 유전자는 서열번호 2의 염기서열과 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.The present invention also provides a gene encoding a LCYB2 variant in which a serine is inserted at the 140th position of the carrot-derived LCYB2 protein. The gene is synonymous with a polynucleotide. The gene encoding the protein variant according to the present invention may include the nucleotide sequence of SEQ ID NO: 2. In addition, homologs of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene comprises a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, most preferably 95% or more to the nucleotide sequence of SEQ ID NO: 2 may include The "% of sequence homology" for a polynucleotide is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (additions or deletions) to the optimal alignment of the two sequences. may include additions or deletions (ie, gaps) compared to (not including).

본 발명은 또한, 상기 유전자를 포함하는 재조합 벡터를 제공한다.The present invention also provides a recombinant vector comprising the gene.

용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 코딩된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 단편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.The term "recombinant" refers to a cell in which the cell replicates, expresses a heterologous nucleic acid, or expresses a peptide, heterologous peptide or protein encoded by the heterologous nucleic acid. Recombinant cells can express genes or gene fragments not found in the native form of the cell, either in sense or antisense form. Recombinant cells can also express genes found in cells in a natural state, but the genes are modified and re-introduced into cells by artificial means.

용어 "벡터"는 세포 내로 전달하는 DNA 단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 용어 "전달체"는 흔히 "벡터"와 호환하여 사용된다.The term “vector” is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "carrier" is often used interchangeably with "vector."

본 발명의 벡터는 전형적으로 발현 또는 클로닝을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 예를 들어, 본 발명의 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터 (예를 들면, pLλ 프로모터, trp 프로모터, lac 프로모터, T7 프로모터, tac 프로모터 등), 해독의 개시를 위한 리보솜 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 숙주 세포로서 대장균(Escherichia coli)이 이용되는 경우, E. coli 트립토판 생합성 경로의 프로모터 및 오퍼레이터 부위, 그리고 파아지 λ의 좌향 프로모터 (pLλ 프로모터)가 조절 부위로서 이용될 수 있다.Vectors of the invention can typically be constructed as vectors for expression or cloning. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) ), a ribosome binding site for initiation of translation and a transcription/translation termination sequence. When Escherichia coli is used as the host cell, the promoter and operator sites of the E. coli tryptophan biosynthesis pathway, and the left-handed promoter (pLλ promoter) of phage λ may be used as regulatory regions.

본 발명의 재조합 벡터는 당업자에 주지된 방법에 의해 구축될 수 있다. 상기 방법은 시험관 내 재조합 DNA 기술, DNA 합성 기술 및 생체 내 재조합 기술 등을 포함한다. 상기 DNA 서열은 mRNA 합성을 이끌기 위해 발현 벡터 내의 적당한 프로모터에 효과적으로 연결될 수 있다. 또한 벡터는 번역 개시 부위로서 리보솜 결합 부위 및 전사 터미네이터를 포함할 수 있다.The recombinant vector of the present invention can be constructed by methods well known to those skilled in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology. The DNA sequence can be effectively linked to a suitable promoter in an expression vector to direct mRNA synthesis. The vector may also include a ribosome binding site as a translation initiation site and a transcription terminator.

본 발명의 벡터는 선택표지로서, 당업계에서 통상적으로 이용되는 항생제 내성 유전자를 포함할 수 있으며, 예를 들어 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신, 카나마이신, 게네티신, 네오마이신 및 테트라사이클린에 대한 내성 유전자가 있다.The vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and a resistance gene to tetracycline.

본 발명은 또한, 상기 재조합 벡터로 형질전환된 숙주세포를 제공한다.The present invention also provides a host cell transformed with the recombinant vector.

본 발명의 벡터를 원핵세포에 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주세포는 당업계에 공지된 어떠한 숙주세포도 이용할 수 있으며, 예컨대, E. coli BL21, E. coli JM109, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, 바실러스 서브틸리스(Bacillus subtilis), 바실러스 튜린겐시스(Bacillus thuringiensis)와 같은 바실러스 속 균주, 그리고 살모넬라 티피무리움(Salmonella typhimurium), 세라티아 마르세센스(Serratia marcescens) 및 다양한 슈도모나스 종과 같은 장내균과 균주 등이 있다.As a host cell capable of continuously cloning and expressing the vector of the present invention in a prokaryotic cell, any host cell known in the art may be used, for example, E. coli BL21, E. coli JM109, E. coli RR1 , E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis ( Bacillus subtilis ), Bacillus thuringiensis ( Bacillus thuringiensis ), such as Bacillus genus strains, and Salmonella typhimurium ( Salmonella typhimurium ), Serratia marcescens ( Serratia marcescens ) and enterobacteriaceae and strains such as various Pseudomonas species.

또한, 본 발명의 벡터를 진핵 세포에 형질전환시키는 경우에는 숙주세포로서, 효모(예컨대, Saccharomyce cerevisiae; Pichia pastoris; Kluyveromyces lactis; Kluyveromyces marxianus; Yarrowia lipolytica; Hansenula polymorpha 등), 곤충세포(예컨대, Spodoptera frugiperda Sf9, Sf21, High Five^TM), 동물세포 (예컨대, CHO 세포주(Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN 및 MDCK 세포주) 및 식물세포 등이 이용될 수 있다.In addition, when the vector of the present invention is transformed into a eukaryotic cell, as a host cell, yeast (eg, Saccharomyce cerevisiae ; Pichia pastoris ; Kluyveromyces lactis ; Kluyveromyces marxianus ; Yarrowia lipolytica ; Hansenula polymorpha , etc.), insect cells (eg, Spodoptera frugiperda ) Sf9, Sf21, High Five ^TM ), animal cells (eg, CHO cell lines (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines) and plant cells can be used. .

본 발명의 일 구현 예에 따른 재조합 벡터로 형질전환된 숙주세포는 바람직하게는 식물세포 또는 E. coli BL21(DE3)일 수 있으나, 이에 제한되지 않는다.The host cell transformed with the recombinant vector according to an embodiment of the present invention may preferably be a plant cell or E. coli BL21 (DE3), but is not limited thereto.

본 발명의 벡터를 숙주세포 내로 운반하는 방법은, 숙주세포가 원핵 세포인 경우, CaCl₂ 방법, 하나한 방법(Hanahan, D., 1983 J. Mol. Biol. 166, 557-580) 및 전기천공 방법 등에 의해 실시될 수 있다. 또한, 숙주세포가 진핵세포인 경우에는, 미세주입법, 칼슘포스페이트 침전법, 전기천공법, 리포좀-매개 형질감염법, DEAE-덱스트란 처리법, 및 유전자 밤바드먼트 등에 의해 벡터를 숙주세포 내로 주입할 수 있다.Methods for delivering the vector of the present invention into a host cell include, when the host cell is a prokaryotic cell, the CaCl ₂ method, the Hanahan method (Hanahan, D., 1983 J. Mol. Biol. 166, 557-580) and electroporation. method and the like. In addition, when the host cell is a eukaryotic cell, the vector may be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene bombardment. can

본 발명은 또한, The present invention also

상기 서열번호 1의 아미노산 서열로 이루어진 LCYB2 변이체 코딩 유전자를 포함하는 재조합 벡터로 식물세포를 형질전환하는 단계; 및Transforming plant cells with a recombinant vector containing the LCYB2 mutant coding gene consisting of the amino acid sequence of SEQ ID NO: 1; and

상기 형질전환된 식물세포로부터 식물을 재분화하는 단계;를 포함하는 라이코펜 함량이 증가된 형질전환 식물체의 제조방법을 제공한다.It provides a method for producing a transgenic plant having an increased lycopene content, comprising the step of re-differentiating a plant from the transformed plant cells.

본 발명의 일 구현 예에 따른 방법에 있어서, 상기 LCYB2 변이체를 코딩하는 유전자의 범위는 전술한 것과 같다.In the method according to an embodiment of the present invention, the range of the gene encoding the LCYB2 variant is as described above.

본 발명의 일 구현 예에 따른 제조방법에 있어서, 라이코펜 함량이 증가된 형질전환 식물체의 제조방법은 상기 LCYB2 변이체를 코딩하는 유전자를 식물세포에서 과발현시키거나 근색이 주황색인 당근 유래 LCYB2 단백질의 140번째에 세린 잔기를 삽입시켜 LCYB2 단백질의 활성을 저해시켜 식물체의 라이코펜 함량을 증가시키는 것일 수 있으나, 이에 제한되지 않는다.In the production method according to an embodiment of the present invention, the method for producing a transgenic plant having an increased lycopene content overexpresses the gene encoding the LCYB2 mutant in plant cells or the 140th of the carrot-derived LCYB2 protein whose root color is orange. It may be to increase the lycopene content of the plant by inhibiting the activity of the LCYB2 protein by inserting an eserine residue, but is not limited thereto.

식물의 형질전환은 DNA를 식물에 전이시키는 임의의 방법을 의미한다. 그러한 형질전환 방법은 반드시 재생 및(또는) 조직 배양기간을 가질 필요는 없다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 잡종 DNA를 적당한 선조 세포로 도입시키는데 이용될 수 있다. 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법(Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., 1987, Plant Mol. Biol. 8, 363-373), 원형질체의 전기천공법(Shillito R.D. et al., 1985, Bio/Technol. 3, 1099-1102), 식물 요소로의 현미주사법(Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), 각종 식물 요소의(DNA 또는 RNA-코팅된) 입자 충격법(Klein T.M. et al., 1987, Nature 327, 70), 식물의 침윤 또는 성숙 화분 또는 소포자의 형질전환에 의한 아그로박테리움 튜머파시엔스 매개된 유전자 전이에서(비완전성) 바이러스에 의한 감염(EP 0 301 316호) 등으로부터 적당하게 선택될 수 있다. 본 발명에 따른 바람직한 방법은 아그로박테리움 매개된 DNA 전달을 포함한다. 특히 바람직한 것은 EP A 120 516호 및 미국 특허 제4,940,838호에 기재된 바와 같은 소위 이원 벡터 기술을 이용하는 것이다.Transformation of a plant refers to any method of transferring DNA into a plant. Such transformation methods need not necessarily have a period of regeneration and/or tissue culture. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., 1987, Plant Mol. Biol. 8, 363-373), Electroporation (Shillito R.D. et al., 1985, Bio/Technol. 3, 1099-1102), microinjection with plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185) ), particle bombardment of various plant elements (DNA or RNA-coated) (Klein T.M. et al., 1987, Nature 327, 70), Agrobacterium tumapsis by infiltration of plants or transformation of mature pollen or vesicles In ence-mediated gene transfer (incomplete) infection by a virus (EP 0 301 316) and the like can be appropriately selected. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particular preference is given to using the so-called binary vector technique as described in EP A 120 516 and US Pat. No. 4,940,838.

또한, 상기 형질전환된 식물세포로부터 형질전환 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다.In addition, any method known in the art may be used as a method for redifferentiating a transgenic plant from the transformed plant cells.

본 발명은 또한, 상기 방법에 의해 제조된 라이코펜 함량이 증가된 형질전환 식물체 및 이의 형질전환된 종자를 제공한다.The present invention also provides a transgenic plant having an increased lycopene content prepared by the method and a transformed seed thereof.

본 발명의 상기 식물체는 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리, 양파 등의 단자엽 식물 또는 당근, 애기장대, 감자, 가지, 담배, 고추, 토마토, 우엉, 쑥갓, 상추, 도라지, 시금치, 근대, 고구마, 미나리, 배추, 양배추, 갓무, 수박, 참외, 오이, 호박, 박, 딸기, 대두, 녹두, 강낭콩, 완두 등의 쌍자엽일 수 있고, 바람직하게는 쌍자엽 식물체일 수 있으며, 더욱 바람직하게는 당근일 수 있으나, 이에 제한되지 않는다.The plants of the present invention are monocotyledonous plants such as rice, barley, wheat, rye, corn, sugar cane, oats, and onions, or carrots, Arabidopsis thaliana, potatoes, eggplants, tobacco, red peppers, tomatoes, burdock, wormwood, lettuce, bellflower, Spinach, beetroot, sweet potato, water parsley, Chinese cabbage, cabbage, radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, pea, etc. may be dicotyledonous, preferably dicotyledonous plants, and more Preferably it may be a carrot, but is not limited thereto.

본 발명은 또한, 서열번호 1의 아미노산 서열로 이루어진 당근 유래 LCYB2 변이체를 코딩하는 유전자를 유효성분으로 포함하는 식물체의 라이코펜 함량 증진용 조성물을 제공한다. 본 발명의 조성물은 유효성분으로 식물체의 라이코펜 함량을 증가시킬 수 있는 LCYB2 변이체 코딩 유전자를 포함하며, 상기 LCYB2 변이체 코딩 유전자의 발현을 증가시키면 식물체의 라이코펜 함량을 증가시킬 수 있다.The present invention also provides a composition for enhancing the lycopene content of plants comprising a gene encoding a carrot-derived LCYB2 mutant consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient. The composition of the present invention includes an LCYB2 mutant coding gene capable of increasing the lycopene content of a plant as an active ingredient, and increasing the expression of the LCYB2 mutant coding gene can increase the lycopene content of a plant.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명은 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

재료 및 방법Materials and Methods

1. 카로티노이드 생합성 관련 주요 유전자 및 단백질의 서열 분석1. Sequence analysis of major genes and proteins related to carotenoid biosynthesis

당근의 근색 형질에 따라 홍색과 주황색으로 구분되는 계통 종자를 농우바이오로부터 분양받아 사용하였다. 홍색 당근 4계통(D802, D903, D904, 19-1284)과 주황색 당근 2계통(GD2002, GD2003)을 식물 배양실에서 24℃, 16시간(명)/8시간(암) 조건으로 생육하였다. 약 2주간 생육된 유식물체 잎에서 총 mRNA를 추출하여 cDNA를 합성한 후, 카로티노이드 생합성 관련 주요 유전자인 DcLCYB1(lycopene β-cyclase 1), DcLCYB2(lycopene β-cyclase 2), DcLCYE(lycopene ε-cyclase), DcSGR1(stay green 1) 및 DcOR(orange)의 CDS(coding sequence) 부위의 프라이머를 제작하였다.According to the root color characteristics of carrots, red and orange seeds were distributed from Nongwoo Bio and used. Four red carrot lines (D802, D903, D904, 19-1284) and two orange carrot lines (GD2002, GD2003) were grown in a plant culture room at 24° C., 16 hours (person)/8 hours (dark) conditions. After synthesizing cDNA by extracting total mRNA from the leaves of plantlets grown for about 2 weeks, DcLCYB1 (lycopene β-cyclase 1), DcLCYB2 (lycopene β-cyclase 2), DcLCYE (lycopene ε-cyclase ), DcSGR1 (stay green 1) and DcOR (orange) of the CDS (coding sequence) region was prepared as a primer.

프라이머 정보Primer information 유전자gene 염기서열 (5'→3') (서열번호)Base sequence (5'→3') (SEQ ID NO:) DcLCYB1DcLCYB1 F: CAACATATGATGAAAGTGATGGATACTCT (3)F: CAACATATGATGAAAGTGATGGATACTCT (3) R: GTTCTCGAGTTTCTCTATCTTTGATCAGAT (4)R: GTTCTCGAGTTTCTCTATCTTTGATCAGAT (4) DcLCYB2DcLCYB2 F: AGCCATATGGAGACTCTTAAATTTACCAGG (5)F: AGCCATATGGAGACTCTTAAATTTACCAGG (5) R: AGCCTCGAGAATAGTCTCAACAGCTAAATTACC (6)R: AGCCTCGAGAATAGTCTCAACAGCTAAATTACC (6) DcLCYEDcLCYE F: CTACCATGGGCATGGAGTCGTACTGCATAGGT (7)F: CTACCATGGGCATGGAGTCGTACTGCATAGGT (7) R: AGCCTCGAGGGCCGTTAAATATGTTTTTAC (8)R: AGCCTCGAGGGCCGTTAAATATGTTTTTAC (8) DcSGR1DcSGR1 F: GCCCGAAAATCTCGGAAGTTTC (9)F: GCCCGAAAATCTCGGAAGTTTC (9) R: CATAGTAAGACTACAATACTGATCT (10)R: CATAGTAAGACTACAATACTGATCT (10) DcORDcOR F: CGCCTGAACATAACCGAAACTA (11)F: CGCCTGAACATAACCGAAACTA (11) R: CTTTACTCATCGAGGCTTGTC (12)R: CTTTACTCATCGAGGCTTGTC (12)

( PCR에 사용된 프라이머 서열을 기재하여 주시기 바랍니다. )( Please indicate the primer sequence used for PCR. )

참조 유전체 서열은 NCBI 웹사이트 정보를 활용하였으며, 계통별로 cDNA를 주형으로 하여 Pfu(Pyrococus furiosus) DNA Polymerase를 이용한 PCR을 진행하였고, PCR 산물을 정제하여 생거 염기서열(Sanger sequencing) 분석을 수행하였다. 근색에 따른 당근 계통별 염기서열과 참조 유전체 염기서열을 이용하여 NCBI blast를 진행한 후 홍색 당근 계통과 주황색 당근 계통의 아미노산 서열을 ClustalW 프로그램으로 다중서열정렬하여 아미노산 서열의 유의성을 확인하였다. For the reference genome sequence, information from the NCBI website was used, and PCR using Pfu ( Pyrococus furiosus ) DNA Polymerase was performed using cDNA as a template for each lineage, and Sanger sequencing analysis was performed by purifying the PCR product. After performing NCBI blast using the nucleotide sequence for each carrot line and the reference genome sequence according to the root color, the amino acid sequences of the red and orange carrot lines were multi-sequenced using the ClustalW program to confirm the significance of the amino acid sequence.

2. 2. E. coli E. coli 시스템을 통한 LCYs 재조합 단백질의 효소 활성 분석 Enzyme Activity Analysis of LCYs Recombinant Proteins Through the System

카로티노이드 생합성 경로에서 라이코펜이 α-카로틴 또는 β-카로틴으로 전환되는 것을 촉매하는 필수 효소인 당근 유래 LCYB2 단백질(이하, DcLCYB2)의 활성을 분석하기 위해서, 대장균(E. coli)에서 라이코펜이 최종 대사물질로 생성될 수 있도록 하였다. To analyze the activity of carrot-derived LCYB2 protein (hereinafter, DcLCYB2), which is an essential enzyme that catalyzes the conversion of lycopene to α-carotene or β-carotene in the carotenoid biosynthesis pathway, E. coli lycopene is the final metabolite was allowed to be created.

구체적으로, 라이코펜 생합성과 관련된 에르위니아 허비콜라(Erwinia herbicola) 유래의 crtE, crtI 및 crtB 유전자가 클로닝되어 있는 pAC-LYC 벡터(pAC-LYCipi, Addgene, 미국) 또는 pAC-BETA(pAC-BETAipi, Addgene)를 사용하였고, E. coli 균주는 Thermofisher 사의 Top10이며, 플라스미드를 재증폭시키기 위한 E. coli strain으로는 DH5α를 사용하였다. Specifically, pAC-LYC vector (pAC-LYCipi, Addgene, USA) or pAC-BETA (pAC-BETAipi, Addgene) in which crtE , crtI and crtB genes derived from Erwinia herbicola related to lycopene biosynthesis are cloned. ) was used, and the E. coli strain is Thermofisher's Top 10, and DH5α was used as the E. coli strain for re-amplification of the plasmid.

상기 pAC-LYC 벡터와 DcLCYB2가 클로닝 되어있는 pET28a-DcLCYB2 벡터로 Top10 E. coli 세포를 공동 형질전환(co-tranformation)하였으며, pAC-LYC 벡터는 클로람페니콜(chloramphenicol) 내성 유전자를 포함하고 있고, pET28a-DcLCYB2 벡터는 카나마이신(kanamycin) 내성 유전자를 포함하고 있어 2종류의 항생제가 포함된 고체배지에서 자란 콜로니를 선별하여 세포 배양하였다. Top10 E. coli cells were co-transformed with the pET28a-DcLCYB2 vector into which the pAC-LYC vector and DcLCYB2 were cloned, and the pAC-LYC vector contains a chloramphenicol resistance gene, and pET28a- Since the DcLCYB2 vector contains a kanamycin resistance gene, colonies grown in a solid medium containing two types of antibiotics were selected and cell cultured.

또한, 양성 대조군으로서 클로람페니콜 내성 유전자를 가진 pAC-LYC 벡터와 애기장대 유래 LCYB 유전자를 가진 pLCYbsk 벡터(암피실린 내성 벡터)를 공동 형질전환하였으며, 상기 2종류의 항생제가 포함된 배지에서 자란 콜로니를 선별하였다. 또한, 음성대조군으로는 pAC-LYC 벡터만을 형질전환시켜 클로람페니콜이 포함된 배지에서 콜로니를 선별하였다. pET28a-DcLCYB2 벡터의 단백질 발현을 위해 10 ㎖ LB 배지에서 배양한 세포가 OD₆₀₀=0.4~0.6일 때 0.1 mM의 IPTG를 첨가하였으며, 라이코펜 흡수를 줄여줄 수 있는 0.01 μg/㎖의 황산제1철(FeSO₄)을 샘플마다 넣어주었다. 라이코펜에서 카로틴으로의 전환이 최대로 이뤄질 수 있는 배양 시간을 결정하기 위해 2~4일 동안 암조건에서 배양하였다.In addition, as a positive control, a pAC-LYC vector having a chloramphenicol resistance gene and a pLCYbsk vector (ampicillin resistance vector) having an Arabidopsis-derived LCYB gene were co-transformed, and colonies grown in a medium containing the two types of antibiotics were selected. . In addition, as a negative control, only the pAC-LYC vector was transformed to select colonies in a medium containing chloramphenicol. For protein expression of the pET28a-DcLCYB2 vector, 0.1 mM IPTG was added when cells cultured in 10 ml LB medium had an OD of ₆₀₀ = 0.4 to 0.6, and 0.01 μg/ml ferrous sulfate to reduce lycopene absorption (FeSO ₄ ) was added to each sample. To determine the incubation time for maximal conversion of lycopene to carotene, the cells were cultured under dark conditions for 2 to 4 days.

3. PCR을 이용한 카로티노이드 생합성 관련 유전자의 발현량 분석3. Expression level analysis of carotenoid biosynthesis-related genes using PCR

형질전환된 E. coli 세포에서 카로티노이드 생합성 관련 유전자의 발현량을 분석하기 위해 각각의 형질전환 세포로부터 RNAiso plus 키트(Takara)를 이용하여 RNA를 추출한 후 RT master mix(Takara)를 이용하여 cDNA를 합성하여 PCR을 수행하였다. To analyze the expression level of carotenoid biosynthesis-related genes in transformed E. coli cells, RNA is extracted from each transformed cell using RNAiso plus kit (Takara), and cDNA is synthesized using RT master mix (Takara). and PCR was performed.

PCR 과정은 전변성 95℃ 5분; 변성(denaturation) 95℃ 30초, 결합(annealing) 55℃ 30초, 신장(extension) 72℃ 1분의 과정을 총 35회 반복; 최종 신장 72℃ 5분의 조건으로 수행하였으며, PCR 증폭 산물은 1% 아가로스 겔에서 전기영동하여 확인하였다.The PCR process was predenatured at 95°C for 5 minutes; A total of 35 cycles of denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and extension at 72° C. for 1 minute; The final elongation was carried out at 72° C. for 5 minutes, and the PCR amplification product was confirmed by electrophoresis on a 1% agarose gel.

실시예 1. 카로티노이드 생합성 관련 주요 유전자 및 단백질의 서열 분석Example 1. Sequence analysis of major genes and proteins related to carotenoid biosynthesis

홍색 당근 계통(D802, D903, D904, 19-1284)과 주황색 당근 계통(GD2002, GD2003)을 대상으로 카로티노이드 생합성 경로 핵심 유전자들을 선별하기 위해, 라이코펜을 α-카로틴 또는 β-카로틴으로 전환시키는 효소인 DcLCYB1, DcLCYB2 및 DcLCYE와, 카로티노이드 합성의 상위 단계 효소인 PSY의 기능을 억제하는 것으로 알려진 DcSGR1과, 반대로 PSY의 기능을 촉진시키는 것으로 알려진 DcOR을 코딩하는 유전자의 염기서열을 비교 분석하였고, 이들 유전자가 암호화하는 단백질들의 아미노산 서열을 비교하여 각 계통별로 아미노산 서열이 얼마나 일치하는지 확인하였다(도 2).To select key genes of the carotenoid biosynthesis pathway in red carrot strains (D802, D903, D904, 19-1284) and orange carrot strains (GD2002, GD2003), an enzyme that converts lycopene into α-carotene or β-carotene The nucleotide sequences of DcLCYB1, DcLCYB2 and DcLCYE, DcSGR1, which are known to inhibit the function of PSY, an upper-stage enzyme of carotenoid synthesis, and DcOR, which is known to promote the function of PSY, were compared and analyzed. By comparing the amino acid sequences of the encoding proteins, it was confirmed how much the amino acid sequences were identical for each lineage (FIG. 2).

그 결과, LCYB1 및 LCYE 단백질의 아미노산 서열은 당근 근색에 따라 두 종류로 구분되었고, 이후 효소 활성(enzyme activity) 실험을 위해 주황색 당근 GD2002 계통과 홍색 당근 D903 계통의 LCYB1 및 LCYE 유전자를 대표 유전자로 선별하였다. As a result, the amino acid sequences of LCYB1 and LCYE proteins were divided into two types according to the color of the carrot, and LCYB1 and LCYE genes of the orange carrot GD2002 line and the red carrot D903 line were selected as representative genes for enzyme activity experiments. did.

또한, LCYB2 및 SGR1-1 단백질의 경우 홍색 당근 계통인 19-1284에서 홍색과 주황색의 혼합된 아미노산 서열을 가지고 있음을 확인하였고, 이후 효소 활성 실험을 위해 주황색 당근 GD2003 계통과 홍색 당근 19-1284 및 D903 계통의 LCYB2 및 SGR1-1 유전자를 대표 유전자로 선별하였다.In addition, in the case of LCYB2 and SGR1-1 proteins, it was confirmed that they had a mixed amino acid sequence of red and orange in 19-1284, which is a red carrot line. LCYB2 and SGR1-1 genes of D903 lineage were selected as representative genes.

반면, DcSGR1-2와 DcOR1 단백질의 아미노산 서열은 근색과 관계없이 모든 계통에서 동일하였고, PSY1 단백질은 홍색 D904 계통에서만 몇 개의 아미노산 잔기에 차이가 있었으나 근색이 구별되지 않아 효소 활성 실험에서 제외되었다.On the other hand, the amino acid sequences of the DcSGR1-2 and DcOR1 proteins were the same in all strains regardless of the rhizome, and the PSY1 protein was excluded from the enzyme activity experiment because the rhizome was indistinguishable although there were differences in several amino acid residues only in the red D904 strain.

실시예 2. 근색에 따른 당근 계통별 DcLCYB2 재조합 단백질의 효소 활성 분석Example 2. Analysis of Enzyme Activity of DcLCYB2 Recombinant Protein by Carrot Lines According to the Root Color

홍색 당근 계통과 주황색 당근 계통별 DcLCYB2 재조합 단백질의 효소 활성을 분석하기 위해서, E. coli 세포에 라이코펜 합성에 관여하는 에르위니아 허비콜라 균주 유래의 crtE, crtI 및 crtB 유전자가 클로닝된 pAC-LYC 벡터와 함께 D903, GD2003 또는 19-1284 계통 유래 DcLCYB2 유전자가 클로닝된 pET28a-DcLCYB2 벡터를 발현시킨 후 암조건에서 0.1 mM IPTG 처리하고 2~4일 동안 E. coli 세포색을 확인하였다. E. coli 세포색을 통해 카로틴 합성 정도를 판단하여 DcLCYB2 재조합 단백질의 효소 활성을 측정하였다. LCYB 단백질은 카로티노이드 생합성 경로에서 라이코펜을 α-카로틴 또는 β-카로틴으로 전환시키는 역할을 하므로, E. coli 세포색이 노란색 또는 주황색일 경우 LCYB 단백질의 활성이 증가(카로틴 함량 증가)한 것을 의미하고, E. coli 세포색이 홍색을 나타낼 경우 LCYB 활성이 감소(라이코펜 함량 증가)한 것을 의미한다.In order to analyze the enzymatic activity of the DcLCYB2 recombinant protein for each red and orange carrot lineage, the pAC-LYC vector in which the crtE , crtI and crtB genes derived from the Erwinia herbicola strain involved in lycopene synthesis in E. coli cells were cloned and After expressing the pET28a-DcLCYB2 vector in which the D903, GD2003 or 19-1284-derived DcLCYB2 gene was cloned together, 0.1 mM IPTG was treated under dark conditions, and E. coli cell color was confirmed for 2 to 4 days. The enzymatic activity of the DcLCYB2 recombinant protein was measured by judging the degree of carotene synthesis through E. coli cell color. Since the LCYB protein plays a role in converting lycopene into α-carotene or β-carotene in the carotenoid biosynthesis pathway, when the E. coli cell color is yellow or orange, it means that the activity of the LCYB protein is increased (increased carotene content), When the color of E. coli cells is red, it means that LCYB activity is decreased (lycopene content is increased).

그 결과, 홍색 당근 D903 계통 유래 DcLCYB2 유전자가 클로닝된 벡터로 형질전환시킨 E. coli 세포에서 가장 뚜렷한 홍색을 나타내었고, 이는 라이코펜 합성에 관여하는 유전자가 클로닝된 벡터로 형질전환된 E. coli 세포(음성대조군)와 유사한 수준의 홍색인 것을 확인하였다(도 3A). 또한, 상기 형질전환된 E. coli 세포로부터 추출된 게놈 RNA를 이용하여 PCR을 수행한 결과, D903 계통, 19-1284 계통 및 GD2003 계통 순으로 DcLCYB2 유전자의 발현량이 증가하는 것을 확인하였다(도 3B).As a result, the E. coli cells transformed with the vector in which the DcLCYB2 gene derived from the red carrot D903 lineage was cloned showed the most pronounced red color, which was obtained in the E. coli cells transformed with the vector in which the gene involved in lycopene synthesis was cloned ( It was confirmed that the level of red was similar to that of the negative control group (FIG. 3A). In addition, as a result of performing PCR using the genomic RNA extracted from the transformed E. coli cells, it was confirmed that the expression level of the DcLCYB2 gene increased in the order of D903 line, 19-1284 line, and GD2003 line (FIG. 3B). .

이를 통해, 홍색 당근 D903 계통 유래 DcLCYB2 재조합 단백질이 다른 계통의 DcLCYB2 재조합 단백질에 비해 라이코펜에서 카로틴으로의 전환을 촉진하는 LCYB2 활성이 가장 낮고, 그 다음으로 홍색 당근 19-1284 계통과 주황색 당근 GD2003 계통 순으로 LCYB2 활성이 증가하는 것을 알 수 있었다.From this, the DcLCYB2 recombinant protein derived from the red carrot D903 strain had the lowest LCYB2 activity that promotes the conversion of lycopene to carotene compared to the DcLCYB2 recombinant protein from other strains, followed by the red carrot 19-1284 strain and the orange carrot GD2003 strain in that order. It was found that LCYB2 activity was increased.

실시예 3. DcLCYB2에서 홍색 당근 형질과 관련된 아미노산 잔기 탐색Example 3. Search for amino acid residues related to the red carrot trait in DcLCYB2

LCYB2 효소의 활성이 가장 낮아 라이코펜 함유량이 많은 홍색 당근 D903 계통과 다른 홍색 당근 19-1284 계통 및 주황색 당근 GD2003 계통의 LCYB2 아미노산 서열을 비교 분석하였다.The LCYB2 amino acid sequence of the red carrot D903 line, which has the lowest LCYB2 enzyme activity, and the other red carrot 19-1284 line and the orange carrot GD2003 line, which has a high lycopene content, was compared and analyzed.

그 결과, 홍색 당근 D903 계통의 LCYB2 아미노산 서열에서 140번째에 세린 잔기가 삽입된 것을 확인하였고, 344번째의 잔기는 이소류신(isoleucine)인 것을 확인하였다. 반면, 홍색 당근 19-1284 계통과 주황색 당근 GD2003 계통의 LCYB2 아미노산 서열 344번째 잔기는 발린(valine)인 것을 확인하였다(도 4). As a result, it was confirmed that a serine residue was inserted at the 140th position in the LCYB2 amino acid sequence of the red carrot D903 line, and it was confirmed that the 344th residue was isoleucine. On the other hand, it was confirmed that the 344th residue of the LCYB2 amino acid sequence of the red carrot 19-1284 line and the orange carrot GD2003 line was valine ( FIG. 4 ).

즉, 홍색 당근 D903 계통은 다른 당근 계통과 다르게 LCYB2 아미노산 서열 140번째에 세린 염기가 삽입(S140)되고, 344번째 아미노산 잔기가 이소류신으로 치환(V344I)된 점돌연변이(point mutation)가 유발되었음을 알 수 있었다.That is, it can be seen that the red carrot D903 line, unlike other carrot lines, has a point mutation in which a serine base is inserted at the 140th LCYB2 amino acid sequence (S140) and the 344th amino acid residue is substituted with isoleucine (V344I). there was.

실시예 4. DvLCYB2 아미노산 서열에서 유발된 점돌연변이가 LCYB2 효소 활성에 미치는 영향 분석Example 4. Analysis of the effect of point mutations induced in the DvLCYB2 amino acid sequence on LCYB2 enzyme activity

상기와 같이 홍색 당근 D903 계통의 LCYB2 아미노산 서열 140번째 및 344번째 위치에서의 점돌연변이를 확인한 후, 홍색 당근이지만 주황색 당근의 LCYB2 아미노산 서열과 동일하였던 19-1284 계통과 주황색 당근 GD2003 계통의 LCYB2 아미노산 서열 140번째에 세린을 삽입(S140)시킨 구조체(construct) PM1(19-1284-PM1 및 GD2003-PM1)과, 344번째의 발린을 이소류신으로 치환(V344I)시킨 구조체 PM2(19-1284-PM2 및 GD2003-PM2)를 각각 제작하였고, 상기 각각의 구조체들을 pET28a 벡터에 클로닝하여 E. coli 시스템을 통해 4일간 단백질을 발현시켰다. E. coli 세포색을 통해 카로틴 합성 정도를 판단함으로써, 상기 2종류의 점돌연변이가 DcLCYB2 효소 활성에 미치는 영향을 분석하였다.After confirming the point mutations at positions 140 and 344 of the LCYB2 amino acid sequence of the red carrot D903 line as described above, the LCYB2 amino acid sequence of the 19-1284 line and the orange carrot GD2003 line, which were the same as the LCYB2 amino acid sequence of the orange carrot, although it was a red carrot. Construct PM1 (19-1284-PM1 and GD2003-PM1) in which serine was inserted at position 140 (S140), and construct PM2 (19-1284-PM2 and GD2003) in which valine at position 344 was substituted with isoleucine (V344I) -PM2) was prepared, and each of the constructs was cloned into a pET28a vector and the protein was expressed through the E. coli system for 4 days. By judging the degree of carotene synthesis through E. coli cell color, the effect of the two types of point mutations on DcLCYB2 enzyme activity was analyzed.

그 결과, 19-1284-PM1이 발현된 E. coli 세포는 19-1284-PM2가 발현된 E. coli 세포에 비해 더 진한 홍색을 나타내었고, 특히 라이코펜 합성 관련 유전자가 클로닝된 음성대조군 및 홍색 당근 D903 계통 유래 LCYB2가 발현된 E. coli 세포와 유사하게 홍색을 나타내고 있음을 확인하였다. 반면, 19-1284-PM2가 발현된 E. coli 세포는 돌연변이가 유발되지 않은 19-1284 계통 유래 LCYB2가 발현된 E. coli 세포와 유사한 주황색을 나타내는 것을 확인하였다(도 5). As a result, the E. coli cells expressing 19-1284-PM1 showed a deeper red color than the E. coli cells expressing 19-1284-PM2. It was confirmed that the D903 lineage-derived LCYB2 was expressed in red similarly to the expressed E. coli cells. On the other hand, it was confirmed that the 19-1284-PM2-expressing E. coli cells exhibited an orange color similar to that of the 19-1284 lineage-derived LCYB2-expressing E. coli cells that were not mutated ( FIG. 5 ).

더욱이, 주황색 당근 GD2003 계통에서도 LCYB2 아미노산 서열 140번째에 세린이 삽입될 경우 LCYB2의 효소 활성을 감소시켜 라이코펜 함량을 증가시킬 수 있는지 확인하기 위해 GD2003-PM1(S140)과 GD2003-PM2(V344I)를 제작하였고, E. coli 시스템을 통해 E. coli 세포에서 발현시킨 후 세포색을 관찰하였다.Furthermore, in the orange carrot GD2003 strain, GD2003-PM1 (S140) and GD2003-PM2 (V344I) were produced to check whether the insertion of serine at the 140th amino acid sequence of LCYB2 can increase the lycopene content by reducing the enzyme activity of LCYB2. After expression in E. coli cells through the E. coli system, cell color was observed.

그 결과, GD2003-PM1이 발현된 E. coli 세포는 GD2003-PM2가 발현된 E. coli 세포에 비해 더 진한 홍색을 나타내었고, 특히 라이코펜 합성 관련 유전자가 클로닝된 음성대조군 및 홍색 당근 D903 계통 유래 LCYB2가 발현된 E. coli 세포와 매우 유사한 수준으로 홍색을 나타내고 있음을 확인하였다. 반면, GD2003-PM2가 발현된 E. coli 세포는 돌연변이가 유발되지 않은 GD2003 계통 유래 LCYB2가 발현된 E. coli 세포와 유사한 주황색을 나타내는 것을 확인하였다(도 6). As a result, the E. coli cells expressing GD2003-PM1 showed a darker red color than the E. coli cells expressing GD2003-PM2. It was confirmed that it exhibited a red color at a level very similar to that of the expressed E. coli cells. On the other hand, it was confirmed that the E. coli cells expressing GD2003-PM2 showed an orange color similar to that of the E. coli cells expressing LCYB2 derived from the GD2003 lineage without mutagenesis ( FIG. 6 ).

또한, 당근 유래 LCYB2 아미노산 서열 내 점돌연변이에 따른 라이코펜 함량 변화를 정량적으로 확인하기 위해 HPLC를 수행하였다. 분석 결과, 하기 표 2에 나타난 바와 같이, 라이코펜 합성 관련 유전자가 클로닝된 벡터로 형질전환된 음성대조군(-)에서는 라이코펜만 다량 검출되었고, 라이코펜에서 β-카로틴으로의 전환을 촉매하는 애기장대 유래 LCYB2 유전자가 클로닝된 벡터로 형질전환된 양성대조군(+)에서는 β-카로틴만 다량 검출되었다. 또한, 홍색 당근 D903 계통 유래 LCYB2가 발현된 E. coli 세포에서는 β-카로틴이 검출되지 않은 반면, 주황색 당근 GD2003 계통 유래 LCYB2가 발현된 E. coli 세포에서는 β-카로틴이 소량 검출되었다. In addition, HPLC was performed to quantitatively confirm the change in the lycopene content according to the point mutation in the LCYB2 amino acid sequence derived from carrot. As a result of the analysis, as shown in Table 2 below, only a large amount of lycopene was detected in the negative control group (-) transformed with the vector cloned with the lycopene synthesis-related gene, and Arabidopsis-derived LCYB2 , which catalyzes the conversion of lycopene to β-carotene In the positive control group (+) transformed with the gene cloned vector, only a large amount of β-carotene was detected. In addition, β-carotene was not detected in E. coli cells expressing LCYB2-derived from the red carrot D903 line, whereas a small amount of β-carotene was detected in E. coli cells expressing LCYB2 derived from the orange carrot GD2003 line.

그리고, 주황색 당근에서 유래된 GD2003-PM1이 발현된 E. coli 세포에서는 β-카로틴이 검출되지 않은 반면, GD2003-PM2가 발현된 E. coli 세포에서는 β-카로틴이 소량 검출된 것을 확인하였다. 특히 GD2003-PM1은 주황색 당근에서 유래된 것임에도 불구하고 홍색 당근 D903 유래 LCYB2가 발현된 E. coli 세포와 라이코펜 함량이 비슷하였다(표 2).In addition, it was confirmed that β-carotene was not detected in E. coli cells expressing GD2003-PM1 derived from orange carrot, whereas a small amount of β-carotene was detected in E. coli cells expressing GD2003-PM2. In particular, although GD2003-PM1 was derived from orange carrot, the content of lycopene was similar to that of E. coli cells expressing LCYB2 derived from red carrot D903 (Table 2).

상기 결과를 통해, 당근 유래 LCYB2 아미노산 서열 140번째에 세린 잔기가 삽입되는 점돌연변이가 유발될 경우 LCYB2의 효소 활성이 감소되어 라이코펜에서 카로틴으로의 전환이 억제되어 라이코펜의 함량을 증가시킬 수 있음을 알 수 있었고, LCYB2 아미노산 서열 344번째에서 유발되는 점돌연변이는 LCYB2 활성에 영향을 미치지 않아 라이코펜 함량 증진에 효과가 없음을 알 수 있었다.From the above results, it can be seen that when a point mutation in which a serine residue is inserted at the 140th amino acid sequence of LCYB2 derived from carrots is induced, the enzymatic activity of LCYB2 is reduced and the conversion of lycopene to carotene is inhibited, thereby increasing the content of lycopene. It was found that the point mutation induced at the 344th amino acid sequence of LCYB2 did not affect LCYB2 activity and had no effect on enhancing the lycopene content.

실시예 5. 근색에 따른 당근 계통별 DcLCYB1 및 DcLCYE 재조합 단백질의 효소 활성 분석Example 5. Enzymatic activity analysis of DcLCYB1 and DcLCYE recombinant proteins by carrot lineage according to root color

홍색 당근 D903 계통과 주황색 당근 GD2003 계통을 대상으로 카로티노이드 생합성 관련 LCYB1 및 LCYE 재조합 단백질의 효소 활성을 분석하기 위해 E. coli 세포에서 발현시킨 후 세포색을 관찰한 결과, 홍색 당근 D903 계통과 주황색 당근 GD2003 계통 유래 LCYB1 또는 LCYE가 발현된 E. coli 세포는 모두 노란색을 나타내고 있음을 확인하였다(도 7A).To analyze the enzymatic activity of LCYB1 and LCYE recombinant proteins related to carotenoid biosynthesis in the red carrot D903 line and the orange carrot GD2003 line, the cell color was observed after expression in E. coli cells. As a result, the red carrot D903 line and the orange carrot GD2003 line. It was confirmed that all of the lineage-derived E. coli cells expressing LCYB1 or LCYE were yellow ( FIG. 7A ).

또한, E. coli 시스템을 통해 클로닝된 DcLCYB1 및 DcLCYE가 세포 내에서 정상적으로 발현되고 있는지 확인하기 위해 RNA를 추출하여 RT-PCR을 수행한 결과, 모든 cDNA가 mRNA수준에서 동일하게 발현되고 있음을 확인하였다(도 7B). In addition, in order to confirm that DcLCYB1 and DcLCYE cloned through the E. coli system are normally expressed in cells, RNA was extracted and RT-PCR was performed. As a result, it was confirmed that all cDNAs were equally expressed at the mRNA level. (Fig. 7B).

즉, 홍색 당근 및 주황색 당근 계통 간에 LCYB1 및 LCYE 효소 활성은 큰 차이가 없으므로, DcLCYB1 및 DcLCYE 유전자는 라이코펜 함량 증진과 연관이 없음을 알 수 있었다.That is, since there was no significant difference in LCYB1 and LCYE enzyme activity between the red and orange carrot strains, it was found that the DcLCYB1 and DcLCYE genes were not related to the enhancement of lycopene content.

실시예 6. 근색에 따른 당근 계통별 DcSGR1-1 재조합 단백질의 효소 활성 분석Example 6. Analysis of enzymatic activity of DcSGR1-1 recombinant protein by carrot lineage according to root color

카로테노이드 생합성 경로의 상위 단계에서 작용하는 PSY 효소를 억제하는 것으로 알려진 SGR1-1이 홍색 또는 주황색 당근 계통에 따라 PSY 효소를 억제하는 정도에 차이가 있는지, 또는 라이코펜 또는 β-카로틴 생성에 미치는 영향을 확인하기 위해 E. coli 세포에서 발현시킨 후 세포색을 관찰하였다.To determine whether SGR1-1, which is known to inhibit the PSY enzyme acting at the upper stage of the carotenoid biosynthesis pathway, differs in the degree of inhibition of the PSY enzyme depending on the red or orange carrot strains, or the effect on the production of lycopene or β-carotene In order to do this, the cell color was observed after expression in E. coli cells.

그 결과, SGR1-1을 함께 발현시키지 않은 대조군과 홍색 당근(D904, 19-1284) 또는 주황색 당근(GD2003) 유래 SGR1-1이 발현된 E. coli 세포 간에 뚜렷한 세포색 차이가 없음을 확인하였다(도 8). 이를 통해, 당근 유래 SGR1-1 유전자는 당근의 근색에 관계없이 PSY 효소 억제에 미치는 영향이 거의 동일하므로, 라이코펜 함량 증진과 큰 연관이 없음을 알 수 있었다.As a result, it was confirmed that there was no significant difference in cell color between the control group not expressing SGR1-1 and the E. coli cells expressing SGR1-1 derived from red carrot (D904, 19-1284) or orange carrot (GD2003) ( Fig. 8). Through this, it was found that the carrot-derived SGR1-1 gene had almost the same effect on the inhibition of PSY enzyme regardless of the root color of the carrot, and thus had no significant association with the enhancement of the lycopene content.

<110> Korea Research Institute of Bioscience and Biotechnology <120> LCYB2 mutant from Daucus carota and uses thereof <130> PN20415 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 493 <212> PRT <213> Daucus carota <400> 1 Met Glu Thr Leu Lys Phe Thr Arg Pro Ser Ser His Pro Ser Leu Ala 1 5 10 15 Leu His Gln Ser Asn Tyr Lys Ala Val Lys Ser Pro Ser Leu Lys Tyr 20 25 30 Lys Pro Lys Lys Val Thr His Thr Val Gln Cys Ser Lys Tyr Gly Asn 35 40 45 Phe Leu Asp Leu Lys Pro Gly Lys Arg His Glu Ser Met Glu Phe Asp 50 55 60 Leu Ser Trp Tyr Asp Pro Ser Lys Arg Ser Arg Phe Asp Val Ile Val 65 70 75 80 Ile Gly Ala Gly Pro Ala Gly Leu Arg Leu Ala Gln Arg Val Ala Gly 85 90 95 Tyr Gly Ile Gln Val Cys Cys Val Asp Pro Ser Pro Leu Cys Val Trp 100 105 110 Pro Asn Asn Tyr Gly Val Trp Val Asp Glu Phe Glu Ala Met Gly Phe 115 120 125 Gln Asp Cys Phe Asp Lys Thr Trp Pro Met Ser Ser Ser Val Tyr Ile 130 135 140 Asn Glu Glu Lys Ser Lys Val Leu Asn Arg Pro Tyr Gly Arg Val Asn 145 150 155 160 Arg Glu Lys Leu Lys Met Arg Leu Leu Gly Gly Cys Val Ser Asn Gly 165 170 175 Val Val Phe His Lys Ala Lys Val Trp Lys Val Asp His Gln Glu Phe 180 185 190 Glu Ser Ser Ile Leu Cys Asp Asp Gly Lys Glu Phe Lys Ala Ser Leu 195 200 205 Ile Val Asp Ala Ser Gly Phe Ala Ser Thr Phe Val Asp Tyr Asp Lys 210 215 220 Pro Arg Asn His Gly Tyr Gln Leu Ala His Gly Ile Leu Ala Glu Val 225 230 235 240 Glu Ser His Pro Phe Glu Leu Asp Arg Met Val Leu Met Asp Trp Arg 245 250 255 Asp Ser His Leu Gly Asn Glu Pro Ala Leu Arg Phe Ala Asn Ala Lys 260 265 270 Ser Pro Thr Phe Leu Tyr Ala Met Pro Phe Asp Ser Asn Leu Ile Phe 275 280 285 Leu Glu Glu Thr Ser Leu Val Ser Arg Pro Ala Leu Ser Tyr Lys Glu 290 295 300 Val Lys Leu Arg Met Ala Ala Arg Leu Arg His Leu Gly Ile Arg Val 305 310 315 320 Lys Ser Ile Ile Glu Asp Glu Lys Cys Leu Ile Pro Met Gly Gly Pro 325 330 335 Leu Pro Arg Thr Pro Gln Asp Ile Val Ala Ile Gly Gly Ser Ser Gly 340 345 350 Ile Val His Pro Ser Thr Gly Tyr Met Val Ala Arg Thr Leu Ala Leu 355 360 365 Ala Pro Val Leu Ala Asp Ala Ile Ala Glu Cys Leu Gly Ser Thr Arg 370 375 380 Met Ile Arg Gly Ser Ser Leu Tyr His Arg Val Trp Asn Gly Leu Trp 385 390 395 400 Pro Ile Glu Ser Lys Cys Thr Arg Glu Phe Tyr Ser Phe Gly Met Glu 405 410 415 Thr Leu Leu Lys Leu Asp Leu Asn Gly Thr Arg Asn Phe Phe Asp Ala 420 425 430 Phe Phe Asp Leu Asp Pro His Tyr Trp Gln Gly Phe Leu Ser Ser Arg 435 440 445 Leu Ser Leu Lys Glu Leu Ala Met Leu Ser Leu Ser Leu Phe Gly His 450 455 460 Ala Ser Asn Ser Ser Lys Met Asp Ile Val Thr Lys Cys Pro Ala Pro 465 470 475 480 Leu Val Lys Met Leu Gly Asn Leu Ala Val Glu Thr Ile 485 490 <210> 2 <211> 1482 <212> DNA <213> Daucus carota <400> 2 atggagactc ttaaatttac caggccatct tcacatccat cacttgcatt gcatcaatcc 60 aattataaag ctgtaaaatc tccctcactc aaatacaaac ctaaaaaggt tacccataca 120 gtccagtgta gcaaatatgg taattttctt gacctcaaac ctggaaaaag gcatgagtca 180 atggagtttg atctgtcatg gtatgatcca tctaagcgat cacgattcga tgtgattgtg 240 atcggagctg gtccagccgg gcttcgccta gctcagcgtg tggctggcta tggaattcag 300 gtttgctgtg ttgacccttc accactatgt gtttggccta acaattatgg tgtgtgggtt 360 gatgagtttg aggctatggg gtttcaagat tgttttgata agacatggcc catgtcatca 420 tctgtttata taaatgagga gaagagcaag gttttgaatc ggccttatgg ccgagtcaat 480 agagagaaat tgaagatgcg gttgttagga gggtgtgttt ccaatggcgt cgtgtttcat 540 aaggccaaag tgtggaaggt ggatcaccaa gagtttgagt cttcgattct atgtgatgat 600 ggaaaggaat tcaaggcgag tttgattgtg gatgctagtg gatttgcaag cacttttgtg 660 gactatgaca agccaagaaa ccatgggtat cagcttgctc atggtatttt agctgaagtg 720 gagtctcacc cttttgaatt ggatagaatg gtgcttatgg attggagaga ttctcatttg 780 ggtaatgagc ctgcattgcg ttttgctaac gccaagtctc ccacctttct gtatgcaatg 840 ccatttgatt caaatttgat tttcttggaa gagacttctt tagtgagtcg accagcctta 900 tcatacaagg aggtcaagtt aaggatggcc gcgaggctca gacatttagg aatcagggtg 960 aagagtataa ttgaggacga gaagtgtttg atcccaatgg gaggaccctt gccccggact 1020 ccacaagaca ttgttgccat tggcggatca tctggaatag ttcatccttc aacagggtac 1080 atggtggcac gaacattggc attagccccc gtgttagctg atgccattgc tgagtgtctt 1140 ggatcgacac gaatgattag aggatcatcc ctttaccata gagtttggaa tggtttgtgg 1200 cctattgaga gcaagtgcac gagggaattc tactcttttg ggatggagac tttgctgaag 1260 cttgatttga atggtacaag gaattttttt gatgctttct tcgatttgga tccccattac 1320 tggcagggat ttttgtcgtc gaggttgtca ttgaaagagc ttgcgatgct tagcttgtca 1380 ctctttggcc atgcttccaa ttcgtcgaaa atggacattg tgaccaaatg ccctgccccc 1440 ctggttaaaa tgctaggtaa tttagctgtt gagactattt ga 1482 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 caacatatga tgaaagtgat ggatactct 29 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gttctcgagt ttctctatct ttgatcagat 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 agccatatgg agactcttaa atttaccagg 30 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agcctcgaga atagtctcaa cagctaaatt acc 33 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ctaccatggg catggagtcg tactgcatag gt 32 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 agcctcgagg gccgttaaat atgtttttac 30 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gcccgaaaat ctcggaagtt tc 22 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 catagtaaga ctacaatact gatct 25 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 cgcctgaaca taaccgaaac ta 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ctttactcat cgaggcttgt c 21 <110> Korea Research Institute of Bioscience and Biotechnology <120> LCYB2 mutant from Daucus carota and uses thereof <130> PN20415 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 493 <212> PRT <213> Daucus carota <400> 1 Met Glu Thr Leu Lys Phe Thr Arg Pro Ser Ser His Pro Ser Leu Ala 1 5 10 15 Leu His Gln Ser Asn Tyr Lys Ala Val Lys Ser Pro Ser Leu Lys Tyr 20 25 30 Lys Pro Lys Lys Val Thr His Thr Val Gln Cys Ser Lys Tyr Gly Asn 35 40 45 Phe Leu Asp Leu Lys Pro Gly Lys Arg His Glu Ser Met Glu Phe Asp 50 55 60 Leu Ser Trp Tyr Asp Pro Ser Lys Arg Ser Arg Phe Asp Val Ile Val 65 70 75 80 Ile Gly Ala Gly Pro Ala Gly Leu Arg Leu Ala Gln Arg Val Ala Gly 85 90 95 Tyr Gly Ile Gln Val Cys Cys Val Asp Pro Ser Pro Leu Cys Val Trp 100 105 110 Pro Asn Asn Tyr Gly Val Trp Val Asp Glu Phe Glu Ala Met Gly Phe 115 120 125 Gln Asp Cys Phe Asp Lys Thr Trp Pro Met Ser Ser Ser Val Tyr Ile 130 135 140 Asn Glu Glu Lys Ser Lys Val Leu Asn Arg Pro Tyr Gly Arg Val Asn 145 150 155 160 Arg Glu Lys Leu Lys Met Arg Leu Leu Gly Gly Cys Val Ser Asn Gly 165 170 175 Val Val Phe His Lys Ala Lys Val Trp Lys Val Asp His Gln Glu Phe 180 185 190 Glu Ser Ser Ile Leu Cys Asp Asp Gly Lys Glu Phe Lys Ala Ser Leu 195 200 205 Ile Val Asp Ala Ser Gly Phe Ala Ser Thr Phe Val Asp Tyr Asp Lys 210 215 220 Pro Arg Asn His Gly Tyr Gln Leu Ala His Gly Ile Leu Ala Glu Val 225 230 235 240 Glu Ser His Pro Phe Glu Leu Asp Arg Met Val Leu Met Asp Trp Arg 245 250 255 Asp Ser His Leu Gly Asn Glu Pro Ala Leu Arg Phe Ala Asn Ala Lys 260 265 270 Ser Pro Thr Phe Leu Tyr Ala Met Pro Phe Asp Ser Asn Leu Ile Phe 275 280 285 Leu Glu Glu Thr Ser Leu Val Ser Arg Pro Ala Leu Ser Tyr Lys Glu 290 295 300 Val Lys Leu Arg Met Ala Ala Arg Leu Arg His Leu Gly Ile Arg Val 305 310 315 320 Lys Ser Ile Ile Glu Asp Glu Lys Cys Leu Ile Pro Met Gly Gly Pro 325 330 335 Leu Pro Arg Thr Pro Gln Asp Ile Val Ala Ile Gly Gly Ser Ser Gly 340 345 350 Ile Val His Pro Ser Thr Gly Tyr Met Val Ala Arg Thr Leu Ala Leu 355 360 365 Ala Pro Val Leu Ala Asp Ala Ile Ala Glu Cys Leu Gly Ser Thr Arg 370 375 380 Met Ile Arg Gly Ser Ser Leu Tyr His Arg Val Trp Asn Gly Leu Trp 385 390 395 400 Pro Ile Glu Ser Lys Cys Thr Arg Glu Phe Tyr Ser Phe Gly Met Glu 405 410 415 Thr Leu Leu Lys Leu Asp Leu Asn Gly Thr Arg Asn Phe Phe Asp Ala 420 425 430 Phe Phe Asp Leu Asp Pro His Tyr Trp Gln Gly Phe Leu Ser Ser Arg 435 440 445 Leu Ser Leu Lys Glu Leu Ala Met Leu Ser Leu Ser Leu Phe Gly His 450 455 460 Ala Ser Asn Ser Ser Lys Met Asp Ile Val Thr Lys Cys Pro Ala Pro 465 470 475 480 Leu Val Lys Met Leu Gly Asn Leu Ala Val Glu Thr Ile 485 490 <210> 2 <211> 1482 <212> DNA <213> Daucus carota <400> 2 atggagactc ttaaatttac caggccatct tcacatccat cacttgcatt gcatcaatcc 60 aattataaag ctgtaaaatc tccctcactc aaatacaaac ctaaaaaggt tacccataca 120 gtccagtgta gcaaatatgg taattttctt gacctcaaac ctggaaaaag gcatgagtca 180 atggagtttg atctgtcatg gtatgatcca tctaagcgat cacgattcga tgtgattgtg 240 atcggagctg gtccagccgg gcttcgccta gctcagcgtg tggctggcta tggaattcag 300 gtttgctgtg ttgacccttc accactatgt gtttggccta acaattatgg tgtgtgggtt 360 gatgagtttg aggctatggg gtttcaagat tgttttgata agacatggcc catgtcatca 420 tctgtttata taaatgagga gaagagcaag gttttgaatc ggccttatgg ccgagtcaat 480 agagagaaat tgaagatgcg gttgttagga gggtgtgttt ccaatggcgt cgtgtttcat 540 aaggccaaag tgtggaaggt ggatcaccaa gagtttgagt cttcgattct atgtgatgat 600 ggaaaggaat tcaaggcgag tttgattgtg gatgctagtg gatttgcaag cacttttgtg 660 gactatgaca agccaagaaa ccatgggtat cagcttgctc atggtatttt agctgaagtg 720 gagtctcacc cttttgaatt ggatagaatg gtgcttatgg attggagaga ttctcatttg 780 ggtaatgagc ctgcattgcg ttttgctaac gccaagtctc ccacctttct gtatgcaatg 840 ccatttgatt caaatttgat tttcttggaa gagacttctt tagtgagtcg accagcctta 900 tcatacaagg aggtcaagtt aaggatggcc gcgaggctca gacatttagg aatcagggtg 960 aagagtataa ttgaggacga gaagtgtttg atcccaatgg gaggaccctt gccccggact 1020 ccacaagaca ttgttgccat tggcggatca tctggaatag ttcatccttc aacagggtac 1080 atggtggcac gaacattggc attagccccc gtgttagctg atgccattgc tgagtgtctt 1140 ggatcgacac gaatgattag aggatcatcc ctttaccata gagtttggaa tggtttgtgg 1200 cctattgaga gcaagtgcac gagggaattc tactcttttg ggatggagac tttgctgaag 1260 cttgatttga atggtacaag gaattttttt gatgctttct tcgatttgga tccccattac 1320 tggcagggat ttttgtcgtc gaggttgtca ttgaaagagc ttgcgatgct tagcttgtca 1380 ctctttggcc atgcttccaa ttcgtcgaaa atggacattg tgaccaaatg ccctgccccc 1440 ctggttaaaa tgctaggtaa tttagctgtt gagactattt ga 1482 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 caacatatga tgaaagtgat ggatactct 29 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gttctcgagt ttctctatct ttgatcagat 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 agccatatgg agactcttaa atttaccagg 30 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agcctcgaga atagtctcaa cagctaaatt acc 33 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ctaccatggg catggagtcg tactgcatag gt 32 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 agcctcgagg gccgttaaat atgtttttac 30 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gcccgaaaat ctcggaagtt tc 22 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 catagtaaga ctacaatact gatct 25 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 cgcctgaaca taaccgaaac ta 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ctttactcat cgaggcttgt c 21

Claims

Carrot ( Daucus carota ) derived from the amino acid sequence of SEQ ID NO: 1 LCYB2 (lycopene β-cyclase 2) variant.

A gene encoding the LCYB2 variant of claim 1.

A recombinant vector comprising the gene of claim 2 .

A host cell transformed with the recombinant vector of claim 3.

Transforming plant cells with the recombinant vector of claim 3; and
Re-differentiation of a plant from the transformed plant cells; Lycopene (Lycopene) content is increased, the method of producing a transgenic plant comprising a.

A transgenic plant having an increased lycopene content prepared by the method of claim 5 .

The transformed seed of the plant according to claim 6 .

A composition for enhancing the lycopene content of a plant comprising a gene encoding a carrot-derived LCYB2 variant consisting of the amino acid sequence of SEQ ID NO: 1 as an active ingredient.