KR20170069050A

KR20170069050A - Anti-inflammatory agent containing hydrolysates of semisulcospira libertina

Info

Publication number: KR20170069050A
Application number: KR1020150176273A
Authority: KR
Inventors: 김미령; 최재석; 김태욱
Original assignee: 신라대학교 산학협력단
Priority date: 2015-12-10
Filing date: 2015-12-10
Publication date: 2017-06-20

Abstract

본 발명은 다슬기 가수분해물을 유효성분으로 포함하는 항염 조성물에 관한 것이다. 상기 다슬기 가수분해물은 세포 독성이 없을 뿐만 아니라, 염증과 관련된 iNOS 및 COX-2의 mRNA의 전사 수준 및 단백질 함량을 확인한 결과, pH 7의 인산나트륨 완충액에 프로타맥스를 처리하여 가수분해한 가수분해물이 가장 효과적으로 염증을 저해할 수 있음을 확인하여 완성한 것으로, 이를 유효성분으로 포함하는 상기 항염 조성물은 염증과 관련된 질병에서 염증을 억제하는 항염증제 및 항염효과가 있는 화장료 조성물 등으로 응용될 수 있다.The present invention relates to a pharmaceutical composition comprising a polyglycolic acid hydrolyzate as an active ingredient. As a result of examining the transcription level and protein content of iNOS and COX-2 mRNA associated with inflammation as well as the cytotoxicity of the polyglycosylated hydrolyzate, the hydrolyzate of hydrolyzate obtained by treating protease in a sodium phosphate buffer at pH 7 The anti-inflammatory composition comprising the compound as an active ingredient can be applied as an anti-inflammatory agent for suppressing inflammation in inflammation-related diseases and a cosmetic composition having anti-inflammatory effect.

Description

ANTI-INFLAMMATORY AGENT CONTAINING HYDROLYSATES OF SEMISULCOSPIRA LIBERTINA < RTI ID = 0.0 >

본 발명은 항염효과가 있는 천연물, 구체적으로 다슬기 가수분해물을 유효성분으로 포함하는 항염 조성물에 관한 것이다.The present invention relates to an anti-inflammatory composition comprising a natural product having an anti-inflammatory effect, specifically, a hydrolyzate of a polyunsaturated fatty acid as an active ingredient.

염증은 외부에서 들어온 해로운 물질이나 유기체 등과 같은 여러 요인에 의하여 세포나 조직이 손상을 입거나 파괴되었을 때 그 손상을 최소화하고 손상된 부위를 원상으로 회복시키기 위하여 국소적으로 일어나는 면역반응으로서, 생체를 보호하고 조직 손상으로 생성된 산물들을 제거하는데 유용한 방어 메카니즘이다. 상기 방어 메카니즘에 의해, 결과적으로 통증, 부종, 발적 또는 발열 등이 일어나 기능장애가 유발되기도 한다. 상기 염증을 유발하는 여러 요인에는 외상, 화상, 동상, 방사능 등에 의한 물리적 요인, 산(acid)과 같은 화학물질에 의한 화학적 요인 및 항체반응에 의한 면역학적 요인들이 있으며, 그 외에 혈관이나 호르몬 불균형에 의해 발생되기도 한다.Inflammation is a localized immune response that minimizes the damage of a cell or tissue when it is damaged or destroyed by various factors, such as harmful substances or organisms from the outside, and restores the damaged area to the original state. And is a useful defense mechanism to remove the products produced by tissue damage. As a result, pain, swelling, redness, fever, or the like may occur as a result of the defensive mechanism, resulting in malfunction. Various factors causing inflammation include physical factors such as trauma, burn, bronze, radioactivity, chemical factors such as acid, and immunological factors due to antibody reaction. In addition, blood vessel and hormone imbalance .

상기 염증은 정상적인 경우에는 생체 내에서 염증반응을 통하여 발병 요인을 중화시키거나 제거하고 상한 조직을 재생시켜서 정상적인 구조와 기능을 회복시키는 작용을 하지만, 염증의 정도가 일정 수준 이상이 되거나 만성화되어 만성염증과 같은 질병 상태로 진행되는 경우 문제가 된다. 임상질환 가운데 거의 모든 질환에서 염증 반응을 관찰할 수 있을 뿐만 아니라, 과도하고 부적절한 염증반응이 진행되어, nitric oxide(NO)가 많이 생성되면, 염증 반응의 항진, 상처 치유의 억제, 신경조직 손상, 과도한 혈관확장에 의한 패혈성 쇼크 유발 등이 일어나게 된다. 또한, 최근 연구에 의하면 암발생과정(carcinogenesis)에서도 염증 반응과 관련된 효소들이 중요한 역할을 하는 것으로 알려져 있다.The inflammation normally functions to neutralize or eliminate the causative factor through in vivo inflammatory reaction and regenerate the upper tissue to restore the normal structure and function. However, when the degree of inflammation is over a certain level or becomes chronic, chronic inflammation And the like. In addition to being able to observe inflammatory responses in almost all diseases of clinical disease, excessive and inappropriate inflammatory reaction progresses and a large amount of nitric oxide (NO) is produced, resulting in hyperactivity of inflammation, inhibition of wound healing, Resulting in septic shock due to excessive vasodilatation. In addition, recent studies have shown that enzymes involved in the inflammatory response play an important role in carcinogenesis.

특히, 급성염증 반응은 외부물질의 자극에 의해 대식 세포에서 염증 반응의 전사 인자가 활성화되면, inducible nitric oxide synthase(iNOS), cyclooxygenase-2(COX-2)가 발현되어, nitric oxide(NO)와 prostaglandin E2(PGE2)가 생성됨으로써, 염증이 일어나는 메커니즘을 갖는다. In particular, the acute inflammatory response is caused by the induction of nitric oxide (NO) and inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) prostaglandin E2 (PGE2) is produced, so that inflammation takes place.

체내에서의 염증반응의 진행과 관련된 COX(cyclooxygenase) 효소는 생체 내에 존재하는 프로스타그란딘(prostaglandin)의 생합성에 관련하는 주 효소로서(Smith 등, J. Biol.Chem., 271, 33157(1996)), 두 종류의 이성 효소인 COX-1과 COX-2가 존재하는 것으로 알려져 있다. 상기 COX-1은 위나 신장과 같은 조직에 일정하게 존재하며, 정상적인 항상성을 유지하는데 관여하는 반면, 상기 COX-2는 염증이나 기타 면역 반응 시 세포분열인자(mitogen)나 사이토카인(cytokines)류에 의해 세포 내에서 일시적이고 빠르게 발현되는 효소이다.The cyclooxygenase (COX) enzyme involved in the progression of the inflammatory reaction in the body is the main enzyme involved in the biosynthesis of prostaglandin in vivo (Smith et al., J. Biol. Chem., 271, 33157 It is known that there are two kinds of isozyme enzymes, COX-1 and COX-2. The COX-1 is constantly present in tissues such as the stomach or kidney and is involved in maintaining normal homeostasis, while the COX-2 is involved in mitogen or cytokines in inflammation or other immune responses. Is a transient and rapidly expressed enzyme in the cell.

또 하나의 강력한 염증 매개물인 나이트릭 옥사이드(Nitric oxide, NO)는 NO 합성효소(NOS)에 의해 L-알지닌으로부터 생성되며, UV와 같은 외부 스트레스나 엔도톡신 또는 사이토카인과 같은 물질에 의해 많은 종류의 세포에서 생성된다. 상기와 같은 염증 자극들은 세포 내의 유도성 NOS(iNOS)의 발현을 증가시키고, 이를 통하여 세포내에서 NO 생성을 유도하여, 대식 세포를 활성화시킴으로써 염증 반응을 일으킬 수 있다.Another strong inflammatory mediator, nitric oxide (NO), is produced from L-arginine by NO synthase (NOS), and is produced by a variety of substances, such as UV, external stress, endotoxin or cytokines Lt; / RTI > cells. These inflammatory stimuli increase the expression of inducible NOS (iNOS) in the cells, thereby inducing NO production in the cells and activating the macrophages to cause an inflammatory reaction.

따라서, 최근 효과적인 염증 완화를 위하여, NO의 생성 및 COX-2 생성을 억제할 수 있는 물질에 대한 연구가 진행되고 있다. 그러나, 이러한 연구에 의해 개발된 항염물질의 경우 몇 가지 부작용이 문제되고 있다. 일 예로, 급성 또는 류마티스성 관절염과 같은 만성 염증 질환의 치료에 사용되는 비스테로이드성 소염 약물들은 COX-2 효소를 억제할 뿐만 아니라 COX-1 효소도 억제함으로써 위장관 장애와 같은 부작용을 나타내는 것으로 알려져 있다.Therefore, in order to effectively alleviate inflammation, researches on substances capable of inhibiting NO production and COX-2 production are underway. However, some side effects of anti-inflammatory substances developed by these studies are problematic. For example, non-steroidal anti-inflammatory drugs used in the treatment of chronic inflammatory diseases such as acute or rheumatoid arthritis are known to exhibit side effects such as gastrointestinal disorders by inhibiting COX-1 enzyme as well as inhibiting COX-2 enzyme .

한편, 일상생활에 사용되는 화장품은 피부를 보호하고 미화 청결을 위해 사용되는 제품이지만 화장품 조성물을 살펴보면 피부 보호 목적과는 상이한 성분들이 제품 형성에 필수 불가결한 존재로서 사용된다. 예를 들어, 계면활성제, 방부제, 향료, 자외선 차단제, 색소 및 기타 효능이나 효과를 부여하기 위해 쓰이는 여러 가지 성분들을 들 수 있다. 상기 화장품 제조에 필수적으로 사용되는 성분은 일반적으로 피부에 염증이나, 뾰루지 또는 부종 등과 여러 가지 부작용을 발생하는 것으로 알려져 있다.On the other hand, cosmetics used in everyday life are products used for protecting skin and cleansing the shine, but when the cosmetic composition is examined, ingredients different from the purpose of skin protection are used as indispensable substances for product formation. For example, surfactants, preservatives, fragrances, sunscreens, pigments, and other ingredients used to impart other benefits or effects. Ingredients that are essential for the manufacture of cosmetics are generally known to cause skin irritation, rashes, swelling, and various other side effects.

또한, 체내로부터 배출되는 피지 성분, 땀 성분 및 화장품 성분 중의 지방산, 고급 알코올, 단백질 등이 피부 상에 존재하는 피부 상재 균들에 의해 독성이 강한 물질로 분해되면, 이들에 의해 피부 염증이 유발될 수도 있으며, 태양으로부터 나오는 자외선에 의해서도 피부 염증이 유발된다는 것은 잘 알려진 사실이다.Further, when sebum components, sweat components, and fatty acids, higher alcohols, and proteins in cosmetic components, which are discharged from the body, are decomposed into highly toxic substances by skin-derived bacteria existing on the skin, they may cause skin inflammation It is well known that skin inflammation is caused by ultraviolet rays from the sun.

이렇듯 화장품에 있어서 피부 부작용 유발요인은 항상 잠재되어 있으며 이를 해결 하고자 여러 가지 연구가 진행되어 왔다. 현재까지 홍반이나 부종 같은 자극완화 및 염증 완화 목적으로 이용되고 있는 물질로는 비스테로이드계로 플루페나믹산(flufenamic acid), 이부프로펜(ibuprofen), 벤지다민(benzydamine), 인도메타신(indomethacin)등이 있고, 스테로이드계로는 프레드니솔론(prednisolone), 덱사메타손(dexamethasone) 등이 있으며, 알란토인, 아즈렌, ε-아미노키프론산, 하이드로코티존, 감초산 및 그 유도체(β-글리칠레친산, 글리칠레친산 유도체) 등이 항염증에 효과가 있는 것으로 알려져 있다.In this way, the causes of skin adverse effects in cosmetics are always present and various studies have been conducted to solve them. To date, substances that are used for irritation relief and inflammation relief such as erythema and edema include flutenamic acid, ibuprofen, benzydamine, indomethacin, , Steroids such as prednisolone and dexamethasone, and allantoin, azrene, epsilon-aminocaproic acid, hydrocotisone, licorice acid and its derivatives (? -Glycyrrhetinic acid, glycyrrhetinic acid derivative) It is known to be effective for anti-inflammation.

그러나, 일반적으로 항염제로 쓰이는 상기 인도메타신은 화장료에는 사용할 수 없는 물질이고, 상기 하이드로코티존은 사용량이 제한되어 있으며, 감초산 및 그 유도체는 안정화시키기 어렵거나 용해도가 좋지 않아 실제 적용 시 농도의 제한으로 인하여 실질적인 효과를 거두기가 어려운 점이 있는 등 지금까지 알려진 항염제는 피부안전성 면이나 화장료 배합시의 안정성 면에서 대부분 문제점을 가지고 있어서 그 사용이 제한되고 있다.However, the indomethacin generally used as an anti-inflammatory agent is a substance that can not be used in cosmetics. The amount of hydrocotisin is limited. The licorice acid and its derivatives are difficult to stabilize or have poor solubility, It is difficult to achieve a substantial effect. Thus, known anti-inflammatory agents have problems in terms of skin safety and stability in mixing cosmetics, and their use is limited.

그러므로, 천연물질 유래 물질로 이러한 부작용이나 세포독성에 대한 위험이 없거나 적으면서, 효과적으로 NO의 생성이나 COX-2의 발현을 억제할 수 있어 항염효과가 우수하여, 부작용 없이 염증을 억제할 수 있을 뿐만 아니라 그 함량의 제한 없이 화장품에 사용될 수 있는 물질의 개발이 요구되고 있다.Therefore, it is possible to inhibit the production of NO and the expression of COX-2 effectively, while having little or no risk for such side effects or cytotoxicity as a natural substance-derived substance, so that the anti-inflammatory effect is excellent and the inflammation can be suppressed without side effects However, there is a demand for development of a substance which can be used in cosmetics without limitation of its content.

특히, 최근에는 소비자들의 욕구에 부응하기 위하여 천연 원료를 이용한 화장료에 대한 연구개발이 활발히 진행되고 있는 실정이다.In recent years, in order to meet the needs of consumers, research and development of cosmetics using natural raw materials have been actively conducted.

KRKR 2013-00664742013-0066474 AA

상기와 같은 요구에 부응하기 위하여, 본 발명은 부작용과 관련된 문제가 발생될 가능성이 적은 천연물 유래 물질을 유효성분으로 하는 항염 조성물을 제공하는 것을 목적으로 한다.In order to meet such a demand, the present invention aims to provide a anti-inflammatory composition comprising a natural-substance-derived substance having a low possibility of causing a problem related to side effects as an active ingredient.

또한, 기존의 항염물질과 달리 식용으로 사용될 수 있는 천연물에서 비롯하여 부작용 등이 문제되지 아니하고, 안전성이 우수할 뿐만 아니라, 염증과 관련된 NO 생성을 억제할 수 있고, COX-2 발현을 억제할 수 있는 성분을 유효성분으로 포함하는 항염증제 또는 화장품 조성물을 제공하는 것을 목적으로 한다.In addition, there is no problem of side effects caused by natural substances that can be used for food, unlike existing anti-inflammatory substances, and it is not only excellent in safety, but also inhibits NO production associated with inflammation and inhibits COX-2 expression As an active ingredient, to provide an anti-inflammatory agent or a cosmetic composition.

상기 목적을 달성하기 위하여, 본 발명은 다슬기 가수분해물을 유효성분으로 포함하는 항염 조성물을 제공한다.In order to achieve the above object, the present invention provides a anti-inflammatory composition comprising a polyglycolic acid hydrolyzate as an active ingredient.

상기 다슬기 가수분해물, 구체적으로 프로타맥스(PROTAMEX)에 의해 가수분해된 다슬기 효소가수분해물은 다슬기 추출물 또는 다른 효소에 의해 가수분해된 다슬기 효소가수분해물에 비하여, NO 분비를 효과적으로 억제할 수 있고, COX-2의 발현을 억제할할 수 있을 뿐만 아니라, 천연물인 다슬기로부터 유래된 것으로 부작용이 문제될 가능성도 낮고, MTT 분석 결과 세포 독성도 낮은 것으로 확인되었다.The hydrolyzate of the polyglycerol hydrolyzate, specifically hydrolyzate of polyglycerol hydrolyzed by PROTAMEX, can effectively inhibit the secretion of NO, as compared with hydrolyzate of polyglycerol hydrolyzate hydrolyzed with polyglycerol or other enzymes, and COX -2 as well as the possibility that side effects are not a problem due to a natural product, and that the cytotoxicity of the MTT assay is low.

따라서, 본 발명의 항염 조성물은 항염증제의 유효성분 또는 염증을 억제하기 위한 목적으로 화장료 조성물의 유효성분으로 제공될 수 있다.Accordingly, the anti-inflammatory composition of the present invention can be provided as an effective ingredient of the cosmetic composition for the purpose of inhibiting the active ingredient of the anti-inflammatory agent or inflammation.

본 발명자들은 다슬기 가수분해물이 항염효과가 있으며, 특히 다슬기를 직접 프로타맥스(PROTAMEX)로 가수분해한 가수분해물이 다른 부위에 비하여 염증을 직접적으로 유도할 수 있는 NO의 분비를 효과적으로 억제할 수 있고, COX-2의 발현을 효과적으로 억제할 수 있다는 결과를 통하여, 다슬기 프로타맥스 효소가수분해물이 항염효과가 우수하다는 것을 확인하여 본 발명을 완성하였다. The present inventors have found that hydrolysates of hydrolysates of hydrolysates of hydrolysates of hydrolysates are effective for anti-inflammation, especially hydrolysates obtained by hydrolyzing the hydrolysates directly with PROTAMEX can effectively inhibit the secretion of NO, which can directly induce inflammation, , And COX-2 expression, the present inventors completed the present invention by confirming that the hydrolyzate of the prolonged protease enzyme hydrolyzate is excellent in anti-inflammatory activity.

이하, 본 발명을 보다 상세하게 설명한다. Hereinafter, the present invention will be described in more detail.

본 발명은 다슬기 가수분해물, 바람직하게는 다슬기 프로타맥스 효소가수분해물을 유효성분으로 포함하는 항염 조성물에 관한 것이다.The present invention relates to a anti-inflammatory composition comprising a polyhydric hydrolyzate, preferably a polyhydric protease enzyme hydrolyzate as an active ingredient.

상기 다슬기(Semisulcospira libertina)는 연체동물문 다슬기과에 속하는 연체동물로, 지방에 따라 고뎅이, 고동, 고디, 대사리, 올갱이 및 올뱅이 등으로 불리운다. The crossbone ( Semisulcospira libertina ) is a mollusc, which belongs to the mollusc family. It is also called molluscidae, rhododendron, gordi, larvae, grapevines, and oranges.

우리나라를 비롯한 일본, 대만 및 중국 등에 널리 분포해 있으며, 주로, 민물, 구체적으로 맑은 연못이나, 강, 개울, 호수 등에 주로 서식하고, 자갈이나 돌 밑에서 많이 서식하고, 돌 틈이나 모래 속에 숨어 있기도 한다. 자웅이체로 난태생이다. 주로 바위나 자갈에 붙어있는 부착조류, 물고기의 배설물, 하상에 퇴적된 유기물이나 수초 등을 먹고 산다.It is widely distributed in Korea, Japan, Taiwan and China. It mainly lives in fresh water, specially clean pond, river, stream, lake, etc. It lives in many places under gravel and stone, and hides in stone gaps and sand . It is an ovary with a diversion. Mainly eat attached birds attached to rocks and pebbles, excrement of fish, organic matter deposited in bed and aquatic plants.

상기 다슬기의 패각은 길쭉한 탑형으로 껍데기의 길이가 약 25 mm 내지 30 mm, 지름이 약 8 mm 내지 10 mm 정도이고, 그 표면은 황록색이나 황갈색 바탕에 흑갈색 또는 적갈색의 가로무늬가 있는 것이 보통이나 어두운 갈색인 것도 있다.The shell of the polygonum is an elongated tower having a shell length of about 25 mm to 30 mm and a diameter of about 8 mm to 10 mm and a surface having a dark brown or reddish brown transverse pattern on yellow- Some are brown.

상기 다슬기는 강이나 냇가에서 손쉽게 채취할 수 있는 패류이어서 일찍부터 우리나라에서 예로부터 식용으로 쓰이며, 주로 삶아서 가식부 즉, 살을 그대로 식용하거나 조리하여 식용하여 왔다.It is a shellfish that can be easily picked from a river or stream, and it has been used in Korea since ancient times for a long time. It has been cooked and cooked and edible as it is.

식용 외의 이용에는 민간요법으로 많이 이용되었다. 구체적으로, 동의보감이나 본초강목에서 다슬기는 간장과 신장에 작용해 갈증, 뱃속의 창, 눈의 충혈 등을 해소하며, 대소변을 잘 나가게 하고, 반위와 위 냉증 및 위통과 소화불량을 치료하며, 빈혈 치료 및 예방에 효과가 있고, 지방간, 간경화 등 간질환의 치료 및 간기능 회복에 도움이 되는 것으로 기록되어 있다. 특히, 다슬기의 푸른 색소가 사람의 간색소와 같은 뿌리를 지녔으므로 간을 이루는 세포에 좋다라고 다슬기에 대한 효능이 기록되어 있다. 현재, 다슬기와 관련된 연구는 기본적인 영양성분에 관한 연구나 조리법과 관련된 연구 외에 간 보호 효과에 대한 연구 위주로 진행되고 있으나, 전반적인 기능성과 관련된 연구는 충분히 이루어지지 않은 것으로 파악되며, 항염증에 관한 연구는 전혀 진행되지 않은 것으로 파악되었다. Non-food use was often used as a folk remedy. Specifically, in Dongbokbo or Gongcheon Gangmyeong, it acts on the liver and kidneys to relieve thirst, window of the stomach, and redness of the eyes, to make the feces go well, to treat the hemorrhoids, gastrointestinal disorders and stomach pain and digestive disorders, Treatment and prevention, and it is reported that it is useful for the treatment of liver diseases such as fatty liver, liver cirrhosis and recovery of liver function. Especially, it has been recorded that the blue pigment of the shoots has the same root as the human liver pigment, so it is good for the cells forming the liver. At present, studies related to hyperlipidemia are focused on research on basic nutritional components and the study of liver protection as well as on the study of recipes. However, studies on the overall functionality have not been conducted sufficiently, and studies on anti- It has been confirmed that it has not proceeded at all.

본 발명에서 가수분해물이란 단백질 분해 후 생산되는 물질로, 단백질가수분해산물이라고도 하고, 다슬기 가수분해물이란 다슬기 단백질이 단백질 가수분해효소에 의해 가수분해되어 생산되는 물질을 의미한다. 상기 단백질 가수분해효소는 단백질 분자 속의 펩티드 결합 등을 가수분해하여 단백질을 아미노산 또는 펩티드 혼합물로 만드는 화학반응을 수행하는 효소를 의미한다.In the present invention, the hydrolyzate refers to a substance produced after proteolysis. The protein is also referred to as a seaweed product, and the polyglycolic acid hydrolyzate refers to a substance produced by hydrolysis of polyglycolipids by a protein hydrolyzing enzyme. The protein hydrolyzing enzyme refers to an enzyme that performs a chemical reaction that hydrolyzes a peptide bond or the like in a protein molecule to convert the protein into an amino acid or a peptide mixture.

본 발명의 다슬기 가수분해물은 연체동물 또는 어패류 등의 가수분해물 제조를 위한 통상의 제조방법에 따라 제조된 것일 수 있으며, 바람직하게는 효소를 이용한 가수분해에 의해 제조된 것일 수 있다. 더욱 바람직하게는 본 발명의 다슬기 가수분해물은 껍질을 제거한 가식부 즉, 살에 완충액을 가한 후에, 단백질 가수분해 효소를 첨가하여 반응시키고, 상기 반응이 끝나면 효소를 불활성화 시킨 후에 불용물을 제거하며, 상기 불용물을 제거한 가수분해액을 동결건조하여 수득할 수 있다.The polyglycolic acid hydrolyzate of the present invention may be one prepared by a conventional production method for producing a hydrolyzate such as a mollusk or a fish or shellfish, and preferably one prepared by hydrolysis using an enzyme. More preferably, the polygalactosylated hydrolyzate of the present invention is prepared by adding a proteolytic enzyme to the edible part of the edible part, i.e., flesh, after removing the peel, and then reacting the protein hydrolyzed enzyme. After completion of the reaction, the enzyme is inactivated, The hydrolysis solution from which the insolubles are removed can be obtained by lyophilization.

이 때, 상기 완충액는 다슬기 1kg에 3,000ml에서 7,000ml, 더욱 바람직하게는 4,000ml에서 6,000ml를 첨가할 수 있고, 상기 완충액의 pH는 pH 6 내지 pH 8, 바람직하게는 pH 6.5 내지 pH 7.5일 수 있으며, 상기 단백질 가수분해 효소는 바람직하게는 프로타맥스(Protamax), 알카라제, 플라보자임(Flavourzyme), 브로멜라인(Bromelain), 피신(Ficin), 파파인(Papain), 뉴트라제(Neutrase) 및 프로테아제(Protease)로 이루어진 군중에서 선택된 하나 이상의 단백질 가수분해 효소, 더욱 바람직하게는 프로타맥스 효소일 수 있으며, 상기 프로타맥스 효소는 상기 다슬기 1kg 당 바람직하게는 0.1g 내지 2g, 더욱 바람직하게는 45 g 내지 55 g을 첨가할 수 있다.At this time, the buffer solution may be added at a rate of 3,000 ml to 7,000 ml, more preferably 4,000 ml to 6,000 ml, to 1 kg of the supernatant, and the pH of the buffer may be pH 6 to pH 8, preferably pH 6.5 to pH 7.5 The protein hydrolyzing enzyme is preferably selected from the group consisting of Protamax, Alkalase, Flavourzyme, Bromelain, Ficin, Papain, Neutrase, ) And a protease, more preferably a protease enzyme, and the protease enzyme is preferably 0.1 g to 2 g, more preferably 0.1 g to 2 g, 45 g to 55 g may be added.

상기 효소 반응은 효소의 종류에 따라 적절하게 수행될 수 있으며, 바람직하게는 40℃ 내지 60℃ 더욱 바람직하게는 47℃ 내지 53℃의 교반 배양기(shaking incubator)에서 1시간 내지 24시간, 바람직하게는 5시간 내지 15시간, 더욱 바람직하게는 9시간 내지 11시간을 반응시킬 수 있다.The enzyme reaction may be suitably carried out according to the kind of the enzyme, preferably in a shaking incubator at 40 to 60 DEG C, more preferably 47 to 53 DEG C for 1 to 24 hours, 5 hours to 15 hours, more preferably 9 hours to 11 hours.

상기 효소의 불활성화는 효소의 종류에 따라 적절하게 선택된 통상의 방법으로 수행될 수 있고, 80℃ 내지 120℃, 바람직하게는 90℃ 내지 110℃, 더욱 바람직하게는 95℃ 내지 105℃에서 1분 내지 30분, 바람직하게는 5분 내지 20분, 더욱 바람직하게는 15분간 가열처리하여 수행할 수 있다.The inactivation of the enzyme may be carried out by a conventional method appropriately selected depending on the kind of the enzyme and is performed at a temperature of 80 to 120 캜, preferably 90 to 110 캜, more preferably 95 to 105 캜 for 1 minute To 30 minutes, preferably 5 minutes to 20 minutes, more preferably 15 minutes.

상기 가수분해물의 수득은 상기 다슬기 가수분해과정을 수행한 다슬기 가수분해액을 1℃ 내지 9℃, 바람직하게는 3℃ 내지 5℃, 더욱 바람직하게는 4℃에서, 1,000 rpm 내지 10,00rpm, 바람직하게는 2,500rpm 내지 7,500rpm, 더욱 바람직하게는 4,500rpm으로 1분 내지 30분, 바람직하게는 5분 내지 20분, 더욱 바람직하게는 10분간 원심분리한 후, 상등액만 수득하는 방법으로 수행할 수 있다.The hydrolyzate is obtained by reacting the polyhydric hydrolyzate subjected to the polyhydric hydrolysis step at a temperature of 1 to 9 DEG C, preferably 3 to 5 DEG C, more preferably 4 to DEG C, at 1,000 to 10,00 rpm, Followed by centrifugation at 2,500 rpm to 7,500 rpm, more preferably 4,500 rpm for 1 minute to 30 minutes, preferably 5 to 20 minutes, more preferably 10 minutes, and then only the supernatant is obtained have.

상기 수득한 다슬기 가수분해물은 급속 냉동 냉장고(deep freezer)를 이용하여 보관할 수 있다. 또한, 상기 다슬기 가수분해물은 수득된 가수분해물을 농축 및 동결건조를 통하여 수분이 완전히 제거된 것일 수 있다.The obtained tetrahydrolysates can be stored using a deep freezer. In addition, the polyhydric hydrolyzate may be obtained by completely removing moisture through concentration and lyophilization of the obtained hydrolyzate.

본 발명의 다슬기 가수분해물을 10 ㎍/㎖를 처리한 경우 LPS에 의해 유도된 iNOS의 생성 및 COX-2의 mRNA생성을 유의적으로 감소시키고, 1,000 ㎍/㎖를 처리한 경우, iNOS의 mRNA생성을 약 50%, iNOS의 생성을 약 20% 수준으로 감소시키며, 100 ㎍/㎖를 처리한 경우에 COX-2의 mRNA생성을 약 60% 미만으로 감소시켜 현저하게 우수한 항염 효과를 갖는 것으로 확인되었다.When treated with 10 μg / ml of the hydrolyzate of the present invention, the production of iNOS induced by LPS and the production of mRNA of COX-2 were significantly reduced and 1,000 μg / ml of iNOS produced mRNA To about 50%, and the production of iNOS to about 20%, and when it was treated with 100 μg / ml, the mRNA production of COX-2 was reduced to less than about 60% .

한편, 다슬기 가수분해물은 MTT 분석결과 1,000 ㎍/㎖의 농도를 처리한 경우에도 세포 독성이 없는 것으로 확인되었다.On the other hand, MTT analysis of the hydrolyzate of the polyglycerol showed no cytotoxicity even when treated with a concentration of 1,000 μg / ml.

따라서 상기 항염 조성물은 염증을 억제하거나 염증을 치료 또는 예방하기 위하여 사용될 수 있다. 상기 염증은 일반적인 염증질환을 포함하는 개념이며, 일 예로 상기 염증질환은 각종 피부염, 알레르기, 전신성 홍반성 낭창, 망막염, 위염, 간염, 장염, 췌장염 및 신장염으로 이루어진 군 중에서 선택된 1종 이상일 수 있고, 상기 알레르기는 과민증(anaphylaxis), 알러지성 비염(allergic rhinitis), 천식(asthma), 알러지성 결막염, 알러지성 피부염, 아토피성 피부염(atopic dermatitis), 접촉성 피부염, 두드러기(urticaria), 곤충 알러지, 식품 알러지 및 약품 알러지를 포함한다. 따라서, 본 발명의 항염 조성물은 염증질환의 치료 또는 예방용 조성물로 응용되거나, 상기 염증질환의 예방 또는 개선용 식품조성물로 응용될 수 있다. 상기 식품조성물은 일 예로 상기 염증질환의 예방 또는 개선을 위한 건강기능식품 조성물일 수 있다.Therefore, the anti-inflammatory composition can be used to suppress inflammation or to treat or prevent inflammation. The inflammation may include one or more selected from the group consisting of various dermatitis, allergy, systemic lupus erythematosis, retinitis, gastritis, hepatitis, enteritis, pancreatitis and nephritis, The allergies may be selected from the group consisting of anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, atopic dermatitis, contact dermatitis, urticaria, Allergies and drug allergies. Accordingly, the anti-inflammatory composition of the present invention can be applied as a composition for treating or preventing inflammatory diseases or as a food composition for preventing or ameliorating the inflammatory diseases. The food composition may be, for example, a health functional food composition for preventing or ameliorating the inflammatory disease.

상기 건강기능식품은 식품에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 식품의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 식품군이나 식품 조성이 갖는 생체방어리듬조절, 질병방지와 회복 등에 관한 체조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 식품을 의미한다. 상기 건강기능식품에는 식품학적으로 허용 가능한 식품 보조 첨가제를 포함할 수 있으며, 건강기능식품의 제조에 통상적으로 사용되는 적절한 담체, 부형제 및 희석제를 더욱 포함할 수 있다.The above-mentioned health functional foods are used to control the bio-defense rhythm of the food group or the food composition imparted with added value to function and express the function of the relevant food by physical, biochemical and biotechnological techniques, Means a food which is processed and designed so that the body controlling function of the body is sufficiently expressed to the living body. The health functional food may include food-acceptable food supplementary additives, and may further include suitable carriers, excipients and diluents conventionally used in the production of health functional foods.

본 발명의 염증질환의 예방 또는 개선용 건강기능식품 조성물은 상기 다슬기 가수분해물을 전체 식품 중량의 0.001 중량% 내지 99.9 중량% 또는 0.01 중량% 내지 50 중량% 또는 0.1 중량% 내지 30 중량% 또는 0.1 중량% 내지 15 중량% 포함될 수 있다.The health functional food composition for preventing or ameliorating an inflammatory disease according to the present invention comprises 0.001 to 99.9% by weight or 0.01 to 50% by weight or 0.1 to 30% by weight or 0.1% by weight, % To 15% by weight.

상기 다슬기 가수분해물을 유효성분으로 포함하는 항염 조성물은 인간을 포함한 동물에 직접 적용될 수 있다. 상기 동물은 식물에 대응하는 생물군으로 주로 유기물을 영양분으로 섭취하고, 소화기관, 배설기관 및 호흡기관이 분화되어 있는 것을 말하며, 바람직하게는 포유류, 더욱 바람직하게는 인간일 수 있다.The anti-inflammatory composition comprising the polyglycolic acid hydrolyzate as an active ingredient can be directly applied to animals including humans. The animal is a group of organisms corresponding to plants. It mainly consumes organic matter as nutrients, and differentiates digestive organs, excretory or respiratory organs. Preferably, it is a mammal, more preferably a human.

상기 다슬기 가수분해물은 상기 항염 조성물 내에 단독으로 사용될 수 있으며, 그 외 약리학적으로 허용가능한 담체, 부형제, 희석제 또는 부성분을 추가로 포함할 수 있다. 보다 상세하게는, 상기 다슬기 가수분해물을 포함하는 조성물이 약제로 사용되거나, 의약 또는 약학적 용도로 사용되는 경우, 상기 다슬기 가수분해물은 통상적인 방법에 따라 약학적으로 허용되는 담체 또는 부형제와 혼합하거나 희석제로 희석하여 사용될 수 있다.The tetrahydrolysates may be used alone in the anti-inflammatory composition, and may further include other pharmacologically acceptable carriers, excipients, diluents or subcomponents. More specifically, when the composition containing the polyhydric hydrolyzate is used as a medicine or used for pharmaceutical or pharmaceutical purposes, the polyhydric hydrolyzate is mixed with a pharmaceutically acceptable carrier or excipient according to a conventional method It can be used diluted with diluent.

이 경우 상기 조성물 내 다슬기 가수분해물의 함량은 0.001 중량 % 내지 99.9 중량 %, 0.1 중량% 내지 99 중량% 또는 1 중량% 내지 50 중량%일 수 있으나, 이에 한정되는 것은 아니며, 조성물의 사용태양 및 사용방법에 따라 상기 화합물의 함량은 바람직한 함량으로 적절히 조절하여 사용될 수 있다. In this case, the content of the polyhydric hydrolyzate in the composition may be 0.001 to 99.9% by weight, 0.1 to 99% by weight or 1 to 50% by weight, but is not limited thereto. Depending on the method, the content of the compound may be suitably adjusted in a desired amount.

상기 약학적으로 허용되는 담체, 부형제 또는 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐 피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유, 덱스트린, 칼슘카보네이트, 프로필렌글리콜, 리퀴드 파라핀 및 생리식염수로 이루어진 군에서 선택된 1 이상을 들 수 있으나, 이에 한정되는 것은 아니며 통상의 담체, 부형제 또는 희석제 모두 사용가능하다. 또한, 상기 약학 조성물은 통상의 충진제, 증량제, 결합제, 붕해제, 항응집제, 윤활제, 습윤제, pH 조절제, 영양제, 비타민, 전해질, 알긴산 및 그의 염, 펙트산 및 그의 염, 보호성 콜로라이드, 글리세린, 향료, 유화제 또는 방부제 등을 추가로 포함할 수 있다. 상기 성분들은 상기 유효성분인 다슬기 가수분해물에 독립적으로 또는 조합하여 추가될 수 있다.Examples of the pharmaceutically acceptable carrier, excipient or diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, propylhydroxybenzoate, talc, magnesium stearate and mineral oil , Dextrin, calcium carbonate, propylene glycol, liquid paraffin, and physiological saline. However, the present invention is not limited thereto, and any conventional carrier, excipient or diluent may be used. In addition, the pharmaceutical composition may further comprise at least one selected from the group consisting of conventional fillers, extenders, binders, disintegrants, anticoagulants, lubricants, humectants, pH adjusters, nutrients, vitamins, electrolytes, alginic acid and its salts, pectic acid and its salts, , Fragrances, emulsifiers, preservatives, and the like. The components may be added independently or in combination with the active ingredient, the tetrahydrolysate.

또한, 본 발명의 조성물은 상기 유효성분 이외에 공지의 항염효과가 있는 것으로 인정된 물질, 일 예로 COX-2 저해제, NO 저해제 또는 항염증제 등으로 사용되는 물질을 더욱 포함할 수 있다.In addition, the composition of the present invention may further comprise a substance used as a known substance having a known anti-inflammatory effect, for example, a substance used as a COX-2 inhibitor, an NO inhibitor, or an anti-inflammatory agent.

상기 조성물이 약제로 사용하는 경우 투여방법은 경구 또는 비경구 모두 가능하며, 일 예로는 경구, 경피, 피하, 정맥 또는 근육을 포함한 여러 경로를 통해 투여될 수 있다.When the composition is used as a medicine, it can be administered orally or parenterally. In one example, it can be administered through various routes including oral, transdermal, subcutaneous, intravenous or muscular.

또한, 상기 조성물의 제형은 사용방법에 따라 달라질 수 있으며, 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 본 발명이 속하는 기술분야에 잘 알려진 방법을 사용하여 제형화될 수 있다. 일반적으로는, 경구 투여를 위한 고형제제에는 정제(TABLETS), 알약, 연질 또는 경질 캅셀제(CAPSULES), 환제(PILLS), 산제(POWDERS) 및 과립제(GRANULES) 등이 포함되고, 이러한 제제는 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상 제제로는 현탁제(SUSTESIONS), 내용액제, 유제(EMULSIONS) 및 시럽제(SYRUPS) 등이 해당되는데, 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제 예를 들면, 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. In addition, the formulations of the compositions may vary depending on the method of use and may be formulated using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal . In general, solid dosage forms for oral administration include tablets, pills, soft or hard capsules, pills, powders and granules, which may contain one or more Excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, Sweeteners, fragrances, preservatives, and the like.

비경구투여를 위한 형태는 크림(CREAM), 로션제(LOTIONS), 연고제(ONITMENTS), 경고제(PLASTERS), 액제(LIQUIDS AND SOULTIONS), 에어로솔제(AEROSOLS), 유동엑스제(FRUIDEXTRACTS), 엘릭서(ELIXIR), 침제(INFUSIONS), 향낭(SACHET), 패취제(PATCH) 또는 주사제(INJECTIONS) 등의 형태일 수 있다.Forms for parenteral administration include creams, looses, ONITMENTS, PLASTERS, LIQUIDS AND SOULTIONS, AEROSOLS, FRUIDEXTRACTS, (ELIXIR), INFUSIONS, SACHET, PATCH or INJECTIONS.

더 나아가, 본 발명의 조성물은 당해 기술 분야의 공지된 적절한 방법을 사용하여 또는 레밍턴의 문헌(Remington's Pharmaceutical Science(최근판), Mack Publishing Company, Easton PA)에 개시되어 있는 방법을 이용하여 제형화될 수 있다.Furthermore, the compositions of the present invention may be formulated using any suitable method known in the art or using methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA .

상기 조성물의 투여량은 투여방법, 복용자의 연령, 성별, 환자의 중증도, 상태, 체내에서 활성 성분의 흡수도, 불활성률 및 병용되는 약물을 고려하여 결정할 수 있으며, 일 예로 1일 유효성분을 기준으로 하였을 때 0.1 mg/kg(체중) 내지 500 mg/kg(체중), 0.1 mg/kg(체중) 내지 400 mg/kg(체중) 또는 1 mg/kg(체중) 내지 300 mg/kg(체중)으로 투여할 수 있으며, 1회 또는 수회로 나누어 투여할 수 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.The dosage of the composition may be determined in consideration of the administration method, the age, sex, the severity of the patient, the condition of the patient, the degree of absorption of the active ingredient in the body, the inactivity and the drug to be used in combination. Kg body weight to 500 mg / kg body weight, 0.1 mg / kg body weight to 400 mg / kg body weight or 1 mg / kg body weight to 300 mg / kg body weight, And may be administered once or several times in divided doses. The dose is not intended to limit the scope of the invention in any way.

본 발명은 또한, 상기 다슬기 가수분해물을 유효성분으로 포함하는 항염 조성물 또는 다슬기 가수분해물을 유효성분으로 포함하는 항염증제를 제공한다.The present invention also provides an anti-inflammatory agent comprising an anti-inflammatory composition or a polyhydric hydrolyzate containing the above-mentioned polyunsaturated hydrolyzate as an active ingredient as an active ingredient.

상기 다슬기 가수분해물은 바람직하게는 다슬기 프로타맥스 가수분해물일 수 있다. The tetrahydrolysates may preferably be polyglycolipids hydrolysates.

상기 항염증제는 상기 유효성분을 단독으로 포함할 수 있으며, 이외 제형, 사용방법 및 사용목적에 따라 약제학적으로 허용가능한 담체 또는 부형제를 더욱 포함할 수 있다. 혼합물로 제공되는 경우, 상기 유효성분은 항염증제 전체에 대해 0.1 중량% 내지 99.9 중량%로 포함될 수 있으나, 통상 0.001 중량% 내지 50 중량%의 함량으로 포함되는 것이 일반적이다.The anti-inflammatory agent may include the active ingredient alone, and may further include a pharmaceutically acceptable carrier or excipient depending on the formulation, the method of use, and the intended use. When provided as a mixture, the active ingredient may be contained in an amount of 0.1% by weight to 99.9% by weight based on the whole anti-inflammatory agent, but is usually contained in an amount of 0.001% by weight to 50% by weight.

상기 항염제는 류마티스 관절염, 루푸스, 다발성 경화증과 같은 각종 만성 염증 질환, 패혈증, 쇼크, 장기이식의 거부반응과 같은 각종 급성 염증 질환, 안과질환, 기관지염, 또는 염증성 장질환의 예방 및 치료의 목적으로 사용가능하다.The anti-inflammatory agent is used for the prevention and treatment of various acute inflammatory diseases such as rheumatoid arthritis, lupus, multiple sclerosis such as various chronic inflammatory diseases, septicemia, shock, rejection of organ transplantation, ophthalmic diseases, bronchitis or inflammatory bowel disease It is possible.

상기 담체 또는 부형제의 일예로는 물, 덱스트린, 칼슘카보네이드, 락토스, 프로필렌글리콜, 리퀴드 파라핀, 생리식염수, 덱스트로스, 수크로즈, 솔비톨, 만니톨, 자이리톨, 에리스리톨, 말티톨, 전분, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 폴리비닐피롤리돈, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유가 있으나, 이에 한정되는 것은 아니다. 담체 또는 부형제는 2종이상 사용될 수 있다. Examples of the carrier or the excipient include water, dextrin, calcium carbonate, lactose, propylene glycol, liquid paraffin, physiological saline, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gelatin, calcium phosphate, But are not limited to, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. Two or more carriers or excipients may be used.

또한 항염증제를 약제화하는 경우, 통상의 충진제, 증량제, 결합제, 붕해제, 계면활성제, 항응집제, 윤활제, 습윤제, 향료, 유화제 또는 방부제 등을 더욱 포함할 수 있다.In addition, when the anti-inflammatory agent is weakly formulated, it may further contain conventional fillers, extenders, binders, disintegrants, surfactants, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers or preservatives.

또한 본 발명의 항염증제는, 상기 유효성분 이외에 공지의 항염활성을 갖는 화합물 또는 식물 추출물을 더욱 포함할 수 있으며, 상기 유효성분 100 중량부에 대하여 각각 5 중량부 내지 20 중량부로 포함될 수 있다.In addition, the anti-inflammatory agent of the present invention may further comprise a compound having a known anti-inflammatory activity, or a plant extract, in addition to the active ingredient, and may be included in an amount of 5 to 20 parts by weight based on 100 parts by weight of the active ingredient.

항염증제의 제형은 사용방법에 따라 바람직한 형태일 수 있으며, 특히 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 공지된 방법을 채택하여 제형화할 수 있다. 구체적인 제형의 예로는 경고제, 과립제, 로션제, 리니멘트제, 리모나데제, 산제, 시럽제, 안연고제, 액제, 에어로솔제, 엑스제(EXTRACTS), 엘릭실제, 연고제, 유동엑스제, 유제, 현탁제, 전제, 침제, 점안제, 정제, 좌제, 주사제, 주정제, 캅셀제, 크림제, 환제, 연질 또는 경질 젤라틴 캅셀 등이 있다.The formulations of anti-inflammatory agents may be in their preferred forms depending on the method of use, and may be formulated employing methods known in the art to provide rapid, sustained or delayed release of the active ingredient, especially after administration to the mammal. Exemplary formulations include, but are not limited to, excipients, granules, lotions, liniments, rimonadense, powders, syrups, ointments, liquids, aerosols, EXTRACTS, elixirs, ointments, Suspensions, premixes, infusions, eye drops, tablets, suppositories, injections, main tablets, capsules, creams, pills, soft or hard gelatin capsules.

본 발명에 따른 항염증제는 경구 또는 비경구로 사용될 수 있으며, 예컨대 진피내, 근육내, 복막내, 정맥내, 피하내, 코안, 경막외 및 구강경로를 통하여 사용될 수 있으며, 이의 투여량은, 투여방법, 복용자의 연령, 성별 및 체중, 및 질환의 중증도 등을 고려하여 결정하는 것이 좋다. 일예로, 본 발명의 항염증제는 유효성분을 기준으로 하였을 때 1일 0.1 ㎎/㎏(체중) 내지 100 ㎎/㎏(체중)으로 1회 이상 투여가능하다. 그러나 상기한 투여량은 예시하기 위한 일예에 불과하며 상기 범위에 한정되지는 않는다.The anti-inflammatory agent according to the present invention may be used orally or parenterally and may be used, for example, through the intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intramuscular, epidural and oral routes, , The age, sex, and weight of the recipient, and the severity of the disease. For example, the anti-inflammatory agent of the present invention can be administered once or more at 0.1 mg / kg (body weight) to 100 mg / kg (body weight) per day based on the active ingredient. However, the above-mentioned dosage is only for illustrative purposes and is not limited to the above range.

본 발명은 또한, 상기 다슬기 가수분해물을 유효성분으로 포함하는 항염 조성물 또는 다슬기 가수분해물을 유효성분으로 포함하는 화장료 조성물을 제공한다.The present invention also provides a cosmetic composition comprising an anti-inflammatory composition or a polyhydric hydrolyzate containing the above-described polyunsaturated hydrolyzate as an active ingredient as an active ingredient.

상기 다슬기 가수분해물은 천연물질 유래이므로 부작용이 문제되지 아니하고, 세포독성도 없을 뿐만 아니라, 염증 억제 효과가 뛰어나기 때문에 항염 및 항자극 활성이 뛰어나므로, 화장품에 포함된 성분들에 의해 유도되는 염증 및 외부 환경에 의해 유도되는 염증을 효과적으로 제어할 수 다. 따라서, 상기 다슬기 가수분해물을 유효성분으로 포함하는 항염 조성물 또는 다슬기 가수분해물은 염증 개선 및 완화효과를 갖는 화장료 조성물의 유효성분으로 사용될 수 있다.Since the polyglycosylated hydrolyzate is derived from a natural substance, it has no side effects, is not cytotoxic, and has excellent anti-inflammatory and anti-irritating activity because it has excellent inflammation inhibitory effect. Therefore, And can effectively control the inflammation induced by the external environment. Accordingly, the anti-inflammatory composition or the polyhydric hydrolyzate containing the polyglycolic acid hydrolyzate as an active ingredient can be used as an effective ingredient of a cosmetic composition having an inflammation improving and alleviating effect.

상기 다슬기 가수분해물은 바람직하게는 다슬기 프로타맥스 가수분해물일 수 있다.The tetrahydrolysates may preferably be polyglycolipids hydrolysates.

상기 화장료 조성물은 기초 화장료, 메이크업 화장료, 바디 화장료, 두발용 화장료, 두피용 화장료, 면도용 화장료 또는 구강용 화장료의 용도로 제공될 수 있다.The cosmetic composition may be used as a cosmetic composition for basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, shaving cosmetics or oral cosmetics.

상기 기초 화장료의 예로는 크림, 화장수, 팩, 마사지 크림, 유액 등이 있고, 상기 메이크업 화장료의 예로는 파운데이션, 메이크업 베이스, 립스틱, 아이섀도, 아이라이너, 마스카라, 아이브로우 펜슬 등이 있으며, 상기 바디 화장료의 예로는 비누, 액체 세정제, 입욕제, 선스크린 크림, 선 오일 등이 있고, 상기 두발용 화장료의 예로는 샴푸, 린스, 헤어 트리트먼트, 헤어 무쓰, 헤어 리퀴드, 포마드, 헤어 칼라제, 헤어 블리치제 또는 칼라 린스 등이 있으며, 상기 두피용 화장료의 예로는 헤어 토닉 또는 스칼프 트리트먼트 등이 있고, 상기 면도용 화장료의 예로는 애프터셰이브로션 또는 셰이빙 크림 등이 있으며, 상기 구강용 화장료의 예로는 치약 또는 마우스 워셔 등이 있다.Examples of the cosmetic cosmetic include a cream, a lotion, a pack, a massage cream, and a milky lotion. Examples of the cosmetic cosmetic include a foundation, a makeup base, a lipstick, an eye shadow, an eyeliner, a mascara, an eyebrow pencil, Examples of the cosmetic material include soap, liquid cleansing agent, bathing agent, sunscreen cream, and sun oil. Examples of the cosmetic for hair include shampoo, rinse, hair treatment, hair mousse, hair liquid, pomade, hair color, hair bleach Examples of the cosmetic composition for scalp include hair tonic or scarf treatment, and examples of the cosmetic composition for shaving include aftershave lotion or shaving cream. Examples of the oral cosmetic composition include Toothpaste or mouth washer.

상기 화장료 조성물에는 유효성분 외에 사용용도 및 화장료 조성물의 성질에 따라 통상 화장료 조성물에 배합되고 있는 성분, 일예로 보습제, 자외선 흡수제, 비타민류, 동식물 추출성분, 소화제, 미백제, 혈관확장제, 수렴제, 청량제, 호르몬제 등을 추가로 배합될 수 있다. 또한, 상기 화장료 조성물은 약물 또는 유효성분을 피부조직으로 침투 또는 이행시키기 위해서 필요한 기제를 추가로 포함할 수 있다. The cosmetic composition may contain, in addition to the active ingredient, a component incorporated in the cosmetic composition, for example, a moisturizer, an ultraviolet absorber, a vitamin, an animal or plant extract, a digestive agent, a whitening agent, a vasodilator, Hormones and the like may be further added. In addition, the cosmetic composition may further include a medicament or a mechanism necessary for infiltrating or transferring the active ingredient into the dermal tissue.

상기 화장료 조성물의 제형은 사용용도 및 화장료 조성물의 성질에 따라 적절한 형태를 취할 수 있으며, 일예로 수용액계, 가용화계, 유화계, 유액계, 겔계, 페이스트계, 연고계, 에어졸계, 물-기름 2층계 또는 물-기름-분말 3층계일 수 있으며, 상기 제형의 예는 단순한 예시일 뿐, 상기 예시에 의해 본 발명의 화장료 조성물의 제형 및 형태가 제한되는 것은 아니다.The formulation of the cosmetic composition may take any appropriate form depending on the intended use and the properties of the cosmetic composition. Examples of the formulation include an aqueous solution, a solubilization system, an emulsion system, an emulsion system, a gel system, a paste system, an ointment system, A two-layer system or a water-oil-powder three-layer system. Examples of the formulations are merely illustrative, and the formulations and forms of the cosmetic composition of the present invention are not limited by the above examples.

상기 유효성분은 상기 화장료 조성물 총 중량을 기준으로 0.001 중량% 내지 50 중량%로 포함될 수 있으며, 바람직하기로는 0.01 중량% 내지 20 중량%일 수 있으나, 상기 함량은 제형 또는 화장료 조성물에 함유되는 유효성분외의 성분의 함량에 따라 적절히 조절할 수 있으며, 상기 함량에 의해 본 발명에 포함되는 유효성분의 함량이 제한되는 것은 아니다.The active ingredient may be contained in an amount of 0.001 to 50% by weight, preferably 0.01 to 20% by weight, based on the total weight of the cosmetic composition, , And the content of the active ingredient contained in the present invention is not limited by the above content.

본 발명의 다슬기 가수분해물은 식용으로 사용되는 동물 유래 가수분해물로서 부작용이나 안전성에 대한 문제가 없고, MTT 분석 결과, 세포 독성이 없을 뿐만 아니라, 염증과 관련된 iNOS 및 COX-2의 발현 및 mRNA의 전사여부를 통하여 확인한 결과, 효과적으로 염증을 저해할 수 있는 것으로 확인되었다. 따라서, 상기 다슬기 가수분해물을 유효성분으로 포함하는 항염 조성물은 염증을 억제하여 염증과 관련된 질병을 치료 또는 예방하기 위한 항염증제 및 특정 제형 등과 관련하여 화장품 제조에 필수적으로 사용되는 성분 또는 외부환경으로 인한 피부의 염증을 효과적으로 억제할 수 있는 특징을 갖는 화장료 조성물 등에 응용될 수 있다. 그러므로, 본 발명은 염증과 관련된 질병에 대한 치료와 관련된 의료산업 및 피부염증의 제어와 관련된 화장품 산업의 분야에서 널리 사용될 수 있다.The hydrolyzate of the present invention is an animal-derived hydrolyzate which is used as an edible animal and has no side effects or safety problems. As a result of MTT analysis, it is not only cytotoxic, but also expresses iNOS and COX-2 associated with inflammation, , It was confirmed that it can effectively inhibit inflammation. Accordingly, the anti-inflammatory composition comprising the polyglycolic acid hydrolyzate as an active ingredient is useful as an anti-inflammatory agent for treating or preventing inflammation-related diseases by inhibiting inflammation, a component that is essential for cosmetic preparation, Can be effectively applied to cosmetic compositions and the like that have a characteristic of being able to effectively inhibit inflammation. Therefore, the present invention can be widely used in the medical industry related to the treatment of diseases related to inflammation and in the field of the cosmetic industry related to control of skin inflammation.

도 1은 본 발명의 일 실시예에 따른, RAW264.7 세포주를 이용하여, 다슬기 가수분해물(Protamex(Buffer system)) 및 다슬기 증류수 가수분해물(Protamex(D.W system))의 세포독성을 확인한 결과를 나타낸 그래프로, Control은 LPS를 처리하지 않았다는 것을 의미하며, 가로축의 수치는 다슬기 가수분해물의 투여량(㎍/mL)을 의미하고, 세로축은 LPS 미처리 대조군 대비 세포 생존률(%)을 의미한다.
도 2는 본 발명의 일 실시예에 따른, 다슬기 가수분해물(Protamex(Buffer system)) 및 다슬기 증류수 가수분해물(Protamex(D.W system))의 항염 효과를 iNOS의 mRNA 함량 및 단백질 함량을 확인한 결과를 나타낸 그래프로, 도 2a 및 도 2c는 mRNA 함량을 확인한 결과이고, 도 2b 및 도 2d는 단백질 함량을 확인한 결과이며, +는 LPS(3 ㎍/mL)를 함께 처리하였다는 것을 의미하고, 도 2a 및 도 2b는 다슬기 가수분해물 처리에 따른 결과를 나타낸 것이고, 도 2c 및 도 2d는 다슬기 증류수 가수분해물 처리에 따른 결과를 나타낸 것이며, +는 LPS(3 ㎍/mL)를 함께 처리하였다는 것을 의미하고, -는 LPS를 처리하지 않았다는 것을 의미하며, 가로축의 수치는 다슬기 가수분해물 또는 다슬기 증류수 가수분해물의 투여량(㎍/mL)을 의미하고, 세로축은 LPS를 처리한 대조군 대비 의 mRNA 함량 및 단백질 함량을 함량비(%)로 나타낸 것을 의미한다.
도 3은 본 발명의 일 실시예에 따른, 다슬기 가수분해물(Protamex(Buffer system)) 및 다슬기 증류수 가수분해물(Protamex(D.W system))의 항염 효과를 COX-2의 mRNA 함량을 확인한 결과를 나타낸 그래프로, +는 LPS(3 ㎍/mL)를 함께 처리하였다는 것을 의미하고, 도 3a는 다슬기 가수분해물 처리에 따른 결과를 나타낸 것이고, 도 3b는 다슬기 증류수 가수분해물 처리에 따른 결과를 나타낸 것이며, +는 LPS(3 ㎍/mL)를 함께 처리하였다는 것을 의미하고, -는 LPS를 처리하지 않았다는 것을 의미하며, 가로축의 수치는 다슬기 가수분해물 또는 다슬기 증류수 가수분해물의 투여량(㎍/mL)을 의미하고, 세로축은 LPS를 처리한 대조군 대비 mRNA 함량 및 단백질 함량을 함량비(%)로 나타낸 것을 의미한다.Figure 1 shows the results of confirming the cytotoxicity of Protamex (Buffer system) and polyglycerol distilled water hydrolyzate (Protamex (DW system)) using RAW 264.7 cell line according to one embodiment of the present invention In the graph, Control means that LPS was not treated, and the abscissa indicates the dose (쨉 g / mL) of the hydrolyzate of the polysaccharide and the ordinate indicates the cell survival rate (%) as compared to the LPS untreated control.
2 is a graph showing the results of confirming the anti-inflammatory effect of the iNOS mRNA and protein content of the protamine (Buffer system) and the distilled water hydrolyzate (Protamex (DW system)) according to an embodiment of the present invention 2A and 2C show results of confirming the mRNA content, FIGS. 2B and 2D show the result of confirming the protein content, + means that LPS (3 μg / mL) was treated together, and FIGS. 2b and 2d show the result of hydrolyzate treatment with distilled water, and + means treatment of LPS (3 ㎍ / ml) together, and FIG. - indicates the absence of LPS treatment, the abscissa indicates the dose (占 퐂 / mL) of the hydrolyzate of the hydrolyzate or the polyphenol distilled water, and the ordinate indicates the mRNA content and protein content of the LPS- Is expressed as a content ratio (%).
FIG. 3 is a graph showing the anti-inflammatory effect of the protease hydrolyzate (Protamex (Buffer system) and the polymega distilled water hydrolyzate (Protamex (DW system)) in the mRNA content of COX-2 , + Indicates that LPS (3 μg / mL) was treated together, FIG. 3 a shows the results of the treatment with the polyhydric hydrolyzate, FIG. 3 b shows the results with the polyhydric distillate hydrolyzate treatment, Means that LPS (3 μg / mL) was treated together, - means no LPS treatment, and the abscissa indicates the dose (㎍ / mL) of the hydrolyzate of polyhydric or polyhydric distilled water , And the vertical axis represents the mRNA content and the protein content as the content ratio (%) as compared with the control group treated with LPS.

이하, 본 발명의 이해를 돕기 위하여 구체적인 실시예 및 비교예를 통하여 본 발명의 구성 및 효과를 보다 상세히 설명하기로 한다. 그러나 하기 실시예는 본 발명을 보다 명확하기 이해시키기 위한 것일 뿐이며, 본 발명의 하기 실시예에 한정되는 것은 아니며, 본 발명의 보호 범위는 특허청구범위에 의하여 해석되어야 하고, 그와 동등한 범위 내에 있는 모든 기술 사상은 본 발명의 권리범위에 포함되는 것으로 해석되어야 한다.
Hereinafter, the structure and effects of the present invention will be described in more detail with reference to specific examples and comparative examples in order to facilitate understanding of the present invention. However, it should be understood that the following examples are for the purpose of further illustrating the present invention and are not to be construed as limiting the scope of the invention as defined by the appended claims. All technical ideas are to be construed as falling within the scope of the present invention.

<< 실시예Example 1> 다슬기 1> Reaction 가수분해물의Hydrolyzate 제조 Produce

본 실험에 사용한 다슬기는 사단법인 다슬기 유통생산자 협회에서 받아 사용하였다. 다슬기 가수분해물 및 추출물은 다음과 같은 방법으로 제조하였다.The drafts used in this experiment were received from the Association of Distributors and Distributors of the Association. The hydrolysates and extracts of the extracts were prepared in the following manner.

우선, 다슬기 열수추출물은 입수한 다슬기의 껍질이 제거된 다슬기 살(어육) 1000 g을 잰 후, 다슬기 살의 10배인 증류수 10L를 채워 넣고, 100℃에서 25시간 동안 열수추출을 수행하였다. 상기 열수추출이 끝난 후, 기름층 및 찌꺼기를 분리하여, 다슬기 열수추출물을 수득하였다.First, 1000 g of the dried fish skin of which the obtained shells were removed was weighed, and then 10 L of distilled water of 10 times of the water content was filled in the hot water extract, and the hot water extraction was carried out at 100 캜 for 25 hours. After the hot water extraction was completed, the oil layer and the residue were separated to obtain a hot-water extract of polyglycerol.

다슬기 효소 가수분해물 중 완충액(buffer)을 이용한 효소 가수분해물 즉, 완충액 효소 가수분해물은 상기 다슬기의 껍질이 제거된 다슬기 살(어육) 25 g에 다슬기 살의 5배인 0.1M 인산나트륨완충액(sodium phosphate buffer, pH 7.0) 125 mL를 가한 뒤, 알카라제(Alcalase, 1.5 AU/g), 프로타맥스(Protamex, 1.5 AU/g), 알카라제 및 프로타맥스(Alcalase + Protamex)를 각 1%의 농도로 첨가하고, 50℃에서 100 rpm의 교반 배양기(shacking incubator)를 이용하여, 10 시간 동안 반응시켰다. 이 후, 상기 반응액을 100℃에서 15분 동안 끓인 후, 4℃ 및 4500rpm의 조건으로 10분 동안 원심분리하고, 상등액을 수득하는 방법으로 제조하였다.The enzymatic hydrolyzate, that is, the enzyme hydrolyzate of the buffer using the buffer hydrolyzate of the polyglycerol hydrolyzate, was dissolved in 25 ml of a 0.1 M sodium phosphate buffer (pH 5) (Alcalase, 1.5 AU / g), Protamax (1.5 AU / g), Alcalase and Protamax (Alcalase + Protamex) were added to each 1% And the mixture was reacted for 10 hours using a shaking incubator at 50 rpm at 100 rpm. Thereafter, the reaction solution was boiled at 100 DEG C for 15 minutes, and then centrifuged at 4 DEG C and 4500 rpm for 10 minutes to obtain a supernatant.

다슬기 효소 가수분해물 중 증류수 즉, 물을 이용한 효소 가수분해물 즉, 증류수 효소 가수분해물(distilled water 효소 가수분해물)은 상기 다슬기의 껍질이 제거된 다슬기 살(어육) 25 g에 다슬기 살의 5배인 증류수(distilled water) 125 mL를 가한 뒤, 알카라제(Alcalase), 프로타맥스(Protamex), 알카라제 및 프로타맥스(Alcalase + Protamex)를 각 1%의 농도로 첨가하고, 50℃에서 100 rpm의 교반 배양기(shacking incubator)를 이용하여, 10 시간 동안 반응 시켰다. 이 후, 상기 반응액을 100℃에서 15분 동안 끓인 후, 4℃ 및 4500rpm의 조건으로 10분 동안 원심분리하고, 상등액을 수득하는 방법으로 제조하였다.The distilled water, that is, the enzyme hydrolyzate using water, that is, the distilled water enzyme hydrolyzate (distilled water enzyme hydrolyzate), of distilled water hydrolyzate is distilled water (distilled water) which is 5 times of multipurpose to 25 g of the shell of the above- (Alcalase), Protamax, Alcalase, and Protamax (Alcalase + Protamex) were added at a concentration of 1% each, and the mixture was reacted at 50 rpm at 100 rpm The reaction was carried out for 10 hours using a shaking incubator. Thereafter, the reaction solution was boiled at 100 DEG C for 15 minutes, and then centrifuged at 4 DEG C and 4500 rpm for 10 minutes to obtain a supernatant.

상기 수득한 추출물 및 가수분해물은 실험에 사용하기 전까지 냉동보관하였다.
The extracts and hydrolysates obtained above were stored frozen until used in the experiment.

<< 실시예Example 2> 세포 독성 실험 2> Cytotoxicity experiment

상기 실시예 1에서 제조된 다슬기 가수분해물 및 다슬기 추출물의 세포 독성을 측정하기 위하여, 쥐의 대식세포인 RAW264.7 세포를 ATCC에서 구입하여 이용하였다.In order to measure the cytotoxicity of the hydrolyzate of the polyglycerol and the polyglycerol produced in Example 1, rat macrophages RAW264.7 cells were purchased from ATCC.

상기 세포의 배양(Cell culture)에 사용된 DMEM/F12(Dulbecco's modified Eagle's medium/ Nutrient Mixture Ham's F12), FBS(fetal bovine serum), L-글루타민(L-glutamine) 및 페니실린(Penicillin) 및 스트렙토마이신(Streptomycin)은 Hyclone사에서 구입하였다(Dulbecco's modified Eagle's medium / Nutrient Mixture Ham's F12), fetal bovine serum (FBS), L-glutamine, penicillin, and streptomycin used in the cell culture Streptomycin) was purchased from Hyclone

상기 세포는 10% FBS, 100 units/ml 페니실린 및 100 ㎍/ml 스트렙토마이신이 함유된 DMEM 배지를 이용하여 37℃ 및 5% CO₂ 조건(5% CO₂/95% air)에서 배양하였다. 상기 세포가 배양접시의 약 80%가 차게 배양시킨 후, PBS(pH 7.4)로 세포의 단층을 씻어낸 후 세척하고, 0.25% 트립신 및 2.56 mmol/L EDTA를 처리하여 계대 배양하였다. 배지는 2일마다 교환하였다. The cells were cultured in DMEM medium containing 10% FBS, 100 units / ml penicillin and 100 μg / ml streptomycin at 37 ° C and 5% CO ₂ (5% CO ₂ /95% air). After the cells were cultured to about 80% of the culture dish, the cells were washed with PBS (pH 7.4), washed, and subcultured by treatment with 0.25% trypsin and 2.56 mmol / L EDTA. The medium was changed every 2 days.

상기 MTT 분석은 CellTiter 96^?AQueous One Solution을 사용하여 수행하였다. 구체적으로, 96 well plate에 1.5×10⁴ cells/well의 밀도로 상기 배양한 RAW 264.7 세포를 분주 한 후, 37℃ 및 5% CO₂ 조건(5% CO₂/95% air)에서 24시간 동안 더 배양하였다. 상기 24시간 경과 후, 아무런 처리를 하지 않고 LPS만 처리한 대조군과 LPS와 상기 실시예 1의 다슬기 가수분해물, 구체적으로 다슬기 가수분해물(Protamex(Buffer system)) 및 다슬기 증류수 가수분해물(Protamex(D.W system))을 농도별로(0.1, 1, 10, 100, 1000 ug/ml) 처리한 뒤 24시간 동안 재배양하였다. 배양 후, 플레이트에 에 20 ㎕ MTS solution을 첨가해 CO₂ 배양기에서 1시간 동안 반응시킨 후, ELISA를 이용하여 490nm에서 흡광도를 측정하였다. 상기 흡광도를 측정한 결과를 이용하여, 세포생존율을 확인하였다. 상기 다슬기 가수분해물로 처리한 결과는 상기 실험을 동일하게 3회 수행하여, 측정된 값의 평균 값으로 도 1에 나타내었다.The MTT assay was performed using CellTiter 96 ^? AQueous One Solution. Specifically, the cultured RAW 264.7 cells were seeded at a density of 1.5 × 10 ⁴ cells / well in a 96-well plate and cultured for 24 hours at 37 ° C. and 5% CO ₂ (5% CO ₂ /95% air) Lt; / RTI > After the lapse of 24 hours, the control group treated with LPS alone without any treatment, LPS and the polyglycosylated hydrolyzate of Example 1, specifically Protamex (Buffer system) and Protamex (DW system ) Was treated with concentration (0.1, 1, 10, 100, 1000 ug / ml) and regenerated for 24 hours. After incubation, 20 μl of MTS solution was added to the plate, reacted for 1 hour in a CO ₂ incubator, and absorbance was measured at 490 nm using ELISA. The cell viability was confirmed using the results of the measurement of the absorbance. The results of treatment with the hydrolysates of the polyglycols are shown in FIG. 1 as an average value of the measured values by performing the same experiment three times in the same manner.

상기 도 1에 나타낸 바와 같이, 상기 실시예 1에서 제조된 다슬기 증류수 효소 가수분해물(도 1a)을 다양한 농도, 구체적으로 10 ㎍/㎖ 내지 2,000 ㎍/㎖까지 농도별로 처리하고, 24시간을 처리한 경우에도, 아무런 시료를 처리하지 않고 LPS만 처리한 대조예와 비교한 결과, 상기 실시예 1에서 제조된 다슬기 증류수 효소 가수분해물(도 1a)을 다양한 농도로 처리한 경우 모두 세포의 증식에 별다른 영향을 나타내지 않는 것으로 확인되었다. 따라서, 상기 결과로부터 다슬기 증류수 효소 가수분해물은 2,000 ㎍/㎖까지는 세포독성이 없는 것으로 확인되었다. 한편, 상기 실시예 1에서 제조된 다슬기 완충액 효소 가수분해물을 처리한 경우, 1,000 ㎍/㎖까지는 세포독성이 없는 것으로 확인되었으나, 2,000 ㎍/㎖의 농도로 처리한 경우에는 세포독성이 확인되었다. 따라서, 상기 결과로부터 다슬기 완충액 효소 가수분해물은 1,000 ㎍/㎖까지는 세포독성이 없는 것으로 확인되었다.
As shown in FIG. 1, the polysaccharide distilled water hydrolyzate (FIG. 1A) prepared in Example 1 was treated at various concentrations, specifically, at concentrations ranging from 10 μg / mL to 2,000 μg / mL and treated for 24 hours As a result of comparison with a control sample in which only LPS was treated without any sample treatment, it was found that when the polysaccharide distilled aqueous enzyme hydrolyzate prepared in Example 1 (FIG. 1A) was treated at various concentrations, . &Lt; / RTI > Therefore, it was confirmed from the above results that the hydrolyzate of the tetrahydrofuran distilled water was not cytotoxic up to 2,000 占 퐂 / ml. On the other hand, when the tetrahydrofuran buffer hydrolyzate prepared in Example 1 was treated, it was found that there was no cytotoxicity up to 1,000 μg / ml, but when it was treated at a concentration of 2,000 μg / ml, cytotoxicity was confirmed. Therefore, it was confirmed from the above results that the polysaccharide buffer hydrolyzate did not have cytotoxicity up to 1,000 μg / ml.

<< 실시예Example 3> 가수분해 처리 용액 종류별 항염효과 측정 3> Measurement of anti-inflammatory effect by hydrolysis treatment type

상기 실시예 1에서 제조된 다슬기 효소 가수분해물의 항염 효과를 확인하기 위하여, 상기 실시예 2에서 배양한 RAW264.7 세포를 이용하여, iNOS와 COX-2의 단백질 발현 및 mRNA의 생성 정도를 확인하였다.In order to confirm the anti-inflammatory effect of the hydrolysates of the aglycase enzymes prepared in Example 1, protein expression and mRNA production of iNOS and COX-2 were examined using RAW264.7 cells cultured in Example 2 .

상기 단백질 발현 정도의 측정은 상기 실시예 1에서 제조된 2 종류의 다슬기 효소 가수분해물과 LPS를 함께 첨가한 후, 상기 실시예 2의 방법으로 24시간 배양한 뒤, 웨스턴 블로팅(western blot analysis)하는 방법으로 수행하였다.The degree of protein expression was measured by adding the two kinds of agarose hydrolyzate prepared in Example 1 and LPS together, culturing for 24 hours in the same manner as in Example 2, and then performing western blot analysis, .

구체적으로, 상기 24시간 배양한 후, 배양액을 제거한 세포(cell)를 1 X ice cold-PBS로 세척(washing)한 다음, PBS를 다시 1 ml분주하여, 세포를 수득하였다. 수득한 세포를 4℃ 및 13,000 rpm의 조건으로 원심분리하고, cell pellet에 1 X RIPA buffer 100 ㎕를 첨가하고, 1시간 동안 용해(lysis)한 뒤, 4℃ 및 17000 rpm의 조건으로 15분 동안 원심분리 하였다.Specifically, after culturing for 24 hours, the cells from which the culture solution had been removed were washed with 1 × ice cold-PBS, and 1 ml of PBS was further added thereto to obtain cells. The resulting cells were centrifuged under the conditions of 4 ° C and 13,000 rpm, and 100 μl of 1 × RIPA buffer was added to the cell pellet. The cells were lysed for 1 hour and then lysed at 4 ° C. and 17,000 rpm for 15 minutes And centrifuged.

상기 세포 내 단백질 농도는 Bradford 법으로 정량하였다. 이 후, 10% SDS-gel을 이용하여 전기영동 후, cellulose membrane으로 gel의 단백질을 옮긴 후(blot), 5% skim milk로 2시간 동안 blocking 하고, 각 희석된 비율의 1차 항체(1^st antibody)를 첨가하고, 4℃의 조건으로 교반기에서 교반하며, 밤샘반응(overnight, 12시간)을 수행하였다. 이 후, 1 X TBST를 이용하여, 10 분 동안 3회 세척한 후, washing 후 알맞게 희석된 비율의 2차 항체(2^nd antibody)를 첨가하고, 4℃의 조건으로 1시간 동안 교반하였다. 그 후, TBS-T buffer를 사용하여 10분 동안 3회 세척한 후, ECL detection 용액으로 High performance chemiluminescence film에 현상하였다. 상기 현상에 사용된 현상액은 developer와 fixer를 각각 증류수를 이용하여 1:4(용액 : 증류수)의 배율로 희석된 것을 사용하였다.The intracellular protein concentration was determined by the Bradford method. Then, the gel was transferred to a cellulose membrane using a 10% SDS-gel electrophoresis, blotted, blocked with 5% skim milk for 2 hours, and the diluted primary antibody (1 ^st antibody) was added thereto. The mixture was stirred at 4 ° C on a stirrer, and overnight (12 hours) was performed. After washing, the plate was washed three times for 10 minutes using 1 X TBST. After washing, appropriately diluted second antibody (2 ^nd antibody) was added and stirred at 4 ° C for 1 hour. After washing with TBS-T buffer three times for 10 minutes, the cells were developed with high-performance chemiluminescence film using ECL detection solution. The developers used in the above development were developers and fixers diluted with distilled water at a ratio of 1: 4 (solution: distilled water).

또한, mRNA의 생성 함량은 상기 염증관련 분자지표인 iNOS와 COX-2의 유전자 발현 즉, mRNA 함량을 RT-PCR을 이용하는 방법으로 수행하였다.In addition, mRNA production levels of iNOS and COX-2, that is, inflammation-related molecular markers, that is, mRNA content were measured by RT-PCR.

상기 배양된 세포에서 mRNA 분리는 세포 내 total RNA 분리(Total RNA isolation, MACJEREY-NAGEL, USA)를 이용하였다. 상기 분리된 mRNA는 ImProm-Ⅱ^TM Recerse Transcripption System(Promega, USA)을 이용하여 cDNA로 합성하였고, cDNA에 대한 PCR을 수행하기 위해 cDNA 4 ㎍에 프라이머(primer) 1 ㎕, 멸균증류수 5 ㎕를 첨가한 후, Dr. Taq-HOT MasterMix 2 X with Dye(DOCTOR PROTEIN, KOREA) 10 ㎕와 혼합하여 반응액을 제조하고, PCR을 수행하였다. 상기 PCR을 수행한 후, 2% agarose gel을 이용하여, 100 V의 조건에서 25분 동안 전기영동을 수행하였고, 이 후 UV관찰을 통해 정량하였다. 상기 프라이머로 이용된 각 유전자들의 서열은 하기 표 1에 기재하였다The mRNA was isolated from the cultured cells using total RNA isolation (MACEREY-NAGEL, USA). The separated mRNA is ^{ImProm-Ⅱ TM Recerse Transcripption System (} Promega, USA) for use by was synthesized by cDNA, the addition of primers (primer) 1 ㎕, sterile distilled water 5 ㎕ the cDNA 4 ㎍ to perform PCR on cDNA After that, Dr. And 10 μl of Taq-HOT MasterMix 2 X with Dye (DOCTOR PROTEIN, KOREA) to prepare a reaction solution and perform PCR. After the PCR was performed, electrophoresis was carried out using 2% agarose gel at 100 V for 25 minutes, and then quantified by UV observation. The sequence of each gene used as the primer is shown in Table 1 below

확인대상 mRNAMRNA to be identified Primer sequencePrimer sequence Annealing Tm(℃)Annealing Tm (° C) iNOSiNOS sensesense CCCTTCCGAAGTTTCTGGCACCACC CCCTTCCGAAGTTTCTGGCACCACC 50℃, 45sec50 캜, 45 sec anti-senseanti-sense GGCTGTCAGAGCCTCGTGGCTTTGG GGCTGTCAGAGCCTCGTGGCTTTGG COX-2COX-2 sensesense CTGACCCACTTCAAGGGAGTCTGG CTGACCCACTTCAAGGGAGTCTGG 58℃, 30sec58 ° C, 30 sec anti-senseanti-sense CCATCCTGGAAAAGGCGCAGTT CCATCCTGGAAAAGGCGCAGTT β-actinβ-actin sensesense TGACCGAGCGTGGCTACAGC TGACCGAGCGTGGCTACAGC 58℃, 30sec58 ° C, 30 sec anti-senseanti-sense ACCGCTCATTGCCGATAGTG ACCGCTCATTGCCGATAGTG

상기 real-time PCR 결과는 β-actin 함량과 함께 비교하여 사진으로 촬영한 결과 및 이로부터 확인한 결과로 도 2 및 3에 나타내었다.The real-time PCR results were compared with the β-actin content and photographed. The results are shown in FIGS. 2 and 3.

상기 도 2 및 도 3 나타낸 바와 같이, LPS를 처리하지 않은 대조군은 염증과 관련된 iNOS의 발현 및 mRNA와 COX-2의 mRNA가 현저하게 증가하는 것이 확인되었다.As shown in FIG. 2 and FIG. 3, it was confirmed that the expression of iNOS associated with inflammation and mRNA of mRNA and COX-2 significantly increased in the control group not treated with LPS.

한편, 다슬기 효소 가수분해물 특히, 인산나트륨 완충액에서 프로타맥스로 가수분해한 다슬기 효소 가수분해물(Buffer system)은 1 ㎍/mL 처리한 실험군부터, iNOS를 농도 의존적으로 감소시키는 것으로 확인되었고, 10 ㎍/mL 처리한 실험군부터 COX-2도 농도 의존적으로 감소시키는 것으로 확인되었다. 한편, 증류수에서 프로타맥스로 가수분해한 다슬기 효소 가수분해물(D.W system)은 여러 농도로 처리하여도 iNOS 및 COX-2의 발현능 및 mRNA 생성능 억제에 대해선 효과가 없어, 항염 활성이 없는 것으로 확인되었다. 상기 결과로부터, 효소의 종류뿐만 아니라 완충액의 종류에 따른 항염활성의 차이가 현저한 것이 확인되었다.
On the other hand, it was confirmed that the hydrolyzate of the polyglycosylated enzyme hydrolyzate, especially the hydrolyzate of the hydrolyzate of the protease in the sodium phosphate buffer, at a concentration of 1 / / mL, decreased the concentration of iNOS in a concentration-dependent manner, / mL < / RTI > of COX-2 in a dose-dependent manner. On the other hand, hydrolysates of hydrolysates of hydrolysates hydrolyzed with distilled water to proteasma (DW system) were not effective against the expression of iNOS and COX-2 and inhibition of mRNA production even at various concentrations. . From the above results, it was confirmed that the difference in anti-inflammatory activity depending on the type of the enzyme as well as the type of the buffer was remarkable.

상기 실험결과에 의하면, 식용으로 사용가능한 다슬기의 가수분해물은 예상한 바와 같이 MTT 분석결과 세포독성이 없는 것으로 확인되었고, 항염효과와 관련하여 NO에 의해 유발되는 염증과 관련된 결과(iNOS의 분비량) 및 염증을 유발하는 다양한 사이토카인과 관련된 COX-2의 함량과 관련된 결과를 고려하면, 매우 효과적으로 염증을 저해할 수 있을 것으로 확인되었고, 특히 다슬기의 pH 7의 인산나트륨 완충액에서의 프로타맥스 가수분해물이 다른 종류의 가수분해물에 비하여 현저하게 우수한 항염 효과를 가지는 것으로 확인되었으므로, 본 발명의 다슬기 가수분해물 특히, 다슬기 프로타맥스 효소 가수분해물은 기존 염증 치료제를 대체할 수 있을 뿐만 아니라, 기존 화장품에 사용되는 성분으로 인한 염증 발생을 적절하게 제어할 수 있어 화장료 조성물의 유효성분으로 사용될 수 있을 것으로 기대된다.
According to the results of the above experiment, it was confirmed that the hydrolyzate of the polyglycosylic acid which can be used for edible food was not cytotoxic as a result of MTT analysis as expected, and the results related to inflammation caused by NO (iNOS secretion amount) and Considering the results related to the content of COX-2 associated with various inflammatory cytokines, it was found that the inflammation could be inhibited very effectively, and in particular, the protease hydrolyzate in the sodium phosphate buffer at pH 7 It has been found that the hydrolyzate of the polyglycerol hydrolyzate of the present invention, particularly the polyglycolytic hydrolyzate of the prothmax enzyme, can replace the conventional inflammation drug, It is possible to appropriately control the occurrence of inflammation caused by the ingredients, It is expected that it can be used as an active ingredient of water.

Claims

Semisulcospira libertina hydrolyzate as an active ingredient.

The method according to claim 1,
The polyglycosylated hydrolyzate may be selected from the group consisting of Protamax, Alcalase, Flavourzyme, Bromelain, Ficin, Papain, Neutrase and Protease. Wherein the hydrolyzate is an enzyme hydrolyzate hydrolyzed with at least one protein hydrolyzing enzyme selected from the group consisting of:

3. The method of claim 2,
Wherein the polyglycosylated hydrolyzate is a protease hydrolyzate hydrolyzed with protease.

The method of claim 3,
Wherein the polyglycosylated hydrolyzate is a protease hydrolyzate obtained by adding a buffer having a pH of from 6.5 to pH 7.5 to the polyglycosylated polysaccharide and then hydrolyzing the protease.

The anti-inflammatory composition according to claim 4, wherein the buffer solution is a sodium phosphate buffer having a pH of 7. The anti-inflammatory composition according to claim 4, wherein the buffer solution is a proteasma enzyme hydrolyzate.

An anti-inflammatory agent comprising the anti-inflammatory composition of claim 1 as an active ingredient.

A cosmetic composition having anti-inflammatory effect comprising the anti-inflammatory composition of claim 1 as an active ingredient.