KR101221617B1 - Anti-inflammatory agent containing stauntonia hexaphyllafruit leaf extract - Google Patents

Abstract

PURPOSE: An anti-inflammatory composition containing a Stauntonia Hexaphylla leaf extract is provided to suppress COX-2 enzymes and inflammation without cytotoxicity. CONSTITUTION: An anti-inflammatory composition contains a Stauntonia Hexaphylla leaf extract as an active ingredient. The extract is obtained using water, alcohol with 1-5 carbon atoms, or a mixture thereof. The extract is also a fraction which is fractioned with ethyl acetate or chloroform. A pharmaceutical composition for treating and preventing inflammatory diseases contains the extract as an active ingredient. A method for preparing the fraction of the extract comprises: a step of adding water to Stauntonia Hexaphylla leaves, and hot-water extracting; and a step of adding butanol to the hot water extract of Stauntonia Hexaphylla.

Description

Anti-inflammatory including honey leaf extract {ANTI-INFLAMMATORY AGENT CONTAINING STAUNTONIA HEXAPHYLLAFRUIT LEAF EXTRACT}

The present invention relates to an anti-inflammatory composition comprising a plant extract having an anti-inflammatory effect, specifically, a honey leaf extract as an active ingredient.

Inflammatory reactions are caused by various factors, such as exposure to harmful substances or organisms from outside, including external infectious agents such as bacteria, fungi, viruses, or various types of allergens, or exposure to harmful substances or organisms from outside. When this damage is done or destroyed, it means a locally occurring immune response to minimize the damage and restore the damaged area.

In addition, various factors that cause inflammation include physical factors such as trauma, burns, frostbite, radioactivity, chemical factors such as acids, and immunological factors due to antibody reactions. It can also be caused by imbalance.

The inflammatory response is a protective mechanism useful for protecting the living body and removing products generated by tissue damage. The inflammatory response is associated with various inflammatory mediators and immune cells present in local blood vessels and body fluids, such as enzyme activation, inflammatory mediator secretion, fluid infiltration, Symptoms such as cell migration, tissue destruction, erythema, edema, fever or pain may appear, and dysfunction may be caused by the above symptoms.

In the normal case, the inflammation removes an external infectious agent or neutralizes or removes a pathogen, and regenerates upper tissues, thereby restoring normal structure and function. However, if the antigen is not removed continuously or a specific internal substance causes the degree of inflammation to be above a certain level or becomes chronic, it becomes a problem when progressing to a disease state such as irritability or chronic inflammation. In addition to observing the inflammatory response in almost all diseases, it is known that enzymes related to the inflammatory response play an important role in carcinogenesis. It is also an obstacle in the treatment process such as blood transfusion, drug administration or organ transplantation.

In vivo, the inflammatory response involves various biochemical phenomena, and in particular, the reaction is initiated or regulated by various enzymes related to the inflammatory response produced by immune cells.

Recently, it is known that the progression of the inflammatory response in the body is related to the enzyme activity of cyclooxygenase (COX). The COX enzyme is a major enzyme involved in the biosynthesis of prostaglandin present in vivo (Smith et al ., J. Biol . Chem ., 271, 33157 (1996)), and two types of isozymes COX-1 and COX -2 is known to exist. The COX-1 is constantly present in tissues such as the stomach and kidneys, and is involved in maintaining normal homeostasis, whereas the COX-2 is involved in mitogen or cytokines during inflammation or other immune responses. Is an enzyme that is transiently and rapidly expressed in cells.

Another strong inflammatory mediator, nitric oxide (NO), is produced from L-arginine by NO synthase (NOS), and is produced by a variety of substances, such as UV, external stress, endotoxin or cytokines Lt; / RTI > cells. Such inflammatory stimuli can increase the expression of inducible NOS (iNOS) in the cell, thereby inducing NO production in the cell, thereby inducing an inflammatory response by activating macrophages.

Therefore, in order to effectively alleviate inflammation, researches on a substance capable of inhibiting the production of NO are under way. However, some side effects are problematic for anti-inflammatory substances developed by these studies. For example, nonsteroidal anti-inflammatory drugs used in the treatment of acute or chronic inflammatory diseases are known to exhibit side effects such as gastrointestinal disorders by inhibiting COX-2 enzyme as well as COX-1 enzyme.

On the other hand, cosmetics used in everyday life are products used for protecting skin and cleansing the shine, but when the cosmetic composition is examined, ingredients different from the purpose of skin protection are used as indispensable substances for product formation. For example, surfactants, preservatives, fragrances, sunscreens, pigments, and other ingredients used to impart other benefits or effects. Ingredients that are essential for the manufacture of cosmetics are generally known to cause skin irritation, rashes, swelling, and various other side effects.

In addition, if fatty acids, higher alcohols, proteins, etc. in sebum, sweat, and cosmetic components discharged from the body are decomposed into highly toxic substances by dermatophytes present on the skin, skin inflammation may be caused by them. It is well known that skin irritation is caused by UV rays from the sun.

In this way, the causes of skin adverse effects in cosmetics are always present and various studies have been conducted to solve them. To date, non-steroidal substances such as flufenamic acid, ibuprofen, benzydamine, and indomethacin are used for nonsteroidal substances such as erythema and edema. In the case of steroids, prednisolone, dexamethasone, and the like, allantoin, azulene, ε-aminokiproic acid, hydrocortisone, licoriceic acid and derivatives thereof (β-glycilechinic acid, and glycyrcinic acid derivatives) ) Is known to be effective in anti-inflammatory.

However, the indomethacin generally used as an anti-inflammatory agent is a substance that can not be used in cosmetics. The amount of hydrocotisin is limited. The licorice acid and its derivatives are difficult to stabilize or have poor solubility, It is difficult to achieve a substantial effect. Thus, known anti-inflammatory agents have problems in terms of skin safety and stability in mixing cosmetics, and their use is limited.

In addition, the mechanism of treatment related to gastritis is mainly based on H2-Blockers, which block the release of gastric acid from gastric wall cells by blocking the second histamine receptor (H2 receptor). To prevent further damage to the stomach ulcers. These H2 inhibitors interfere with the metabolism of other drugs in the liver (potent inhibitors of P-450), so they must be used with other drugs and have anti-Androgen effects, resulting in male gynecomastia. ), Side effects such as impotence and decreased libido may occur. In addition, because it passes through the placenta and cerebrovascular barrier, side effects may be more dangerous for pregnant women and the elderly, and may cause headaches, confusion, confusion, and dizziness.

Therefore, as a substance derived from natural substances, it is possible to effectively suppress the production of NO, inhibit the expression of iNOS and TNF-α, and effectively inhibit the activity of COX-2 enzyme, so that it is not only excellent in anti-inflammatory effect but also natural As a substance-derived substance, there is a need to develop a substance having little or no risk for such side effects or cytotoxicity, and thus there is almost no limit on the amount of the substance used.

In particular, in recent years, research and development on cosmetics or cosmetic ingredients using anti-inflammatory agents or natural materials as natural medicines using natural raw materials in order to meet consumer needs.

KR 0530843 B KR 0614465 B KR 0941133 B KR 0954984 B

In order to meet such demands, the present invention aims to provide an anti-inflammatory composition comprising as an active ingredient a plant extract which is less likely to cause problems related to side effects.

In addition, unlike the existing anti-inflammatory substances, side effects such as natural plants, which can be used for food, are not a problem, and safety is excellent, and it is possible to inhibit NO production related to inflammation and effectively inhibit COX-2 enzyme. It is an object of the present invention to provide an anti-inflammatory or cosmetic composition comprising a plant extract as an active ingredient.

In order to achieve the above object, the present invention provides an anti-inflammatory composition comprising a honey leaf extract as an active ingredient. The anti-inflammatory composition may be a pharmaceutical composition, for example, may be an anti-inflammatory analgesic.

The honey leaf extract can effectively inhibit NO secretion, inhibit the expression of iNOS associated with NO production, and promote an inflammatory response in relation to the biosynthesis of prostaglandin in vivo. It was confirmed that the enzyme activity can be inhibited, and in addition, the ethyl acetate fraction among the various solvent fractions of the hot water extract of the honey leaf effectively inhibits NO production amount to other fractions within the range where toxicity is not a problem, and also effective COX enzyme activity. It was confirmed that it can be inhibited.

Therefore, the anti-inflammatory composition of the present invention may be provided as an active ingredient of an anti-inflammatory agent or an active ingredient of a cosmetic composition for the purpose of inhibiting inflammation.

The present inventors have an anti-inflammatory effect because the honey leaf extract can effectively inhibit the mRNA transcription of cytokines associated with the secretion of the secretion and inflammation causing NO, and especially the ethyl acetate fraction or chloroform fraction of the hot water extract of the honey leaf is Compared with the fractions using other fractional solvents, NO production can be suppressed more effectively, and COX enzyme inhibitory activity results in significantly higher COX enzyme inhibitory activity of honey leaf hot water extract, especially ethyl acetate fraction of honey leaf hot water extract. It was confirmed that the anti-inflammatory effect is excellent, and when using butanol as a fractional solvent in addition, the fraction yield is excellent, and the anti-inflammatory effect was confirmed to be superior to the water fraction and the like to complete the present invention.

Hereinafter, the present invention will be described in more detail.

The present invention relates to an anti-inflammatory composition comprising honey extract, preferably honey leaf extract as an active ingredient.

The nectar ( Stauntonia hexapillya ) is an evergreen vine plant with dicotyledon plant Buttercup hyacinth vine, also called beech tree. The honey is a male and female, the main stem extends about 5m, the leaves are shifted, palm-like double leaf of 5 to 7 small leaves. Small leaves are thick, egg-shaped or oval, and have flat edges. Petioles are about 6cm to 8cm long, petioles about 3cm long. Flowers bloom in May, yellowish white, and hang on inflorescences. Small flower branch of female flower becomes reddish brown in autumn, and there are many big trees and is rough. Fruits are berries, egg-shaped or oval, 5cm to 10cm long, ripened in reddish brown in October, and pulp tastes better than erosion. Seeds are oval-shaped oval black. The honey is mainly distributed in Korea, Japan, Taiwan or China. In Korea, it grows well in the valleys and forests of southern regions such as Jeollanam-do, Gyeongsangnam-do, and Chungcheongnam-do.

The honey extract may be prepared according to a conventional method for producing a plant extract, for example by extracting by adding an extracting solvent to the leaves, branches, stems, roots or bark of the honey or a pulverized product thereof, preferably the leaves of the honey It may be prepared by fractionation by adding a fractional solvent to the crude extract prepared or prepared by extraction with an extraction solvent.

The extraction solvent may be at least one selected from the group consisting of water and an organic solvent. The organic solvent may be a polar solvent such as alcohol having 1 to 5 carbon atoms, the alcohol dilution water, ethyl acetate or acetone and a nonpolar solvent of ether, chloroform, benzene, hexane or dichloromethane, or a mixed solvent thereof. The alcohol having 1 to 5 carbon atoms may be methanol, ethanol, propanol, butanol, or isopropanol, but is not limited thereto. In addition, the alcohol dilution water may be one obtained by diluting the alcohol in water at 50% (v / v) to 99.9% (v / v).

Extraction solvent of the honey leaf extract of the present invention is preferably at least one selected from the group consisting of water, alcohol having 1 to 5 carbon atoms, alcohol dilution water and mixtures thereof, more preferably water, 1 to 4 carbon atoms It may be any one selected from the group consisting of alcohols and mixtures thereof, and even more preferably may be water. For example, the extraction process may be performed at 50 ° C. to 150 ° C., or 75 ° C. to 120 ° C., or 90 ° C. to 115 ° C., but is not limited thereto. In addition, the extraction time is not particularly limited, but may be 10 minutes to 12 hours, or 30 minutes to 8 hours, or 2 hours to 6 hours.

The honey leaf extract of the present invention may be prepared according to a conventional method of producing a plant extract, and specifically, may be a heat extraction method including a hot water extraction method, a cold extraction method, a warm extraction method, an ultrasonic extraction method, etc. Grinding extractors or fractionators may be used.

In addition, the extract extracted with the solvent is any one solvent selected from the group consisting of hexane, chloroform, methylene chloride, ethyl acetate, ethyl ether, acetone, butanol, water and mixtures thereof, preferably ethyl acetate, chloroform or Butanol, more preferably ethyl acetate or chloroform, even more preferably may be fractionated with ethyl acetate. Two or more solvents may be used in the fractionation, and each solvent extract may be prepared by sequentially using or mixing the solvent according to the polarity of the solvent.

The thus-prepared extract or the fraction obtained by performing the fractionation process may be filtered, concentrated or dried to remove the solvent, and may be subjected to both filtration, concentration and drying. Specifically, the filtration can be performed using a filter paper or a vacuum filter, and the concentration can be reduced by using a vacuum concentrator, for example, a rotary evaporator. The drying can be performed by, for example, freeze drying.

The anti-inflammatory composition may be used as a medicament, or may be used for medicament or pharmaceutical use, in this aspect, the anti-inflammatory composition may be a pharmaceutical composition, for example, may be an anti-inflammatory analgesic.

When the anti-inflammatory composition is used for medicinal or pharmaceutical purposes, the anti-inflammatory composition may be used to suppress or treat or prevent inflammation.

In this aspect, the present invention may be directed to a pharmaceutical composition for preventing and treating inflammatory diseases comprising honey leaf extract as an active ingredient. The pharmaceutical composition comprising the honey leaf extract as an active ingredient may be used to suppress, treat or prevent inflammatory diseases, and specifically may be an anti-inflammatory agent.

In an anti-inflammatory composition comprising the honey leaf extract as an active ingredient or an anti-inflammatory agent comprising the honey leaf extract as an active ingredient, the honey leaf extract is a honey leaf hydrothermal extract, preferably an ethyl acetate fraction of the honey leaf hydrothermal extract, chloroform Fractions or butanol fractions, more preferably ethyl acetate fractions or chloroform fractions, even more preferably ethyl acetate fractions.

The inflammation is a concept including a general inflammatory disease, for example, the inflammatory disease is a variety of dermatitis, including atopic dermatitis, dermatomyositis, polymyositis, allergy, systemic lupus erythematosus, pemphigus, aphthal stomatitis, Various chronic inflammatory diseases such as retinitis, gastritis, hepatitis, bronchitis, esophagitis, enteritis, pancreatitis, colitis, nephritis, pressure sores, lupus, chronic thyroiditis, multiple sclerosis, sepsis, shock, radiation damage, rejection of organ transplantation It may be one or more selected from the group consisting of various acute inflammatory diseases, systemic edema and local edema.

Therefore, the anti-inflammatory composition can be used for the purpose of treating, preventing or ameliorating the inflammatory disease.

The allergy is anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, atopic dermatitis, contact dermatitis, urticaria, insect allergy, food Allergy and drug allergies.

The systemic edema may be any one selected from the group consisting of congestive heart failure, interlocking pericarditis, restrictive cardiomyopathy, cirrhosis, renal failure, nephrotic syndrome, and a combination thereof, and the local edema is a part of skin and soft tissue. It refers to a swollen condition, and may specifically include cellulitis, which causes inflammation of skin and soft tissues, reflux disorders of veins or leaf canals, burns in which parts of skin and soft tissues are lost, insect bites, and bacterial infections. .

An anti-inflammatory composition comprising the honey leaf extract as an active ingredient can be directly applied to animals including humans. The animal is a biological group corresponding to a plant, and the organic material is mainly consumed as nutrients, and the digestive organ, the excretory organ, and the respiratory organ are differentiated. Preferably, the animal may be a mammal, more preferably a human.

The honey leaf extract may be used alone in the anti-inflammatory composition, and may further include other pharmacologically acceptable carriers, excipients, diluents or subcomponents.

More specifically, when the composition comprising the honey leaf extract is used as a medicament, or for medicinal or pharmaceutical use, the honey leaf extract is mixed with a pharmaceutically acceptable carrier or excipient according to a conventional method or It can be used diluted with a diluent.

In this case, the content of the honey leaf extract in the composition may be 0.001% by weight to 99.9% by weight, 0.1% by weight to 99% by weight or 1% by weight to 50% by weight, but is not limited thereto. Depending on the method, the content of the extract can be used by appropriately adjusting to the desired content.

Examples of the pharmaceutically acceptable carrier, excipient or diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, propylhydroxybenzoate, talc, magnesium stearate and mineral oil , Dextrin, calcium carbonate, propylene glycol, liquid paraffin, and one or more selected from the group consisting of physiological saline, but is not limited thereto, and all common carriers, excipients or diluents can be used. Carrier or excipient may be used two or more kinds.

In addition, the pharmaceutical composition is conventional fillers, extenders, binders, disintegrants, anti-coagulants, lubricants, wetting agents, pH adjusting agents, nutrients, vitamins, electrolytes, alginic acid and salts thereof, pectic acid and salts thereof, protective colloids, glycerin , Fragrances, emulsifiers or preservatives may be further included. The components may be added independently or in combination to the honey leaf extract is the active ingredient.

In addition, the anti-inflammatory composition of the present invention may further include a substance used as an anti-inflammatory agent, an NO inhibitor or a COX-2 inhibitor, etc., in addition to the active ingredient, which is known to have a known anti-inflammatory effect.

In addition, the anti-inflammatory composition of the present invention may further include a compound or plant extract having a known anti-inflammatory activity in addition to the active ingredient, and 0.1 to 99.9 parts by weight or 0.5 part by weight to 100 parts by weight of the active ingredient, respectively. It may be included in 20 parts by weight.

When the composition is used as a medicine, it can be administered orally or parenterally. In one example, it can be administered through various routes including oral, transdermal, subcutaneous, intravenous or muscular.

In addition, the formulations of the compositions may vary depending on the method of use and may be formulated using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal .

In general, solid dosage forms for oral administration include tablets, pills, soft or hard capsules, pills, powders and granules, which may contain one or more Excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Oral liquid preparations include suspending agents (SUSTESIONS), liquid solutions, emulsions (EMULSIONS) and syrups (SYRUPS) .Such as simple diluents such as water and liquid paraffin, various excipients such as wetting agents, Sweeteners, fragrances, preservatives and the like can be included.

Forms for parenteral administration include creams, looses, ONITMENTS, PLASTERS, LIQUIDS AND SOULTIONS, AEROSOLS, FRUIDEXTRACTS, (ELIXIR), INFUSIONS, SACHET, PATCH or INJECTIONS.

Furthermore, the compositions of the present invention may be formulated using suitable methods known in the art or using methods disclosed in Remington's Pharmaceutical Science (Recent Edition, Mack Publishing Company, Easton PA). Can be.

The dosage of the composition may be determined in consideration of the administration method, the age, sex, the severity of the patient, the condition of the patient, the degree of absorption of the active ingredient in the body, the inactivity and the drug to be used in combination. Kg body weight to 500 mg / kg body weight, 0.1 mg / kg body weight to 400 mg / kg body weight or 1 mg / kg body weight to 300 mg / kg body weight, And may be administered once or several times in divided doses. The dose is not intended to limit the scope of the invention in any way.

In addition, the anti-inflammatory composition of the present invention can be applied as a food composition for the prevention or improvement of inflammatory diseases. The food composition may be, for example, a health functional food composition for preventing or improving the inflammatory disease.

In this aspect, the present invention may be a health functional food composition for improving or preventing inflammatory diseases comprising a honey leaf extract as an active ingredient.

The health functional food is a physical, biochemical, biotechnological method, such as using the physical, biochemical, biotechnological techniques, such as food groups or food composition that has added value to give a function and expression of the function of the food for a specific purpose, disease prevention and recovery, etc. It refers to a food that is designed and processed to fully express the function of the gymnastics. The health functional food may include a food-acceptable food-aid additive, and may further comprise suitable carriers, excipients and diluents conventionally used in the production of health functional foods.

Health functional food composition for the prevention or improvement of inflammatory diseases of the present invention is 0.001% to 99.9% or 0.01% to 50% or 0.1% to 30% or 0.1% by weight of the honey leaf extract % To 15% by weight may be included.

The honey leaf extract is honey leaf hydrothermal extract, preferably ethyl acetate fraction, chloroform fraction or butanol fraction of honey leaf hydrothermal extract, more preferably ethyl acetate fraction or chloroform fraction, still more preferably ethyl acetate fraction is derived from natural substances Therefore, the side effects are not a problem, and as a result of the MTT experiment, as well as cytotoxicity is not a problem, as well as anti-inflammatory and anti-irritant activity because of the excellent anti-inflammatory effect, inflammation induced by the components contained in cosmetics And inflammation induced by the external environment.

Therefore, the anti-inflammatory composition or the honey leaf extract containing the honey leaf extract as an active ingredient may be used as an active ingredient of a cosmetic composition having an effect of improving inflammation and alleviating inflammation.

The honey leaf extract may be preferably an ethyl acetate fraction or a chloroform fraction of a honey leaf hydrothermal extract, more preferably an honey acetate hydrothermal extract, even more preferably an ethyl acetate fraction.

The cosmetic composition may be used as a cosmetic composition for basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, shaving cosmetics or oral cosmetics.

Examples of the basic cosmetics include creams, lotions, packs, massage creams, latexes, etc. Examples of the makeup cosmetics include foundations, makeup bases, lipsticks, eye shadows, eyeliners, mascaras, eyebrow pencils, and the like. Examples of cosmetics include soaps, liquid detergents, baths, sunscreen creams, sun oils, and the like. Examples of the hair cosmetics include shampoo, conditioner, hair treatment, hair mousse, hair liquid, pomade, hair colorant, and hair bleach. Agent or color rinse. Examples of the scalp cosmetics include hair tonic or scalp treatment, and examples of the shaving cosmetics include aftershave or shaving cream, and examples of the oral cosmetics include Toothpaste or mouse washer.

In addition to the active ingredients, the cosmetic composition is a component that is normally formulated in cosmetic compositions, depending on the purpose of use and the nature of the cosmetic composition, for example, moisturizers, ultraviolet absorbers, vitamins, animal and plant extracts, digestive agents, whitening agents, vasodilators, astringents, refreshing agents , Hormones and the like can be further formulated. In addition, the cosmetic composition may further include a medicament or a mechanism necessary for infiltrating or transferring the active ingredient into the dermal tissue.

The formulation of the cosmetic composition may take an appropriate form depending on the purpose of use and the nature of the cosmetic composition, for example, an aqueous solution, solubilizing, emulsifying, emulsion, gel, paste, ointment, aerosol, water-oil It may be a two-layered or water-oil-powder three-layered, examples of the formulations are merely illustrative, and the formulations and forms of the cosmetic composition of the present invention are not limited by the above examples.

The active ingredient may be contained in an amount of 0.001 to 50% by weight, preferably 0.01 to 20% by weight, based on the total weight of the cosmetic composition, , And the content of the active ingredient contained in the present invention is not limited by the above content.

In addition, the present invention relates to a method for producing a honey fraction having an anti-inflammatory effect in one aspect.

More specifically, as confirmed in one embodiment of the present invention, in the solvent fraction of the honey leaf hot water extract, when the hexane is used as the fractionation solvent, the yield is too low, so a process problem may occur in industrialization, Evaluated as. On the other hand, in the case of butanol fraction and water fraction is confirmed an excellent yield, because the economic efficiency is recognized due to the high yield in the efficiency of fraction production it is evaluated to be excellent industrially. In the case of a fraction of the cases, while the butanol fractions confirmed the very low anti-inflammatory effect is recognized by the anti-inflammatory effects, particularly in In vivo experiments showed that the anti-inflammatory effect is significantly superior to the water fraction.

Therefore, it was determined that the butanol fraction was excellent in terms of the industrial aspects, that is, the anti-inflammatory effect and the production yield in terms of the anti-inflammatory honey fraction production method, butanol was selected as the fraction solvent.

Specifically, meolkkul fractions manufacturing method having the anti-inflammatory effect is a step for preparing a butanol fraction was added to butanol in meolkkul hot-water extract prepared steps and meolkkul hot-water extract prepared above to extract hot water water was added to the meolkkul (Stauntonia hexaphylla) It may be a method.

The honey honey water extract manufacturing step is the honey ( Stauntonia hexaphylla ) after adding water, for example distilled water to the leaves, 0.5 to 20 hours, preferably 1 hour to 80 ℃ to 150 ℃, preferably 90 ℃ to 130 ℃, more preferably 100 ℃ to 120 ℃ The heating may be carried out for 10 hours, more preferably for 2 hours to 8 hours.

The amount of water added based on 100 parts by weight of the honey leaf may be 100 parts by weight to 10,000 parts by weight or 500 parts by weight to 5,000 parts by weight or 1,000 parts by weight to 3,000 parts by weight.

For example, the honey hot water extract manufacturing step is the process of washing the honey leaf in flowing water; Adding 1,500 parts by weight to 2,500 parts by weight of water, more specifically distilled water, based on 100 parts by weight of the honey leaf, and heating the mixture of honey and water at 100 ° C. to 120 ° C. for 3 hours to 5 hours. It can be carried out by the method, the process of filtering the extract prepared by the method using a filter cloth, the process of concentrating the filtrate obtained by the filtration process through a reduced pressure concentration method and the like and the concentrated concentrate is freeze-dried The method may further include the step of drying.

Preparing the butanol fraction may include adding butanol to the hot water extract; And it may be carried out by a method comprising the step of separating the butanol fraction.

For example, preparing the butanol fraction may include dissolving the hot water extract in distilled water; It can be carried out by a method comprising the step of adding butanol to the solution and mixing and the step of separating the butanol layer from the mixed solution.

The preparing of the butanol fraction may be performed by sequentially adding and mixing a solvent in the order of hexane, chloroform, ethyl acetate, and butanol in a solution of hot water extract with distilled water, separating the solvent layer, and then adding the next solvent to the remaining water layer. It can be carried out by the method of adding and preparing a fraction of the solvent.

In addition, the step of preparing the butanol fraction is the process of filtering the fraction prepared by the method using a filter cloth, the step of concentrating the filtrate obtained by the fraction or the filtration process through a vacuum concentration method and the concentration It may further comprise the step of drying the concentrated solution by a method such as lyophilization.

In relation to the preparation of fractions of the honey leaf hot water extract, the yield of the hexane fraction is 0.015%, the yield of the chloroform fraction is only 0.27%, while the butanol fraction is significantly excellent yield of 27.5%, water Unlike the fraction, the anti-inflammatory effect is excellent, and the honey leaf material, unlike honey fruit, its yield is abundant and easy to store, the method for producing butanol fraction of the honey leaf hydrothermal extract is economical due to the high yield in fraction production efficiency It is recognized, and anti-inflammatory effect is also recognized, so it is evaluated to be excellent industrially.

The honey leaf extract of the present invention is a plant-derived extract used for edible, and has no problems with side effects or safety, and as a result of MTT analysis, there is no cytotoxicity, and it is easy to produce because the yield is higher than that of the honey fruit. The related anti-inflammatory effects were also recognized. In particular, the ethyl acetate fraction of the honey leaf extract fractions inhibited NO secretion, effectively inhibited the expression of iNOS, and significantly inhibited COX-2 enzyme activity. In addition, the butanol fraction of the fraction of the honey leaf extract was confirmed that not only the anti-inflammatory effect is recognized but also the production yield is excellent.

In this aspect, the anti-inflammatory composition containing the honey leaf extract as an active ingredient may be used as an anti-inflammatory agent for treating or preventing diseases related to inflammation by inhibiting inflammation. In addition, it can be used as a COX-2 inhibitor or NO inhibitor which is a substance that is recognized as having an anti-inflammatory effect, and in this aspect, it can be used to impart anti-inflammatory effect or hypoallergenicity to various cosmetics.

Therefore, the present invention can be widely used in the medical industry related to the treatment of diseases related to inflammation and in the field of the cosmetic industry related to control of skin inflammation.

1 is a schematic diagram showing a process for preparing a honey leaf hydrothermal extract and a solvent fraction of the hydrothermal extract according to an embodiment of the present invention.
Figure 2 is a graph showing the results of measuring the cytotoxicity of the honey leaf extract by MTT assay using RAW264.7 cell line according to an embodiment of the present invention, where + is LPS (1 μg / mL) Or-means that the extract was treated,-means not treated, the SHL value of the horizontal axis represents the dose (㎍ / mL) of the honey leaf hydrothermal extract, the vertical axis is the control group not administered any sample % Of relative cytotoxicity.
3 is a graph showing the results of measuring the amount of NO secretion in order to confirm the anti-inflammatory effect of the honey leaf hydrothermal extract using RAW264.7 cell line, according to an embodiment of the present invention, + is LPS (1 μg / mL) together,-means not treated with LPS, the SHL value on the horizontal axis means the dosage of the honey leaf hot water extract (㎍ / mL), the vertical axis is the control treated only LPS It means the relative value (%) of the relative NO secretion.
Figure 4 is a graph showing the results of measuring the cytotoxicity of the fraction of the honey leaf extract by MTT assay using RAW264.7 cell line, according to an embodiment of the present invention, where + is LPS (1 μg) / mL) or solvent fractions treated,-means untreated samples, each value on the horizontal axis represents the dosage (㎍ / mL) of the fraction of each fraction solvent of the honey leaf hot water extract The vertical axis represents the percentage (%) showing cytotoxicity compared to the control group which did not receive any sample.
5 is a graph showing the result of measuring the amount of NO secretion, in order to confirm the anti-inflammatory effect of the fraction of the honey leaf hot water extract using RAW264.7 cell line, according to an embodiment of the present invention, + is LPS (1 Μg / mL) or solvent fractions,-means no sample, the horizontal axis letters and numbers indicate the type and dosage of the fraction for each fraction solvent of the honey leaf hydrothermal extract (50 μg / mL). mL), and the vertical axis represents the relative value (%) of NO secretion compared to the control treated with LPS only.
6 is a graph showing the results of measuring inflammation-related cytokine iNOS mRNA level in order to confirm the anti-inflammatory effect of honey leaf hot water extract according to an embodiment of the present invention, + is LPS (1 ㎍ / mL) or Means that the solvent fraction has been treated,-means that the sample has not been treated, and the horizontal axis value indicates the dose of the honey leaf hydrothermal extract (μg / mL).
Figure 7 is a graph showing the results of measuring the expression level of iNOS and COX-2 in order to confirm the anti-inflammatory effect of the honey leaf hot water extract according to an embodiment of the present invention, + is LPS (1 ㎍ / mL) Or means that the solvent fraction has been treated,-means that the sample has not been treated, and the horizontal axis value indicates the dose of the honey leaf hydrothermal extract (μg / mL).
8 is a graph showing the results of measuring the inhibitory activity of COX-2 through the activity of COX-2 in order to confirm the anti-inflammatory effect of each solvent fraction of the honey leaf hot water extract according to an embodiment of the present invention. , The solvent that separates each graph means a fraction solvent, the horizontal axis represents the elapsed time after treatment, and the vertical axis represents the activity of COX-2.

Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to specific examples and comparative examples in order to help understanding of the present invention. However, the following examples are only intended to more clearly understand the present invention, and are not limited to the following examples of the present invention, the protection scope of the present invention should be interpreted by the claims, and within the equivalent range All technical thoughts should be construed as being included in the scope of the present invention.

< Example  1> Honey  Leaf extract and Fraction  Produce

1-1. Honey  Leaf extract manufacturer

A hot water extract was prepared by performing hot water extraction at 110 ° C. using 10 kg of leaves of Stauntonia hexaphylla .

More specifically, after adding 200L of distilled water to 10 kg of honey leaves washed with distilled water, hot water extraction was performed while heating at 110 ° C. for 4 hours using an electric bath. After performing the extraction, the resultant was filtered through a 400 mesh filter cloth, and the filtrate was concentrated using a vacuum concentrator. After filtration, using the same amount of distilled water again to the remaining residue was performed twice more extraction, filtration and reduced pressure in the same process.

The honey leaf hot water extract prepared through the above process was lyophilized in a freeze dryer. Through the freeze-drying, 1 kg of honey leaf hydrothermal extract was obtained, and as a result, it was confirmed that the yield by the honey leaf hydrothermal extraction method was 10%.

1-2. Honey  Of leaf extract Fraction  Produce

Preparation of fractions of the honey leaf hot water extract was carried out by the production method shown in FIG.

Specifically, 250 g of the hot water extract is completely dissolved in 5 L of distilled water, and then put into a fraction filter and 5 L of hexane (Hexane) is added, mixed and fractionated to separate the hexane soluble layer hexane layer and the hexane insoluble layer aqueous layer. And the hexane fraction liquid was prepared by obtaining only a hexane layer.

5 L of chloroform was added to the remaining solution (aqueous layer), followed by mixing. The chloroform fraction was prepared by separating the chloroform layer, which is a chloroform soluble layer, and the aqueous layer, which is a chloroform insoluble layer, to obtain only a chloroform layer.

5 L of ethyl acetate was added to the remaining solution (aqueous layer), followed by mixing, fractionating, separating an ethyl acetate layer as an ethyl acetate soluble layer and an aqueous layer as an ethyl acetate insoluble layer, and obtaining only an ethyl acetate layer to prepare an ethyl acetate fraction. It was.

Butanol fraction was prepared by adding 5 L of butanol to the remaining solution (aqueous layer), followed by mixing, separating the butanol layer as the butanol soluble layer and the water layer as the butanol insoluble layer, and obtaining only butanol layer.

The butanol soluble layer was fractionated to separate the remaining butanol insoluble layer to remove the remaining organic solvent, thereby preparing a water fraction.

Each of the obtained fractions was concentrated by filtration through a vacuum filter, and then lyophilized at -20 ° C to completely remove the solvent, and then used in this experiment. Through this process, 0.02 g of hexane fraction (0.015%), 0.67 g of chloroform fraction (0.27%), 2g of ethyl acetate fraction (1.05%), 68.75 g of butanol fraction (27.5%) and 150.14g of water fraction ( 60.06%) was used as a sample. Since the yield of the hexane fraction in the manufacturing process is too low can cause process problems in the industrialization, it was evaluated as inappropriate. In addition, in the case of butanol fraction and water fraction, the excellent yield is confirmed, and the economic efficiency is recognized due to the high yield in the efficiency of fraction production, it is evaluated to be industrially excellent.

The extracts and fractions obtained were cryopreserved until use in experiments.

< Example  2> extract and Fraction  Cytotoxicity experiment

In order to measure the cytotoxicity of fractions of the honey leaf hydrothermal extract and honey leaf hydrothermal extract prepared in Example 1, RAW264.7 cells, which are mouse macrophages, were purchased from ATCC.

DMEM / F12 (Dulbecco's modified Eagle's medium / Nutrient Mixture Ham's F12), FBS (fetal bovine serum), L-glutamine (L-glutamine) and penicillin-streptomycin used in the cell culture were Gibco / BRL (USA).

The RAW264.7 cells were cultured using a medium containing 10% FBS, 1% penicillin streptomycin and 1% L-glutamine in DMEM / F12 medium, and a 37 ° C. wet CO₂ incubator (5% CO₂ / 95% air). Incubated).

After about 80% of the cells were incubated with the cells, the monolayers of cells were washed with PBS (pH 7.4), washed, and subcultured with 0.25% trypsin and 2.56 mmol / L EDTA. Medium was changed every two days.

The cultured cells were aliquoted into 48 well-plates at a density of 50,000 cells / well and further cultured for 24 hours. After 24 hours, the LPS-treated control group without any treatment and LPS and the honey leaf extract and fraction of Example 1 were prepared at various concentrations using DMSO, which was found to have little effect on cell survival. The honey leaf extract and fractions were divided into experimental groups, and further cultured for 24 hours, the culture solution was removed, and the number of living cells was measured by MTT assay. The MTT analysis was performed in the following manner.

First, the cell culture medium was removed, and then treated with 1 ml per well of DMEM / F12 medium containing MTT at 1 mg / ml, and further incubated in a 37 ° C. wet CO 2 incubator for 4 hours. After removing the medium, the tetrazolium bromide salt was removed, and 200 μl of DMSO was dissolved to dissolve the formazan crystal produced in each well, and the cell viability was measured by measuring absorbance at a wavelength of 540 nm in a microplate reader (BIO-RAD). Confirmed.

The result of the treatment with the honey leaf extract was performed the same three times the experiment, shown in Figure 2 as the average value of the measured value, the result of treatment with the fraction of the honey leaf hot water extract the same three times the experiment The average value of the measured values is shown in FIG. 4.

As shown in FIG. 2, the honey leaf hydrothermal extract prepared in Example 1-1 was treated at various concentrations, specifically, the honey leaf hydrothermal extract at a concentration of 10 μg / ml to 200 μg / ml and elapsed for 24 hours. In any case, it was confirmed that all samples did not show any effect on the proliferation of the cells as compared with the control without LPS treatment. Therefore, it was confirmed from the results that the honey leaf extract is not cytotoxic up to 200 ㎍ / ㎖.

In addition, as shown in FIG. 4, in the case of the fraction of the honey leaf hydrothermal extract prepared in Example 1-2, it was confirmed that the cell survival rate was significantly reduced in the experimental group administered 25 ㎍ / ㎖ in the hexane fraction It was found to be cytotoxic. In addition, the ethyl acetate fraction was not significant in the experimental group administered with 100 ㎍ / ml, but the cell viability was slightly reduced, and further decreased in the experimental group administered with 200 ㎍ / ml, and significantly reduced to 100 ㎍ / ml. It was confirmed to be safe. In addition, the cell viability was maintained at 50 ㎍ / ㎖ or 100 ㎍ / ㎖ in the case of other solvents, there is no cytotoxicity when the 50 ㎍ / ㎖ administration of the fraction using a solvent other than hexane as a fraction solvent, It was confirmed to be safe.

< Example  3> extract and Fraction  Anti-inflammatory effect measurement

In order to confirm the anti-inflammatory effect of the honey leaf extract and fractions prepared in Example 1, RAW 264.7 cells cultured in Example 2 was used.

After adding together the solvent fraction and the LPS of the honey leaf hydrothermal extract prepared in Example 1 or the honey leaf hydrothermal extract, and incubated for 24 hours by the method of Example 2, the culture was carried out for 24 hours. The culture broth was centrifuged at 3,000 rpm for 5 minutes to separate the supernatant, and the same amount of Griess reagent (1% sulfanilamide, 0.1% naphthyl-ethylene diamine dihydrochloride, 2% phosphoric acid, Promega, USA) and reacted, the amount of NO secretion was measured at 540nm, the results are shown in Figures 3 and 5.

As shown in FIG. 3, in the case of the control group not treated with LPS, a low NO secretion amount was confirmed. On the other hand, in the experimental group to which LPS was added, it was confirmed that the content of NO was significantly increased by causing inflammation due to LPS. In addition, despite the LPS treatment, when the honey leaf hot water extract prepared in Example 1 was treated, the concentration of NO was reduced, especially when 100 μg / ml of the honey leaf hot water extract was treated with LPS. The amount of NO secretion decreased to about 80% of the control group that caused inflammation, and when 200 μg / ml was treated, the amount of NO secretion decreased to less than 70% of the control group that caused inflammation due to LPS. The effect could be confirmed.

The honey leaf hot water extract did not affect cell survival even when treated with 200 ㎍ / ㎖ in Example 2, it was confirmed that there is no cytotoxicity, the honey leaf extract of the present invention is not cytotoxic and safe as well In addition, it was confirmed that the anti-inflammatory effect is also excellent.

In addition, as shown in FIG. 5, when the 50 ㎍ / ㎖ was confirmed that all kinds of fractions are safe in Example 2, it was confirmed that the NO secretion in the water fraction is almost reduced. In addition, the butanol fraction also confirmed the anti-inflammatory effect of 60% NO secretion compared to the control. On the other hand, the chloroform fraction and ethyl acetate fraction of the honey leaf hot water extract were found to be less than 20% NO compared to the control group, and the ethyl acetate fraction and the chloroform fraction were significantly superior to the NO production inhibitory effect at a concentration at which cytotoxicity was not a problem. It was confirmed to have

< Example 4 > Inflammatory cytokines mRNA  Determination of anti-inflammatory effect by measuring level

In order to confirm the anti-inflammatory effect of the honey leaf hot water extract, which was confirmed to have an excellent anti-inflammatory effect through the amount of NO secretion in Example 3, the change of mRNA content of cytokines (specifically, iNOS) related to the inflammatory response was observed in macrophages. It was confirmed using (primary cell).

In order to obtain the primary cells, 32 rats (ICR mouse, male) and Sprague-Dawley rats weighing 15 g to 20 g each were purchased from Samtaco Inc. (Korea), Each group was divided into 16 groups, and 4 animals were placed in each group for breeding. The breeding of the experimental animals was carried out under a temperature condition of 20 ℃ to 24 ℃, humidity conditions of 60% to 70% and day and night lighting conditions of 12 hours cycle, water and diet were to be ingested freely. The diet used a solid feed (Samyang feed, South Korea). The experimental animals were bred under the above conditions for 7 days to adapt to the laboratory environment, and then used for the experiment.

Macrophages obtained from the experimental animals (Macrophage primary cells, 2 X 10 ⁶ cells / ml) were incubated with serum starvation medium for 24 hours. After the culture, LPS (0.5 mg / ml) or LPS (0.5 mg / ml) and treated with honey leaf hot water extract of various concentrations, and then incubated for 24 hours. After 24 hours, RNA was isolated from each of the cultured cells. Isolation of the RNA was carried out in the following manner.

Specifically, the cultured cells were lysed with GIT solution (easy BLUE Total RNA extraction kit, Intron Biotechnology, Korea), centrifuged at 10,000 rpm at room temperature for 5 minutes, and then the supernatant was removed and pelleted. (pellet) was obtained. 1 ml of 0.1% DEPC solution (Sigma, USA) was added to the pellet, followed by centrifugation at 12,000 rpm for 2 minutes to remove the supernatant, and then pellets were obtained. 0.5 ml of guanidinium was added to the obtained pellets, followed by vortexing. Further, 0.5 ml of a phenol / chloroform / iso-amylalchol mixed solution (25: 24: 1) was added, vortexed, and centrifuged at 12,000 rpm for 3 minutes to obtain a supernatant. The supernatant and the same amount of isopropyl alcohol (iso-propylalcol) was added and mixed well, and left to stand at -20 ° C for 30 minutes. Thereafter, the supernatant was removed by centrifugation at 12,000 rpm for 10 minutes, and then the pellet was washed with 70% aqueous ethanol solution and dried under vacuum to separate RNA.

The isolated RNA was dissolved in 1 ml of 0.1% DEPC solution and used to measure mRNA content of inflammation-related cytokines. The mRNA content of iNOS, an inflammation-related cytokine, was measured by the following method.

Superscript II reverse transcriptase (Invitrogen, USA) was added to 3 μg of the isolated RNA, incubated at 42 ° C. for 1 hour and 45 minutes, and then incubated at 70 ° C. for 15 minutes to obtain cDNA. The obtained cDNA was quantified by real-time PCR. Sequence and experimental conditions of the primer for performing the real-time PCR are described in Table 1 below.

Target mRNA primer sequence Annealing Tm (℃) iNOS sense CAGAGGACCCAGAGACAAG 50.8 anti-sense ACCTGATGTTGCCATTGTTG

The real-time PCR result is shown in Figure 6 the result taken with a picture compared with the β-actin content.

As shown in FIG. 6, in the control group not treated with LPS, mRNA of iNOS, a cytokine associated with inflammation, was not found at all, whereas mRNA of iNOS was significantly higher when only LPS was treated. In addition, despite the LPS treatment, when the honey leaf hot water extract prepared in Example 1 was treated, it was confirmed that the mRNA content of iNOS was reduced depending on the concentration. When the honey leaf hydrothermal extract was treated, the mRNA content of iNOS was reduced in a concentration-dependent manner, and the honey leaf hydrothermal extract was found to have an excellent anti-inflammatory effect.

< Example 5 > Inflammation iNOS  And COX -2 Expression Inhibition Activity Confirmation

In order to confirm the anti-inflammatory effect of the honey leaf hot water extract, which was confirmed to be excellent anti-inflammatory effect through the NO secretion amount and the mRNA content of iNOS in Example 3 and Example 4, iNOS and COX2 expression inhibitory activity was confirmed.

Specifically, the macrophage (Macrophage primary cell) obtained in Example 4 was adjusted to 1 X 10 ⁵ cells / ml using DMEM medium and then inoculated in a 24 well plate, 18 hours before in a 5% CO ₂ thermostat Incubated. After the incubation, the honey leaf hydrothermal extracts were treated by concentration (0.1 μg / ml, 1 μg / ml, 10 μg / ml, 100 μg / ml and 200 μg / ml), and after 1 hour of incubation, LPS (1 μg / ml). Ml) was treated and cultured under the same conditions as the pre-culture. After 24 hours, the cultured cells were collected and washed three times with phosphate buffered saline (PBS), followed by cell lysis buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 2 mM EDTA). , 1 mM EGTA, 1 mM NaVO ₃ , 10 mM NaF, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 25 μg / ml aprotinin, 25 μg / ml leupeptin) were added and dissolved at 4 ° C. for 30 minutes at 4 ° C. and 15,000 rpm. Cell membrane components and the like were removed by centrifugation for 15 minutes at.

Protein concentration was quantified using the Bio-Rad Protein Assay Kit by standardizing bovine serum albumin (BSA). 20 μg of the isolated protein was loaded on 10% mini gel SDS-PAGE and denatured, and transferred to a nitrocellulose membrane (membrane, BIO-RAD, Richmond, CA, USA) for 1 hour at 350 mA. The blocking of the membrane to which the protein was moved was performed at room temperature for 2 hours in a TTBS (0.1% Tween 20 + TBS) solution containing 5% skim milk.

Anti-mouse iNOS (Calbiochem, La Jolla, USA) was used as an antibody to examine the expression level of iNOS, and anti-mouse COX-2 (BD Biosciences Pharmingen, SanJose was used as an antibody to examine the expression level of COX-2. , USA) was diluted 1: 1000 in a TTBS solution and reacted at room temperature for 2 hours, and then washed three times with TTBS. As a secondary antibody, HRP (horse radish peroxidase) conjugated anti-mouse IgG (Amersham Pharmacia Biotech, LittleChalfont, UK) was diluted 1: 5000, reacted at room temperature for 30 minutes, washed three times with TTBS, and then ECL substrate. After 30 seconds of reaction with (Amersham Biosciences, Piscataway, NJ, USA), the expression amount was measured using a chemiluminescence imaging system (ATTO AE-9150 EZ-Capture II, Japan). The result of measuring the expression amount is shown in FIG.

As shown in FIG. 7, the control group not treated with LPS, i.e., iNOS and COX-2, were not identified at all, whereas the LPS-only control group showed significantly higher iNOS and COX-2. In addition, despite the LPS treatment, it was confirmed that the iNOS and COX-2 contents were reduced depending on the concentration when the honey leaf hydrothermal extract prepared in Example 1 was treated. When the honey leaf hot water extract was treated, it was confirmed that the honey leaf hot water extract has an excellent anti-inflammatory effect from the result of decreasing iNOS and COX-2 contents in a concentration-dependent manner.

< Example 6 > Fraction COX -2( Cyclooxygenase enzyme -2) Confirmation of inhibitory effect

In order to confirm the anti-inflammatory effect of the fraction of the honey leaf hot water extract which was confirmed to have excellent anti-inflammatory effect through the amount of NO secretion in Example 3, COX-2 enzyme inhibitory activity was confirmed.

First, five-week-old Sprague-Dawley male rats (Samtako, South Korea) were used in the experiment after adapting to the environment for one week. The breeding of the experimental animals was carried out under a temperature condition of 20 ℃ to 24 ℃, humidity conditions of 50% to 55% and day and night lighting conditions of 12 hours cycle, water and diet were to be ingested freely. The diet used a solid feed (Samyang feed, South Korea). The experimental animals were bred under the above conditions for 7 days to adapt to the laboratory environment, and then used for the experiment.

10 ml of 4% thioglycolate was injected into the abdominal cavity of the experimental animals (SD male rats), and the peritoneal macrophages were proliferated for 3 days, followed by cervical dislocation. Peritoneal macrophages were collected from SD male rats prepared by cervical dislocation.

Specifically, 10 ml of HBSS was injected into the abdominal cavity, and then the abdominal macrophages were taken using a syringe (syringe), and then transferred to a conical tube. Peritoneal macrophages were centrifuged at 13,000 rpm for 5 minutes, washed twice with DMEM medium, aliquoted into a 60 mm diameter petri dish, and incubated in a CO ₂ cell incubator for 4 hours. After incubation, the suspended cells were removed and the adhered cells were stabilized for 24 hours, after which the proteins were separated and used.

50 mg / ml of each fraction of the honey leaf hot water extract obtained in Example 1 was treated to the separated protein, stabilized for 30 minutes, and then by a method according to COX Fluorescent Activity Assay Kit (Cayman ChemiaclCpmpany, Item No. 700200). Cyclooxygenase enzyme activity was measured. The measured enzyme activity measurement results are shown in FIG. 8.

As shown in FIG. 8, the water fraction of the honey leaf hot water extract was found to have no inhibitory effect, and the inhibitory activity was also decreased in the hexane and butanol fractions, while the ethyl acetate fraction and the chloroform fraction were inferior. It was confirmed that silver inhibitory activity was remarkably excellent. In particular, it was confirmed that the difference in the inhibitory activity is remarkable with time. In particular, the ethyl acetate fraction of the honey leaf hot water extract was found to have the best COX-2 inhibitory activity.

According to the results of the experiment, the extract of honey leaves that can be used for food was found to have no cytotoxicity in the MTT assay as expected, and results related to inflammation induced by NO with respect to the anti-inflammatory effect (NO secretion amount) And considering the results related to the mRNA transcription and NOS expression of the iNOS that causes inflammation, it was confirmed that it can effectively inhibit the inflammation, in particular, the ethyl acetate fraction of the honey leaf hydrothermal extract fraction has a range of safety was confirmed by MTT analysis In addition, the NO inhibitory effect was excellent, and in particular, it was confirmed that it has a remarkably excellent anti-inflammatory effect in relation to the COX-2 inhibitory activity, the ethyl acetate fraction of the honey leaf hot water extract replaces the existing inflammatory therapeutic agent, such as an anti-inflammatory composition Not only can be used as a component, but also as a component used in existing cosmetics It can properly control the inflammation it is expected to be used as an active ingredient of the cosmetic composition.

Claims (7)

Anti-inflammatory composition comprising the extract of the honey ( Stauntonia Hexaphylla ) leaf as an active ingredient. The method of claim 1,
The honey leaf extract is an anti-inflammatory composition that extracts one or more selected from the group consisting of water, alcohol having 1 to 5 carbon atoms and mixtures thereof with an extract solvent. The method of claim 2,
The honey leaf extract is an anti-inflammatory composition which is a fraction obtained by fractionation of ethyl acetate or chloroform with a fraction solvent in the honey leaf hot water extract. Pharmaceutical composition for the treatment and prevention of inflammatory diseases comprising a honey extract of Stauntonia Hexaphylla leaf. 5. The method of claim 4,
The honey leaf extract is a pharmaceutical composition for treating and preventing inflammatory diseases, which is a fraction obtained by fractionating ethyl acetate or chloroform with a fraction solvent in the honey leaf hydrothermal extract. 5. The method of claim 4,
The inflammatory diseases include dermatitis, dermatomyositis, polymyositis, allergies, systemic lupus erythematosus, pemphigus, aphthous stomatitis, retinitis, gastritis, hepatitis, bronchitis, esophagitis, enteritis, pancreatitis, colitis, nephritis, bedsores, Lupus, chronic thyroiditis, multiple sclerosis, sepsis (sepsis), radiation damage, organ transplant rejection, systemic edema and local edema, any one selected from the group consisting of a pharmaceutical composition for treating and preventing inflammatory diseases. Honey ( Stauntonia) hexaphylla ) step of producing honey honey water extract to add water to the leaves and hot water extract; And
Preparing butanol fraction by adding butanol to the honey honey water extract prepared above
Method of producing a fraction of the honey leaf extract having an anti-inflammatory effect comprising a.

Images