CN113801871B

CN113801871B - Function and application of SiLCYE for regulating and controlling anabolism of zeaxanthin and other millet carotenoids

Info

Publication number: CN113801871B
Application number: CN202111177100.8A
Authority: CN
Inventors: 刘君; 高英; 王欢; 石添添; 王竞馨; 王芮; 程溪柳; 朱梦圆; 魏钰; 李莎; 刘远航
Original assignee: Biotechnology Research Institute of CAAS; Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Biotechnology Research Institute of CAAS; Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2021-10-09
Filing date: 2021-10-09
Publication date: 2022-09-27
Anticipated expiration: 2041-10-09
Also published as: CN113801871A

Abstract

The invention discloses a method for increasing the content of zeaxanthin or/and lutein stearate or/and anther xanthin in millet, which comprises the steps of increasing the content of zeaxanthin or/and lutein stearate or/and anther xanthin in millet by inhibiting or reducing the expression level of a protein coding gene in the millet and/or inhibiting or reducing the activity and/or the content of the protein in the millet; the protein is a SilcYE protein. The SilcYE was cloned by homologous cloning techniques. The amino acid sequence of SiLCYE is shown in SEQ ID NO.1, and the coding sequence is shown in SEQ ID NO. 2. An editing strain of the SiLCYE gene is obtained by a CRISPR-Cas9 editing technology, the regulation and control functions of the two genes in the millet carotenoid metabolic reaction are determined by metabonomic analysis, and an experimental basis and gene resources are provided for disclosing a millet carotenoid metabolic pathway regulation and control mechanism and cultivating a novel millet germplasm rich in carotenoids and high in nutritional quality.

Description

Function and application of SiLCYE for regulating and controlling anabolism of zeaxanthin and other millet carotenoids

Technical Field

The invention belongs to the technical field of biology, and relates to a function and application of SiLCYE protein for regulating and controlling anabolism of zeaxanthin and other millet carotenoids.

Background

The carotenoid is a necessary nutrient element for human bodies and has unique nutrition and health care effects of resisting oxidation, regulating immunity, resisting cancer, delaying senility, protecting eyesight and the like, so that the work of enhancing the content of the carotenoid in grains and promoting the metabolic absorption of the carotenoid is necessary. The carotenoid is of various types, and the found natural carotenoid reaches more than 700 types, and the natural carotenoid can be divided into two types according to the difference of chemical structures: one is carotene (only two elements containing hydrogen, such as beta-carotene and lycopene); the other is xanthophyll (except hydrocarbon, hydroxyl, keto, carboxyl, methoxyl, etc. oxygen-containing functional groups such as xanthophyll, astaxanthin, etc.). Wherein the carotenoid with larger content comprises beta-carotene (accounting for 25 to 30 percent of the total carotenoid by mass percent), lutein (40 to 50 percent), violaxanthin (15 percent) and neoxanthin (15 percent); the trace carotenoid includes alpha-carotene, zeaxanthin, antheraxanthin and 5, 6-epoxylutein. The most important carotenoids in food crops are beta-carotene, alpha-carotene, beta-cryptoxanthin, lutein, zeaxanthin, and lycopene. Millet (Setaria italica) is an ancient crop originated from China, has the characteristics of drought resistance, barren resistance, rich nutrition and easiness in cooking, plays a very important role in agricultural planting structure adjustment, industrial structure optimization and dietary structure improvement of people in China, and is deeply popular in the market. The lutein is an important nutritional quality index and an important appearance quality index of millet, namely millet seeds.

The carotenoid biosynthesis pathway is deeply researched in arabidopsis thaliana, rice, wheat, corn, pepper, tomato, orange and other plants, but the research in millet is rarely reported. Although the carotenoid biosynthetic pathway is relatively conserved, so far, the transcriptional regulators of carotenoid biosynthesis are different in almost different species and even in different tissues of each species, and it is worth further analyzing the regulatory network and the function of each regulatory factor. Research has shown that: lycopene beta-cyclase (LCYB) and lycopene epsilon-cyclase (LCYE) are two regulatory genes at an important branch point in the lycopene metabolic pathway, which are capable of decomposing lycopene to form beta-and epsilon-ring-bearing carotenes, and the amount of carotenoids produced with vitamin a activity depends on the relative levels of the two cyclases LCYB and LCYE. The study on LCYE is relatively few so far, and the study on LCYE in millet is rarely reported.

Disclosure of Invention

The purpose of the present application is to provide the function of the SilcYE protein to regulate the synthesis of carotenoid and the application of the function in the creation of new germ plasm of millet, such as: how to quickly and efficiently prepare the millet rich in zeaxanthin or/and lutein stearate or/and anther xanthin. To achieve the above objects, a first aspect of the present application provides a use of a protein or a substance regulating the expression of a gene encoding the protein, or a substance regulating the activity or content of the protein, which is a silk protein, or a substance regulating the expression of a gene encoding the protein, or a substance regulating the activity or content of the protein, for increasing zeaxanthin or/and lutein stearate or/and anther xanthin in millet kernels;

the SiLCYE protein is any one of the following proteins a1) -a 3):

a1) the amino acid sequence is protein shown as a sequence 1 in a sequence table;

a2) a protein which is obtained by substituting and/or deleting and/or adding one or more than one amino acid residue in the amino acid sequence shown in a1), has more than 80% of identity with the amino acid sequence shown in a1), and is related to the millet carotenoid;

a3) a fusion protein obtained by connecting a label at the N terminal or/and the C terminal of a1) or a 2).

Wherein SEQ ID No.1 consists of 540 amino acid residues.

The protein is derived from millet.

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The protein-tag refers to a polypeptide or protein which is expressed by fusion with a target protein by using a DNA in vitro recombination technology so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag, and/or a SUMO protein tag, etc.

Table 1: sequence of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

In the above applications, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a calculation to search for identity of a pair of amino acid sequences, a value (%) of identity can be obtained.

In the above applications, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

In the above application, the substance for regulating the activity or content of the protein may be a substance for knocking out a gene encoding the protein and/or a substance for regulating the expression of a gene encoding the protein.

In the above application, the substance for regulating gene expression may be a substance for regulating at least one of the following 6 kinds of regulation: 1) regulation at the level of transcription of said gene; 2) regulation after transcription of the gene (i.e., regulation of splicing or processing of a primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of nuclear to cytoplasmic transport of mRNA of the gene); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; 6) post-translational regulation of the gene (i.e., regulation of the activity of a protein translated from the gene).

In the above application, the regulation of gene expression may be the inhibition or reduction of gene expression, and the inhibition or reduction of gene expression may be achieved by gene knockout or by gene silencing.

The gene knockout (geneknockout) refers to a phenomenon in which a specific target gene is inactivated by homologous recombination. Gene knockout is the inactivation of a specific target gene by a change in the DNA sequence.

The gene silencing refers to the phenomenon that a gene is not expressed or is under expression under the condition of not damaging the original DNA. Gene silencing is premised on no change in DNA sequence, resulting in no or low expression of the gene. Gene silencing can occur at two levels, one at the transcriptional level due to DNA methylation, differential staining, and positional effects, and the other post-transcriptional gene silencing, i.e., inactivation of a gene at the post-transcriptional level by specific inhibition of a target RNA, including antisense RNA, co-suppression (co-suppression), gene suppression (quelling), RNA interference (RNAi), and micro-RNA (mirna) -mediated translational suppression, among others.

In the above application, the substance for regulating gene expression may be an agent for inhibiting or reducing the gene expression. The agent that inhibits or reduces the expression of the gene can be an agent that knocks out the gene, such as an agent that knocks out the gene by homologous recombination, or an agent that knocks out the gene by CRISPR-Cas 9. The agent that inhibits or reduces expression of the gene may comprise a polynucleotide that targets the gene, such as an siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

Further, in the above method, the inhibition or reduction of the expression amount of the protein-encoding gene in the millet, and/or the inhibition or reduction of the activity and/or content of the protein in the millet is achieved by introducing the CRISPR/Cas9 system into the millet, wherein the CRISPR/Cas9 system comprises a recombinant expression vector for expressing a DNA molecule targeting the gRNA of the protein-encoding gene.

CRISPR/Cas9 includes two portions: a guide rna (grna) and a non-specific CRISPR-binding endonuclease (Cas 9). The guide RNA is a short synthetic RNA consisting of a scaffold sequence necessary for binding Cas9 and a specific about 20nt empty (spacer) or targeting sequence (target site) that determines the gene target for modification.

Further, in the above method, the target sequence of the gRNA is represented by position 171-190 of sequence 3 in the sequence table, i.e., 5'-GAAGCACGATGAGACGGCGG-3'.

The coding gene of the targeting sequence of the gRNA is shown as 705-724 th position of the sequence 4 in the sequence table.

Further, in the above method, the inhibiting or reducing the expression level of the gene encoding the protein in the millet, and/or the inhibiting or reducing the activity and/or content of the protein in the millet is carried out by subjecting sequence 2 in the sequence table to any one of the following mutations:

b1) mutating a SiLCYE gene shown in a sequence 2 in a sequence table into SiLCYE/+1bp, wherein the SiLCYE/+1bp is a DNA molecule obtained by inserting a nucleotide T between 187 th to 188 th nucleotides of the sequence 2 in the sequence table and keeping other nucleotide sequences of the sequence 2 unchanged;

b2) mutating a SiLCYE gene shown as a sequence 2 in a sequence table into SiLCYE/-1bp, wherein the SiLCYE/-1bp is a DNA molecule obtained by deleting 186 th nucleotide G of the sequence 2 in the sequence table and keeping other nucleotide sequences of the sequence 2 unchanged;

b3) the SiLCYE gene shown in the sequence 2 in the sequence table is mutated into SiLCYE/-3bp, wherein the SiLCYE/-3bp is a DNA molecule obtained by deleting the nucleotide GAC between the 183 rd and 185 th positions of the sequence 2 in the sequence table and keeping other nucleotide sequences of the sequence 2 unchanged.

In order to achieve the above objects, a second aspect of the present application is to provide a mutein and related biological material obtained by the above method. The protein is SiLCYE/+1bp, SiLCYE/-1bp or SiLCYE/-3bp,

the protein SiLCYE/+1bp is a protein coded by a SiLCYE/+1bp gene, and the SiLCYE/+1bp is a DNA molecule obtained by inserting a nucleotide T between 187 th to 188 th nucleotides of a sequence 2 in a sequence table and keeping other nucleotide sequences of the sequence 2 unchanged;

the protein SiLCYE/-1bp is a protein coded by a SiLCYE/-1bp gene, and the SiLCYE/-1bp is a DNA molecule obtained by deleting 186 th nucleotide G in a sequence 2 in a sequence table and keeping other nucleotide sequences of the sequence 2 unchanged;

the protein SiLCYE/-3bp is a protein coded by a SiLCYE/-3bp gene, and the SiLCYE/-3bp is a DNA molecule obtained by deleting the nucleotide GAC between the 183 rd and 185 th sites of the sequence 2 in a sequence table and keeping other nucleotide sequences of the sequence 2 unchanged.

Further, a biomaterial related to the above-mentioned protein SiLCYE/+1bp, SiLCYE/-1bp or SiLCYE/-3bp, said biomaterial comprising any one of A1) -A7),

A1) nucleic acid molecules encoding the above-mentioned proteins SiLCYE/+1bp, SiLCYE/-1bp or SiLCYE/-3 bp;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising A1) said nucleic acid molecule or a recombinant vector comprising A2) said expression cassette;

A4) a recombinant microorganism containing A1) the nucleic acid molecule, or a recombinant microorganism containing A2) the expression cassette, or a recombinant microorganism containing A3) the recombinant vector;

A5) a transgenic plant cell line comprising A1) the nucleic acid molecule, or a transgenic plant cell line comprising A2) the expression cassette, or a transgenic plant cell line comprising A3) the recombinant vector;

A6) transgenic plant tissue comprising A1) the nucleic acid molecule, or transgenic plant tissue comprising A2) the expression cassette, or transgenic plant tissue comprising A3) the recombinant vector;

A7) a transgenic plant organ containing A1) the nucleic acid molecule, or a transgenic plant organ containing A2) the expression cassette, or a transgenic plant organ containing A3) the recombinant vector.

Further, in the above-mentioned biomaterial, A1) the nucleic acid molecule is SiLCYE/+1bp, SiLCYE/-1bp or SiLCYE/-3bp,

the SiLCYE/+1bp is a DNA molecule obtained by inserting a nucleotide T between 187 th to 188 th nucleotides of a sequence 2 in a sequence table and keeping other nucleotide sequences of the sequence 2 unchanged;

the SiLCYE/-1bp is a DNA molecule obtained by deleting 186 th nucleotide G of a sequence 2 in a sequence table and keeping other nucleotide sequences of the sequence 2 unchanged;

the SiLCYE/-3bp is a DNA molecule obtained by deleting the nucleotide GAC between 183 th and 185 th sites of the sequence 2 in the sequence table and keeping other nucleotide sequences of the sequence 2 unchanged.

In order to achieve the above object, a third aspect of the present application provides an application, the application being M1) or M2),

m1) use of the substance for expression or regulation of the above-mentioned silcee protein or regulatory gene encoding said silcee protein in regulating zeaxanthin or/and lutein stearate or/and anther xanthin in millet;

m2) the SiLCYE/+1bp, SiLCYE/-1bp or SiLCYE/-3bp protein or the expression substance of the regulation gene or the substance for regulating the activity and/or the content of the SiLCYE/+1bp, SiLCYE/-1bp or SiLCYE/-3bp protein is applied to the regulation of the millet zeaxanthin or/and lutein stearate or/and anther xanthin, and the gene codes the SiLCYE/+1bp, SiLCYE/-1bp or SiLCYE/-3bp protein.

Further, in the application, the M1) substance for regulating the expression of the gene or the substance for regulating the activity and/or content of the SiLCYE protein is the following biological material B1) or B2):

B1) a nucleic acid molecule that inhibits or reduces the expression of a gene encoding the SilcYE protein or a nucleic acid molecule that inhibits or reduces the activity of the SilcYE protein;

B2) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule according to B1).

M2) or the substance which regulates the activity and/or content of the SiLCYE/+1bp, SiLCYE/-1bp or SiLCYE/-3bp protein is the biological material as described in any one of A1) -A7):

A1) nucleic acid molecules encoding said SilcYE/+1bp, SilcYE/-1bp or SilcYE/-3bp proteins;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

Further, in the above-mentioned application, the nucleic acid molecule according to B1) is a DNA molecule for expressing a gRNA targeting the gene encoding the silk protein or a gRNA encoding the gene encoding the silk protein.

The target sequence of the gRNA is shown as position 171-190 of the sequence 3 in the sequence table, namely 5'-GAAGCACGATGAGACGGCGG-3'.

In the application, the increase of the content of the zeaxanthin or/and the lutein stearate or/and the anther xanthin in the millet can be the increase of the content of the zeaxanthin or/and the lutein stearate or/and the anther xanthin in the millet seeds.

The application specifies the function and metabolic pathway position of SiLCYE in the millet carotenoid metabolic pathway. Firstly, millet SiLCYE is cloned through a homologous cloning technology, SiLCYE genes are edited through a CRISPR/Cas9 gene editing technology to obtain an editing strain, the content change of all components of carotenoid is measured on an editing pure line and a corresponding wild species through a liquid chromatography tandem mass spectrometry (LC-MS/MS) technology, and the result shows that the SiLCYE gene editing leads the content of zeaxanthin, lutein stearate and anther xanthin in millet grains to be obviously improved, and the content of lutein and lutein palmitate to be obviously reduced, which indicates that the SiLCYE genes have important regulation and control functions on the carotenoid components in carotenoid metabolism. By using technical means such as molecular biology, genetics and the like, the endogenous expression level of the SiLCYE gene is regulated, and new millet germplasm rich in zeaxanthin, lutein stearate, anther xanthin, lutein and lutein palmitate is expected to be obtained. .

Drawings

FIG. 1 is a flow chart of the construction of LacZ-U6a-sgRNA expression cassettes containing SiLCYE target sequences.

FIG. 2 is a PCR amplification of the LacZ-U6a-sgRNA expression cassette.

FIG. 3 shows Bsa I cleavage of pYLCRISPR/Cas9Pubi-H vector.

FIG. 4 is a frame diagram of pYLCRISPR/Cas9Pubi-H-SiLCYE recombinant vector.

FIG. 5 shows PCR and restriction enzyme digestion identification of pYLCRISPR/Cas9Pubi-H-SiLCYE recombinant vector; wherein A in FIG. 5 is plasmid PCR identification, and B in FIG. 5 is plasmid Bsa I enzyme digestion identification.

FIG. 6 shows differentiated seedlings with hygromycin resistance.

FIG. 7 shows PCR molecular assay of SiLCYE transgenic positive lines.

FIG. 8 shows the CRISPR/Cas9 target site of SiLCYE and the screening and identification of different editing pure lines; wherein, A in FIG. 8 is the gene structure diagram of SiLCYE and the position and sequence of target point design; in FIG. 8B, 1 base T is inserted into the target sequence at the 3 rd and 4 th bases before PAM. In FIG. 8, C is a GAC in which 3 bases of the target sequence are deleted. In FIG. 8, D is the deletion of 1 base G from the target sequence. FIG. 9 is a statistical analysis of carotenoids in significant changes in content in SiLCYE compiled clones.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

pYLCRISPR/Cas9Pubi-H binary vectors are disclosed in the documents "PLoS ONE,2016,11(4): e0154027 and Mol plant.2015, 8(8): 1274-84", which are publicly available to the Applicant for obtaining the above biomaterials which are only used for repeating the experiments of the present invention and are not used for other purposes.

The pYLsgRNA-OsU6a plasmid is disclosed in the documents "PLoS ONE,2016,11(4): e0154027 and Mol plant.2015, 8(8): 1274-84" which are publicly available to the Applicant as the above-mentioned biomaterial, which is only used for experiments for repeating the present invention and is not used for other purposes.

The millet variety Ci846 as a material to be transformed is awarded by the resource material of the subject group of the researchers of the Shanghai institute of crop science of the Chinese academy of agricultural sciences. Ci846 is disclosed in the document "http:// www.setariamodel.cn/#/map", which is publicly available to the applicant for use in the experiments for which the invention was repeated, and is not useful for other applications.

The present invention will be described in detail with reference to examples, which are provided for illustration of the present invention and should not be construed as limiting the scope of the present invention. The examples were carried out under the conventional conditions, unless otherwise specified.

Example 1 SiLCYE Gene editing target design

1.1 amino acid sequence, coding sequence and genome sequence of SiLCYE

The amino acid sequence of the SiLCYE is shown as a sequence 1 in a sequence table, the coding gene of the SiLCYE is shown as a sequence 2 in the sequence table, and the genome sequence of the SiLCYE is shown as a sequence 3 in the sequence table. By bioinformatics analysis, the SilcYE genome has 10 exons, 9 introns and 1623bp of CDS total length.

1.2 SiLCYE Gene editing target design

Predicting websites through online targets according to millet SiLCYE genome sequence (http:// crispor.tefor.net/) Generating a target point list, and finally selecting the nucleotide No. 171 and 190 of the sequence 3 in the sequence table, namely 5'-GAAGCACGATGAGACGGCGG-3' as a target sequence.

Example 2 construction of pYLCRISPR/Cas9Pubi-H-SiLCYE recombinant vector

2.1 construction of LacZ-U6a-sgRNA expression cassette

Constructing a LacZ-U6a-sgRNA expression cassette containing a 20bp target sequence of a SiLCYE gene according to a sgRNA expression cassette construction flow chart shown in figure 1, wherein the expression cassette sequentially consists of the following elements: pYLCRISPR/Cas9Pubi-H binary vector (PLoS ONE,2016,11(4): e0154027) and LacZ-U6a promoter linker primer sequence Cas9U6aF (+), LacZ-U6a promoter sequence, 20bpSiLCYE target sequence, sgRNA and linker primer sequence gR-Rcas9(-) -of pYLCRISPR/Cas9Pubi-H binary vector. The nucleotide sequence (862bp) of the expression cassette is shown as a sequence 4 in a sequence table.

The construction process is as follows:

firstly, 4 primers are designed at the positions shown in FIG. 1: cas9U6aF (+), U6aSILCYET1, gRSLCYET 1 and gR-Rcas9(-), wherein a Cas9U6aF (+) primer contains a Bsa I enzyme cutting site 6 base sequence and a 17bp sequence flanking the enzyme cutting site on a pYLRISPR/Cas 9Pubi-H vector; the gR-Rcas9(-) primer also contains another Bsa I restriction site 6 base sequence on the Cas9 vector and a 17bp sequence beside the restriction site. Cas9U6aF (+), U6aSiLCYET1, gRSLCYET 1, gR-Rcas9(-), the primer sequences are as follows:

Cas9U6a-F(+)：

5'-CGCGCCGTAGTGCTCGAGAGACCCTCCGTTTTACCTGTGGAATCG-3'

U6aSiLCYET1：5'-CCGCCGTCTCATCGTGCTTC ggcagccaagccagca-3'

gRSiLCYET1：5'-AAGCACGATGAGACGGCGGGTTTTAGAGCTAGAAAT-3'

gR-Rcas9(-)：5'-CGCGCCAATGATACCGCGAGACCCGGAGGAAAATTCCATCCAC-3'

pYLsgRNA-OsU6a plasmid was used as template, and amplified with Cas9U6aF (+)/U6aSiLCYET1 and gRSLCYET 1/gR-Rcas9(-) primer pairs, respectively. The PCR reaction system was ddH2O 19. mu.l, 2xKOD neo buffer 2. mu.l, F-primer 0.75. mu.l, R-primer 0.75. mu.l, 40mM dNTP 1. mu.l, KOD Fx neo 0.5. mu.l, OsU6a 2. mu.l, for a total of 50. mu.l. And then overlapping by using a PCR amplification product mixture of two primer pairs as a template and a Cas9U6aF (+)/gR-Rcas9(-) primer pair. The overlapping PCR reaction system is ddH2O 19.5.5 μ l, 2xKOD neo buffer 25 μ l, F-primer 0.75 μ l, R-primer0.75 μ l, 40mM dNTP1 μ l, KOD Fx neo 0.5ul, OsU6a 2ul, totaling 50ul, the template is equal amount mixture of the two primers to PCR amplification products, overlapping amplification products are recovered, namely the 862bp LacZ-U6 a-sNA expression cassette, and the overlapping amplification products are subjected to electrophoresis detection, as shown in figure 2.

The results in FIG. 2 show that the electrophoresis band of the overlapping amplification product is between 750bp and 1000bp, which is consistent with the size of 862bp of the amplification product.

2.2 homologous recombination of LacZ-U6a-sgRNA expression cassette and pYLCRISPR/Cas9Pubi-H binary vector

The pYLCRISPR/Cas9Pubi-H vector is cut by Bsa I and then a large fragment vector is recovered, as shown in figure 3, the large fragment linear vector and the LacZ-U6a-sgRNA expression cassette obtained by 2.1 are subjected to homologous recombination, and the LacZ-U6a-sgRNA expression cassette is constructed into two cutting positions of the pYLCRISPR/Cas9Pubi-H vector Bsa I, so that a recombinant vector pYLCRISPR/Cas9Pubi-H-SiLCYE is obtained, as shown in figure 4. The specific recombination method steps are as follows: takara Bio USA, Inc.

HD Cloning Kit User Manual, cat.

The obtained recombinant vector pYRCISPR/Cas 9Pubi-H-SiLCYE is subjected to PCR and enzyme digestion identification, so that the constructed sgRNA expression cassette sequence is ensured to be correct and is correctly connected to two Bsa I cleavage point positions of pYRCISPR/Cas 9 Pubi-H. The recombinant pYLCRISPR/Cas9Pubi-H-SiLCYE vector is firstly subjected to chemical competent cell transformation of escherichia coli DH10B, ice bath is carried out for 30min, heat shock is carried out for 90s at 42 ℃, LB liquid culture medium without antibiotic is added, shaking culture is carried out at 37 ℃ and 150rpm for 45min, then bacterial liquid is coated on LB solid culture medium containing Kanamycin (Kanamycin, 50mg/L), and dark inversion screening culture is carried out at 37 ℃ for 12H. The specific steps of the method can be referred to the specification of TOP 10F' competent cell Cat. NO. ZC1029 of ZOMANBIO, a member of the union Biotechnology Ltd.

Selecting a single clone to 1ml LB liquid culture medium containing Kanamycin (Kanamycin, 50mg/L) and shaking at 37 ℃ and 230rpm for 6-8h, collecting bacterial liquid and carrying out plasmid extraction, wherein the specific method steps can refer to a plasmid small quantity rapid extraction kit BM191220 of Biomed of Bomaide biotechnology and Co.

Then carrying out bacteria liquid PCR and plasmid enzyme digestion identification, and amplifying by using sequencing primers on a vector, namely a sequence SP-L1/SP-R primer pair before and after the sgRNA expression cassette on the vector is accessed, wherein the positive clone has the size of 983bThe band of p specifically amplified is shown in FIG. 5, panel A. The PCR reaction system is as follows: ddH ₂ O15.5. mu.l, 10 × Taq buffer 2. mu.l, F-primer 0.3. mu.l, R-primer 0.3. mu.l, 40mM dNTP 0.4. mu.l, Taq enzyme 0.5. mu.l, bacterial suspension 1. mu.l, totaling 20. mu.l of the reaction system. Extracting positive clone plasmid, Bsa I enzyme digestion identification, and an enzyme digestion reaction system:

v2 endonuclease 0.5ul, constructed plasmid 5ul, 10X cutscart buffer 2ul, ddH2O 2.5.5 ul, and 10ul reaction system, wherein the small fragment is sgRNA expression cassette of 862bp, and the enzyme cutting result is shown as B in FIG. 5.

The results in FIG. 5 show that: the size of the target band amplified by PCR and the size of the enzyme digestion fragment are the same as the expected size, which indicates that the sgRNA expression cassette of SiLCYE is successfully constructed on the pYLCRISPR/Cas9Pubi-H vector.

The vector sequencing primers were:

SP-L1：5'-GCGGTGTCATCTATGTTACTAG-3'；

SP-R：5'-TGCAATAACTTCGTATAGGCT-3'。

example 3 acquisition of SiLCYE-Positive transgenic millet and line editing identification

3.1 Ci846 mature embryo callus culture and pYLCRISPR/Cas9Pubi-H-SiLCYE Agrobacterium strain EHA105 mediated callus transformation

The millet variety Ci846 as a material to be transformed is awarded by the resource material of the subject group of the researchers of the Shanghai institute of crop science of the Chinese academy of agricultural sciences.

The recombinant vector pYLCRISPR/Cas9Pubi-H-SiLCYE was introduced into EHA105 competent cells according to the instructions of the Bomed Biotechnology Ltd (Biomed) EHA105 Agrobacterium competent cell reagent (product number BC303-01) to obtain an Agrobacterium strain containing pYLCRISPR/Cas9Pubi-H-SiLCYE plasmid.

The mature embryo of millet Ci846 is used as an explant to perform callus induction culture, and the infection transformation experiment of agrobacterium strain containing pYLCRISPR/Cas9Pubi-H-SiLCYE plasmid is finished by the transgenic center of the institute of crop science of Chinese academy of agricultural sciences, and the center opens genetic transformation service of millet. A large number of differentiated shoots with hygromycin resistance were obtained by this central experiment, as shown in FIG. 6.

3.2 identification of transgenic Positive lines and editing lines of SiLCYE

And (3) transplanting the differentiated plantlets into soil to continue growing, firstly carrying out PCR molecular identification on a real positive transgenic line, and then carrying out molecular identification on an editing line on the basis of determining the positive transgenic line. The primer pair for identifying the positive transgenic positive is Cas9-f/Cas9-r, the amplification size is 572bp, and the primer sequences are respectively: cas 9-f: CTGACGCTAACCTCGACAAG, respectively; cas 9-r: CCGATCTAGTAACATAGATGACACC are provided. FIG. 7 shows the detection result of a partially transgenic strain Cas9-f/Cas9-r molecule.

As seen in fig. 7: the majority of the tested transgenic lines are true transgenic lines, and some lines are false positive.

A primer pair HiTomSiLCYEF1/HiTomSiLCYER1 is designed at a proper position on the upstream and downstream of the SiLCYE gene genome target point, and the size of an amplified fragment is 237 bp. And detecting the PCR molecule of the positive transgenic strain identified by the Cas9-f/Cas9-r primer by using a HiTomSiLCYEF1/HiTomSiLCYER1 primer, sequencing a PCR amplification product, namely, the Senui Bo Biotech limited company, and determining whether the SiLCYE target site sequence in the genome DNA is changed, thereby determining whether the gene is edited. The sequences of HiTomSiLCYEF1/HiTomSiLCYER1 are respectively as follows:

HiTomSiLCYEF1：5'-ggagtgagtacggtgtgcAGGGCGGAGGTGGAGAGGTG-3'

HiTomSiLCYER1：5'-gagttggatgctggatggCTTGGAGGCGATCTTGGAC-3'

by bioinformatics analysis, the SilcYE gene has 10 exons, 9 introns and 1623bp of CDS total length. Through analysis of CRISPR target analysis software, 20bp in total from 171bp to 190bp of the first exon is taken as a target sequence, and A in FIG. 8 is shown as the target sequence. Through screening and identification of T0 and T1 generation editing strains, 29 editing pure lines are obtained in total, and B, C and D shown in figure 8 are obtained: 3 editing pure lines of 3 editing forms with 1 base insertion, 3 base deletion and 1 base deletion. Through analysis, the two editing forms B and D in the figure 8 can seriously affect the normal translation of the base after the insertion and deletion site, the frame shift variation occurs, the RNA expression and the normal translation of the protein can be seriously affected, the deletion of three bases C in the figure 8 can not cause the frame shift variation after the deletion site, and the whole sequence can affect the normal translation of 2 amino acids, the normal translation of 1 amino acid and the deletion of 1 amino acid.

FIG. 8A, the gene structure diagram of SiLCYE and the location and sequence of target design; in FIG. 8B, C in FIG. 8 and D in FIG. 8, there are shown three different editing modes in the editing pure line, the left side is the comparison of the wild type sequence and the editing sequence, the upper sequence is the wild type sequence, the lower sequence is the editing sequence, the red frame circle is the target point position sequence of 20bp, and the right side is the sequencing map of the target point corresponding to the editing strain and the sequences before and after.

In FIG. 8B, 1T base is inserted into the target sequence, a nucleotide T is inserted between 187 th to 188 th nucleotides in the sequence 3 in the sequence table in the genomic change, the other nucleotide sequence of the sequence 3 is kept unchanged, the coding sequence is a DNA molecule obtained by inserting a nucleotide T between 187 th to 188 th nucleotides in the sequence 2 in the sequence table and keeping the other nucleotide sequence of the sequence 2 unchanged, the DNA molecule is named as SiLCYE/+1bp, so that the translated protein generates frame shift mutation after the mutation site, and the obtained mutated protein is named as SiLCYE/+1 bp.

C in FIG. 8 shows that 3 bases are deleted in the target sequence, the change of the genome is the deletion of the nucleotide GAC between the 183 rd and 185 th positions of the sequence 3 in the sequence table, the other nucleotide sequence of the sequence 3 is kept unchanged, the coding sequence is the deletion of the nucleotide GAC between the 183 rd and 185 th positions of the sequence 2 in the sequence table, the DNA molecule obtained by keeping the other nucleotide sequence of the sequence 2 unchanged is named as SiLCYE/-3bp, the amino acid deletion mutation of the protein after translation is caused, and the obtained protein after mutation is named as SiLCYE/-3 bp.

In FIG. 8, D shows that 1G base is deleted in the target sequence, and the change in the genome is that the nucleotide G at the 186 th position of the sequence 3 in the sequence table is deleted, and the other nucleotide sequences of the sequence 3 are kept unchanged; the coding sequence is the deletion of nucleotide G at 186 th site of the sequence 2 in the sequence table, the DNA molecule obtained by keeping other nucleotide sequences of the sequence 2 unchanged is named as SiLCYE/-1bp, so that the translated protein generates frame shift mutation after mutation sites, and the obtained mutated protein is named as SiLCYE/-1 bp.

Example 4 Regulation of SiLCYE in Carotenoid anabolism

We examined the identified silcee editing clones in example 3 and the change in carotenoid content in the receptor Ci846 by liquid chromatography tandem mass spectrometry (LC-MS/MS) technique. Selecting 3 biological replicates, namely selecting 3 SiLCYE editing pure lines and 3 wild Ci846 strains to total 6 parts of the carotenoid content change after dehulling of the millet material seeds. The content change of nearly 70 carotenoid components was measured, and the data were processed by using SPSS19.0 statistical software, and the following 6 carotenoid components were included in the significantly changed content, and the results are shown in FIG. 9. The results are shown as mean ± standard deviation, with P < 0.05(×) representing significant differences and P < 0.001(×) representing very significant differences in fig. 9.

The results in fig. 9 show that the lutein, lutein stearate, lutein palmitate, anther xanthin, and zeaxanthin 5 carotenoid components undergo significant changes in the content of the silcey editing line compared to the wild type acceptor material. Wherein, the content of lutein and lutein palmitate is significantly reduced compared with wild type (figure 9), and the content of zeaxanthin, lutein stearate, anther xanthin is all increased (figure 9), which shows that SiLCYE has important regulation and control function on the metabolism of the 5 carotenoid components.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

Institute of biotechnology, national academy of agricultural sciences

<120> function and application of SiLCYE in regulating and controlling anabolism of zeaxanthin and other millet carotenoids

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 540

<212> PRT

<213> millet (Setaria italica)

<400> 1

Met Gly Leu Ser Gly Ala Ala Ile Ser Ala Pro Leu Gly Cys Arg Gly

1 5 10 15

Leu Pro His Gly Ala Val Gly Gly Gly Ser Lys Val Arg Arg Ala Glu

20 25 30

Val Glu Arg Trp Arg Arg Arg Glu Gly Ala Gly Arg Arg Val Ala Gly

35 40 45

Pro Lys Val Arg Cys Val Ala Thr Glu Lys His Asp Glu Thr Ala Ala

50 55 60

Val Gly Ala Ala Ala Ala Gly Val Glu Phe Ala Asp Glu Glu Asp Tyr

65 70 75 80

Arg Lys Gly Gly Gly Gly Glu Leu Leu Tyr Val Gln Met Gln Ala Thr

85 90 95

Lys Pro Met Glu Ser Gln Ser Lys Ile Ala Ser Lys Leu Leu Pro Ile

100 105 110

Ser Asn Glu Asn Ser Val Leu Asp Leu Val Ile Ile Gly Cys Gly Pro

115 120 125

Ala Gly Leu Ser Leu Ala Ser Glu Ser Ala Lys Lys Gly Leu Thr Val

130 135 140

Gly Leu Ile Gly Pro Asp Leu Pro Phe Thr Asn Asn Tyr Gly Val Trp

145 150 155 160

Glu Asp Glu Phe Lys Asp Leu Gly Leu Glu Ser Cys Ile Glu His Val

165 170 175

Trp Lys Asp Thr Ile Val Tyr Leu Asp Asn Asn Glu Pro Ile Leu Ile

180 185 190

Gly Arg Pro Tyr Gly Arg Val His Arg Asp Leu Leu His Glu Glu Leu

195 200 205

Leu Arg Arg Cys Tyr Glu Ala Gly Val Thr Tyr Leu Asn Ser Lys Val

210 215 220

Asp Lys Ile Ile Glu Ser Pro Asp Gly His Arg Val Val Cys Cys Glu

225 230 235 240

Arg Gly Arg Glu Ile Leu Cys Arg Leu Ala Ile Val Ala Ser Gly Ala

245 250 255

Ala Ser Gly Arg Leu Leu Glu Tyr Glu Val Gly Gly Pro Arg Val Cys

260 265 270

Val Gln Thr Ala Tyr Gly Val Glu Val Glu Val Glu Asn Asn Pro Tyr

275 280 285

Asp Pro Ser Leu Met Val Phe Met Asp Tyr Arg Asp Cys Phe Lys Glu

290 295 300

Lys Phe Ser His Ser Glu Gln Glu Asn Pro Thr Phe Leu Tyr Ala Met

305 310 315 320

Pro Met Ser Ser Thr Arg Val Phe Phe Glu Glu Thr Cys Leu Ala Ser

325 330 335

Lys Asp Ala Met Pro Phe Asp Val Leu Lys Lys Arg Leu Met Tyr Arg

340 345 350

Leu Asp Ala Met Gly Val Arg Ile Leu Lys Val His Glu Glu Glu Trp

355 360 365

Ser Tyr Ile Pro Val Gly Gly Ser Leu Pro Asn Thr Asp Gln Lys Asn

370 375 380

Leu Ala Phe Gly Ala Ala Ala Ser Met Val His Pro Ala Thr Gly Tyr

385 390 395 400

Ser Val Val Arg Ser Leu Ser Glu Ala Pro Arg Tyr Ala Ser Val Ile

405 410 415

Ser Asp Ile Leu Arg Asn Arg Val Pro Ala Gln Tyr Leu Pro Gly Ser

420 425 430

Ser Gln Asn Tyr Ser Pro Ser Met Leu Ala Trp Arg Thr Leu Trp Pro

435 440 445

Gln Glu Arg Lys Arg Gln Arg Ser Phe Phe Leu Phe Gly Leu Ala Leu

450 455 460

Ile Ile Gln Leu Asn Asn Glu Gly Ile Gln Thr Phe Phe Glu Ala Phe

465 470 475 480

Phe Arg Val Pro Lys Trp Met Trp Arg Gly Phe Leu Gly Ser Thr Leu

485 490 495

Ser Ser Val Asp Leu Ile Leu Phe Ser Phe Tyr Met Phe Ala Ile Ala

500 505 510

Pro Asn Gln Leu Arg Met Asn Leu Val Arg His Leu Leu Ser Asp Pro

515 520 525

Thr Gly Ser Thr Met Ile Lys Thr Tyr Leu Thr Leu

530 535 540

<210> 2

<211> 1623

<212> DNA

<213> millet (Setaria italica)

<400> 2

atggggctct cgggcgcggc gatctccgcg ccgctcggct gccgcgggct gccgcacggg 60

gcggtcggcg gaggcagcaa ggtgcggagg gcggaggtgg agaggtggcg gcggcgggag 120

ggcgcgggcc ggcgcgtggc cggaccgaag gtgaggtgcg tggcgaccga gaagcacgat 180

gagacggcgg cggtcggggc ggcggcggcg ggcgtggagt tcgcggacga ggaggactac 240

cgcaaggggg gcggcggcga gctgctctac gtgcaaatgc aggccaccaa gcccatggaa 300

agccagtcca agatcgcctc caagctgctg cccatatcca atgaaaattc agtacttgat 360

ctggttatca ttggctgtgg tcctgccggt ctttctctag cttcagagtc agccaagaaa 420

ggcctcactg ttggtcttat tggccctgac cttccgttca cgaataacta tggtgtgtgg 480

gaggatgaat tcaaagatct tggtctagag agctgtattg agcatgtctg gaaggatacc 540

attgtctatc tagacaataa tgaaccaata ctgattggcc gtccatatgg cagggtgcac 600

cgtgacctgc tgcatgagga gttgctgaga agatgctatg aagctggcgt tacatacctc 660

aactcgaaag tggacaagat catcgaatct ccagatggtc atagagtagt ctgttgtgaa 720

aggggccgtg agatactctg taggcttgcg attgttgctt cgggggcagc atctggtcgg 780

cttttagaat acgaggttgg aggtccccgt gtctgtgtgc agactgcata tggagtagaa 840

gttgaggtgg aaaacaatcc atatgatccc agcttaatgg ttttcatgga ctacagagat 900

tgtttcaaag agaaattctc gcattctgaa caagaaaatc caactttcct gtatgctatg 960

cctatgtcat ccacacgagt tttctttgag gaaacatgct tagcctctaa agatgcgatg 1020

ccctttgatg tacttaagaa aaggttgatg tatcggttgg atgcaatggg agttcggatc 1080

ctgaaagttc atgaggagga atggtcctac attcctgttg gaggttcctt accaaataca 1140

gatcagaaaa atcttgcatt tggtgctgca gcaagtatgg tgcaccctgc aactggctac 1200

tcagtggtca gatctttgtc tgaggctcca agatatgcct ctgtaatatc agatatctta 1260

aggaaccgag ttcctgcgca atatttgcca ggaagttctc aaaattacag tccatcaatg 1320

cttgcttgga gaacactatg gcctcaagaa aggaaacggc aacgctcatt tttccttttc 1380

ggattggcat tgatcatcca actgaataat gaaggcatac aaacattctt cgaagccttt 1440

ttcagggtgc cgaaatggat gtggcgaggg ttcttgggct caaccctttc atcggtagat 1500

ctaatactat tttcattcta catgtttgcg atagctccga atcaattgcg aatgaacctc 1560

gtcagacatc tactctctga tccgaccggc tcaacaatga tcaagaccta cctgaccttg 1620

taa 1623

<210> 3

<211> 3700

<212> DNA

<213> millet (Setaria italica)

<400> 3

atggggctct cgggcgcggc gatctccgcg ccgctcggct gccgcgggct gccgcacggg 60

gcggtcggcg gaggcagcaa ggtgcggagg gcggaggtgg agaggtggcg gcggcgggag 120

ggcgcgggcc ggcgcgtggc cggaccgaag gtgaggtgcg tggcgaccga gaagcacgat 180

gagacggcgg cggtcggggc ggcggcggcg ggcgtggagt tcgcggacga ggaggactac 240

cgcaaggggg gcggcggcga gctgctctac gtgcaaatgc aggccaccaa gcccatggaa 300

agccagtcca agatcgcctc caaggttatt agattactga tactgataat tctctaatca 360

atttctgtgc ttgttctaat gatcatgatt atagatttcg tccccttatc ttgtactagt 420

attttgggat ttactggaca tgaaatccat aacatctgcc actataaact ttgattaaca 480

tgtacgagat aaaattcatg tacatcgaag ctttctattt ctcatttttg cctgtaaccg 540

cacaccattc atattgtcca tccatcagca atcgaacttt atctttttca agagaaataa 600

ccccagccaa gtaggttagg gtaatcattt aagagcgtag taaaatattg cacaattcag 660

tatggaacca cacgcgccgt acttcacgtg ctttggctac aatgacgtcc gtggaaacgg 720

gtggtgatga cttgtccatc tcctcttcgg ctggttgaca cagttgatca tcgtttatgt 780

ccatttggaa gtgtatactg tagtttaaaa gttctgaaat gcattttatc atgaaaatga 840

gagtagctta tcagttttat actattacaa agtgaacatt gtgctgtaac tgtacttgac 900

tgcgatctga aaaatctact taggaactgt cacaagactc aaggtattgt gattggtggg 960

gagggacaat gactagtcac ttccatttcc ggactattgt aagaagataa atcacagcca 1020

cacgtcctag ggtgtttgca catgaagatc atgtctcttt ttttctgttt actacttact 1080

agttccacca acagtatgat gttgcctgaa tgcacagtga tgttgaattc actggattgt 1140

acacacatgg gcatgtcatt tacggtctaa tgtcacgcag tttgactttg ctttaattta 1200

agcagtcaag tgggtagtct aggcacatgt aatccctcaa aattatgcca tttttcctag 1260

gattgctcaa acctttgacg gaaacatgtg ctgttaaaaa tatgtgcaca ttaacaatgt 1320

tttagttctt gttttatcgt aaacctattt tcttagggaa tgaagtattt ccttacatga 1380

tgaagtagct aaaaatcgta ctggcatagg ttcgctgtat ggttcaggaa aaatgaatat 1440

gtggtctttt ctttttcgca gctgctgccc atatccaatg aaaattcagt acttgatctg 1500

gttatcattg gctgtggtcc tgccggtctt tctctagctt cagagtcagc caagaaaggc 1560

ctcactgttg gtcttattgg ccctgacctt ccgttcacga ataactatgg tgtgtgggag 1620

gatgaattca aaggtattat attatttgca ttgctacgat gaagagtttt tgcataatat 1680

ctttatcaac ataatttact ttgacgatac ttattctttt ctctcttttt ctgtccagat 1740

cttggtctag agagctgtat tgagcatgtc tggaaggata ccattgtcta tctagacaat 1800

aatgaaccaa tactgattgg ccgtccatat ggcagggtgc accgtgacct gctgcatgag 1860

gagttgctga gaaggtaaat tctcatgtac caatattggg attcaaaagt atgaattacc 1920

aagcaacgtg atatactatg attgacaagt agcaacactt aaatcattgg cagatgctat 1980

gaagctggcg ttacatacct caactcgaaa gtggacaaga tcatcgaatc tccagatggt 2040

catagagtag tctgttgtga aaggggccgt gagatactct gtaggcttgc gattgttgct 2100

tcgggggcag catctggtcg gcttttagaa tacgaggttg gaggtccccg tgtctgtgtg 2160

cagactgcat atggagtaga agttgaggta cacaaagaag ctgttacttt caattcattt 2220

gccatttcat agtttacata atatcagtgc tcattctcgt tcttgatgaa actttcaaca 2280

tagcatttgg ttactagtta tatgttcttt cagaatgatt tgaatttttc aggtggaaaa 2340

caatccatat gatcccagct taatggtttt catggactac agagattgtt tcaaagagaa 2400

attctcgcat tctgaacaag aaaatccaac tttcctgtat gctatgccta tgtcatccac 2460

acgagttttc tttgaggtct gtatggaact tccattacat ctgtgattct acaaccagta 2520

cttccatgct tcaaagtttc cgatcaaatt ctttatcaca ggaaacatgc ttagcctcta 2580

aagatgcgat gccctttgat gtacttaaga aaaggttgat gtatcggttg gatgcaatgg 2640

gagttcggat cctgaaagtt catgaggagg taagaagtta agggtcacta gcatgttcgg 2700

ctatgattct tgccgctgcg ctgcagctgc gcctgcagca ccaacaactc tggttcctgt 2760

agttttagaa ggctagcagc tgcagcaatc tcagccaaac agcttgttaa tttctcattc 2820

atatgtattg tgaacataaa ctgaaatgct gaagcttggt ttcaggaatg gtcctacatt 2880

cctgttggag gttccttacc aaatacagat cagaaaaatc ttgcatttgg tgctgcagca 2940

agtatggtgc accctgcaac tggtatggcc aaatccttaa tttttacaca ccatgtcctt 3000

ccttgcaatc tagctgatat tcacaacgtg ttggaaaatt cataggctac tcagtggtca 3060

gatctttgtc tgaggctcca agatatgcct ctgtaatatc agatatctta aggaaccgag 3120

ttcctgcgca atatttgcca ggaagttctc aaaattacag tccatcaatg cttggtaagt 3180

attctgctgg tttttactct cgtagacatc acttctggac aagtacagct tcagtctttt 3240

taaattttag acaagtgagc aaaaccttct gcttctaatt gttatatgat gtttcagctt 3300

ggagaacact atggcctcaa gaaaggaaac ggcaacgctc atttttcctt ttcggattgg 3360

cattgatcat ccaactgaat aatgaaggca tacaaacatt cttcgaagcc tttttcaggg 3420

tgccgaaatg gtagtttcac ttttgccctg ttttcagtct attttcatag agattcggtg 3480

tactgaaggt aacaatttcc aagaagtttt gacagccatt gttattgtca acaggatgtg 3540

gcgagggttc ttgggctcaa ccctttcatc ggtagatcta atactatttt cattctacat 3600

gtttgcgata gctccgaatc aattgcgaat gaacctcgtc agacatctac tctctgatcc 3660

gaccggctca acaatgatca agacctacct gaccttgtaa 3700

<210> 4

<211> 862

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgcgccgtag tgctcgagag accctccgtt ttacctgtgg aatcggcagc aaaggacgcg 60

ttgacattgt aggactatat tgctctaata aaggaggcag ctatgctggc cgtcgtttta 120

caacgtcgtg actgggaaaa ccctggcgtt acccaactta atcgccttgc agcacatccc 180

cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg atcgcccttc ccaacagttg 240

cgcagcctga atggctaatt ttttcctgta gttttcccac aaccattttt taccatccga 300

atgataggat aggaaaaata tccaagtgaa cagtattcct ataaaattcc cgtaaaaagc 360

ctgcaatccg aatgagccct gaagtctgaa ctagccggtc acctgtacag gctatcgaga 420

tgccatacaa gagacggtag taggaactag gaagacgatg gttgattcgt caggcgaaat 480

cgtcgtcctg cagtcgcatc tatgggcctg gacggaatag gggaaaaagt tggccggata 540

ggagggaaag gcccaggtgc ttacgtgcga ggtaggcctg ggctctcagc acttcgattc 600

gttggcaccg gggtaggatg caatagagag caacgtttag taccacctcg cttagctaga 660

gcaaactgga ctgccttata tgcgcgggtg ctggcttggc tgccgaagca cgatgagacg 720

gcgggtttta gagctagaaa tagcaagtta aaataaggct agtccgttat caacttgaaa 780

aagtggcacc gagtcggtgc tttttttcaa gagcttggag tggatggaat tttcctccgg 840

gtctcgcggt atcattggcg cg 862

Claims

1. A method for increasing zeaxanthin or/and lutein stearate or/and anther xanthin in millet, which comprises mutating a gene encoding a silk protein in millet to increase zeaxanthin or/and lutein stearate or/and anther xanthin content in millet;

the SilcYE protein is a1) or a2) as follows:

a1) the protein with the amino acid sequence shown as SEQ ID No.1 in the sequence table;

a2) a fusion protein obtained by connecting labels at the N terminal or/and the C terminal of a 1);

the mutation is any one of the following:

b1) mutating a SiLCYE gene shown as SEQ ID No.2 in a sequence table into SiLCYE/+1bp, wherein the SiLCYE/+1bp is a DNA molecule obtained by inserting a nucleotide T between 187 th to 188 th nucleotides of the SEQ ID No.2 in the sequence table and keeping other nucleotide sequences of the SEQ ID No.2 unchanged;

b2) the SiLCYE gene shown in SEQ ID No.2 in the sequence table is mutated into SiLCYE/-1bp, and the SiLCYE/-1bp is a DNA molecule obtained by deleting 186 th nucleotide G of the SEQ ID No.2 in the sequence table and keeping other nucleotide sequences of the SEQ ID No.2 unchanged;

b3) the SiLCYE gene shown by SEQ ID No.2 in the sequence table is mutated into SiLCYE/-3bp, wherein the SiLCYE/-3bp is a DNA molecule obtained by deleting the nucleotide GAC between 183 rd and 185 th positions of the SEQ ID No.2 in the sequence table and keeping other nucleotide sequences of the SEQ ID No.2 unchanged.

2. The method of claim 1 wherein the SilcYE protein encoding gene in the mutant fox is achieved by introducing into the fox a CRISPR/Cas9 system comprising a recombinant expression vector containing a DNA molecule that expresses a gRNA targeted to said protein encoding gene.

3. The method of claim 2, wherein the target sequence of the gRNA is depicted in SEQ ID No.2 at position 171 and 190 of the sequence Listing.

4. The application of the substance of the SiLCYE protein coding gene in the mutant millet in regulating and controlling the content of the zeaxanthin or/and lutein stearate or/and anther xanthin of the millet;

the SilcYE protein is a1) or a2) as follows:

the mutation is any one of the following:

b2) the SiLCYE gene shown by SEQ ID No.2 in the sequence table is mutated into SiLCYE/-1bp, and the SiLCYE/-1bp is a DNA molecule obtained by deleting 186 th nucleotide G of the SEQ ID No.2 in the sequence table and keeping other nucleotide sequences of the SEQ ID No.2 unchanged;

5. The use of claim 4, wherein: the substance of the SiLCYE protein coding gene in the mutant millet is the biological material described in the following B1) or B2):

B1) a nucleic acid molecule that inhibits or reduces expression of a gene encoding the SilcYE protein;

6. The use of claim 5 wherein B1) said nucleic acid molecule is a DNA molecule that expresses a gRNA targeted to said gene encoding a SiLCYE protein or is a gRNA targeted to said gene encoding a SiLCYE protein.