KR20150050642A - Nucleotide for modify the content of fatty acid in seeds and uses thereof - Google Patents

Abstract

The present invention relates to new functionality of DPBF2 as a modified transcription factor in Arabidopsis, confirming the modification of a fatty acid composition in seeds of a plant by the DPBF2, and enabling to manufacture the seeds of the plant with an increased amount of specific fatty acid by modifying expression of DPBF2.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a nucleic acid for regulating fatty acid composition in plant seeds,

The novel function of the DPBF2 gene, a transcription factor of Arabidopsis thaliana, and its effect on the change of fatty acid composition in plant seeds.

Unsaturated fatty acids are chain-like compounds having one or more double bonds in a molecule and are widely distributed in plants and animals, and are generally composed of even numbers of about 12 to 20 carbon atoms. When a fatty acid molecule has only one double bond, it is called a monounsaturated fatty acid and has two or more double bonds and is called a polyunsaturated fatty acid. Unsaturated fatty acids are divided into a cis configuration and a trans configuration depending on the type of double bond followed by the hydrogen atom. The cis type means that the adjacent hydrogen atom is in the same direction as the double bond, and the trans type means that the next two hydrogen atoms are bonded in the opposite direction to the double bond. When a double bond is formed in a fatty acid chain, the hydrogen atom has to be removed, so the term " saturated " in saturated fatty acids means that the hydrogen atom is saturated. In intracellular metabolism, hydrogen-carbon bonds are broken or oxidized for energy production. Thus, unsaturated fatty acids contain less energy than saturated fatty acids of the same size. It is also known that unsaturated fatty acids have a lower melting point, which also increases the fluidity of the cell membrane. Saturated fatty acid intake is associated with the risk of cardiovascular diseases such as hypercholesterolemia and atherosclerosis while the intake of unsaturated fatty acids is associated with a decrease in blood cholesterol and a reduced risk of developing atherosclerosis Is known to be associated with. Examples of unsaturated fatty acids include palmitoleic acid, oleic acid, myristoleic acid, linoleic acid, arachidonic acid, eicosapentaenoic acid, Eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and the like. Foods containing such unsaturated fatty acids include avocados, nuts, vegetable oils such as canola oil and olive oil. Vegetable oils are used in a variety of ways and depending on the intended oil application, different fatty acid compositions are required. Plant species, especially those that synthesize large amounts of oil in seeds, are important oil sources for both food and industrial use.

There is a need for compositions and methods for altering genes involved in fatty acid synthesis to produce plants and plant products (e.g., plant oils) having selected fatty acids. By producing plant variants with low levels of individual and total saturated fats in seed oils, it is possible to produce oil-based food products containing less saturated fats, which reduce the incidence of arteriosclerosis and coronary artery disease It will be beneficial to public health.

Transcription factors show sequence-specific DNA binding and are generally defined as proteins that can activate and / or inhibit transcription. The Arabidopsis genome encodes at least 1533 transcriptional modulators corresponding to about 5.9% of the total number of genes evaluated. About 45% of these transcription factors are reported to be plant-specific families (Riechmann et al., 2000 (Science Vol. 290, 2105-2109)).

Accordingly, the inventors of the present invention have studied the transcription factor of Arabidopsis thaliana, and discovered that DPBF2 has a function of changing the fatty acid composition in the plant. Therefore, it will contribute to the development of the seed of the plant having the increased specific fatty acid content.

An object of the present invention is to provide a transgenic plant transformed with a recombinant vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1.

Yet another object of the present invention is to provide a mutant plant in which the function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1 is lost.

It is still another object of the present invention to provide a method for producing a transgenic plant wherein the transcription factor comprising the amino acid sequence of SEQ ID NO: 2 is overexpressed.

It is still another object of the present invention to provide a method for producing a mutant plant in which the function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1 is completely lost.

In order to achieve the above object, the present invention provides a transgenic plant transformed with a recombinant vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a mutant plant in which the function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1 is lost.

The present invention also provides a method for producing a transgenic plant wherein the transcription factor comprising the amino acid sequence of SEQ ID NO: 2 is overexpressed.

In addition, the present invention provides a method for producing a mutant plant in which the function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1 is completely lost.

The seeds of the plant transformed with the vector containing DPBF2 , the Arabidopsis transcription factor of the present invention, or the plant in which the function of DPBF2 has been lost, can be determined by measuring the content of oleic acid and linolenic acid or the content of linoleic acid And can be usefully used for the production of specific unsaturated fatty acids.

Brief Description of the Drawings Figure 1 is a plot of the transcriptional regulatory activity of DPBF2 in yeast:
DB-DPBF2: Experimental group expressed by binding of GAL4 DNA-binding (DB) domain and DB-DPBF2 gene;
+ Positive control: a positive control that simultaneously expresses the GAL4 DNA-binding domain (DB) and the GAL4 activation domain (AD);
-pGBKT7: Negative control in which the vector pGBKT7, which is an empty vector, was expressed;
SD-W: minimal medium without Tryptophan;
SD-WA: minimal medium without Tryptophan and Adenosine; And
SD-WU: Minimum medium without Tryptophan and Uracil.
Figure 2 (A) is a diagram showing the T-DNA has been mutated dpbf2 -1 gene construct inserted into the first intron of the gene DPBF2.
FIG. 2 (B) is an analysis of genotype of mutant Arabidopsis by genomic DNA PCR analysis using LBb1.3, LP and RP primers:
1 kb: DNA marker;
WT: wild type genotype; And
dpbf2 -1 : Mutant genotype.
Figure 2 (C) is an analysis of the wild type (WT) and dpbf2 -1 DPBF2 transcript expression in mutant seeds by RT-PCR analysis:
1 kb: DNA marker;
WT: wild type genotype;
dpbf2 -1 # 1 and # 2: Mutant genotype; And
ACT2 : Actin2 gene (control).
Fig. 3 is a comparative analysis of the fatty acid composition and total local production of wild-type (WT) and mutant Arabidopsis seeds dpbf2 -1:
(A): wild-type and mutant dpbf2 dpbf2 -1 -1 # 1 and # 2 of the seed fatty acid composition;
(B) wild-type and mutant dpbf2 -1 dpbf2 -1 # 1 and # 2 seeds per total fatty acid content.
Figure 4 is a wild-type (WT) and comparative analysis dpbf2 -1 mutant fatty acid composition of the leaves.
Figure 5 shows OX-DPBF2, a DPBF2 overexpressing transformation vector:
Bar: herbicide resistance gene;
35S CaMV: Cauliflower mosaic virus 35S promoter;
DPBF2: DPBF2 cDNA, OCS: Octopine synthase gene 3 'sequences;
Kan: kanamycin resistance gene;
LB: left border; And
RB: right border.
FIG. 6 is a graph comparing the fatty acid composition of wild-type (WT) and OX-DPBF2 overexpressed seeds.

Hereinafter, the present invention will be described in detail.

The present invention provides a recombinant vector comprising the gene consisting of the nucleotide sequence of SEQ ID NO: 1.

The gene is preferably DPBF2 , which is a transcription factor (transcription factor) of Arabidopsis thaliana, and variants of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The recombinant vector is preferably, but not limited to, a plant transformant.

The recombinant vector preferably includes a herbicide resistance Bar gene, but is not limited thereto.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "expression vector" is often used interchangeably with a "recombinant vector ". The term "recombinant vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed by using prokaryotic cells or eukaryotic cells as hosts. For example, when the recombinant vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter (for example, pL? Promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) , Ribosome binding sites for initiation of detoxification, and transcription / translation termination sequences.

The vectors that can be used in the present invention include plasmids such as pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series and pUC19 which are frequently used in the art, phages such as λgt4 · λB ,? -charon,?? z1, and M13), or a virus (e.g., SV40, etc.).

On the other hand, when the recombinant vector of the present invention is an expression vector and a eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a mammalian virus (e.g., Adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may be a selection marker and may include an antibiotic resistance gene commonly used in the art, for example, ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, , Tetracycline and basta herbicides.

When the vector of the present invention is transformed into eukaryotic cells, yeast ( Saccharomyce cerevisiae) and the like insect cells, human cells (e.g., CHO cells (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines), plant cells and plants can be used. The host cell is preferably a plant.

When the host cell is a eukaryotic cell, the vector of the present invention may be delivered by a microinjection method, a calcium phosphate precipitation method, an electroporation method, a liposome-mediated transfection method, an Agrobacterium-mediated transfection method, DEAE-dextran treatment, and gene bombardment, etc., into a host cell.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, Bleomycin, hygromycin, ), Chloramphenicol (chloramphenicol), but are not limited thereto.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens ) Octopine gene terminator, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The present invention also provides a transgenic plant transformed with said recombinant vector.

Preferably, the transgenic plant has an increased oleic acid and linolenic acid content and reduced linoleic acid content due to overexpression of a transcription factor comprising the amino acid sequence of SEQ ID NO: 2, But is not limited thereto.

Oleic acid is an unsaturated fatty acid of 18: 1 (CH3 (CH2) 7CH = CH (CH2) 7COOH) and is the main ingredient of oils such as olive oil and camellia oil. It is used in cosmetics, pharmaceutical additives and fabric softeners, May be used as a drug.

Linolenic acid is an unsaturated fatty acid of 18: 3 (CH3 (CH2CH = CH) 3CH2 (CH2) 6COOH), and is a saturated fatty acid such as flexed-seed oil, walnut oil, evening primrose, blackcurrant seed oil, borage oil or It is an essential fatty acid essential for the in vivo synthesis of prostaglandins. It is also used for the production of chicks, soaps, and so on. It is also effective in lowering the blood cholesterol level.

Linoleic acid is an unsaturated fatty acid of 18: 2 (CH3 (CH2) 4CH = CHCH2CH (CH2) 7COOH) and is the main component of semi-drying oil such as soybean oil, corn oil and cottonseed oil.

The plant is preferably an Arabidopsis or an oil plant, but is not limited thereto.

The above-mentioned sustaining plant is preferably a plant which obtains oil from seed or fruit, more preferably selected from the group consisting of sesame, rapeseed, sunflower, very, peanut, soybean, coconut, oil palm and jojoba .

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of mature pollen or vesicles into Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.

The plant according to the present invention is selected from the group consisting of food crops selected from the group consisting of rice, wheat, barley, corn, soybean, potato, wheat, red bean, oats and millet; Vegetable crops selected from the group consisting of Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Ginseng, tobacco, cotton, sesame, sugar cane, beet, perilla, peanut and rapeseed; Apple trees, pears, jujubes, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots and banana; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And feed crops selected from the group consisting of Ryegrass, Red Clover, Orchardgrass, Alpha Alpha, Tall Fescue, and Fereniallaigrus.

The present invention also provides a mutant plant in which the function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1 is lost.

Preferably, the mutant plant is deficient in the function of the gene due to deletion, substitution or insertion of the gene consisting of the nucleotide sequence of SEQ ID NO: 1. In the mutant plant, the gene ( DPBF2 ) comprising the nucleotide sequence of SEQ ID NO: It is more preferable that the function of the gene is lost due to the insertion of the DNA, but the present invention is not limited thereto.

In the mutant plant, the content of oleic acid (18: 1) and linolenic acid (18: 3) in the seed is decreased by the loss of function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1 and linoleic acid : 2) The content is preferably increased, but is not limited thereto.

In addition,

(1) preparing a recombinant vector comprising the gene consisting of the nucleotide sequence of SEQ ID NO: 1;

(2) transforming the recombinant vector of step (1) into a plant using Agrobacterium; And

(2) selecting a transformant. The present invention also provides a method for producing a transformed plant.

In the step (3), it is preferable to select a transformant containing a herbicide resistance gene by spraying a herbicide. The herbicide may be barstyle, but is not limited thereto.

In addition,

(1) preparing a seed which has lost gene function through deletion, substitution or insertion of a gene consisting of the nucleotide sequence of SEQ ID NO: 1;

(2) The function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1, which comprises the step of selecting a plant in which the gene deficient, substituted or inserted in plants obtained by culturing the seed of step (1) is homozygous Thereby producing a mutant mutant plant.

The insertion in step (1) is preferably, but not limited to, insertion of T-DNA into the gene of SEQ ID NO: 1.

The present invention also provides oleic acid and linolenic acid comprising the step of obtaining oleic acid and linolenic acid from seeds of a transgenic plant transformed with the recombinant vector according to the present invention, And a method for producing the same.

The present invention also provides a method for producing linoleic acid comprising the step of obtaining a linoleic acid from a seed of a mutant plant in which the function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1 according to the present invention is lost.

In a specific embodiment of the present invention, the present inventors have found that Arabidopsis DPBF2 The rate of 18: 2 unsaturated fatty acid (linoleic acid) in the mutant Arabidopsis seeds, in which gene expression was inactivated by insertion of T-DNA into the DPBF2 gene, was found to be 8 % Of unsaturated fatty acid (oleic acid) decreased by 2% and that of 18: 3 unsaturated fatty acid (linolenic acid) was decreased by 6%. In addition, in the Arabidopsis seeds overexpressing DPBF2 gene, 18: 2 fatty acids decreased by up to 6%, 18: 3 fatty acids increased up to 4%, 18: 1 increased up to 3% Confirming the opposite effect of the lost mutant plant, DPBF2 The ability of the gene to regulate the fatty acid composition in the plant seeds was confirmed.

Therefore, inhibiting or overexpressing the expression of the DFBF2 transcriptional regulatory factor of the present invention in plants can control the production rate of unsaturated fatty acids in plant seeds, and thus can be utilized in the production of specific unsaturated fatty acids.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more fully explain the present invention to those skilled in the art.

< Example  1> DPBF2  Gene transcriptional regulation function assay

In order to confirm the transcriptional regulatory function of the protein encoded by the DPBF2 gene, the expression of the auxotrophic gene was tested by mutual binding between the DNA-binding domain (DB) and the activation domain (AD) of the GAL4 transcription regulator, Yeast two hybrid (Y2H) system was used. Specifically, the DPBF2 gene of SEQ ID NO: 1 was inserted into the GAL4 DNA-binding domain (DB), the yeast expression vector (DB-DPBF2), the GAL4 DNA-binding domain (DB) and the GAL4 activation domain (AD) (PGBKT7) expressing the vector pGBKT7 without the GAL4-DNA binding domain (DB) vector and the GAL4 activation domain (AD) at the same time were introduced into the yeast strain deficient in auxotrophy Respectively. Then, the nutrient deficient yeast strains into which the respective genes were introduced were cultured in nutrient-poor conditions (medium lacking Uracil and Adenosine), and the degree of growth was confirmed.

As a result, it was confirmed that URA3 and ADE2 genes were expressed in the yeast of the experimental group, and that the growth was the same as that of the positive control yeast even under the nutritional deficiency conditions, and DPBF2 functions as a transcriptional regulator (FIG.

< Example  2> DPBF2  Production and testing of mutant defective mutants

<2-1> DPBF2  Production and selection of defective mutants

DPBF2 Dpbf2 the T-DNA is a rear, T-DNA fragment of the Arabidopsis obtained by culturing the strains obtained from the inserted seeds salk_085497C ABRC (Arabidopsis Biological Resource Center) the gene is inserted into the DPBF2 gene lost completely the function of the gene - 1 LBb1.3 primers shown in Table 1 to obtain a plant (SEQ ID NO: 3), LP primer (SEQ ID NO: 4) and the RP primer (SEQ ID NO: 5) PCR analysis on the Arabidopsis thaliana genomic DNA using a set (Fig. 2A) carried out by the function of the gene were selected DPBF2 completely lost Homo screen the mutant dpbf2 -1 (Fig. 2B) a. Primers specific to the beginning of the N-terminal (N-ter) part of a gene to detect the expression of the gene in the seed of a selected one DPBF2 dpbf2 -1 mutant (SEQ ID NO: 6) and C-ternimal (C-ter) part (Reverse transcriptase-polymerase chain reaction) method using a primer (SEQ ID NO: 7) specific for the gene of the present invention.

As a result, the control wild type (WT) plant seeds DPBF2 the gene is expressed, but not in the flower Homo dpbf2 -1 mutant plants of dpbf2 -1 # 1 and # 2 is the seed of dpbf2 -1 DPBF2 gene expression (Fig. 2C) . The dpbf2 -1 # 1 and # 2 -1 dpbf2 the T-DNA in the first intron of the gene through DPBF2 Genotyping and gene expression analysis is inserted in secured to dpbf2 -1 mutant does not DPBF2 gene expression. The dpbf2-1 mutant plants showed no significant difference in growth compared to the wild type plants.

SEQ ID NO: Primer name Sequences (5 '-> 3') 3 LBb1.3 ATTTTGCCGATTTCGGAAC 4 LP ACGTGTAATTTCAGCATCGG 5 RP CTCGGTTTTGGGAGAATCTTC 6 N-ter ATGTCGGTTTTCGAAT 7 C-ter TTACCACCCGGCACTGGC

<2-2> DPBF2  Analysis of fatty acids in the seeds of defective mutants

Example <2-1> and dpbf2 selected from -1 Homo mutation chain dpbf2 -1 # 1 and # 2 dpbf2-1 Arabidopsis thaliana with the control of the wild-type (WT) fatty acids of the seed harvested from Arabidopsis thaliana gas chromatography (GC2010 plus, Shimadzu, Japan) analysis method was used to analyze the fatty acid composition and total fatty acid production.

As a result, dpbf2 -1 mutant seeds as compared to wild type in the 18: 2 fatty acid was a (linoleic acid) ratio increased by about 8%, 18: 1 (oleic acid) was 2%, and 18: 3 (linolenic acid) is decreased by 6% (Table 1 and Figure 3A). These results 18 of the wild-type: it is estimated to have been converted to 2: 3 fatty acids in the -1 dpbf2 Mutant 18: 1 and 18. In addition, the total amount of fatty acids in the seeds was 2.9 ㎍ / g for the wild type and 2.8 ㎍ / dpbf2 -1 for the seeds, respectively (Fig. 3B). Taken together, these two results suggest that DPBF2 The mutation in which the function of the gene is lost shows a great change in the fatty acid composition of the seed, but the total amount of the fatty acid in the seed is not changed (Fig. 3B).

Fatty acids WT dpbf2 -1 # 1 dpbf2 -1 # 2 mol% SEM mol% SEM mol% SEM 16: 0 8.4 0.13 8.2 0.06 8.2 0.18 18: 0 2.5 0.04 2.6 0.14 2.6 0.09 18: 1 16.5 0.07 14.6 0.03 14.4 0.07 18: 2 32.7 0.11 40.6 0.21 41.0 0.21 18: 3 19.8 0.11 13.5 0.10 13.7 0.05 20: 1 20.1 0.02 20.5 0.13 20.0 0.14

<2-3> DPBF2  Fatty acid analysis of mutant leaves with loss of function

Wild-type (WT) and Example <2-1> Selection one dpbf2 -1 mutant fatty acid composition in wild-type leaves also a control to investigate any changes as in seeds (WT # 1 and # 2 W1T) and in dpbf2 1 mutants ( dpbf2 -1 # 1 and dpbf2 -1 # 2) were analyzed by gas chromatography (GC).

As a result, it was found that wild type and dpbf2 - 1 in the composition of all fatty acids (16: 0, 16: 1, 16: 2, 16: 3, 18: 0, 18: Since there was no difference between the mutants (Fig. 4), it was found that the DPBF2 gene was specifically involved in the regulation of fatty acid production only in the seeds.

< Example  3> DPBF2  Over-expression transformant preparation and assay

<3-1> DPBF2  Production and selection of over-expressing transformants

The RNA isolated from Arabidopsis seeds for DPBF2 gene to produce a vector for overexpression in a plant using the RT-PCR method was amplified DPBF2 cDNA. The amplified cDNA was cloned into pRNTR-TOPO vector to construct pENTR-DPBF2 vector. PEarleyGate201 (11.7 kb), a plant expression vector containing the pENTR-DPBF2 vector and the 35S CaMV promoter, was cloned using the LR clonase reaction and DPBF2 A plant recombinant expression vector OX-DPBF2 vector in which the gene was overexpressed was prepared (Fig. 5). The plant expression vector was transformed into Agrobacterium GV3101, which was used to transform Arabidopsis thaliana. After that, OX-DPBF2 expression vector was inserted into the plant genome to select 7 transgenic T1 Arabidopsis plants resistant to herbicide (BASTA).

<3-2> DPBF2  Analysis of fatty acids in seeds of overexpressing transformants

Gas chromatography (GC) analysis was performed to analyze the fatty acid composition of T2 seeds obtained from the T1 transgenic Arabidopsis thaliana harvested from 7 individuals selected in Example <3-1> above.

As a result, the content of 18: 1 fatty acids increased from 13% to 15-16% in the seed fatty acids of the seven OX-DPBF2 transformants compared to that of the control wild type (WT) 3 fatty acids increased from 19-20% to 21-23%. In addition, 18: 2 fatty acids decreased from 32-34% to 28-31% (Table 3 and Figure 6). This result is in contrast to the result of the fatty acid composition change of the DPBF2 dysfunctional mutant plant ( dpbf2 -1 ) seed of Example 2, indicating that DPBF2, a transcription factor, regulates fatty acid composition in the seeds of plants I could.

Fatty acid WT # 1 WT # 2 OX-DPBF2 # 1 OX-DPBF2 # 2 OX-DPBF2 # 3 OX-DPBF2 # 4 OX-DPBF2 # 5 OX-DPBF2 # 6 OX-DPBF2 # 7 mol% SEM mol% SEM mol% SEM mol% SEM mol% SEM mol% SEM mol% SEM mol% SEM mol% SME 16: 0 8.9 0.13 8.5 0.06 8.8 0.06 8.5 0.13 8.6 0.05 8.8 0.33 9.4 0.03 9.2 0.02 9.0 0.0 18: 0 4.0 0.05 3.8 0.02 3.7 0.14 3.6 0.06 3.5 0.01 3.6 0.09 3.3 0.01 3.3 0.04 3.5 0.1 18: 1 13.0 0.06 13.7 0.04 15.2 0.26 15.6 0.12 15.1 0.01 15.5 0.19 15.7 0.11 16.3 0.06 15.1 0.1 18: 2 34.0 0.05 32.8 0.11 31.4 0.05 31.4 0.02 30.8 0.05 31.2 0.04 29.6 0.11 28.8 0.04 29.6 0.2 18: 3 19.2 0.11 20.5 0.05 21.1 0.44 20.6 0.15 21.6 0.04 20.5 0.09 23.7 0.04 23.7 0.11 23.0 0.1 20: 1 20.9 0.00 20.7 0.11 19.7 0.04 20.2 0.19 20.4 0.05 20.4 0.09 18.3 0.11 18.7 0.07 19.8 0.2

<110> REPUBLIC OF KOREA <120> Nucleotide for modify the content of fatty acids in seeds and uses          the <130> P131024 <160> 7 <170> Kopatentin 2.0 <210> 1 <211> 996 <212> DNA <213> Arabidopsis thaliana <400> 1 atgtcggttt tcgaatcgga gacttcgaac ttccacgtct acaacaacca cgaaatccaa 60 acgcaaccgc aaatgcaaac gtttctgtcg gaggaggaac cggtagggag acagaactcg 120 attttgtcac taactcttga cgaaattcag atgaaaagcg gtaagagctt tggagcgatg 180 aacatggacg agttcctagc gaacttgtgg acaaccgttg aagaaaacga caacgaagga 240 ggtggggctc acaacgacgg agagaagccg gcggtgctgc cacgtcaagg gtcgttgtcc 300 ctccctgtgc ctttatgcaa gaaaacggtc gacgaggttt ggctcgagat acaaaacggt 360 gtacaacaac atccaccgtc gtcgaattcc ggtcaaaact ccgccgaaaa tattcgccgg 420 caacaaaccc ttggtgagat cactctcgag gattttcttg ttaaggctgg tgttgtacaa 480 gaaccgttga agacaacgat gaggatgtcg agttctgatt ttggttataa ccccgagttt 540 ggagttggtt tacattgtca gaaccaaaac aattatggtg ataaccggtc ggtttatagt 600 gaaaaccgac cgttttactc ggttttggga gaatcttcaa gctgtatgac cgggaatggg 660 aggagtaatc agtatctgac cggtttagat gcttttcgga tcaagaaacg gataattgat 720 ggtccacctg aaattttgat ggagcggaga caacggcgaa tgattaaaaa ccgcgaatct 780 gcggctcggt ctcgagcccg gagacaagct tatactgtgg aactggagtt ggaattgaac 840 aacctcacgg aagaaaacac gaagctgaag gaaattgtgg aggaaaatga gaagaaaaga 900 agacaagaga taataagtag aagcaaacaa gtgactaaag agaagagcgg agacaaattg 960 agaaagattc ggaggatggc cagtgccggg tggtaa 996 <210> 2 <211> 331 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Ser Val Phe Glu Ser Glu Thr Ser Asn Phe His Val Tyr Asn Asn   1 5 10 15 His Glu Ile Gln Thr Gln Pro Gln Met Gln Thr Phe Leu Ser Glu Glu              20 25 30 Glu Pro Val Gly Arg Gln Asn Ser Ile Leu Ser Leu Thr Leu Asp Glu          35 40 45 Ile Gln Met Lys Ser Gly Lys Ser Phe Gly Ala Met Asn Met Asp Glu      50 55 60 Phe Leu Ala Asn Leu Trp Thr Thr Val Glu Glu Asn Asp Asn Glu Gly  65 70 75 80 Gly Gly Ala His Asn Asp Gly Glu Lys Pro Ala Val Leu Pro Arg Gln                  85 90 95 Gly Ser Leu Ser Leu Pro Val Pro Leu Cys Lys Lys Thr Val Asp Glu             100 105 110 Val Trp Leu Glu Ile Gln Asn Gly Val Gln Gln His Pro Pro Ser Ser         115 120 125 Asn Ser Gly Gln Asn Ser Ala Glu Asn Ile Arg Arg Gln Gln Thr Leu     130 135 140 Gly Glu Ile Thr Leu Glu Asp Phe Leu Val Lys Ala Gly Val Val Gln 145 150 155 160 Glu Pro Leu Lys Thr Thr Met Arg Met Ser Ser Asp Phe Gly Tyr                 165 170 175 Asn Pro Glu Phe Gly Val Gly Leu His Cys Gln Asn Gln Asn Asn Tyr             180 185 190 Gly Asp Asn Arg Ser Val Tyr Ser Glu Asn Arg Pro Phe Tyr Ser Val         195 200 205 Leu Gly Glu Ser Ser Ser Cys Met Thr Gly Asn Gly Arg Ser Asn Gln     210 215 220 Tyr Leu Thr Gly Leu Asp Ala Phe Arg Ile Lys Lys Arg Ile Ile Asp 225 230 235 240 Gly Pro Pro Glu Ile Leu Met Glu Arg Arg Gln Arg Arg Met Ile Lys                 245 250 255 Asn Arg Glu Ser Ala Ala Arg Ser Ala Arg Arg Gln Ala Tyr Thr             260 265 270 Val Glu Leu Glu Leu Glu Leu Asn Asn Leu Thr Glu Glu Asn Thr Lys         275 280 285 Leu Lys Glu Ile Val Glu Glu Asn Glu Lys Lys Arg Arg Gln Glu Ile     290 295 300 Ile Ser Arg Ser Lys Gln Val Thr Lys Glu Lys Ser Gly Asp Lys Leu 305 310 315 320 Arg Lys Ile Arg Arg Met Ala Ser Ala Gly Trp                 325 330 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> LBb1.3 primer <400> 3 attttgccga tttcggaac 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LP primer <400> 4 acgtgtaatt tcagcatcgg 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RP primer <400> 5 ctcggttttg ggagaatctt c 21 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> N-ter primer <400> 6 atgtcggttt tcgaat 16 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> C-ter primer <400> 7 ttaccacccg gcactggc 18

Claims (11)

A transformed plant transformed with a recombinant vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1.
[Claim 2] The transgenic plant according to claim 1, wherein the transgenic plant is characterized in that the content of oleic acid and linolenic acid in the seed is increased by overexpression of a transcription factor comprising the amino acid sequence of SEQ ID NO: 2, acid content of the transgenic plant is reduced.
The transgenic plant according to claim 1, wherein the plant is a Arabidopsis thaliana or an oil plant.
[4] The transgenic plant according to claim 3, wherein the preserved plant is selected from the group consisting of sesame, rapeseed, sunflower, castor bean, peanut, soybean, coconut, oil palm and jojoba.
A mutant plant wherein the function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1 is lost.
6. The mutant plant according to claim 5, wherein the mutant plant is deficient in the function of the gene by deletion, substitution or insertion of the gene of SEQ ID NO: 1.
[Claim 6] The mutant plant according to claim 5, wherein the mutant plant is characterized in that the content of oleic acid and linolenic acid in the seed is decreased and the content of linoleic acid is increased due to loss of function of the gene consisting of the nucleotide sequence of SEQ ID NO: Wherein the mutant plant is a mutant plant.
(1) preparing a recombinant vector comprising the gene consisting of the nucleotide sequence of SEQ ID NO: 1;
(2) transforming the recombinant vector of step (1) into a plant using Agrobacterium; And
(2) selecting a transformant.
(1) preparing a seed which has lost gene function through deletion, substitution or insertion of a gene consisting of the nucleotide sequence of SEQ ID NO: 1;
(2) The function of the gene consisting of the nucleotide sequence of SEQ ID NO: 1, which comprises the step of selecting a plant in which the gene deficient, substituted or inserted in plants obtained by culturing the seed of step (1) is homozygous A method for producing a lost mutant plant.
A method for producing oleic acid and linolenic acid comprising the step of obtaining oleic acid and linolenic acid from the seeds of the transgenic plant of claim 1.
A method for producing linoleic acid, comprising the step of obtaining a linoleic acid from the seed of the mutant plant of claim 5.

Images