JP4379087B2 - Geranylgeranyl diphosphate synthase and method for producing geranylgeraniol - Google Patents

Description

  The present invention relates to a method for producing geranylgeranyl diphosphate synthase and geranylgeraniol.

Isoprenoids (or terpenoids) are steroids, squalene, farnesylated protein anchor molecules, natural rubber, retinol, β-carotene (vitamin A), phylloquinone, menaquinone (vitamin K) and ubiquinone (coenzyme Q). It consists of a vast variety including side chains, tocopherol (vitamin E), geranylgeranylated protein anchor molecules, chlorophyll side chains, plant hormones such as gibberellin, abscisic acid and brassinolide, archaic ether type lipid components, etc. Contains a group of compounds. In addition, these isoprenoids contain many compounds with high industrial value. In vivo, isoprenoids are synthesized in vivo by the mevalonic acid pathway from acetyl-CoA via mevalonic acid or the MEP (2- C- methyl-D-erythritol 4-phosphate) pathway from pyruvic acid via glyceraldehyde triphosphate. The

  Prenyl alcohols such as farnesol and geranylgeraniol contained in isoprenoids are known as aromatic substances in essential oils used as fragrances, but are also important as starting materials for the synthesis of compounds including the above-mentioned vitamins that are useful as pharmacological agents. It is a serious substance.

The biosynthetic precursor compounds of farnesol and geranylgeraniol are (all- E ) farnesyl diphosphate and (all- E ) geranylgeranyl diphosphate which are diphosphate type compounds. Therefore, the first prenyl alcohol in the linear biosynthetic pathway having 15 and 20 carbon atoms is (all- E ) farnesol and (all- E ) geranylgeraniol which are all-trans type. The (all- E ) farnesyl diphosphate and (all- E ) geranylgeranyl diphosphate are known as active precursor compounds for isoprenoid synthesis in cells. With these two prenyl diphosphates as precursors, all isoprenoid-related substances (called isoprenoids or terpenoids) in trans or cis form are biosynthesized (Ogura K and Koyama T, `` Enzymatic aspects of isoprenoid chain elongation '' CHEMICAL REVIEWS, 98 , 1263-1276 (1998)). It is desired to establish a system capable of producing a large amount of a pure product of active prenyl alcohol which is not a mixture of these cis- , trans (( Z )-, ( E )-) isomers.

Today, geranylgeraniol is mainly synthesized by a chemical synthesis method (see, for example, JP-A-8-133999). However, according to the chemical synthesis method, the synthesis of geranylgeraniol has a large number of steps and costs more than farnesol and nerolidol, which have shorter carbon chains. In addition, geranylgeraniol synthesized by chemical synthesis generally has the same carbon skeleton, but the double bond is a mixture of ( E ) -type ( trans type) and ( Z ) -type ( cis type). As obtained.

On the other hand, (all- E ) geranylgeraniol is synthesized in the metabolic pathway of organisms and has industrial utility value. In order to obtain (all- E ) geranylgeraniol in a pure form, purification using column chromatography or precision distillation is required. However, precision distillation of geranylgeraniol, which is a thermally unstable allyl alcohol, is difficult. In addition, purification by column chromatography requires a large amount of solvent packing material, and each fraction eluted in sequence must be collected while being analyzed, and the solvent must be removed. Not suitable for industrial implementation. Therefore, a method for synthesizing (all- E ) geranylgeraniol is desired.

The production control of ( E )-and ( Z ) -geometric isomers is attractive because it is completely carried out in a biosynthetic method using an enzyme as a reaction catalyst. Conventional attempts to improve the productivity of isoprenoids using biochemical reactions include enhancing the activity of enzymes that catalyze the above-described metabolic pathway reactions, or modifying the specificity of the enzymes by introducing mutations. Has been taken. For example, the modification of the specificity of prenyl diphosphate synthase can be mentioned. Prenyl diphosphate synthase catalyzes a synthesis reaction from homoallylic diphosphate substrate and allylic diphosphate substrate to prenyl diphosphate in a reaction pathway downstream of the above-described mevalonate pathway or MEP pathway. A conserved region called aspartate-rich domain I exists in the amino acid sequence of prenyl diphosphate synthase. It has been known that the reaction product chain length is controlled by modification of amino acid residues located 5 to 8 residues upstream from the aspartate residue on the N-terminal side of this aspartate-rich domain I (non-patented). Reference 1). In Patent Documents 1 and 2, the amino acid sequence of farnesyl diphosphate synthase, which is one of the prenyl diphosphate synthases, is located 5 residues upstream from the aspartate residue on the N-terminal side of the aspartate-rich domain I. A geranylgeraniol production system based on a technique for culturing cells into which a DNA encoding a polypeptide in which an amino acid residue has been substituted is introduced is disclosed.

  In the above production system, prenyl diphosphate (farnesyl diphosphate), which is an intermediate metabolite of sterol, is obtained by using a mutant cell in which the ability to synthesize sterol essential for growth (deficient in the squalene synthase gene) is used. To accumulate prenyl alcohol. Therefore, as a result of using cells lacking the ability to synthesize sterol, it is necessary to always add a sterol such as ergosterol or cholesterol during culture, which is costly and impractical. In the past, no system has been established that satisfies both sterol requirement and prenyl alcohol production capable of producing geranylgeraniol without adding a special compound such as sterol in addition to general nutrients necessary for growth.

Special Table 2002-519397 Special Table 2002-519049 Ohnuma et al., J Biol Chem., 271, 30748-30754 (1996)

  Thus, the present invention, for example, partially modifies the farnesyl diphosphate synthase gene, converts it into a gene encoding a polypeptide having geranylgeranyl diphosphate synthase activity, and cells containing this gene are treated with sterol. It aims at providing the manufacturing method of geranylgeraniol by culture | cultivating in the culture medium which does not add.

  As a result of intensive research to solve the above problems, the third phenylalanine from the N-terminal side in the amino acid sequence shown in SEQ ID NO: 1 is substituted with another amino acid, preferably serine, glycine or alanine, particularly preferably serine. The present invention was completed by finding that a cell containing a DNA containing the encoded amino acid sequence and having a DNA encoding a polypeptide having geranylgeranyl diphosphate synthase activity produces geranylgeraniol. In particular, geranylgeraniol was remarkably produced when a HMG-CoA reductase gene high expression strain was used for the cells.

That is, the present invention includes the following.
(1) A polypeptide comprising an amino acid sequence in which the third phenylalanine from the N-terminal side is substituted with another amino acid in the amino acid sequence shown in SEQ ID NO: 1 and having geranylgeranyl diphosphate synthase activity DNA.
(2) The DNA according to (1), wherein the third phenylalanine is substituted with serine, glycine or alanine.
(3) The DNA according to (1), wherein the third phenylalanine is substituted with serine.
(4) A polypeptide having an amino acid sequence in which the third phenylalanine from the N-terminal side in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid and having geranylgeranyl diphosphate synthase activity.
(5) The polypeptide according to (4), wherein the third phenylalanine is substituted with serine, glycine or alanine.
(6) The polypeptide according to (4), wherein the third phenylalanine is substituted with serine.
(7) DNA encoding the following polypeptide (a) or (b).
(a) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2
(b) The amino acid sequence represented by SEQ ID NO: 2 consists of an amino acid sequence in which one or several amino acids except the 96th amino acid are deleted, substituted, or added, and has geranylgeranyl diphosphate synthase activity Polypeptide.
(8) The DNA according to (7), wherein the 96th amino acid is serine, glycine or alanine.
(9) The DNA according to (7), wherein the 96th amino acid is serine.
(10) The following polypeptide (a) or (b):
(a) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2
(b) The amino acid sequence represented by SEQ ID NO: 2 consists of an amino acid sequence in which one or several amino acids except the 96th amino acid are deleted, substituted, or added, and has geranylgeranyl diphosphate synthase activity Polypeptide.
(11) The polypeptide according to (10), wherein the 96th amino acid is serine, glycine or alanine.
(12) The polypeptide according to (10), wherein the 96th amino acid is serine.
(13) A DNA construct comprising the DNA according to any one of (1) to (3) and (7) to (9).
(14) A cell retaining the DNA construct according to (13).
(15) The cell according to (14), wherein the host cell is a sterol non-requiring strain.
(16) The cell according to (15), wherein the sterol is cholesterol or ergosterol.
(17) The cell according to (14), wherein the host cell is a strain that highly expresses HMG-CoA reductase.
(18) The cell according to (14), wherein the endogenous farnesyl diphosphate synthase gene is replaced by the DNA construct.
(19) A method for producing geranylgeraniol, wherein the cell according to any one of (14) to (18) is cultured, and geranylgeraniol is recovered from the culture.
(20) The method for producing geranylgeraniol according to (19), wherein the recovery is performed by directly extracting the culture with an organic solvent without disrupting the cells.
(21) The method for producing geranylgeraniol according to (20), wherein the organic solvent is pentane.
(22) The method for producing geranylgeraniol according to (19), wherein the geranylgeraniol is (all- E ) geranylgeraniol.

  In the method for producing geranylgeraniol according to the present invention, geranylgeraniol can be produced in cells, and geranylgeraniol useful in various fields can be produced with excellent productivity.

Hereinafter, the present invention will be described in detail.
The DNA according to the present invention comprises an amino acid sequence in which the third phenylalanine from the N-terminal side is substituted with another amino acid in the amino acid sequence shown in SEQ ID NO: 1 (Ala Tyr Phe Leu Val Ala Asp Asp Met Met Asp). And a DNA encoding a polypeptide having geranylgeranyl diphosphate synthase activity. In the amino acid sequence shown in SEQ ID NO: 1 (Ala Tyr Phe Leu Val Ala Asp Asp Met Met Asp), “Asp Asp Met Met Asp” is called aspartic acid-rich domain I and is the amino acid sequence of prenyl diphosphate synthase. (Chen et al ., “Isoprenyl diphosphte synthases”, Protein Science, 3 , 600-607 (1994)). The function of the domain is expected to be a site that binds to the substrate or reaction product via magnesium ions. The amino acid sequence described in SEQ ID NO: 1 is an amino acid sequence including the aspartic acid-rich domain I and the N-terminal side of the aspartic acid residue to 6 residues upstream.

  Here, “other amino acids” means other than phenylalanine, threonine, histidine, valine, tryptophan, leucine, lysine, isoleucine, methionine, arginine, aspartic acid, glutamine, cysteine, proline, tyrosine, glycine, serine, asparagine, alanine , Glutamic acid. Among these, “other amino acids” are preferably serine, glycine or alanine, and most preferably serine. In the following description, “another amino acid” means the amino acid described above.

Examples of the polypeptide having the amino acid sequence set forth in SEQ ID NO: 1 include a farnesyl diphosphate synthase (hereinafter referred to as “SceFPS”) of budding yeast Saccharomyces cerevisiae (hereinafter referred to as “ S. cerevisiae ”). Call). Besides SceFPS also as a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1, farnesyl diphosphate synthase of Kluyveromyceslactis a yeast of the genus Kluyveromyces (swissprot: locus FPPS_KLULA, accession No.P49349 ) can be exemplified.

  The nucleotide sequence encoding SceFPS and the amino acid sequence of SceFPS are shown in SEQ ID NOs: 3 and 4, respectively. In the amino acid sequence of SEQ ID NO: 4, the amino acid sequence of SEQ ID NO: 1 corresponds to the 94th to 104th residues.

  SceFPS inherently has farnesyl diphosphate synthesizing activity, but by replacing the 96th phenylalanine with another amino acid, preferably serine, glycine or alanine, particularly preferably serine, further geranylgeranyl diphosphate synthase activity is obtained. It will also have.

Since the ERG20 gene encoding SceFPS has a lethal deletion strain, farnesyl diphosphate synthase activity is considered essential for growth. Therefore, a polypeptide obtained by substituting the 96th phenylalanine of SceFPS with another amino acid, preferably serine, glycine or alanine, particularly preferably serine, retains farnesyl diphosphate synthase activity that is essential for growth, while maintaining a culture product. It is expected to have an activity capable of supplying a sufficient amount of geranylgeranyl diphosphate for production of geranylgeraniol. In addition to SceFPS, in the protein having the amino acid sequence described in SEQ ID NO: 1, the third phenylalanine from the N-terminal side in the amino acid sequence described in SEQ ID NO: 1 is replaced with another amino acid, preferably serine or glycine. Alternatively, by substituting with alanine, particularly preferably serine, it also has geranylgeranyl diphosphate synthase activity.

Here, “geranylgeranyl diphosphate synthase activity” means to synthesize (all- E ) geranylgeranyl diphosphate by catalyzing the condensation reaction of isopentenyl diphosphate and allylic diphosphate. . Examples of the method for measuring geranylgeranyl diphosphate synthase activity include a tracer method, a thin layer chromatography method and a phosphate measurement method using an RI substrate (Ohto et al . Plant Mol. Biol., 40 , 307-321 ( 1999); Nishino etal . US Pat. No. 5,773,273 (1998)).

  The amino acid sequence obtained by substituting the 96th phenylalanine with another amino acid in the amino acid sequence of SceFPS (SEQ ID NO: 4) is shown in SEQ ID NO: 2. Therefore, in SEQ ID NO: 2, the 96th amino acid (Xaa) represents an amino acid other than phenylalanine. The other amino acid is preferably serine, glycine or alanine, particularly preferably serine. That is, as an example of the DNA according to the present invention, DNA encoding a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2 can be mentioned.

  The DNA according to the present invention comprises an amino acid sequence in which one or several amino acids except the 96th amino acid are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2, and geranylgeranyl Also included is a DNA encoding a polypeptide having phosphate synthase activity.

The one or several amino acids are preferably amino acids in the region excluding the 94th to 104th amino acids in the amino acid sequence represented by SEQ ID NO: 2.
Here, several amino acids mean 2 to 20 amino acids, preferably 2 to 10 amino acids, more preferably 2 to 5 amino acids.

On the other hand, the base sequence encoding SceFPS described in SEQ ID NO: 3 can be isolated from S. cerevisiae according to a conventional method. That is, by preparing a genomic library or cDNA library derived from S. cerevisiae and hybridizing from the genomic library or cDNA library with a DNA fragment comprising a part of the nucleotide sequence of SEQ ID NO: 3 as a probe, SceFPS DNA encoding can be isolated. Alternatively, DNA encoding SceFPS more simply by PCR techniques such as S. cerevisiae colony PCR, genomic PCR, and RT-PCR using the sequences of appropriate lengths at both ends of the nucleotide sequence of SEQ ID NO: 3 as primer DNA Can be isolated.

  After obtaining the base sequence encoding SceFPS, the third phenylalanine from the N-terminal side in the amino acid sequence shown in SEQ ID NO: 1 is substituted with another amino acid, preferably serine, glycine or alanine, particularly preferably serine. Thus, that is, for example, the DNA according to the present invention can be obtained by introducing mutations so that the amino acid sequence represented by SEQ ID NO: 2 is obtained. As a method for introducing a mutation to obtain DNA according to the present invention, the third phenylalanine from the N-terminal side in the amino acid sequence shown in SEQ ID NO: 1 is another amino acid, preferably serine, glycine or alanine, particularly preferably Is not particularly limited as long as it is substituted with serine, but Kunel method, Eckstein method, kit based on site-directed mutagenesis (for example, Altered Site II in vitro mutagenesis Systems (Promega)) or PCR is used. And a kit for performing mutation introduction (for example, LA PCR in vitro Mutagenesis Kit (manufactured by Takara Bio Inc.)). In addition, it encodes a polypeptide comprising an amino acid sequence in which the third phenylalanine from the N-terminal side in the amino acid sequence shown in SEQ ID NO: 1 is substituted with another amino acid, preferably serine, glycine or alanine, particularly preferably serine It is also possible to design an arbitrary base sequence and chemically synthesize DNA according to the sequence. Alternatively, it encodes a polypeptide comprising an amino acid sequence in which the third phenylalanine from the N-terminal side in the amino acid sequence shown in SEQ ID NO: 1 is substituted with another amino acid, preferably serine, glycine or alanine, particularly preferably serine It is also possible to obtain a sufficient length of DNA according to the present invention by chemically synthesizing a part of an arbitrary base sequence to be well-known by well-known experimental methods of biochemical and molecular biology such as DNA ligase method. It is.

The polypeptide according to the present invention is a geranylgeranyl diphosphate synthase having an activity suitable for production of geranylgeraniol encoded by the DNA according to the present invention. For example, by transforming Escherichia coli (hereinafter referred to as " E. coli ") with the DNA according to the present invention, and extracting the polypeptide synthesized in E. coli , the polypeptide according to the present invention Can be obtained.

  Furthermore, the DNA construct according to the present invention is a DNA construct having the DNA according to the present invention. Here, the DNA construct refers to, for example, a DNA fragment that can be used in a gene introduction method using homologous recombination of eukaryotes (hereinafter referred to as `` DNA fragment according to the present invention '') and a recombinant vector ( Hereinafter, it is referred to as “recombinant vector according to the present invention”). Examples of the DNA fragment according to the present invention include, for example, a PCR product having the DNA according to the present invention amplified by PCR using the DNA template according to the present invention and a DNA having the DNA according to the present invention prepared by chemical synthesis. Is mentioned. It should be noted that the DNA fragment according to the present invention is a DNA fragment that does not have a function capable of autonomous replication in a host, but can be autonomously replicated in host cell DNA, such as genomic DNA, plasmid DNA, or organelle DNA. Any fragment can be used. The DNA fragment according to the present invention can also be obtained by linking or inserting a transcription promoter and a transcription terminator into the DNA according to the present invention.

  On the other hand, the recombinant vector according to the present invention can be obtained by inserting the DNA according to the present invention into an appropriate vector. The vector for inserting the DNA according to the present invention is not particularly limited as long as it can be introduced into the host, and includes any vector that is not replicable or replicable in the host. For example, as a vector for inserting the DNA according to the present invention, the vector itself does not have replication ability in the host, and includes DNA used for genomic DNA insertion purposes, such as pRS404 for yeast genome insertion and transposon sequences. A vector etc. are mentioned. In addition, examples of the vector for inserting the DNA according to the present invention include vectors capable of autonomous replication in a host, such as plasmid vectors, shuttle vectors, and virus vectors (phage vectors).

Examples of plasmid vectors include plasmids derived from E. coli (for example, pET systems such as pET30b, pBR systems such as pBR322 and pBR325, pUC systems such as pUC118, pUC119, pUC18 and pUC19, pBluescript, etc.), plasmids derived from Bacillus subtilis (for example, pUB110, pTP5, etc.), yeast-derived plasmids (eg, YEp systems such as YEp13 and pYES2, YCp systems such as YCp50 and pRS414, etc.) and the like. Examples of the phage vector include λ phage (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP, etc.). Furthermore, animal viruses such as retrovirus or vaccinia virus, plant viruses such as cauliflower mosaic virus, or insect virus vectors such as baculovirus can be used.

  The recombinant vector according to the present invention is preferably composed of a transcription promoter, a ribosome binding sequence, a transcription terminator, and the DNA according to the present invention. Moreover, the gene which controls a promoter may be contained.

The transcription promoter that can be included in the DNA construct according to the present invention includes, for example, a constitutive expression promoter or an inducible expression promoter. Here, the constitutive expression promoter means a transcription promoter of a gene involved in the main metabolic pathway, and is a promoter having transcription activity under any growth condition. On the other hand, the inducible expression type promoter means a promoter that has transcriptional activity under specific growth conditions and can be suppressed under other growth conditions. Any transcription promoter that can be included in the DNA construct according to the present invention may be used as long as it has activity in the host cell into which the DNA construct according to the present invention is introduced. For example, when the host cell is yeast, the GAL1 promoter, GAL10 promoter, TDH3 (GAP) promoter, ADH1 promoter, TEF2 promoter and the like can be used. When the host cell is E. coli , promoters such as trp , lac , trc , tac can be used.

The transcription terminator that can be included in the DNA construct according to the present invention may be any transcription terminator derived from any gene as long as it has activity in the host cell into which the DNA construct according to the present invention is introduced. Good. For example, when the host cell is yeast, ADH1 terminator, CYC1 terminator and the like can be used. When the host cell is E. coli , rrnB terminator can be used.

Furthermore, the DNA construct according to the present invention can contain a cis element such as an enhancer, a splicing signal, a poly A addition signal, a selection marker, and the like, if desired. Selectable markers include marker genes such as URA3 , LEU2 , TRP1 , and HIS3, which are indexed by auxotrophic phenotypes, and antibiotics such as Amp ^r , Tet ^r , Cm ^r , Km ^r , and AUR1- C Resistance genes.

  In addition, when the host cell is a bacterium, the DNA construct according to the present invention has an SD sequence (5′-AGGAGG-3 ′) upstream of the start codon as a ribosome binding site for efficient translation for gene expression. (Represented) can also be incorporated.

  In order to insert the DNA according to the present invention into a vector, a method is used in which the DNA according to the present invention is first cleaved with an appropriate restriction enzyme and then inserted into a restriction enzyme site of an appropriate vector DNA and ligated to the vector.

  The cell according to the present invention is a cell that retains the DNA construct according to the present invention. It can be obtained by introducing the DNA construct according to the present invention into a host cell. The host cell is not particularly limited as long as it can express the polypeptide encoded by the DNA according to the present invention. Fungi including unicellular eukaryotic microorganisms such as yeast, prokaryotes (bacteria and archaea), animals Examples include cells, insect cells, plant cells and the like.

Examples of the fungi include deformed fungi ( Myxomycota ), algae fungi ( Phycomycetes ), ascomycetes ( Ascomycota ), basidiomycetes ( Basidiomycota ), and incomplete fungi ( Fungi Imperfecti ). As fungi, yeasts important for industrial use are well known. Accordingly, as host cells, for example, ascomycetous yeast of ascomycetes, basidiomycetous yeasts of basidiomycetes or incomplete fungal yeasts of incomplete fungi can be used. More specifically, Ascomycetes yeast, in particular, S. cerevisiae, Kuru Vero Streptomyces lactis (Kluyveromyces lactis), Candida Yu Tirith (Candida utilis) or Pichia pastoris (Pichia pastoris) budding such as yeast, shea Examples include fission yeast such as Shizosaccharomyces pombe . The strain of yeast is not particularly limited as long as prenyl alcohol can be produced. In the case of S. cerevisiae , for example, A451, YPH499, YPH500, W303-1A, W303-1B, ATCC28382 and the like can be mentioned.

Examples of bacteria include Escherichia such as Escherichia coli , Bacillus such as Bacillus subtilis , Pseudomonas such as Pseudomonas putida , Agrobacterium tumefaciens and Agrobacterium tumefaciens. Agrobacterium genus such as Agrobacterium rhizogenes , Corynebacterium genus such as Corynebacerium glutamicum , Lactobacillus plantarum ( Lactobacillus plantarum ) and Lactobacillus genus Actinomyces ) And Actinomycetes such as Storeptomyces.

Examples of archaea include methane-producing bacteria such as Metanobacterium , halophilic bacteria such as Halobacterium , and thermoacidophilic bacteria such as Sulfolobus .

In order to obtain the cells according to the present invention, any of the above host cells can be used. Among them, yeast, especially budding yeast, particularly S. cerevisiae is preferred. Furthermore, as a host cell, a sterol non-requiring strain is preferable. Examples of sterol non-requiring strains include cholesterol or ergosterol non-requiring strains. For example, S. cerevisiae non-sterol-requiring strains include recombination host strains such as YPH499, YPH500, YPH501, A451, W303-1A, and W303-1B. Examples of the sterol non-requiring strain include wild-type yeast sterol non-requiring strains isolated from nature. Further, as the host cell, a strain that highly expresses HMG-CoA reductase is preferable. Particularly preferred are sterol non-requiring and HMG-CoA reductase high expression strains. Here, the HMG-CoA reductase high expression strain means a cell that overexpresses HMG-CoA reductase. For example, a HMG-CoA reductase high expression strain can be obtained by preparing a DNA construct having DNA encoding HMG-CoA reductase in the same manner as the DNA construct according to the present invention and introducing it into cells. Examples of the HMG-CoA reductase high expression strain include pRS504GAP-HMG1 / YPH499 strain, which is a HMG1 gene high expression strain.

  Further, in the cell according to the present invention, the farnesyl diphosphate synthase gene endogenous to the host cell may be replaced by recombination by the DNA construct according to the present invention.

  The method for introducing the DNA construct according to the present invention into a fungus including yeast is not particularly limited as long as it is a method for introducing DNA into a fungus. Examples thereof include an electroporation method, a spheroplast method, and a lithium acetate method. .

  Further, the method for introducing the DNA construct according to the present invention into prokaryotes such as bacteria and archaea is not particularly limited as long as it is a method for introducing DNA into prokaryotes. For example, a method using calcium ions, an electroporation method, etc. Is mentioned.

  When animal cells are used as host cells, monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells, and the like are used. The method for introducing the DNA construct according to the present invention into animal cells is not particularly limited as long as it is a method for introducing DNA into animal cells, and examples thereof include an electroporation method, a calcium phosphate method, and a lipofection method.

  When insect cells are used as hosts, Sf9 cells and the like are used. Examples of the method for introducing the DNA construct according to the present invention into insect cells include a calcium phosphate method, a lipofection method, and an electroporation method.

  When using plant cells as host cells, cells derived from plant organs (e.g. leaves, petals, stems, roots, seeds, etc.), plant tissues (e.g. epidermis, phloem, soft tissue, xylem, vascular bundles, etc.) Originated cells or plant cultured cells are used. Examples of methods for introducing the DNA construct according to the present invention into plant cells include the electroporation method, the Agrobacterium method, the particle gun method, and the PEG method.

  Whether or not the DNA according to the present invention has been introduced into the host cell can be confirmed by PCR, Southern hybridization, Northern hybridization or the like. For example, DNA is prepared from the cell according to the present invention, a specific primer DNA for the DNA according to the present invention is designed, synthesized, and subjected to PCR. Subsequently, the PCR amplification product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis or the like, and stained with ethidium bromide, SYBR Green or the like to confirm that the DNA according to the present invention has been introduced. Moreover, PCR can be performed using primer DNA previously labeled with a fluorescent dye or the like to detect the amplification product. Furthermore, a method may be employed in which the amplification product is bound to a solid phase such as a microplate and the amplification product is confirmed by fluorescence or enzyme reaction.

By introducing the DNA according to the present invention described above into the host cell described above, the cell does not require a special nutrient such as sterol, and a sufficient amount of geranylgeranyl dilin for high production of geranylgeraniol. It is possible to synthesize an acid and as a result produce its dephosphorylated geranylgeraniol, in particular (all- E ) geranylgeraniol. Here, (all- E ) geranylgeraniol means geranylgeraniol which is an all-trans type. As described above, (all- E ) geranylgeraniol has a geometric isomerism synthesized in the metabolic pathway of living organisms, and has high industrial utility value.

In the case of a cell having a mevalonate pathway typified by S. cerevisiae , the upstream portion of the metabolic pathway for synthesizing prenyl alcohol such as geranylgeraniol is synthesized from a carbon source such as glucose or ethanol as shown in FIG. Isopentenyl diphosphate is synthesized via mevalonic acid from acetyl-CoA produced by lipolysis. Further, isopentenyl diphosphate is reversibly isomerized to dimethylallyl diphosphate by isopentenyl diphosphate isomerase. Further, as shown in FIG. 1, geranyl diphosphate, farnesyl diphosphate, and geranyl geranyl diphosphate are sequentially synthesized using isopentenyl diphosphate and dimethylallyl diphosphate as substrates. Furthermore, as shown in FIG. 1, the prenyl alcohols farnesol, nerolidol and geranylgeraniol are synthesized from farnesyl diphosphate and geranylgeranyl diphosphate. On the other hand, squalene is synthesized from farnesyl diphosphate by squalene synthase as shown in FIG. Squalene becomes a precursor material of sterol, and finally becomes ergosterol.

  In the above metabolic pathway, the action of the polypeptide according to the present invention having geranylgeranyl diphosphate synthase activity causes a condensation reaction between isopentenyl diphosphate and farnesyl diphosphate to synthesize geranylgeranyl diphosphate and release it. The phosphorous oxide geranylgeraniol will be produced.

In addition, in FIG. 1 and the following description, each compound may be abbreviated as follows.
Isopentenyl diphosphate (IPP)
Dimethylallyl diphosphate (DMAPP)
Geranyl diphosphate (GPP)
Farnesyl diphosphate (FPP)
Farnesol (FOH)
Nerolidol (NOH)
Geranylgeranyl diphosphate (GGPP)
Geranylgeraniol (GGOH)

  What is necessary is just to select suitably as a culture medium which culture | cultivates the cell which concerns on this invention according to the kind of cell mentioned above. A medium for culturing cells according to the present invention obtained by using microorganisms including fungi and prokaryotes as host cells contains a carbon source, a nitrogen source, inorganic salts, etc. that can be assimilated by the microorganisms, and efficiently cultures the microorganisms. As long as the medium can be used, either a natural medium or a synthetic medium may be used. Examples of the carbon source include carbohydrates such as glucose, galactose, fructose, sucrose, raffinose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of nitrogen sources include ammonia, ammonium salts of inorganic or organic acids such as ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate, or other nitrogen-containing compounds. Others include peptone, meat extract, corn steep liquor, and various amino acids. Etc. Examples of inorganic salts include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.

  Further, the production efficiency of geranylgeraniol can be further increased by adding terpenoids, fats and oils, surfactants and the like to the medium, and increasing the concentrations of the nitrogen source and the carbon source shown above in the medium. The following can be illustrated as these additives.

Terpenoids: squalene, tocopherol, IPP, DMAPP
Fats and oils: soybean oil, fish oil, almond oil, olive oil Surfactant: Taditol, Triton X-305, Span 85, Adecanol LG-109 (Asahi Denka), Adecanol LG-294 (Asahi Denka), Adecanol LG-295S ( Asahi Denka), Adecanol LG-297 (Asahi Denka), Adecanol B-3009A (Asahi Denka), Adekapronic L-61 (Asahi Denka)

  The terpenoid concentration is 0.01% (w / v) or more, preferably 1 to 3% (w / v), and the fat concentration is 0.01% (w / v) or more, preferably 1 to 3% (w / v). The surfactant concentration is 0.005 to 1% (w / v), preferably 0.05 to 0.5% (w / v).

The culture is usually performed at 26 ° C. to 36 ° C. under aerobic conditions such as shaking culture or aeration and agitation culture. 2-7 days at 30 ° C. in the case of the S. cerevisiae as a host cell, when the E. coli host cell is preferably performed 12 to 18 hours at 37 ° C.. The pH is adjusted using an inorganic or organic acid, an alkaline solution, or the like. Furthermore, the culture may be carried out by adding an antibiotic such as ampicillin, chloramphenicol or aureobasidin A to the medium as necessary.

  In this method, cells into which the DNA construct according to the present invention has been introduced are cultured, and geranylgeraniol can be collected from the resulting culture. “Culture” means not only the culture supernatant but also cultured cells or cultured cells per se or disrupted cells or cells.

  In this method, geranylgeraniol can be produced. In addition, a jar fermenter culture apparatus etc. can also be used in order to culture the cell which concerns on this invention in large quantities. When geranylgeraniol is produced intracellularly after culturing, geranylgeraniol is collected by crushing the cells by performing a homogenizer treatment or the like. Further, regardless of whether geranylgeraniol stays in the cell or is secreted outside the cell, it may be directly extracted with an organic solvent or the like without disrupting the cell. In this case, the organic solvent is an aliphatic hydrocarbon such as pentane, hexane, heptane or octane, an aliphatic alcohol such as isopropanol, butanol, pentyl alcohol or hexyl alcohol, an aromatic hydrocarbon such as benzene, toluene or xylene, chloroform, or four. Chlorine organic compounds such as carbon chloride and trichlorethylene, ether compounds such as diethyl ether and dipropyl ether, ester compounds such as methyl acetate, ethyl acetate, pentyl acetate, amyl acetate and methyl caproate, ketone compounds such as diethyl ketone, and capryl Acids, caproic acid, and other carboxylic acids, petroleum ether, petroleum benzine and other solvent mixtures, and palm oil, soybean oil, rapeseed oil, and other acylglycerol mixtures can be used. Iodine, especially pentane is preferred. When geranylgeraniol is secreted and produced extracellularly, the culture solution is used as it is, or the cells are removed by centrifugation or the like. Thereafter, geranylgeraniol can be collected from the culture by extraction with the above organic solvent, etc., and can be further isolated and purified using various chromatographies and the like as necessary.

  In general, for primary metabolites that are extremely important for growth, including amino acids, attempts have been made to improve the productivity of the product by enhancing or suppressing genes directly involved in the synthesis reaction of the product. ing. However, in secondary metabolites such as geranylgeraniol, even if the synthesis pathway is strengthened or suppressed, the raw material is often consumed for the synthesis of the primary metabolite and it is difficult to improve productivity. It is. That is, even if the geranylgeranyl diphosphate synthase activity is enhanced, the probability that the biosynthesis of geranylgeraniol is enhanced is low. In addition, the farnesyl diphosphate synthase gene can be completely replaced by the well-known wild-type geranylgeranyl diphosphate synthase in an attempt to block the farnesyl diphosphate to sterol synthesis pathway that competes with the geranylgeraniol synthesis pathway. Even so, it can be said that there is an extremely high possibility that the sterol synthesizing ability essential for growth is lost and it becomes lethal.

  However, in the present invention, it was demonstrated that geranylgeraniol can be produced simply by using a general nutrient source by introducing the DNA according to the present invention into a cell.

EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.
[Example 1] Preparation of expression vector
(1-1) E. coli - S. cerevisiae shuttle vector
Plasmid pRS405 was purchased from Stratagene. PYES2 was purchased from Invitrogen (Carlsbad, CA).

(1-2) Genomic DNA
S. cerevisiae genomic DNA was purchased from Takara Bio, a yeast genomic DNA preparation kit “Gentoru-kun”, and genomic DNA was prepared from S. cerevisiae YPH499 according to the attached protocol.

(1-3) Insertion of CYC1 t fragment into pRS vector
The CYC1 transcription terminator CYC1 t fragment was prepared by PCR. PCR was performed using the following combination of PCR oligo DNA: XhoI-Tcyc1FW and ApaI-Tcyc1RV as PCR primer DNA and pYES2 as a template.
XhoI-Tcyc1FW: 5'-TCC ATC TCG AGG GCC GCA TCA TGT AAT TAG -3 '(SEQ ID NO: 5)
ApaI-Tcyc1RV: 5'-CAT TAG GGC CCG GCC GCA AAT TAA AGC CTT CG-3 '(SEQ ID NO: 6)

The reaction was performed with 50 μl of 0.1 μg pYES2, 50 pmol primer DNA, MgSO4 containing 1x Pfu buffer (Promega, Madison, WI), 10 nmol dNTP, 1.5 u Pfu DNA polymerase (Promega) and 1 μl perfect match polymerase enhancer (Stratagene). A reaction solution was prepared, and the reaction was performed at 95 ° C. for 2 minutes, (95 ° C. for 45 seconds, 60 ° C. for 30 seconds, 72 ° C. for 1 minute) × 30 cycles, 72 ° C. for 5 minutes, and 4 ° C. stock reaction conditions. The amplified DNA was cleaved with Xho I and Apa I, and a 260 bp DNA fragment was purified by agarose gel electrophoresis to obtain CYC1t-XA.
CYC1t-XA was inserted into the Xho I- Apa I site of the pRS405 vector to obtain pRS405Tcyc.

(1-4) Preparation of transcription promoter
A DNA fragment containing a transcription promoter was prepared by PCR using S. cerevisiae genomic DNA as a template. The DNA primers used are as follows.
SacI-Ptdh3FW: 5'-CAC GGA GCT CCA GTT CGA GTT TAT CAT TAT CAA-3 '(SEQ ID NO: 7)
SacII-Ptdh3RV: 5'-CTC TCC GCG GTT TGT TTG TTT ATG TGT GTT TAT TC -3 '(SEQ ID NO: 8)

The above SacI-Ptdh3FW and SacII-Ptdh3RV were used as PCR DNA primers for amplification of the TDH3 (GAP) transcription promoter TDH3p (GAPp), and yeast genomic DNA was used as a template. Prepare 100 μl solution containing 0.46 μg yeast genomic DNA, 100 pmol primer DNA, 1x ExTaq buffer (Takara Bio), 20 nmol dNTP, 0.5 u ExTaq DNA polymerase (Takara Bio) and 1 μl perfect match polymerase enhancer. The reaction conditions were 95 ° C. for 2 minutes, (95 ° C. for 45 seconds, 60 ° C. for 1 minute, 72 ° C. for 2 minutes) × 30 cycles, 72 ° C. for 4 minutes, and 4 ° C. stock. The amplified DNA was cleaved with Sac I and Sac II, and a 620 bp DNA fragment was purified by agarose gel electrophoresis to obtain TDH3p .

(1-5) Preparation of 2μ DNA replication initiation region
After cleaving the YEp vector pYES2 with Ssp I and Nhe I, a 1.5 kbp fragment containing 2 μ DNA replication origin (2 μ ori) was purified by agarose gel electrophoresis, blunted with Klenow enzyme, and this DNA fragment was 2 μOriSN.

(1-6) Preparation of YEp type expression vector
2 μOriSN was inserted into the Nae I site where pRS405Tcyc was treated with BAP (bacterial alkaline phosphatase, Takara Bio) and transformed into E. coli SURE2 to prepare plasmid DNA. This was cleaved with Dra III and Eco RI, Hpa I, or Pst I and Pvu II, and then subjected to agarose gel electrophoresis to check the insertion of 2 μori and its orientation. A plasmid in which 2 μori was inserted into the prepared pRS405Tcyc in the same direction as pYES2 was designated as pRS435Tcyc2μOri.

A fragment TDH3 p (GAPp) containing a transcription promoter was inserted into the Sac I- Sac II site of pRS435Tcyc2μOri to clone the DNA. As a result, pRS435GAP was obtained from pRS435Tcyc2μOri.

(1-7) Preparation of vector for multi-copy integration
(1-7-1) The multicopy YIp plasmid targeting rDNA is hereinafter referred to as pRS (Ribosomal DNA Sequence). A multicopy YIp plasmid targeting the δ sequence is called pDI (Delta Integration). The meaning of the three digits following pRS and pDI is as follows.
5XX: Targeting rDNA
6XX: Targets Ty retrotransposon LTR (δ sequence)
X0X: γ integration, sequences derived from E. coli (Ampr, Col E1) are integrated
X1X: γ integration, sequences derived from E. coli (Ampr, Col E1) are not integrated
X2X: Ω integration, sequences from E. coli (Ampr, Col E1) are not integrated
XX4: TRP marker: HMG1
XX5: LEU marker: BTS1 and its fusion and mutant genes
XX6: URA marker: DPP1 and its fusion and mutant genes
XX8: G418 marker: other genes.

  The outline of γ integration and Ω integration is shown in FIG. In γ integration (FIGS. 2A and 2B), since the target gene remains on both sides of the expression cassette, there is a possibility that the gene introduced by recombination of the target genes may be lost. Also, multiple copies may be integrated in tandem at the same site. For these reasons, in the γ integration, about 1% of inserted DNA may be lost per generation. On the other hand, in the Ω integration (Fig. 2C), such a drop-off is unlikely to occur.

A report that the integrated genes become unstable when bacterial sequences are integrated (Lee FW, Da Silva NA. (1997) Appl. Microbiol. Biotechnol., 48 , 339-345; Awane K, Naito A , Araki H, Oshima Y. (1992) Gene, 2 , 121), therefore, it was decided to prepare a plasmid in which the sequence derived from E. coli was not integrated (FIGS. 2B and C).

For example, pRS504 means that the rDNA site is targeted, the sequence derived from E. coli is integrated by γ integration, and the TRP1 marker is used. Moreover, as shown above, each marker was assigned to each gene to be introduced.

The PCR reaction used to prepare the vector for multicopy integration was performed under the following conditions.
KOD plus DNA polymerase (TOYOBO) 0.02 U / μl and accompanying solution (1x KOD plus buffer, 0.2 mM dNTP mix, and 1 mM MgSO4), primer pair (3 pmol / μl each) and template DNA (1 for plasmid) ng / μl and 4 ng / μl in the case of genomic DNA) were mixed to prepare a 20 μl PCR reaction solution. PCR was performed under the conditions of 94 ° C., 2 min- (94 ° C., 15 sec-Tm ° C., 30 sec-68 ° C., X min) × 25 cycles-4 ° C. stock. The annealing temperature Tm (° C.) was the Tm of the primer, and the extension time X (min) at 68 ° C. was 1 min per 1 kb of DNA to be amplified.

The gene manipulation technique used for the preparation of the vector for multicopy integration is shown below.
For cloning of PCR amplification products, the PCR amplification products were introduced into the pCR-Blunt II TOPO vector using Zero Blunt TOPO PCR Cloning Kit (Invitrogen). T4 polynucleotid Kinase (TOYOBO) was used for phosphorylation of PCR primers. For introduction of plasmid DNA into E. coli , Z-Competent E. coli Transformation Kit (ZYMO RESEARCH) was used. QIA Prep Spin Miniprepkit (50) (QIAGEN) was used for extraction of the plasmid from E. coli . The insert was cut out from the vector after restriction enzyme digestion, electrophoresis on a 1% agarose gel, and recovery from the gel using RECOCHIP (Takara Bio) or Zymoclean Gel DNA Recovery Kit (ZYMO RESEARCH). T4 DNA polymerase (Takara Bio) or KOD plus DNA polymerase was used to smooth the restriction enzyme fragment. TsAP (Thermosensitive Alkaline Phosphatase; GIBCO BRL) was used for dephosphorylation of restriction enzyme fragments. For the ligation reaction, LigaFast Rapid DNA Ligation System (Promega) was used. In addition, Gen Toru-kun (Takara Bio) was used for extraction of genomic DNA of yeast.

(1-7-2) Preparation of pRS504
PRS504 was prepared based on the plasmid pRS434GAP (JP 2002-199883 A) having a TRP1 marker. The target rDNA sequence was referred to Nieto et al. (Nieto A, Prieto JA, Sanz P. (1999) Biotechnol. Prog., 15 , 459-66). The PCR primers used are shown below:
AatTRP1-50F: 5'-TTTTCCGACGTC CACGTG AGTATACGTGATTAAG-3 '(SEQ ID NO: 9)
(Underline indicates Aat II recognition site)
TRP1d-R: 5′-AGGCAAGTGCACAAACAATACTT-3 ′ (SEQ ID NO: 10)
R4: 5′-ATGAGAGTAGCAAACGTAAGTCTAA-3 ′ (SEQ ID NO: 11)
K-R7: 5'-TGACT GGTACC TTTCCTCTAATCAGGTTCCACC -3 '(SEQ ID NO: 12)
(Underline indicates Kpn I recognition site)

TRP1 d (0.8 kb) was amplified using AatTRP1-50F and TRP1d-R as PCR primers and pRS434GAP as template DNA. A part of rDNA (1.3 kb: hereinafter referred to as R47) was amplified using R4 and K-R7 as PCR primers and YPH499 genomic DNA as a template. For use in the next ligation reaction, primers TRP1d-R and R4 were previously phosphorylated. Ligation was performed by mixing TRP1 d fragment and R47 fragment purified by agarose gel electrophoresis. Using this ligation reaction solution as a template, PCR was performed using AatTRP1-50F and K-R7 as PCR primers, and a gene in which TRP1 d and R47 were linked (2.0 kb; hereinafter referred to as TR47) was amplified. TR47 was purified by agarose gel electrophoresis and then subcloned into the pCR-Blunt II TOPO vector (hereinafter referred to as TOPO-TR47). TOPO-TR47 was sequenced and it was confirmed that the subcloned TR47 fragment had no PCR mutation. Next, TOPO-TR47 and pRS434GAP were digested using restriction enzymes Aat II and Kpn I to cut out a 3.2 kb fragment containing TR47 fragment and TDH3 p (GAPp), respectively. The plasmid obtained by ligating these two fragments was designated as pRS504 (FIG. 3).

(1-7-3) Preparation of pRS514
PRS514 was prepared based on the plasmid pRS434GAP (JP 2002-199883 A) having the TRP1 marker. The targeted rDNA sequence is the same as pRS504. The PCR primers used are shown below:
KpnTRP1-50dR: 5'-TGACT GGTACC AGGCAAGTGCACAAACAATACTT-3 '(SEQ ID NO: 13)
(Underline indicates Kpn I recognition site)
S-R4: 5'-TATT GAGCTC ATGAGAGTAGCAAACGTAAGTCTAA-3 '(SEQ ID NO: 14)
(Underline indicates Sac I recognition site)
BB-R5: 5'-CAGGT GCGCGC GGTAACC CAGTTCCTCACTA-3 '(SEQ ID NO: 15)
(Underline indicates Bss HII and Bst PI recognition sites)
AB-R6: 5'-GTGAG GACGTC GGTTACC CGGGGCACCTGTCAC-3 '(SEQ ID NO: 16)
(Underline indicates Aat II and Bst PI recognition sites)
A-R7: 5′-CACTC GACGTC TTTCCTCTAATCAGGTTCCACC -3 ′ (SEQ ID NO: 17)
(Underline indicates Aat II recognition site)

TRP1 d marker DNA (0.8 kb; hereinafter referred to as AK-TRP1d) was amplified using AatTRP1-50F and KpnTRP1-50dR as PCR primers and pRS434GAP as template DNA. A part of rDNA (0.6 kb: hereinafter referred to as SBB-R45) was amplified using S-R4 and BB-R5 as PCR primers and YPH499 genomic DNA as a template. A part of rDNA (0.7 kb: hereinafter referred to as ABA-R67) was amplified using AB-R6 and A-R7 as PCR primers and YPH499 genomic DNA as a template. The amplified AK-TRP1d, SBB-R45 and ABA-R67 fragments were then subcloned into the pCR-Blunt II TOPO vector (referred to as TOPO-AKTRP1d, TOPO-SBBR45, and TOPO-ABAR67, respectively), followed by sequencing and PCR Confirmed that there were no errors. Next, TOPO-AKTRP1d and pRS434GAP were digested using restriction enzymes Aat II and Kpn I to cut out 3.2 kb fragments containing AK-TRP1d fragment and TDH3 p, respectively. The plasmid obtained by ligating these two fragments is called pTRP. TOPO-SBBR45 was digested with restriction enzymes Sac I and Bss HII, and the SBB-R45 fragment was excised. The plasmid obtained by ligating the SBB-R45 fragment to the Sac I- Bss HII site of pTRP is called pTRP-R45. TOPO-ABAR67 was digested with the restriction enzyme Aat II to excise the ABA-R67 fragment. The ABA-R67 fragment was ligated to the Aat II site of pTRP-R45, and a plasmid having the ABA-R67 fragment inserted in the direction shown in FIG. 3 was selected as pRS514.

(1-7-4) Preparation of pRS524
PRS514 was constructed based on the plasmid pRS434GAP having the TRP1 marker. The targeted rDNA sequence is the same as pRS504. The PCR primers used are shown below:
AF-R4: 5'- GCCGC GACGTC GGCCGGCC ATGAGAGTAGCAAACGTAAGTCTAA -3 '(SEQ ID NO: 18)
(Underline indicates Aat II and Fse I recognition sites)
A-R5 :: 5'- ACAGG GACGTC GGGTAACCCAGTTCCTCACT -3 '(SEQ ID NO: 19)
(Underline indicates Aat II recognition site)
S-R6 :: 5'-CTGGG GAGCTC GGGGCACCTGTCACTTTG-3 '(SEQ ID NO: 20)
(Underline indicates Sac I recognition site)
BF-R7 :: 5'- CCAAA GCGCGC GGCCGGCC TTTCACGGAATGGTACGTTTGAT -3 '(SEQ ID NO: 21)
(Underline indicates Bss HI and Fse I recognition sites)

A part of rDNA (0.6 kb: hereinafter referred to as AFA-R45) was amplified using AF-R4 and A-R5 as PCR primers and YPH499 genomic DNA as a template. A part of rDNA (0.7 kb: hereinafter referred to as SBF-R67) was amplified using S-R6 and BF-R7 as PCR primers and YPH499 genomic DNA as a template. Next, the amplified AFA-R45 and SBF-R67 fragments were subcloned into the pCR-Blunt II TOPO vector (referred to as TOPO-AFAR45 and TOPO-SBFR67, respectively) and sequenced to confirm that there were no PCR errors. TOPO-SBFR67 was digested with restriction enzymes Sac I and Bss HII, and the SBF-R67 fragment was excised. The plasmid obtained by ligating the SBF-R67 fragment to the Sac I- Bss HII site of pTRP is called pTRP-R67. TOPO-AFAR45 was digested with the restriction enzyme Aat II, and the AFA-R45 fragment was excised. The AFA-R45 fragment was ligated to the Aat II site of pTRP-R67, and a plasmid having the AFA-R45 fragment inserted in the direction shown in FIG. 3 was selected as pRS524.

(1-7-5) Preparation of pRS515
pRS515 was prepared by replacing the marker gene TRP1 d of pRS514 with LEU2 d. LEU2 d was designed so that the length of the LEU2 promoter was 29 bp with reference to Erhart et al. Report (Erhart E, Hollenberg CP. (1983) J. Bacteriol., 156 , 625-635). The PCR primers used are shown below.
Pma-LEU2d-F: 5'- CACGTG TCGACTACGTCGTAAGGCCGTTT-3 '(SEQ ID NO: 22)
(Underline indicates Pma CI recognition site)
Kpn-LEU2d-R: 5'- GGTACC AAGGATATACCATTCTAATGTCTGCCCC -3 '(SEQ ID NO: 23)
(Underline indicates Kpn I recognition site)

LEU2 d marker DNA (1.6 kb; hereinafter referred to as PK-LEU2d) was amplified using Pma-LEU2d-F and Kpn-LEU2d-R as PCR primers and pRS435GAP as template DNA. The amplified PK-LEU2d fragment was subcloned into the pCR-Blunt II TOPO vector (hereinafter referred to as TOPO-PKLEU2d) and sequenced to confirm that there were no PCR errors. Restriction enzyme Pma with CI and Kpn I digested the TOPO-PKLEU2d, was the planned cutting out the PKLEU2d fragment, because it was found that the LEU2d internally Kpn I is cleaved, in place of the Kpn I pCR Blunt II TOPO restriction enzyme site Xho I was used. TOPO-PKLEU2d was digested with restriction enzymes Pma CI and Xho I, and the PK-LEU2d fragment was excised by agarose gel electrophoresis. The Kpn I site of this fragment was smoothed using T4 DNA polymerase. Next, a fragment obtained by digesting pRS514 using restriction enzymes Pma CI and Kpn I to remove the marker gene TRP1 d was purified by agarose gel electrophoresis, and the Kpn I site was smoothed using KOD plus DNA polymerase. This fragment was ligated PK-LEU2d (Kpn I site obtained by smoothing), it was pRS515 was selected plasmids direction LEU2 d fragment shown is inserted in FIG. As a result of sequencing around the Kpn I site of pRS515, a 42 base pCR-Blunt II TOPO vector-derived sequence (underlined portion) was inserted as shown below.
5'-1601-GGTACC AAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTC -1648 -3 '(SEQ ID NO: 24)

(1-7-6) Preparation of pRS525
pRS525 was prepared by replacing the marker gene TRP1 d of pRS524 with LEU2 d. The LEU2 d fragment was prepared by digesting TOPO-PKLEU2d using restriction enzymes Pma CI and Xho I and then smoothing the Kpn I site using T4 DNA polymerase, as in the above-mentioned “production of pRS515”. Next, a fragment obtained by digesting pRS524 using restriction enzymes Pma CI and Kpn I to remove the marker gene TRP1 d was purified by agarose gel electrophoresis, and the Kpn I site was smoothed using KOD plus DNA polymerase. This fragment was ligated PK-LEU2d (Kpn I site obtained by smoothing), it was pRS525 was selected plasmids direction LEU2 d fragment shown is inserted in FIG. When sequencing was performed around the Kpn I site of pRS525, a 42 base pCR-Blunt II TOPO vector-derived sequence (underlined portion) was inserted as shown below.
5'- 1601- GGTACC AAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTC -1648 -3 '(SEQ ID NO: 24)

(1-7-7) Preparation of pDI626
PDI626 was prepared based on the plasmid pRS436GAP (JP 2002-199883 A) having the URA3 marker. The targeted δ sequence is the LTR sequence part (338 base; 117,702 to 118,039) of YOLWTy1-1 (chromosome XV, from coordinates 117,702 to 123,627). As will be described later, the markers by removing the Aat II- Sse 8387 I site PRS436GAP, a URA3 d which promoter was cut to a length of 23 base. The PCR primers used are shown below:
T7-F: 5'- GCGTAATACGACTCACTATAGGG-3 '(SEQ ID NO: 25)
2 μm-R: 5′-CCTGATGCGGTATTTTCTCCTTAC -3 ′ (SEQ ID NO: 26)
Aat-TY1F: 5'- GACGTC TGTTGGAATAAAAATCCACTATCG-3 '(SEQ ID NO: 27)
(Underline indicates Aat II recognition site)
Sse-TY2R: 5'- CCTGCAGG ATTCCGTTTTATATGTTTATATTCATTG-3 '(SEQ ID NO: 28)
(Underline indicates Sse 8387I recognition site)
SacI-TY3F: 5'- GAGCTC GAGGAATAATCGTAATATTAGTATGTA-3 '(SEQ ID NO: 29)
(Underline indicates Sac I recognition site)
Bss-TY4R: 5'- GCGCGC TGAGAAATTTGTGGGTAATTAGATAAT-3 '(SEQ ID NO: 30)
(Underline indicates Bss HII recognition site)

Inverse PCR was performed using T7-F phosphorylated with T4 polynucleotid Kinase and 2 μm-R as PCR primers and pRS436GAP as template DNA to amplify a 4.7 kb DNA fragment. After the obtained fragment was self-ligated, the methylated template DNA (pRS436GAP) was digested and removed with the restriction enzyme DpnI . In this way, a plasmid from which 2 μm ori was removed from pRS436GAP (hereinafter referred to as pRS436-2 μm) was prepared.

On the other hand, a part of the δ sequence (180 b; hereinafter referred to as T12) was amplified using Aat-TY1F and Sse-TY2R as PCR primers and YPH499 genomic DNA as a template. A part of the δ sequence (158 b; hereinafter referred to as T34) was amplified using SacI-TY3F and Bss-TY4R as PCR primers and YPH499 genomic DNA as a template. The amplified T12 and T34 fragments were then subcloned into pCR-Blunt II TOPO vectors (referred to as TOPO-T12 and TOPO-T34, respectively) and sequenced to confirm that there were no PCR errors. TOPO-T12 was digested with restriction enzymes Aat II and Sse 8387I to excise the T12 fragment. The plasmid obtained by ligating the T12 fragment to the ARS II- Sse 8387I site of pRS436-2 μm is hereinafter referred to as pDIT12. Next, TOPO-T34 was digested with restriction enzymes Sac I and Bss HII, and the T34 fragment was excised. The plasmid obtained by ligating the T34 fragment to the Sac I- Bss HII site of pDIT12 was designated as pDI626 (FIG. 5).

(1-7-8) Preparation of pDI628
pDI628 was prepared by replacing the URA3 d marker of pDI626 with a G418 resistance marker (Tn903-derived gene APT1 , 1696 bp). was digested with restriction enzymes Sse 8387I and Kpn I to pDI626, fragments that do not contain URA3 d a (3.6 kb) were purified by agarose gel electrophoresis. Both ends of this fragment were blunted using T4 DNA polymerase, dephosphorylated using TsAP, and then the plasmid obtained by ligating G418 resistance marker DNA was designated as pDI628 (FIG. 5).

[Example 2] Cloning of HMG-CoA reductase gene
(2-1) Cloning of HMG-CoA reductase gene
Cloning of the S. cerevisiae HMG-CoA reductase gene HMG1 was performed as follows.
Based on the information of S. cerevisiae- derived HMG-CoA reductase gene HMG1 (ANM22002) (ME Basson, et al., Mol. Cell. Biol. 8, 3797-3808 (1988)) registered in GenBank Primers that match the N-terminus and C-terminus of were prepared:
N-terminal primer: 5'-atg ccg ccg cta ttc aag gga ct -3 '(SEQ ID NO: 31)
C-terminal primer: 5'-tta gga ttt aat gca ggt gac gg -3 '(SEQ ID NO: 32)

Using these primers, PCR was performed using a yeast cDNA library (Clontech) as a template.
PCR was performed using Perfect Match polymerase enhancer for 30 cycles of denaturation at 94 ° C for 45 seconds, annealing at 55 ° C for 1 minute, and extension at 72 ° C for 2 minutes.

After completion of PCR, the target fragment (3.2 kbp) was confirmed, so HMG1 was cloned into a pT7Blue T vector capable of TA cloning (this was designated as pT7-HMG1), and the base sequence of HMG1 was determined. As a result, the nucleotide sequence of SEQ ID NO: 33 and the amino acid sequence of SEQ ID NO: 34 were confirmed. The determined base sequence is partially different from the base sequence shown in the sequence registered in GenBank, and PCR errors (C203T, T426C, T1026C, A1167G, T1248C, G1557A, A1605G, T1820C, A2451G, A2726G, T2787C, G2940A). Here, the base substitution mutation notation refers to the one-letter code of the base before substitution, the position of the base to be substituted (number when the A of the start codon ATG is No. 1), and the one-letter code of the base after substitution. Represented by For example, C203T represents a mutation in which the 203rd base C is replaced with T from the start codon. The mutant HMG-CoA reductase gene containing this PCR error is designated as HMG1 ′.

(2-2) Correction of PCR error in HMG-CoA reductase gene
Of the 12 PCR errors shown in (2-1), there were 3 mutations (C203T, T1820C, A2451G) in which the amino acid encoded by the DNA was changed, and the others were nonsense mutations. Therefore, the HMG1 ′ gene fragment was subcloned from pT7HMG1, and the C203T, T1820C, and A2451G mutation portions due to PCR errors in the HMG1 portion were corrected.

Subclone HMG1 'gene fragment from pT7HMG1 having HMG1 ' which is PCR error type DNA of HMG-CoA reductase gene HMG1 , and correct amino acid substitution mutation part due to PCR error of HMG1 part by site-directed mutagenesis method, pALHMG106 was produced. The details of the manufacturing method were as follows.

Plasmid pT7HMG1 was used as cloned HMG1 ′ . In addition, pALTER-1 was purchased as a site-directed mutagenesis vector (Promega).

Site-directed mutagenesis was performed by the method described in “Protocols and application guide, third edition, 1996 Promega, ISBN 1-882274-57-1” published by Promega. The following three types of mutagenesis oligos were chemically synthesized:
HMG1 (190-216): 5'-CCAAATAAAGACTCCAACACTCTATTT-3 '(SEQ ID NO: 35)
HMG1 (1807-1833): 5'-GAATTAGAAGCATTATTAAGTAGTGGA-3 '(SEQ ID NO: 36)
HMG1 (2713-2739): 5'-GGATTTAACGCACATGCAGCTAATTTA-3 '(SEQ ID NO: 37)

For site-directed mutagenesis, pT7HMG1 was cleaved with Sma I, Apa LI and Sal I, and a 3.2 kbp HMG1 ′ fragment was prepared by agarose gel electrophoresis. This was inserted into the Sma I- Sal I site of pALTER-1 to prepare pALHMG1. After pALHMG1 is denatured with alkali, the above mutation-introducing oligo, repair oligo (Amp repair oligo (Promega)) and knockout oligo (Tet knockout oligo (Promega)) are annealed and introduced into E. coli ES1301 (Promega), and then 125 μg / ml ampicillin. The transformant carrying the plasmid introduced with the site-specific mutation was accumulated and cultured to prepare plasmid DNA. The base sequence was then checked using primers having the following sequences:
HMG1 (558-532): 5'-GTCTGCTTGGGTTACATTTTCTGAAAA-3 '(SEQ ID NO: 38)
HMG1 (1573-1599): 5'-CATACCAGTTATACTGCAGACCAATTG-3 '(SEQ ID NO: 39)
HMG1 (2458-2484): 5'-GAATACTCATTAAAGCAAATGGTAGAA-3 '(SEQ ID NO: 40)
As a result of checking the base sequence, the sequences corresponding to HMG1 (190-216), HMG1 (1807-1833), and HMG1 (2713-2739) were all corrected to the sequences of these oligonucleotides. The plasmid whose sequence in HMG1 was corrected in this way was designated as pALHMG106.

[Example 3] Cloning of farnesyl diphosphate synthase gene
A SacFPS gene ERG20 approximately 0.9 kbp fragment (SEQ ID NO: 3) was amplified by PCR using a yeast cDNA library (Clontech) as a template. The PCR primer and reaction solution composition was as follows:
Primer 1 (SCFPS1): 5'- ATG GCT TCA GAA AAA GAA ATT AG -3 '(SEQ ID NO: 41)
Primer 2 (SCFPS 2): 5'-CTA TTT GCT TCT CTT GTA AAC TT -3 '(SEQ ID NO: 42)

Using the above reaction solution, PCR was carried out for 30 cycles of 94 ° C. for 45 seconds, 55 ° C. for 1 minute, and 72 ° C. for 2 minutes.
The obtained PCR fragment was purified by agarose gel electrophoresis and then cloned into pT7Blue-T (Novagen, Madison, Wis.) By T / A ligation. ERG20 was inserted in the same direction as lacZ in pT7Blue-T (FIG. 6). The base sequence of the cloned fragment was determined and compared with the sequence shown in SGD (Saccharomyces Genome Database, http://genome-www.stanford.edu/Saccharomyces/). There was no PCR error at.
The prepared plasmid DNA was designated as pT7ERG20.

[Example 4] Mutation introduction into farnesyl diphosphate synthase gene
(4-1) Subcloning of ERG20 pRS435GAP-ERG20 was prepared by subcloning ERG20 cloned into pRS435GAP in the same manner as described in WO 02/053746. from pRS435GAP-ERG20, excised Sac I- Apa I fragment of about 2.0kbp containing a transcription promoter TDH3 p (GAPp) and ERG20, and inserted into Sac I- Apa I site of pRS405. This was designated as pRS405-ERG20.

Next, SET2 and QCR8 partial fragments of 526 bp and 509 bp, respectively, were prepared by PCR using S. cerevisiae genomic DNA as a template and the following DNA primers and using a probest DNA polymerase (Takara Bio) (see FIG. 6).
SET2-F (SacI): 5'-TAT CGA GCT CTA TTA GTT TCG ACA TGC G-3 '(SEQ ID NO: 43)
SET2-R (BglII): 5'-TCA TAG ATC TAC GCA CTC ACA CTT TGG T -3 '(SEQ ID NO: 44)
QCR8-F (BamHI): 5'- GAT TGG ATC CTA GAT AAG GAC CAT GTA T -3 '(SEQ ID NO: 45)
QCR8-R (PstI): 5'-ATA TCT GCA GTG AGA CTT AAA TCT TCT AA -3 '(SEQ ID NO: 46)

Next, in order to obtain the integration DNA fragment shown in FIG. 6, the SET2, ERG20-LUE2, and QCR8 fragments were sequentially inserted into the cloning vector pSP72 (Promega). The SET2 fragment 526bp obtained by PCR was cleaved with Sac I and Bgl II, it was inserted into Sac I- Bgl II sites of pSP72, to obtain a plasmid pSP72-SET2. Next, the QCR8 fragment 509 bp was cleaved with Pst I and Bam HI and inserted into the Pst I- Bam HI site of pSP72-SET2, resulting in plasmid pSP72-S2Q8. Further, pRS405GAP-ERG20 was digested with Aat II, blunt-ended, then digested with Sac I, about 5.3 kbp containing the ERG20 - LEU2 fragment was inserted into the Sac I- Sma I site of pSP72-S2Q8, and plasmid pSP72-SQERG20 was inserted. Obtained.

(4-2) Production of mutant ERG20
Table 2 shows the amino acid sequence in the vicinity of SacFPS containing the aspartate-rich domain I (indicated by one letter from the 94th amino acid Ala to the C-terminal side), that is, the amino acid sequence shown in SEQ ID NO: 1. A mutant ERG20 encoding a novel mutant SacFPS was planned.

The amino acid sequence mutations are described as follows: ERG20 m1: F96S, ERG20 m2: Y95F-F96S, ERG20 m3: Y95S-F96S, ERG20 m4: Y95A-F96S-102PC103, ERG20 m5: Y95S.

The following DNA primers were prepared for mutation introduction by PCR. “P-” on the 5 ′ side indicates a 5 ′ phosphorylated primer.
ERG20 (289-308): 5'-p-TTG GTC GCC GAT GAT ATG AT -3 '(SEQ ID NO: 52)
ERG20 (F96S): 5'-p-AGA GTA AGC CTG CAA CAA CTC A-3 '(SEQ ID NO: 53)
ERG20 (Y95FF96S): 5'-p-AGA GAA AGC CTG CAA CAA CTC AAT G-3 '(SEQ ID NO: 54)
ERG20 (Y95SF96S): 5'-p-AGA GGA AGC CTG CAA CAA CTC AAT G-3 '(SEQ ID NO: 55)
ERG20 (Y95AF96S): 5'-p-GGC GAC CAA AGA GGC AGC CTG CAA CAA CTC AAT GC -3 '(SEQ ID NO: 56)
ERG20 (102PC103): 5'-p-GAT GAT ATG CCA TGT ATG GAC AAG TCC ATT ACC AG -3 '(SEQ ID NO: 57)
ERG20 (Y95S): 5'-p-GAA AGA AGC CTG CAA CAA CTC AAT G-3 '(SEQ ID NO: 58)

ERG20 (F96S) and ERG20 (289-308) for ERG20 m1, ERG20 (Y95FF96S) and ERG20 (289-308) for ERG20 m2, ERG20 (Y95SF96S) and ERG20 for ERG20 m3 (289-308), ERG20 (Y95AF96S) and ERG20 (102PC103) for ERG20 m4 production, ERG20 (Y95S) and ERG20 (289-308) for ERG20 m5 production as DNA primer pairs for PCR, respectively PCR was performed using pSP72-SQERG20 as a template and a probest DNA polymerase as an enzyme. The amplified DNA fragment was circulated by self-ligation and transformed into E. coli JM109, and the DNA was cloned. The base sequence of the obtained cloned cyclized plasmid DNA was partially determined, and a DNA clone that had been mutated as planned was selected. Plasmid DNAs containing ERG20 m1, ERG20 m2, ERG20 m3, ERG20 m4 and ERG20 m5 having the sequence as planned were designated as pERG20m1-4, pERG20m2-1, pERG20m3-9, pERG20m4-16 and pERG20m5-1, respectively. In addition, during preparation of plasmid DNA containing the above mutant ERG20, a plasmid DNA that could not be mutated as planned and had the same sequence as wild type ERG20 was designated as pERG20.

[Example 5] Preparation of HMG-CoA reductase gene overexpression strain
(5-1) Preparation of DNA construct for HMG1 expression
Based on HMG1 inserted into pALHMG106, pRS434GAP-HMG1 was produced in the same manner as in the example of JP-A-2002-199883. It was decided to cut out HMG1 from pRS434GAP-HMG1 and insert the multicloning site of YIp type vector pRS504GAP to produce a DNA fragment for multicopy integration for HMG1 expression. However, since pRS434GAP-HMG1 has a cloning vector-derived sequence inserted between the initiation codons of TDH p and HMG1 , transcription efficiency may be reduced. Therefore, this insertion sequence was removed as follows. The PCR primers used are shown below:
SacHMG1-F: 5'- CCGCGG AACAAAATGCCGCCGCTATTCAAGGG-3 '(SEQ ID NO: 59)
(Underlined indicates Sac II recognition site)
TthHMG647R: 5'- GACCCGGTC TTCCTCATGTC-3 '(SEQ ID NO: 60)
(Underlined indicates Tth 111I recognition site)

PCR was performed using pRS434GAP-HMG as a template and the above primers to amplify from the start codon of HMG1 to the Tth 111I site (647b downstream of A of start codon ATG). SacHMG1-F allows the AACAAA sequence upstream of the start codon of HMG1 (a consensus sequence upstream of the start codon of 18 genes highly expressed in S. cerevisiae (Hamilton R, Watanabe CK, de Boer HA. (1987) Nucleic Acids Res. , 15 , 3581-93)) and a Sac II recognition site. This PCR product was subcloned into the pCR-Blunt II TOPO vector and sequenced to confirm that there were no PCR errors. By replacing the fragment excised again with Sac II- Tth 111I from this PCR product with the Sac II- Tth 111I part of pRS434GAP-HMG1, an optimized plasmid upstream of the start codon of HMG1 (hereinafter referred to as pRS434GAPa-HMG1). Called).

Next, pRS434GAPa-HMG1 was digested with restriction enzymes Sac II and Xho I, and about 3.2 kbp of HMG1 fragment was excised and inserted into the Sac II- Xho I sites of pRS504, pRS514 and pRS524, respectively. PRS514HMG1 and pRS524HMG1.

(5-2) Production of recombinant yeast
The pRS504HMG1, pRS514HMG1 and pRS524HMG1 plasmid DNA 20-50μg, Eco O65I- Bst PI shown in FIGS 3, Pvu II- Bst PI, was linearized by digestion with Fse I- Bss HII, ethanol precipitation after 5μl of sterile Dissolved in water and used for transformation. The yeast, S. cerevisiae strain YPH499 (hereinafter referred to as “YPH499”) was transformed using a Frozen EZ yeast transformation kit (Zymo Research) and then inoculated on an appropriate selective medium plate. The colonies of the transformant that grew several days later were streaked on a new selective medium plate to purify the colonies and used for the subsequent experiments.

(5-3) Measurement of squalene production volume It is shown in Japanese Patent Application Laid-Open No. 2002-199883 and WO 02/053746 that the prenyl alcohol production potential of HMG1 overexpressing strain can be estimated by the squalene production volume. ing. Also in this example, it was decided to select recombinants using squalene production as an index.

  200 μl of a selective medium was put in a microtiter plate, inoculated with the recombinant yeast prepared in (5-2), and statically cultured at 30 ° C. for 2 days to obtain a preculture solution. 20 μl of the preculture was inoculated into 2 ml of YPD7 + ade medium (1% Yeast extract, 2% Polypeptone, 2% D-glucose, 40 mg / L adenine hemisulfate salt (SIGMA), pH 7). After rotary shaking culture at 130 rpm for 4 days at 30 ° C., 40 μl of the culture solution was diluted 30-fold with water, and the absorbance at 600 nm (OD600) was measured.

  The measurement of squalene production was performed as follows. The culture solution was transferred to a 2 ml Eppendorf tube, and the supernatant and precipitate (cells) were separated by centrifugation. To the supernatant, 2 ml of methanol and 4 ml of pentane were added and stirred with a vortex mixer for 15 seconds, and then the pentane layer was separated. To the precipitate (cells), 200 μl of TE buffer and about 300 μl of glass beads (425-600 microns, Acid-Washed; SIGMA) were added, and the cells were crushed by vigorous stirring for 30 minutes with a vortex mixer. 200 μl of methanol and 1 ml of pentane were added, and the mixture was stirred with a vortex mixer for 3 minutes, and then centrifuged to separate the pentane layer. Add 1 ml of pentane again and extract in the same way. Combine the pentane layer from which the supernatant and precipitate (bacteria) were extracted, put them in a glass test tube, evaporate pentane in a fume hood, and concentrate the solute components. 10 μl of 50 μl / ml undecanol was added as an internal standard substance and subjected to GC / MS analysis.

All GC / MS analyzes in the present invention were performed under the following conditions. The analyzer used was an HP6890 / 5973 GC / MS system manufactured by Hewlett-Packard Company.
Inlet temperature: 250 ℃
Detector temperature: 260 ℃
MS zone temperature
MS Quad: 150 ° C
MS Source: 230 ° C
Scan parameters
Low Mass: 35
High Mass: 200
Threshold: 40
Injection parameter mode: Automatic injection sample volume: 2μl
Number of washings: 3 times with methanol, 2 times with hexane Split ratio: 1:20
Column: HP-5MS manufactured by Hewlett-Packard (O.25mm × 30M, film thickness O.25μm)
Carrier gas: 1 helium 1.0ml / min
Solvent delay: 2 min
Oven temperature rise condition: l15 ° C, hold for 1.5 minutes → heat up to 250 ° C at 70 / min, hold for 2 minutes → heat up to 300 ° C at 70 / min, hold for 7 minutes Post time: O
Internal standard: 1-undecanol / ethanol solution (1 μl / ml) added to each vial 10 μ1 Inlet liner: Split / splitless liner

  Analysis: After capturing TIC, 69 masses were selected and the peak areas of 1 undecanol (RT = 3.39min), farnesol (RT = 4.23min), and geranylgeraniol (RT = 5.78min) were integrated. Quantified from the ratio of peak area to the internal standard undecanol.

FIG. 7 shows the results of measuring the amount of squalene produced by culturing the strains into which pRS504HMG1, pRS514HMG1 and pRS524HMG1 were respectively introduced into YPH499, culturing them in YPD7 + ade medium for 4 days, crushing and extracting. The upper graph in FIG. 7 shows squalene production (mg / L), and the lower graph shows the corresponding absorbance (OD600). The numbers on the horizontal axis indicate sample numbers (#). As a comparison, the maximum amount of squalene produced by YH1 (pRS434HMG1 / YPH499) described in Patent Application 2000-403067 in which HMG1 was introduced with a YEp-type plasmid was 135 mg / l. In contrast, when HMG1 was introduced using the multicopy YIp plasmid prepared in this Example, 267 mg / l (pRS504HMG1 / YPH499 # 13) of squalene was produced at the maximum. From these results, by introducing HMG1 using the plasmid prepared in this Example, a strain in which the productivity of squalene was improved twice as compared with the case of using the YEp type plasmid was obtained.

  When Ω-integration type pRS524HMG1 was transformed as compared with γ-integration type pRS504HMG1 and pRS514HMG1, there was a tendency that the transformation efficiency was low and the number of transformants obtained was small. In this case, it is considered that the Ω integration requires two recombination per integration (see FIG. 2). The squalene productivity tended to be higher in the γ type than in the Ω type.

(5-4) Selection of recombinant strains overexpressing HGM1
From the results of (5-3), pRS504HMG1 / YPH499 # 13 was selected as an HMG1 overexpressing strain (hereinafter referred to as “pRS504HMG1 / YPH499”) having a high prenyl alcohol production potential.

[Example 6] Production of mutant SceFPS-introduced recombinant
A recombinant in which the transcriptional promoter of the wild-type ERG20 gene in the S. cerevisiae genome to the polypeptide coding region is completely replaced with the DNA fragment prepared in Example 4 represented by “ TDH3p (GAPp) -ERG20m”. It was produced by the following method. Each plasmid DNA of pERG20, pERG20m1-4, pERG20m2-1, pERG20m3-9, pERG20m4-16, pERG20m5-1 was used with Frozen EZ yeast transformation kit (Zymo Research), and two types of YPH499 and pRS504HMG1 / YPH499 # 13 After introduction into a host strain, the colonies were purified by inoculating a suitable selective medium plate and streaking recombinant colonies that had grown several days later into a new selective medium plate. Hereinafter, for example, YPH499 introduced with pERG20m1-4 is represented as ERG20m1 / YPH499-1. Note that “-1” is an experimental work number.

Genomic DNA was prepared from the prepared recombinant, and the replacement fragment was confirmed by PCR. As shown in Fig. 6, most of the SET2 and QCR8 were recombined and substituted as planned, but some were recombined near the 5 'end of the ERG20 coding region instead of the SET2 part. As a result, a recombinant in which the transcription promoter ERG20 p in the ERG20 gene remained was also obtained. In this recombinant, the transcription promoter TDH3 p does not transcribe mutant ERG20 , and the wild type transcription promoter ERG20 p transcribes mutant ERG20 . Therefore, for example, by introducing ERG20m1-4 into YPH499, expressed as ERG20p-ERG20m1 / YPH499-1 recombinant wild-type transcriptional promoter ERG20 p transcribes the mutant ERG20. “-1” is an experimental work number.

[Example 7] Prenyl alcohol production of mutant SceFPS-introduced recombinants After the recombinants were cultured in the same manner as in (5-3) above, the culture suspension was directly used without disrupting the cells. Samples with organic solvent were analyzed by GC / MS to quantify prenyl alcohol production. The results are shown in Table 3 below. The unit of production is mg / L, and the numbers after “-” in the stock name are work numbers.

As can be seen from the results shown in Table 3, it was shown that if the mutant SceFPS encoded by ERG20 m1 is expressed in cells, cells capable of producing GGOH can be obtained. In addition, it was shown that the GGOH production capacity was further enhanced in the case of the HMG-CoA reductase high expression strain pRS504HMG1 / YPH499. Transcriptional promoter of ERG20 m1 does not matter even ERG20 p but, more preferably towards the TDH3 p. Furthermore, no special medium-added components such as sterol are required for culturing GGOH-producing cells, which are cells according to the present invention.

It was also revealed that substitution mutants using mutant SceFPS other than ERG20 m1 do not have GGOH production ability. That is, as already reported in Ohnuma etal ., J Biol Chem., 271 , 30748-30754 (1996), asparagine was simply converted from farnesyl diphosphate synthase activity into geranylgeranyl diphosphate synthase activity. It can be seen that a mutant farnesyl diphosphate synthase gene suitable for the production of cells capable of producing GGOH cannot be produced simply by modifying the amino acid sequence upstream of acid-rich domain I. In order to produce cells that produce high concentrations of GGOH just by culturing the cells in a general medium without the addition of a special medium such as sterol, it is essential for growth like the polypeptide encoded by ERG20 m1. It is essential that the farnesyl diphosphate synthase activity and the GGPP synthase activity required for GGOH production are well balanced.

It is a figure which shows typically the prenyl alcohol biosynthetic pathway in a cell. It is a schematic diagram which shows the outline | summary of the integration pattern of (gamma) integration and (omega) integration. It is a schematic diagram which shows the plasmid map of pRS434GAP, pRS504, pRS514, and pRS524. It is a schematic diagram which shows the plasmid map of pRS435GAP, pRS515, and pRS525. It is a schematic diagram which shows the plasmid map of pRS436GAP, pDI626, and pDI628. It is a schematic diagram which shows recombination with a genomic DNA and the DNA fragment for integration. It is a characteristic figure which shows the amount of squalene production of YPH499 which integrated HMG1 .

Sequence number 5-23, 25-32, 38-46, and 52-60 are primers.
In SEQ ID NO: 2, the 96th amino acid (Xaa) represents an amino acid other than phenylalanine.
SEQ ID NO: 24 is the sequence around the Kpn I site of pRS515 or pRS525.
SEQ ID NOs: 35 to 37 are mutagenesis oligos.

Claims (12)

DNA encoding the following polypeptide (a) or (b).
(a) a polypeptide comprising an amino acid sequence in which the 96th amino acid is serine in the amino acid sequence represented by SEQ ID NO: 2
(b) in the amino acid sequence represented by SEQ ID NO: 2, consisting of an amino acid sequence in which the 96th amino acid is serine, and one or several amino acids except the 96th amino acid are deleted, substituted or added; A polypeptide having geranylgeranyl diphosphate synthase activity. The following polypeptide (a) or (b):
(a) a polypeptide comprising an amino acid sequence in which the 96th amino acid is serine in the amino acid sequence represented by SEQ ID NO: 2
(b) in the amino acid sequence represented by SEQ ID NO: 2, consisting of an amino acid sequence in which the 96th amino acid is serine, and one or several amino acids except the 96th amino acid are deleted, substituted or added; A polypeptide having geranylgeranyl diphosphate synthase activity. A DNA construct comprising the DNA of claim 1 . A cell holding the DNA construct according to claim 3 . The cell according to claim 4 , wherein the host cell is a sterol non-requiring strain. 6. The cell according to claim 5 , wherein the sterol is cholesterol or ergosterol. 5. The cell according to claim 4 , wherein the host cell is a HMG-CoA reductase high expression strain. The cell according to claim 4 , wherein the endogenous farnesyl diphosphate synthase gene is replaced by the DNA construct. A method for producing geranylgeraniol, comprising culturing the cell according to any one of claims 4 to 8 and recovering geranylgeraniol from the culture. 10. The method for producing geranylgeraniol according to claim 9 , wherein the recovery directly extracts an organic solvent from the culture without disrupting the cells. The method for producing geranylgeraniol according to claim 10 , wherein the organic solvent is pentane. The method for producing geranylgeraniol according to claim 9 , wherein the geranylgeraniol is (all- E ) geranylgeraniol.

Images