KR20150111793A - Anti-inflammatory agent containing pulchellamin g - Google Patents

Abstract

The present invention relates to an anti-inflammatory agent having anti-inflammatory effects, specifically, completed by confirming excellent anti-inflammatory effects of Pulchellamin G as an ingredient separated from Saussurea pulchella. Specifically, the present invention relates to: a pharmaceutical composition for preventing or treating inflammatory diseases, comprising Pulchellamin G, pharmaceutically acceptable salts thereof, and any one selected from the group consisting of a combination thereof; or a cosmetic composition for preventing or alleviating inflammation, with anti-inflammatory effects, comprising Pulchellamin G, pharmaceutically acceptable salts thereof, and any one selected from the group consisting of a combination thereof.

Description

ANTI-INFLAMMATORY AGENT CONTAINING PULCHELLAMIN G < RTI ID = 0.0 >

The present invention relates to a anti-inflammatory composition, particularly a anti-inflammatory composition comprising as an active ingredient a component derived from a plant extract having an anti-inflammatory effect.

Inflammation is a localized immune response that minimizes the damage when cells or tissues are damaged or destroyed by various factors, such as harmful substances or organisms from the outside, and restores damaged areas to the original state. And is a useful defense mechanism to remove the products produced by tissue damage. As a result, pain, swelling, redness, fever, or the like may occur as a result of the defensive mechanism, resulting in malfunction. Various factors causing inflammation include physical factors such as trauma, burn, bronze, radioactivity, chemical factors such as acid, and immunological factors due to antibody reaction. In addition, blood vessel and hormone imbalance .

The inflammation normally functions to neutralize or eliminate the causative factor through in vivo inflammatory reaction and regenerate the upper tissue to restore the normal structure and function. However, when the degree of inflammation is over a certain level or becomes chronic, chronic inflammation And the like. In addition to being able to observe inflammatory responses in almost all diseases of clinical diseases, enzymes related to inflammatory reaction play an important role in carcinogenesis.

Recently, it has been known that the progress of the inflammatory reaction in the body is related to COX (cyclooxygenase) enzyme activity. The COX enzyme is a major enzyme involved in the biosynthesis of prostaglandin in vivo (Smith et al., J. Biol. Chem., 271, 33157 (1996)), and two kinds of isozyme enzymes, COX-1 and COX -2 is known to exist. The COX-1 is constantly present in tissues such as the stomach or kidney and is involved in maintaining normal homeostasis, while the COX-2 is involved in mitogen or cytokines in inflammation or other immune responses. Is a transient and rapidly expressed enzyme in the cell.

Another strong inflammatory mediator, nitric oxide (NO), is produced from L-arginine by NO synthase (NOS), and is produced by a variety of substances, such as UV, external stress, endotoxin or cytokines Lt; / RTI > cells. These inflammatory stimuli increase the expression of inducible NOS (iNOS) in the cells, thereby inducing NO production in the cells and activating the macrophages to cause an inflammatory reaction.

In addition, the expression or activity of Heme Oxygenase-1 (HO-1), an enzyme closely related to the cell protection mechanism, is closely related to antioxidant and anti-inflammatory mechanisms .

The major function of the Heme Oxygenase-1 (HO-1) is to induce the oxidation of Heme to convert the Heme into biliverdin, free iron ) And carbon monoxide. The bovine peroxidase is converted to bilirubin by biliverdin reductase, which has been reported to exhibit antioxidative effects by acting as a reactive oxygen species (ROS) scavenger.

Particularly, carbon monoxide generated by the hematin oxidase-1 has an anti-inflammatory effect, and the free iron is involved in ferritin synthesis and has a cytoprotective effect. By this action, the hematinoxidase-1 (HO-1) is able to induce oxidation of the hematin to form biliverdin, ultimately bilirubin, free iron, It produces decomposition products of carbon monoxide, exerts cytoprotective effect against external stimulus, and has anti-inflammatory effect.

Therefore, it has been reported that the increase in the expression or activity of hematinoxidase-1 has important cellular mechanisms in relation to anti-inflammatory actions as well as cell protection against external stimuli.

Therefore, in order to effectively alleviate inflammation, researches on substances capable of inhibiting the production of NO and expressing or activating hematin oxidase-1 have been conducted. However, some side effects of anti-inflammatory substances developed by these studies are problematic. For example, non-steroidal anti-inflammatory drugs used in the treatment of chronic inflammatory diseases such as acute or rheumatoid arthritis are known to exhibit side effects such as gastrointestinal disorders by inhibiting COX-1 enzyme as well as inhibiting COX-2 enzyme .

On the other hand, cosmetics used in everyday life are products used for protecting skin and cleansing the shine, but when the cosmetic composition is examined, ingredients different from the purpose of skin protection are used as indispensable substances for product formation. For example, surfactants, preservatives, fragrances, sunscreens, pigments, and other ingredients used to impart other benefits or effects. Ingredients that are essential for the manufacture of cosmetics are generally known to cause skin irritation, rashes, swelling, and various other side effects.

Further, when sebum components, sweat components, and fatty acids, higher alcohols, and proteins in cosmetic components, which are discharged from the body, are decomposed into highly toxic substances by skin-derived bacteria existing on the skin, they may cause skin inflammation It is well known that skin inflammation is caused by ultraviolet rays from the sun.

In this way, the causes of skin adverse effects in cosmetics are always present and various studies have been conducted to solve them. To date, there have been a number of nonsteroidal flufenamic acid, ibuprofen, benzydamine, indomethacin, etc. that have been used to relieve irritation and inflammation, such as erythema and edema , Steroids such as prednisolone and dexamethasone, and allantoin, azrene, epsilon-aminocaproic acid, hydrocotisone, licorice acid and its derivatives (? -Glycyrrhetinic acid, glycyrrhetinic acid derivative) It is known to be effective for anti-inflammation.

However, the indomethacin generally used as an anti-inflammatory agent is a substance that can not be used in cosmetics. The amount of hydrocotisin is limited. The licorice acid and its derivatives are difficult to stabilize or have poor solubility, It is difficult to achieve a substantial effect. Thus, known anti-inflammatory agents have problems in terms of skin safety and stability in mixing cosmetics, and their use is limited.

Therefore, it is possible to induce the expression and activity of hematinoxidase-1 effectively and to inhibit the production of NO, without the risk of such side effects or cytotoxicity as a natural substance-derived substance, Thus, it is required to develop a substance which can be used in cosmetics without limiting its content as well as inhibiting inflammation without side effects.

KR 10-2011-0121487 A KR 10-2005-0055856 A KR 10-0625766 B KR 10-0257448 B

In order to meet such a demand, the present invention aims to provide a anti-inflammatory composition comprising as an active ingredient a substance having an anti-inflammatory effect derived from a plant extract having a low possibility of causing a problem related to side effects.

Specifically, the object of the present invention is to provide a pharmaceutical composition for prevention or treatment of inflammatory diseases, which comprises not only natural plant-derived side effects but also safety, as well as a natural plant-derived component having anti- .

It is another object of the present invention to provide a method for preventing or improving inflammation, which comprises an effective ingredient of a natural plant-derived component having an anti-inflammatory effect, And to provide a cosmetic composition.

In order to achieve the above object, the present invention provides a pharmaceutical composition comprising as an active ingredient any one selected from the group consisting of each component derived from each ingredient, specifically, paclhelamine G, a pharmaceutically acceptable salt thereof, Thereby providing a anti-inflammatory composition.

Pulchelamine G, which is a component derived from each of the above-mentioned viscosities, is an amino acid-sesquiterpene lactone-based compound which is separated from each time-of-death.

In order to achieve the above object, the present invention provides an anti-inflammatory agent comprising as an active ingredient any one selected from the group consisting of angioscintigmine-derived components, specifically paclitaxel G, a pharmaceutically acceptable salt thereof, to provide.

The present invention also provides a pharmaceutical composition for preventing or treating an inflammatory disease, which comprises, as an active ingredient, any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof. to provide. The inflammatory disease may be any one selected from the group consisting of dermatitis, allergy, systemic lupus erythematosus, retinitis, gastritis, hepatitis, enteritis, pancreatitis, nephritis and combinations thereof.

In order to achieve the above object, the present invention also provides a cosmetic composition having anti-inflammatory activity, which comprises, as an active ingredient, any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof and a combination thereof .

Hereinafter, the present invention will be described in more detail.

The inventors of the present invention studied 7 kinds of felcillamine isolated from a natural product, Glycyrrhizae, while studying natural products having an effect of treating, improving or preventing inflammatory diseases. As a result, Phellinamine G increases the expression and activity of Heme Oxygenase-1 (HO-1), an enzyme known to be a protective enzyme against oxidative stress-induced damage, and induces inflammation directly Which can effectively inhibit the secretion of NO and can effectively inhibit the generation and activation of cytokines associated with the inflammation leading to the secretion and inflammation of NO, And the toxicity is not a problem as a result of the cytotoxicity. Thus, the present invention has been completed.

As used herein, the term "pharmaceutically acceptable salt " refers to salts prepared by conventional methods, including those that can be prepared or applied by methods known to those skilled in the art. The "pharmaceutically acceptable salts" include, but are not limited to, salts derived from pharmacologically or physiologically acceptable inorganic and organic acids and bases. Examples of the pharmacologically or physiologically acceptable inorganic and organic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, Acetic acid, citric acid, methanesulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid and the like. In addition, salts derived from the pharmacologically or physiologically acceptable bases may be alkali metals, such as sodium, alkaline noble metals, such as magnesium, ammonium, and the like.

As used herein, "treatment" means any action that improves or alleviates the symptoms of the disease upon administration of a composition comprising the paclitaxel G or a pharmaceutically acceptable salt thereof according to the present invention.

As used herein, "prevention" means any action that inhibits or delays the onset of the disease by administration of a composition comprising paclitaxel G or a pharmaceutically acceptable salt thereof according to the present invention.

As used herein, "carrier" means a carrier, excipient, or diluent that does not significantly stimulate the organism and does not interfere with the biological activity and properties of the administered compound.

The present invention relates to a pharmaceutical composition comprising as an active ingredient any one selected from the group consisting of Pulchelamine G, a pharmaceutically acceptable salt thereof, and a combination thereof. The above-mentioned Pulchellamin G is an amino acid-sesquiterpene lactone-based compound which is separated from each other.

The present invention also relates to an anti-inflammatory agent comprising, as an active ingredient, any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof. The paclitaxel G is an amino acid-sesquiterpene lactone-based compound separated from each time-of-arrival.

The MTT analysis showed that pellucillamine G was not cytotoxic even when treated at a concentration of 80 μg / ml, and even when treated at a concentration of 10 μg / ml or 20 μg / ml, And thus the paclitaxel G can be used for the purpose of inhibiting or reducing inflammation or treating, improving or preventing inflammation-related diseases. In this respect, the paclhelamine G may be used as an active ingredient or an active ingredient of an anti-inflammatory composition or an anti-inflammatory agent.

The anti-inflammatory composition or anti-inflammatory agent comprising any one selected from the group consisting of pellucillamine G, a pharmaceutically acceptable salt thereof, and a combination thereof can be directly applied to animals including humans. The animal is a group of organisms corresponding to plants. It mainly consumes organic matter as nutrients, and differentiates digestive organs, excretory or respiratory organs. Preferably, it is a mammal, more preferably a human.

Any one selected from the group consisting of paclitaxel G, pharmaceutically acceptable salts thereof, and combinations thereof may be used alone in the anti-inflammatory composition or anti-inflammatory agent, or in combination with other pharmacologically acceptable carriers, excipients, It may further include a subcomponent. More specifically, when a composition comprising any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof is used as a pharmaceutical agent or used for medicinal or pharmaceutical use, The active ingredient may be mixed with a pharmaceutically acceptable carrier or excipient according to a conventional method or diluted with a diluent.

In this case, the content of the active ingredient in the composition may be 0.001 wt% to 99.9 wt%, 0.1 wt% to 99 wt%, or 1 wt% to 50 wt%, but is not limited thereto, The content of the compound may be appropriately adjusted in a desired amount.

Examples of the pharmaceutically acceptable carrier, excipient or diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, propylhydroxybenzoate, talc, magnesium stearate and mineral oil , Dextrin, calcium carbonate, propylene glycol, liquid paraffin, and physiological saline. However, it is not limited thereto, and any conventional carrier, excipient or diluent may be used. In addition, the pharmaceutical composition may further comprise at least one selected from the group consisting of conventional fillers, extenders, binders, disintegrants, anticoagulants, lubricants, humectants, pH adjusters, nutrients, vitamins, electrolytes, alginic acid and its salts, pectic acid and its salts, , Fragrances, emulsifiers, preservatives, and the like. The components may be added independently or in combination with any one selected from the group consisting of the above-mentioned active ingredient, pellucamine G, a pharmaceutically acceptable salt thereof, and combinations thereof.

In addition, the composition of the present invention may further comprise a substance used as a known substance having a known anti-inflammatory effect, for example, a substance used as a COX-2 inhibitor, an NO inhibitor, or an anti-inflammatory agent.

When the composition is used as a medicine, it can be administered orally or parenterally. In one example, it can be administered through various routes including oral, transdermal, subcutaneous, intravenous or muscular.

In addition, the formulations of the compositions may vary depending on the method of use and may be formulated using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal . In general, solid dosage forms for oral administration include tablets, pills, soft or hard capsules, pills, powders and granules, which may contain one or more Excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, Sweeteners, fragrances, preservatives, and the like.

Forms for parenteral administration include creams, looses, ONITMENTS, PLASTERS, LIQUIDS AND SOULTIONS, AEROSOLS, FRUIDEXTRACTS, (ELIXIR), INFUSIONS, SACHET, PATCH or INJECTIONS.

Furthermore, the compositions of the present invention may be formulated using any suitable method known in the art or using methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA .

The dosage of the composition may be determined in consideration of the administration method, the age, sex, the severity of the patient, the condition of the patient, the degree of absorption of the active ingredient in the body, the inactivity and the drug to be used in combination. Kg body weight to 500 mg / kg body weight, 0.1 mg / kg body weight to 400 mg / kg body weight or 1 mg / kg body weight to 300 mg / kg body weight, And may be administered once or several times in divided doses. The dose is not intended to limit the scope of the invention in any way.

In addition, the pharmaceutical composition for preventing or treating an inflammatory disease or the composition for preventing or improving inflammatory disease according to one embodiment of the present invention may be any one selected from the group consisting of paclhelamine G, a pharmaceutically acceptable salt thereof, One as an active ingredient.

In this respect, the present invention may be a pharmaceutical composition for preventing or treating inflammatory diseases, comprising any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof as an active ingredient.

In another aspect, the present invention may be a food composition for preventing or ameliorating an inflammatory disease comprising, as an active ingredient, any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof.

In the present specification, inflammation is a concept including general inflammatory diseases, and the inflammatory diseases include those selected from the group consisting of dermatitis, allergy, systemic lupus erythematosus, retinitis, gastritis, hepatitis, enteritis, pancreatitis, It can be one.

More specifically, the inflammatory diseases are various acute inflammatory diseases such as dermatitis, allergies, ophthalmic diseases such as systemic lupus erythematosus, retinitis, various chronic inflammatory diseases such as rheumatoid arthritis, lupus, multiple sclerosis, sepsis, , Bronchitis, inflammatory bowel disease such as gastritis or enteritis, hepatitis, pancreatitis, nephritis, and combinations thereof.

The allergies may be selected from the group consisting of anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, atopic dermatitis, contact dermatitis, urticaria, Allergies and drug allergies.

The paclitaxel G may be obtained naturally from each step or may be artificially synthesized by a method known in the art. For example, the paclhelamine G may be separated from each time extract.

Saussurea pulchella is a wild flower of a biennial plant which is native to Korea and is bloomed mainly from August to October. It grows as seeds and grows in the mountains of various places in Korea. The growing environment grows in the shade of the sun or bar. The leaves from the roots disappear by the time of flowering, and there are small hairs on the surface and back. The fruit grows from October to November after the flowering. It has been used for inflammation, hypertension or hepatitis in traditional medicines in Korea, and it has been used for the saussurea The present invention relates to a method for producing phytochemicals, which comprises the steps of: (a) isolating a phytochemical compound from a plant, But its pharmacological activity has not been studied at all.

The extract may be prepared by extracting the plant by extracting with water or an organic solvent such as alcohol containing alcohol such as methanol, which is a conventional extract in the field of the present invention, and the pellucillamine G Can be separated from the respective extracts of the respective scions by a separation method that is common in the field to which the present invention belongs.

A composition for preventing or treating an inflammatory disease comprising any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof, as an active ingredient, is selected from the group consisting of paclitaxel G, , Or a combination thereof, may be contained in an amount of 0.001 wt% to 99.9 wt%, or 0.1 wt% to 99 wt%, or 1 wt% to 20 wt%, but is not limited thereto. Depending on the use of the composition and the method of use, the content of any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof may be suitably adjusted by a pharmaceutically effective amount or a suitable amount have.

The composition for preventing or treating an inflammatory disease according to the present invention may contain any one selected from the group consisting of pellucamine G, a pharmaceutically acceptable salt thereof, and a combination thereof, which is an effective ingredient, Depending on the method of use and the intended use, it may further comprise a pharmaceutically acceptable carrier, excipient or diluent.

The composition for preventing or treating inflammatory diseases can be directly applied to animals including humans. The animal is a group of organisms corresponding to plants. It mainly consumes organic matter as nutrients, and differentiates digestive organs, excretory or respiratory organs. Preferably, it is a mammal, more preferably a human.

Any one selected from the group consisting of paclitaxel G, pharmaceutically acceptable salts thereof, and combinations thereof may be used alone as an active ingredient in a composition for the prevention or treatment of inflammatory diseases, and other pharmacologically acceptable A nutritional acceptable carrier, excipient, diluent or subcomponent.

Specifically, when any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof is used as a medicament or used for medicinal or pharmaceutical use, the paclhelamine G, Acceptable salts thereof, and combinations thereof, may be mixed with a pharmaceutically acceptable carrier or excipient according to a conventional method, or diluted with a diluent. More specifically, in addition to the above-mentioned active ingredients, there may be further added a nutrient, a vitamin, an electrolyte, a flavoring agent, a coloring agent, a stabilizer, a pectic acid and its salt, an alginic acid and its salt, an organic acid, a protective colloid- , A glycerin, an alcohol, a carbonating agent used in a carbonated drink, and the like.

The term "pharmaceutically acceptable" as used herein means physiologically acceptable and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, or the like when administered to an animal, preferably a human. The pharmaceutically effective amount may be appropriately changed depending on the disease and its severity, the age, body weight, health condition, sex, administration route and treatment period of the patient.

Examples of the pharmaceutically acceptable carrier, excipient or diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, But are not limited to, one or more selected from the group consisting of dextrin, calcium carbonate, dextrin, calcium carbonate, propylene glycol, liquid paraffin, and physiological saline, and any conventional carrier, excipient or diluent may be used.

The components may be added independently or in combination with any one selected from the group consisting of the above-mentioned active ingredient, pellucamine G, a pharmaceutically acceptable salt thereof, and combinations thereof.

In addition, the composition for preventing or treating inflammatory diseases may further comprise at least one selected from the group consisting of conventional fillers, extenders, binders, disintegrants, anticoagulants, lubricants, wetting agents, pH adjusting agents, nutrients, vitamins, electrolytes, alginic acid and its salts, Gum tragacanth, castor oil, glycerin, flavor, emulsifier or preservative. The components may be added to the composition for preventing or treating the inflammatory disease independently or in combination.

In addition, the composition of the present invention may further comprise a substance used for prevention or treatment of known inflammatory diseases in addition to the above-mentioned effective ingredients. The above-mentioned substances to be used for prevention or treatment of inflammatory diseases are preferably 0.1 to 20 parts by weight per 100 parts by weight of the composition for preventing or treating inflammatory diseases or 100 parts by weight of the plant extract But the present invention is not limited thereto.

When the composition for preventing or treating inflammatory diseases is used as a medicament, the administration method can be either oral or parenteral. For example, the composition can be administered through various routes including oral, transdermal, subcutaneous, intravenous or muscular.

In addition, the formulation of the composition for the prevention or treatment of inflammatory diseases may vary depending on the method of use, and may be formulated so as to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal, ≪ / RTI > method. Examples of the above-described formulations include granules, powders, syrups, liquids, suspensions, tablets, injections, injectable tablets, cataplasma, capsules, soft gelatine capsules or hard gelatine capsules.

The formulation may further contain an excipient such as an ordinary filler, an extender, a binder, a disintegrant, a surfactant, an anticoagulant, a lubricant, a wetting agent, a flavor, an emulsifier, an antiseptic, a sweetener, a fragrance or a preservative.

In general, solid dosage forms for oral administration include tablets, pills, soft or hard capsules, pills, powders and granules, which may contain one or more Excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

In addition, liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to water or liquid paraffin, which is a commonly used simple diluent, various excipients, for example, Wetting agents, sweetening agents, perfumes, preservatives, and the like.

Furthermore, the compositions of the present invention may be formulated using any suitable method known in the art or using methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA .

The dose of the composition can be suitably determined by those skilled in the art in consideration of the administration method, the age, sex and weight of the recipient, severity of the disease, the condition, the degree of absorption of the active ingredient in the body, the rate of inactivation and the drug to be used. For example, the active ingredient may be administered in an amount of 0.0001 mg / kg (body weight) to 500 mg / kg (body weight), 0.01 mg / kg (body weight) to 400 mg / kg ) Or 1 mg / kg (body weight) to 300 mg / kg (body weight), and may be administered once a day or divided into several times. However, the dose is not limited in any way to the scope of the present invention.

The food composition for preventing or ameliorating inflammatory diseases includes any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof as an active ingredient.

The food may be a health functional food having an effect of preventing or improving an inflammatory disease, and in this respect, the food composition for preventing or improving inflammatory diseases may preferably be a health functional food.

The above-mentioned active ingredient, pacquillamine G, a pharmaceutically acceptable salt thereof and the inflammatory diseases are the same as those of the above pharmaceutical composition.

The term "food" means a natural or processed product containing one or more nutrients. Preferably, the food refers to a state in which the food can be directly eaten through a certain degree of processing. In general terms, Beverages, food additives and beverage additives.

The food may be, for example, various foods, beverages, gums, tea, a vitamin complex, a health functional food, and the like. In addition, in the present invention, the food may contain special nutritional foods (e.g., crude oil, spirits, infant food, etc.), meat products, fish products, tofu, jelly, noodles (Such as soy sauce, soybean paste, hot pepper paste, mixed sauce), sauces, confectionery (eg snacks), dairy products (eg fermented milk, cheese), other processed foods, kimchi, pickled foods (E.g., fruit and vegetable beverages, two oils, fermented beverages, etc.), natural seasoning (e.g., ramen soup, etc.).

The food, the health functional food, the beverage, the food additive and the beverage additive can be produced by a usual production method.

In the present specification, the health functional food refers to a food group imparted with added value to function and express the function of the food by physical, biochemical, biotechnological, and the like to the food, a bio-defense rhythm control of the food composition, Means a food which is processed and designed so that the body control function related to prevention and recovery is sufficiently expressed in the living body.

The health functional food may include food-acceptable food supplementary additives, and may further include suitable carriers, excipients and diluents conventionally used in the production of health functional foods.

In the present specification, beverage means a generic term for eliminating thirst or drinking to enjoy a taste, and is intended to include a health functional beverage.

The beverage is not particularly limited as long as it contains the pellucamine G and a pharmaceutically acceptable salt thereof as an active ingredient as an essential ingredient at the indicated ratio, and may contain various flavors or natural Carbohydrates and the like as additional components.

Examples of the natural carbohydrates include polysaccharides such as disaccharides such as monosaccharides such as glucose and fructose, maltose and sucrose, dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol . The flavor may be a natural flavor such as tautatin or a stevia extract such as rebaudioside A or glycyrrhizin or a synthetic flavor such as saccharin, aspartame and the like.

The amount of the natural carbohydrate to be added may generally be about 1 to 20 g, preferably 5 to 12 g per 100 ml of the food composition of the present invention. In addition, the composition of the present invention may further contain flesh for the production of natural fruit juice, fruit juice drink, vegetable drink.

In addition to the above, the food composition of the present invention can be used as a flavoring agent such as a variety of nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, coloring agents and thickening agents (cheese, chocolate etc.), pectic acid and its salts, Salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated drinks, and the like. These components can be used independently or in combination. The proportion of such an additive is not so important, but may be selected in the range of 0 to 20,000 parts by weight per 100 parts by weight of the active ingredient of the present invention.

The health-functional beverage is used to control the bio-defense rhythm of the beverage group or beverage composition to which the added value is imparted so that the function of the beverage functions for a specific purpose by physical, biochemical, biotechnological, or the like, Means a beverage which has been designed so as to sufficiently express the body controlling function related to the living body.

The health functional beverage is not particularly limited to the other ingredients except that it contains the active ingredient of the present invention as an essential ingredient at the indicated ratio, and may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages.

Examples of the natural carbohydrates include polysaccharides such as disaccharides such as monosaccharides such as glucose and fructose, maltose and sucrose, dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol . The flavor may be a natural flavor such as tautatin or a stevia extract such as rebaudioside A or glycyrrhizin or a synthetic flavor such as saccharin, aspartame and the like.

The amount of the natural carbohydrate to be added may generally be about 1 to 20 g, preferably 5 to 12 g per 100 ml of the food composition of the present invention. In addition, the composition of the present invention may further contain flesh for the production of natural fruit juice, fruit juice drink, and vegetable drink.

In addition, in the food composition for the purpose of preventing or improving the inflammatory disease, the amount of the active ingredient may be 0.01 to 15% by weight of the total food, and the beverage composition may contain 0.02 g 5 g, preferably 0.3 g to 1 g.

Wherein the active ingredient is selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof. 0.01% to 15% by weight. In addition, in the beverage composition for preventing or improving an inflammatory disease, which contains any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof, May be included in a proportion of 0.002 g to 5 g or 0.03 g to 1 g based on 100 ml of the composition.

The present invention also relates to a cosmetic composition having anti-inflammatory activity comprising, as an active ingredient, any one selected from the group consisting of Pulchelamine G, a pharmaceutically acceptable salt thereof and a combination thereof.

The paclitaxel G is an amino acid-sesquiterpene lactone-based compound separated from each time-of-the-day, which can be obtained naturally from each time of day or artificially synthesized by methods known in the art For example, the paclitaxel G may be isolated from each of the citrus extracts.

Since paclitaxel G is derived from a natural substance, it has no side effects and is not only cytotoxic, but also has excellent antiinflammatory and anti-irritating activity because it has excellent anti-inflammatory effect. Therefore, And the inflammation induced by the external environment can be effectively controlled. Accordingly, any one selected from the group consisting of paclitaxel G, a pharmaceutically acceptable salt thereof, and a combination thereof can be used as an active ingredient of a cosmetic composition having an inflammation improving and alleviating effect.

The cosmetic composition may be used as a cosmetic composition for basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, shaving cosmetics or oral cosmetics.

Examples of the cosmetic cosmetic include a cream, a lotion, a pack, a massage cream, and a milky lotion. Examples of the cosmetic cosmetic include a foundation, a makeup base, a lipstick, an eye shadow, an eyeliner, a mascara, an eyebrow pencil, Examples of the cosmetic material include soap, liquid cleansing agent, bathing agent, sunscreen cream, and sun oil. Examples of the cosmetic for hair include shampoo, rinse, hair treatment, hair mousse, hair liquid, pomade, hair color, hair bleach Examples of the cosmetic composition for scalp include hair tonic or scarf treatment, and examples of the cosmetic composition for shaving include aftershave lotion or shaving cream. Examples of the oral cosmetic composition include Toothpaste or mouth washer.

The cosmetic composition may contain, in addition to the active ingredient, a component incorporated in the cosmetic composition, for example, a moisturizer, an ultraviolet absorber, a vitamin, an animal or plant extract, an extinguishing agent, a whitening agent, a vasodilator, an astringent, Hormones and the like may be further added. In addition, the cosmetic composition may further include a medicament or a mechanism necessary for infiltrating or transferring the active ingredient into the dermal tissue.

The formulation of the cosmetic composition may take any appropriate form depending on the intended use and the properties of the cosmetic composition. Examples of the formulation include an aqueous solution, a solubilization system, an emulsion system, an emulsion system, a gel system, a paste system, an ointment system, A two-layer system or a water-oil-powder three-layer system. Examples of the formulations are merely illustrative, and the formulations and forms of the cosmetic composition of the present invention are not limited by the above examples.

The active ingredient may be contained in an amount of 0.001 to 50% by weight, preferably 0.01 to 20% by weight, based on the total weight of the cosmetic composition, , And the content of the active ingredient contained in the present invention is not limited by the above content.

In accordance with the present invention, in relation to the anti-inflammatory effect, paclhelamine G isolated from the fractions of each extract from the each extract increases the expression and activity of hematoxidase-1, which is known as an enzyme exhibiting cytoprotective effect, and effectively inhibits the secretion amount of NO In addition to being capable of inhibiting the expression and activation of various cytokines, it is also a natural substance-derived substance and has low cytotoxicity, so that safety and side effects related problems are less likely to occur. Thus, treatment, improvement or prevention of inflammatory diseases And can be widely used in industries related to cosmetic compositions having an inflammatory effect.

FIG. 1 is a diagram showing the structure of a substance identified as a substance separated from each cell according to an embodiment of the present invention, that is, a structure of pellucamine G. FIG.
FIG. 2 is a graph showing the results of confirming the cell viability of paclitaxel G in order to examine the cytotoxicity of paclitaxel G according to an embodiment of the present invention. Specifically, ) Of the control cells (control) (cell viability) in which the paclhelamine G treatment was not performed (vertical axis,%).
FIG. 3 is a photograph showing the results of the RT-PCR of iNOS mRNA and COX-2 mRNA transcripts in order to confirm the anti-inflammatory effect of paclitaxel G according to an embodiment of the present invention. - 'means no treatment,' + 'means treatment, numerical value means the throughput (μM) of paclitaxel G, and the remaining indication indicates the type of treated sample or analyzed mRNA . FIG. 3A is a photograph showing the result of measuring the amount of iNOS mRNA transcription, and FIG. 3B is a photograph showing a result of measuring the amount of COX-2 mRNA transcription.
FIG. 4 is a photograph showing the results of Western blot analysis of iNOS protein expression and COX-2 protein expression in order to confirm the anti-inflammatory effect of paclitaxel G according to an embodiment of the present invention. '-' means no treatment, '+' means treatment, numerical value means the throughput (μM) of paclitaxel G, and the remaining label indicates the type of treated sample or analyzed protein . FIG. 4A is a photograph showing the result of measuring the expression level of iNOS, that is, the protein content, and FIG. 4B is a photograph showing the result of measuring the expression level of COX-2.
FIG. 5 shows the results of confirming the inhibition of the production of inflammation-related substances, specifically, NO, PGE ₂ , TNF-α and IL-1β to confirm the anti-inflammatory effect of paclitaxel G according to an embodiment of the present invention In the graph, '-' in the horizontal axis of the graph means that no processing is performed, '+' means processing, numerical value means the throughput (μM) of percellin G, And the vertical axis of the graph represents the content of the inflammation-related substance to be analyzed. FIG. 5A is a graph showing the results of measuring the content of NO, FIG. 4B is a graph showing the results of measuring the content of PGE ₂ , FIG. 5C is a graph showing the results of measuring the content of TNF- 5D is a graph showing the results of measuring the content of IL-1 ?.
FIG. 6 shows the results of confirming the content and activation level of IκB-α and NF-κB in order to confirm the anti-inflammatory effect of paclitaxel G according to an embodiment of the present invention. And the content of phosphorylated IκB-α (phosphorylated IκB-α, p-IκB-α) and the content of p65 in the nuclear fraction were determined by Western blot analysis using antibodies to each of them. '-' means no treatment, '+' means treatment, numerical value means the throughput (μM) of paclitaxel G, and the remaining label indicates the type of treated sample or analyzed protein . Specifically, p-IκB-α means phosphorylated IκB-α, p65 means NF-κB, and FIG. 6b shows the binding activity of NF-κB in the nuclear fraction In the graph, in the abscissa of the graph, '-' means no processing, '+' means processing, numerical value means the throughput (μM) of perchloramine G, Means that the binding activity of NF-kB is expressed as a relative value based on the control group.
FIG. 7 is a graph showing the anti-inflammatory effect of paclitaxel G according to one embodiment of the present invention. The activity of HO-1 (activity ) Means that no processing is performed, '+' means processing, numerical value means the throughput (μM) of perchloramine G, and ' Indicates the treated sample, namely, Tin protophorphyrin (SnPP, 50 μM), which is an inhibitor of the positive control group, Cobalt protophorphyrin (CoPP, 20 μM) or the comparative group HO-1, FIG. 7A shows the fold increase of mRNA of HO-1 compared to the negative control without any sample, and FIG. 7B shows the activity of HO-1 versus HO-1.
8 is a graph showing the production of hemoxic enzyme-1 (Heme oxygenase) in order to confirm the anti-inflammatory effect of paclitaxel G according to an embodiment of the present invention. 1 in the control (control) without treatment with paclitaxel G, and the amount of HO-1 produced by the use of CoPP (horizontal axis, μM) 8b shows the effect of inducing the expression of HO-1 according to the time (horizontal axis, hour (h)) of treatment with 40 μM percellamine G in the control group without treatment with perchloramine G . The figure shows the elapsed time (h) after treatment with pellucormin G. The results are shown in Fig.
FIG. 9 is a photograph showing the content of Nrf2 in the cytoplasm and nucleus by Western blot analysis to confirm the anti-inflammatory effect of paclitaxel G according to an embodiment of the present invention. The values in the above photographs represent the elapsed time after treatment with paclhelamine G (40 μM), control means no control, control line, and the line from the top to the third line indicates the amount of Nrf2 (Cytosolic Nrf2), Lamin B and β-Actin, and the lines from the 4th line to the 6th line show the content of Nrf2 (Nuclear Nrf2), Lamin B and β-Actin in the nuclear fraction will be.
10 is a graph showing inhibition of the production of inflammation-related substances, specifically NO, PGE ₂ , TNF-α and IL-1β, in order to confirm the anti-inflammatory effect associated with HO-1 of puchelamin G according to an embodiment of the present invention , '-' means no treatment, '+' means treatment, and the remaining indication means the kind of treated sample (LPS for inflammation induction) , Pichelamine G and SnPP as an HO-1 inhibitor), and the vertical axis of the graph represents the content of the inflammation-related substance to be analyzed. FIG. 10A is a graph showing the results of measuring the content of NO, FIG. 10B is a graph showing the results of measuring the content of PGE ₂ , FIG. 10C is a graph showing the results of measuring the content of TNF- Fig. 10D is a graph showing the results of measurement of the content of IL-1 ?.
FIG. 11 shows the results of confirming the content and the degree of activation associated with IκB-α and NF-κB in order to confirm the anti-inflammatory effect associated with HO-1 of paclitaxel G according to an embodiment of the present invention. And the content of p65 (NF-κB) in the nuclear fraction was determined by Western blot analysis using an antibody against each of them. In the photograph, '-' indicates no treatment (+) Means treatment, and the numerical value indicates the throughput (μM) of paclitaxel G, and the remaining indication means the treated sample (LPS for induction of inflammation, pellucillamine G and HO- 1 inhibitor SnPP) or the type of protein analyzed. 11B is a graph showing binding activity of NF-κB in the nuclear fraction. In the graph, '-' means no treatment, '+' means treatment, and ' Represents the throughput (μM) of pellucormin G, and the remainder represents the type of treated sample (LPS for induction of inflammation, SnPP as perchelamine G and HO-1 inhibitor) or the analyzed protein, Means that the binding activity of NF-kB is expressed as a relative value based on the negative control group.

Hereinafter, embodiments of the present invention will be described in detail so that those skilled in the art can easily carry out the present invention. The present invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.

[Manufacturing Example]

Pulchelamine G having the formula of Fig. 1 for use in the experiment was obtained by isolating the extract from methanol extract as a solvent from ginsenoside obtained from the researcher of the present invention in August 2005, , And the corresponding compound as a voucher specimen was deposited with Sungkyunkwan University School of Pharmacy (SKK-05-080). Positive control group was Rhus ( Rhus Sulfuretin , isolated from verniciflua, was used.

With respect to cell culture for use in the experiment, murine macrophages isolated from mice (C57BL / 6) were used. The C57BL / 6 was purchased from Orinette Biotechnology Co., Ltd. (Korea), and breeding of experimental animals was carried out according to Wonkwang University's Animal Ethics Regulation (WKU11-29). To separate the macrophages, 3 ml of thioglycollate (TG, BD Pharmingen, USA) was intraperitoneally injected into the experimental animals. After 4 days, the TG-induced peritoneal membrane Peritoneal macrophages were harvested. Peritoneal lavage to obtain the peritoneal macrophages was performed using 8 ml of Hanks' Balanced Salt Solution containing 10 U / ml of heparin. The macrophages were cultured in RPMI (Roswell Park Memirial Institute) medium supplemented with 10% heat-inactivated FBS, fetal bovine serum (Gibco BRL Co, USA) in a 6-well tissue culture plate 5 × 10 ⁶ cells / ml.

The following experiments were repeated three times or more, and statistical analysis was performed using GraphPad Prism software 3.03 (GraphPad software Inc., USA) in the form of a mean value and standard deviation (SD) ), And the comparison of the results of several experimental groups was performed using ANOVA (one-way analysis of variance) according to the Newman-Keuls post hoc test.

Example  1. Cytotoxicity measurement

In order to measure the cytotoxicity of macrophage of Pulchellamin G, a compound of the present invention, to 96 well plate, mouse-derived macrophages obtained above were suspended in 10% heat-inactivated FBS (fetal bovine serum) and penicillin G (100 IU / ml, Gibco co, USA) and streptomycin (100 μg / ml, Gibco co, USA) containing frequency divider in a DMEM culture medium and, 5% CO ₂ incubator (Sanyo, MCO175 ) At 37 占 폚 for 24 hours. Thereafter, the cultured culture (1 x 10 ⁵ cells / ml) was separated into 1-ml 96-well plates, and then pulcellamin G was added at 5, 10, 20, 40 and 80 μM And further incubated for 24 hours in a 5% CO ₂ incubator. After the incubation, 50 mg / ml of MTT reagent (M2128, Sigma, USA) was added to the wells and incubated for 4 hours. Then, ELISA reader (Bio-Rad, Microplate reader model 680 ) Was used to measure the absorbance at a wavelength of 570 nm. After repeating the above experiments three times each, the average value of the measurement results is shown in FIG. 2 as a relative value to the control group in which no treatment was performed.

As shown in FIG. 2, the cell viability was similar to that of the negative control group when the pellucamine G treatment was performed at a concentration of 40 μM or less, regardless of the paclcamin G concentration, but the 80 μM concentration treatment The cell viability was somewhat lower than that of the negative control group, but did not show any significant difference. From the above results, it was confirmed that the pellucillamine G was safe because it did not have cytotoxicity up to a concentration of 40 μM. As shown in FIG. 2, in order to confirm the dimensional protection effect of the pellucillamine G described below, the pellucillamine G was treated at a concentration of less than 50 μM, specifically 40 μM or less, Respectively.

Example  2. Pellucillin  Confirming the anti-inflammatory effect of G

Example  2-1. iNOS  And COX -2 Related anti-inflammatory effects

In order to confirm the anti-inflammatory effect of paclhelamine G, which is confirmed to be safe due to the lack of cytotoxicity, the following experiment was carried out specifically using mouse-derived macrophages.

First, the effects of felcillamine G on the expression of enzymes that induce antiinflammatory effects were investigated using COX-2 (cyclooxygenase 2) and NO (nitric oxide (NO), which induce the production of PGE ₂ (prostaglandin 2, prostaglandin E2) The expression level of iNOS inducible nitric oxide synthase (iNOS) was measured by Western blot analysis and RNA quantification by real-time PCR. The RNA assay by Western blot analysis and RT-PCR was performed as follows.

First, the mouse-derived macrophages obtained above were inoculated in a 10% heat-inactivated fetal bovine serum (FBS) and penicillin G (100 IU / ml, Gibco co, USA) and streptomycin (100 μg / ml, Gibco co, USA) , And the cells were cultured at 37 占 폚 for 24 hours in a 5% CO ₂ incubator (Sanyo, MCO175). Subsequently, the cultured medium (1 x 10 ⁶ cells / ml) was separated into 1-ml 96-well plates, and then treated with 5, 10, 20 and 40 μM perchelamine G , And further cultured for 12 hours in a 5% CO ₂ incubator. After the cultivation, LPS (bacterial lipopoly-saccharide) was treated with 1 μg / ml and further cultured for 18 hours to induce an inflammatory reaction.

After the cultivation, cultured macrophages were collected and centrifuged at 2,000 rpm and 4 ° C for 2 minutes. After the centrifugation, the supernatant was removed and the remaining pellet was resuspended in PER-Mammalian protein extraction buffer (protease inhibitor cocktail I, EMD Boisciences, USA) and 1 mM PMSF (phenylmethylsulfonyl fluoride) PER-Mammalian Protein Extraction buffer, Pierce Biotechnology, USA) was added and homogenized. PMSF (0.1 mM PMSF, 5 mg / ml aprotinin, 5 mg / ml pepstatin A and PMSF) were added to 20 mM Tris-HCl buffer (pH 7.4) containing the protein degradation inhibitor and PMSF 1 mg / ml chymostatin). Subsequently, the cytosolic fraction was prepared by centrifuging the homogenized cell liquor at 15,000 × g and 4 ° C. for 10 minutes.

Nuclear and cytoplasmic fractions were also prepared using NE-PER nuclear and cytoplasmic fractionation reagents (NE-PER Nuclear and cytoplasmic extraction reagents, Pierce Biotechnology, USA).

Specifically, 3 ml of the culture solution (1 × 10 ⁶ cells / ml) treated with the LPS and cultured for 18 hours was separated into a 60 mm dish, cells were collected, and washed with PBS (phosphate-buffered saline) Lt; / RTI > After washing, the cells were washed with RIPA buffer (RIPA buffer, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 Mm Tris-HCl pH 7.4, 50 mM glycerophosphate, The cells were lysed by treatment with mM NaF, 20 mM ethylene glycol tetraacetic acid [EGTA], 1 mM dithiothreitol [DTT], 1 mM Na ₃ VO ₄ , and protease inhibitors) and stirring at 4 ° C for 15 minutes. Thereafter, the mixture was centrifuged at 15,000 x g and 4 ° C for 15 minutes, and then, a supernatant was obtained.

The cytosolic fraction and nuclear and cytoplasmic fractions were stored at -70 ° C until used in the experiment.

The protein content in the separated fractions was measured using a bicinchoninic acid protein kit (BCA).

The expression of iNOS and COX-2 from the nuclear and cytoplasmic fractions was analyzed by the method of measuring the mRNA of each protein, that is, the RNA measurement method.

First, the total RNA for performing the reverse transcription PCR (RT-PCR) was obtained from the obtained cells using Trizol (Invitrogen, USA). The obtained RNA was performed according to the provided protocol including DNase I treatment. The obtained total RNA (total RNA) was quantitatively analyzed and then 1 μg of the RNA isolated by the above method was amplified using a Superscript I Strand Synthesis System (SuperScript First Strand Synthesis System, Invitrogen, USA) and oligo (dT ^{12 ?} Invitrogen, USA) to obtain cDNA. RT-PCR using the cDNA was carried out using 27.5 μl of the cDNA reaction solution. The cDNA reaction solution contained 67.7 mM Tris-HCl (pH 8.8), 16.6 mM (NH ₄ ) ₂ SO ₄ , 0.01% Tween-20, 200 nM dATP, 200 nM dCTP and 200 nM dGTP and 400 nM dUTP, 4.5 mM MgCl ₂ , 300 nM forward primer, 300 nM reverse primer, 200 nM probe, 2 U Taq DNA polymerase, and 2.5 μl of the above reaction mixture. The RT-PCR was carried out using the respective primers described in Table 1 below. The RT-PCR was carried out at 95 ° C for 4 minutes for the initial DNA denaturation. Then, for DNA denaturation, reaction was carried out at 95 ° C for 15 seconds, and the reaction was carried out under the conditions shown in Table 1 below and annealing at 60 ° C for 1 minute The total reaction of the reaction was repeated 40 times in total. The sequences of the primers for performing the RT-PCR and the experimental conditions are shown in Table 1 below.

division Primer sequence (5 '- > 3') Annealing Tm (° C) Size (bp) COX-2 forward   ATGCTCCTGCTTGAGTATGT 65 2,696 reverse   CACTACATCCTGACCCACTT iNOS forward   GACCAGATAAGGCAAGCAC 55 734 reverse   CTTGTCTTTGACCCAGTAGC β-actin forward   TGTGATGGTGGGAATGGGTCAG 58 514 reverse   TTTGATGTCACGCACGATTTCC

The results of the RT-PCR were confirmed by electrophoresis and the results are shown in FIG.

Western blot analysis was performed by measuring the expression of iNOS and COX-2 from the cytoplasmic fraction as follows.

First, the protein content contained in the cytoplasmic fractions obtained using the PER-Mammalian protein extraction buffer containing the protein degradation inhibitor and PMSF was measured using a Lowry protein assay kit (P5626, Sigma Chemical Co., USA) Respectively. The protein solution separated by the same amount as above was separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and electrophoresed on an ECL nitrocellulose membrane (Bio-Rad, USA) Transferred. The protein-transferred ECL nitrocellulose membrane was blocked with 5% skimmed milk, then washed, and the cells were washed with ECL detection system (Amersham Pharmacia Biotech, USA) according to the protocol provided The amount of protein expression was confirmed, and the results are shown in FIG.

Specifically, the antibody reaction according to the ECL detection system was performed by adding an antibody against COX-2 and iNOS (primary antibody, Santa Cruz Biotechnology, USA), reacting at 4 ° C for 24 hours, washing the membrane, (HRP conjugated anti-rabbit antibody) was added, followed by washing for 1 hour, followed by washing and confirming the signal by the antibody.

As shown in FIG. 3, in the control group without LPS treatment, the iNOS and COX-2 protein mRNAs, which are cytokines related to inflammation, were not observed at all, whereas iNOS and COX-2 protein Was clearly identified, and it was confirmed that a remarkably high cytokine mRNA was transcribed. On the other hand, in spite of the LPS treatment, it was confirmed that the addition of paclhelamine G of the present invention resulted in blurring of the mRNA bands of iNOS and COX-2 protein in a concentration-dependent manner. In contrast to the control group treated with LPS only, The band was clearly blurred from the experimental group treated with 20 μM, and a band almost similar to that of the sulferretin treated with 40 μM was confirmed in the experimental group treated with 20 μM. In addition, COX-2 was clearly identified from the experimental group treated with 20 μM, and a significantly obscured band was observed in the experimental group treated with 40 μM than when treated with the positive control group, sulferetin 40 μM.

In addition, as shown in FIG. 4, in the case of β-actin not related to inflammation, similar band was observed in all experimental groups, whereas in the case of iNOS and COX-2 protein expression related to inflammation, LPS and sample addition It was confirmed that the band was changed according to the frequency. Specifically, when the expression of iNOS and COX-2 protein related to the inflammation was confirmed, the proteins were not found in a control group to which LPS was not added. However, when LPS was added, expression of iNOS and COX-2 protein rapidly Respectively. In addition, when paclitaxel G of the present invention was added, the band of iNOS and COX-2 protein was observed to be blunted in a concentration-dependent manner. Compared with the control group treated with LPS alone, The bands were confirmed to be blurred, and bands similar to those of 40 μM of sulferetin treated with the positive control group were confirmed in the 40 μM treatment group. In addition, COX-2 was clearly identified from the experimental group treated with 40 μM

From the above results, it can be seen that the addition of paclhelamine G of the present invention reduces the expression level of iNOS and COX-2 protein and reduces the mRNA transfer amount of phosphorus iNOS and COX-2 protein compared to the positive control group, Inhibited the expression of iNOS and COX-2 and inhibited inflammation, thus confirming the anti-inflammatory effect.

Example  2-2. Identification of the inhibitory effect of inflammation-related substances

In order to confirm the anti-inflammatory effect of paclitaxel G, which is confirmed to have anti-inflammatory effects related to the inhibition of the production of iNOS and COX-2, additionally inhibition of inflammatory substances, specifically NO, PGE ₂ , TNF-α and IL- The following experiment was carried out.

First, as in Example 2-1, mouse-derived macrophages were treated with percellamine G at concentrations of 5, 10, 20 and 40 μM, respectively, for 12 hours, treated with 1 μg / ml of LPS Followed by further incubation for 18 hours to induce an inflammatory response. After the above culture, centrifugation was carried out at 13,000 x g and 4 ° C for 2 minutes, and the supernatant was collected.

The secretion amount of NO in the collected supernatant was measured according to the protocol provided by Promega using Griess reagent system (Promega, USA). Specifically, 100 μl of the supernatant of each control and experimental group and 0.1% (w / v) N- (1-naphathyl) -ethylene diamine in the same amount of Griess reagent (5% Dissolved solution and 1% (w / v) sulfanil amide) were mixed and allowed to react at room temperature, that is, at 15 ° C to 20 ° C for 10 minutes. Then, the content of NO was measured by measuring the absorbance at 525 nm using an ELISA plate reader. The measurement results are shown in Fig. 5A.

The secretion amount of PGE ₂ in the collected supernatant was measured using commercially available PGE ₂ (R & D Systems, USA) according to the protocol provided by the manufacturer. Specifically, the supernatant of each control and test group was added to a 96-well plate coated with antibody against PGE ₂ , followed by addition of a secondary antibody (enzyme-linked polyclonal antibody specific for PGE ₂ ) , And washed to remove unattached secondary antibodies. Then, the content of PGE ₂ was measured by adding the substrate solution and measuring the fluorescence intensity at 450 nm. The results of the measurement are shown in FIG. 5B.

The amount of secretion of TNF-α and IL-1β in the supernatant was measured using a commercially available assay kit (R & D Systems, USA) according to the manufacturer's protocol. Specifically, the supernatants of the respective control and experimental groups were added to 96-well plates coated with antibodies to mouse-derived TNF-α or IL-1β, respectively, and then incubated with a secondary antibody (enzyme-linked polyclonal antibody specific for mouse TNF-α or IL-1β) was added and allowed to react for 2 hours, followed by washing to remove unattached secondary antibodies. Subsequently, the content of TNF-α or IL-1β was measured by adding the substrate solution and measuring the fluorescence intensity at 450 nm. The measurement results are shown in Figs. 5C and 5D.

As shown in FIGS. 5A and 5B, in the control group without addition of LPS, the NO production amount and the PGE ₂ In the case of the addition of LPS, the addition of Phellinemin G significantly increased the NO production and PGE ₂ Production was decreased and it was confirmed that the dose of the test group treated with 40 μM decreased to a level similar to that of the case of treatment with sulfuretin 40 μM, which is a positive control. As shown in the above Example 2-1, the above results showed similar tendency to inhibition of iNOS and COX-2 protein production. From this result, it was found that inhibition of iNOS production resulted in reduction of NO production and inhibition of COX- PGE ₂ The amount of production was also confirmed again.

Further, as shown in FIG. 5C and FIG. 5D, it was confirmed that pellucillamine G was able to effectively inhibit the generation of cytokines in a concentration-dependent manner even in inflammatory cytokines, and the pellucillamine G anti-inflammatory effect was confirmed . Specifically, the expression levels of TNF-α and IL-1β increased by the addition of LPS were decreased in a concentration-dependent manner by the addition of paclitaxel G, and in particular, in the case of IL-1β, 40 μM treated group showed better inhibitory effect than that treated with sulferetin 40 μM, which is a positive control group.

Example  2-3. Identification of inflammation-related protein production and inhibition of activation

In order to confirm the anti-inflammatory effect of paclitaxel G, which has confirmed the anti-inflammatory effect in the above-mentioned examples, a substance which inhibits the expression of an inflammation-inducing protein, specifically NF-κB (p65) The inhibition of phosphorylation and degradation of IκB-α was examined by the following experiment.

First, as in Example 2-1, pellucamine G was treated at 5, 10, 20, and 40 μM in mouse macrophages, cultured for 12 hours, treated with 1 μg / ml of LPS Lt; / RTI > for 1 hour to induce an inflammatory response. After the culture, cytosolic fraction and nuclear and cytoplasmic fractions were collected as in Example 2-1.

The content of IκB-α and phosphorylated IκB-α (phosphorylated IκB-α, p-IκB-α) in the collected cytoplasmic fractions and the content of p65 in the nuclear and cytoplasmic fractions were measured by Western blot analysis And the results are shown in FIG. 6A. In addition, the binding activity of NF-κB to DNA in the collected nuclear and cytoplasmic fractions was measured using a TransAM kit (TransAM kit, Active Motif, USA) according to the manufacturer's protocol And the results are shown in FIG. 6B.

As shown in FIG. 6A, it was confirmed that the band of IκB-α was remarkably blurred in the treatment group treated with LPS compared with the group without any treatment, and the induction of inflammation by LPS decreased the decrease of IκB-α, - > On the other hand, when paclitaxel G was treated, the band of IκB-α became clear and thickened in a concentration-dependent manner, and it was confirmed that the treatment of the above paclitaxel G inhibits the degradation of IκB-α induced by LPS . In addition, it was confirmed that the band of p-IκB-α became clear in the treatment group treated with LPS compared with the group without treatment, and the induction of inflammation by LPS showed an increase of p-IκB-α, Phosphorylation, that is, activation. On the other hand, in the case of treatment with paclcaminin G, the band of p-IκB-a gradually diminished in a concentration-dependent manner, and it was confirmed that the treatment of paclhelamin G inhibits the activation of IκB-α induced by LPS .

In addition, it was confirmed that the band of p65, that is, NF-κB, became apparent in the nuclear fraction of the treated group treated with LPS compared with the group treated with no treatment, and the induction of inflammation by LPS resulted in an increase of p65, It was confirmed to induce migration into the nucleus. On the other hand, in the case of treatment with paclcaminin G, the band of p65 gradually became cloudy depending on the concentration, and it was confirmed that the treatment of the paclitaxel G inhibited the migration of NF-κB into the nucleus induced by LPS.

In addition, as shown in FIG. 6B, the DNA binding activity of NF-κB was increased about 4-fold in the LPS-treated group compared to the untreated group, whereas Phellinamine G When treated, the degree of DNA binding of NF-κB was decreased in a concentration-dependent manner. The degree of DNA binding was significantly decreased from the 10 μM-treated experimental group and decreased to about 50% in the treated group treated with 10 μM.

From these results, it was found that paclhelamine G inhibits the degradation of IκB-α in cells, inhibits the production of p-IκB-α, ie, activation of IκB-α, inhibits the migration of NF-κB into the nucleus , And the DNA binding activity of NF-κB was weakened, and it was confirmed that the anti-inflammatory effect of LPS-induced inflammation was excellent.

Example  2-4. Identification of inflammation-related enzyme production and inhibition of activation

In order to confirm the anti-inflammatory effect of paclitaxel G having the anti-inflammatory effect in the above examples, the expression and activity of inflammation-related enzymes were further measured, specifically, the activity of hematoxylin-1 (HO-1) The following experiments were performed to determine expression and activity.

First, as in Example 2-1, mouse-derived macrophages were treated with percellamine G at concentrations of 5, 10, 20 and 40 μM, respectively, for 12 hours, treated with 1 μg / ml of LPS Lt; / RTI > for 1 hour to induce an inflammatory response. After the culture, cytosolic fraction and nuclear and cytoplasmic fractions were collected as in Example 2-1.

The mRNA content, HO-1 production and HO-1 activity of HO-1 were measured in the collected cytoplasmic fractions and the expression level of HO-1 was measured at a time when paclhelamine G was treated with 40 μM , And the results are shown in Figs. 7 to 9. As a positive control, cobalt protophorphyrin (CoPP), which promotes the expression of HO-1, was treated with 20 μM. As a comparative group, Tin protophorphyrin (porphyrin products, SnPP) Was treated with 50 μM.

The mRNA content of HO-1 was measured by real-time PCR. Specifically, total RNA was obtained from the cells obtained according to the protocol provided by the manufacturer using Trizol (Invitrogen, USA). The RNA thus obtained was quantitated by spectrophotometry at 260 nm. Total RNA (total RNA) was obtained from the cells obtained using Trizol (Invitrogen, USA) according to the protocol provided by the manufacturer. The RNA thus obtained was quantitated by spectrophotometry at 260 nm. CDNA was obtained by reverse transcription from 1 쨉 g of RNA isolated by the above method using a High Capacity RNA-to-cDNA kit (Applied Biosystems, USA). The cDNA was amplified using SYBR Premix Ex Taq kit (TaKaRa Bio Inc., Japan) and a Step One Plus Real-Time PCR system (Applied Biosystems, USA). Specifically, the amplification procedure was performed using 20 ml of each reaction solution containing 10 ml of SYBR Green PCR Master Mix, 0.8 μM of the primer shown in Table 2, and water treated with diethyl pyro carbonate (DEPC) The conditions and methods for carrying out the PCT of the cDNA were performed according to the protocol provided by the manufacturer. The primer sequences of the following Table 2 were determined using Primer Quest (Integrated DNA Technologies, USA).

division Primer sequence (5 '- > 3') HO-1 forward   CTCTTGGCTGGCTTCCTT reverse   GGCTCCTTCCTCCTTTCC GAPDH forward   ACTTTGGTATCGTGGAAGGACT reverse   GTAGAGGCAGGGATGATGTTCT

The real-time PCR result was converted into the amount of mRNA relative to GAPDH (glyceraldehyde 3-phosphate dehydrogenase) by the Ct comparative assay (2 ^{-ΔΔ Ct} ) using Step One software (Applied Biosystems, USA) And the results are shown in Fig. 7A.

As shown in FIG. 7A, when the CoPP promoting the expression of HO-1, which is a positive control group, was treated, it was found that the HO-1 mRNA content was remarkably increased as compared with the control group without any treatment, G treatment, the concentration of HO-1 mRNA was increased in a concentration-dependent manner, and 20 μM treatment was significantly more significant than that of the control group, CoPP.

The activity of HO-1 (Assay for HO activity) was measured by the following method. Specifically, NADPH and a reaction mixture containing rat liver cytosol and hemin as a biliverdin reductase were added to the microsomes obtained from the collected cells, Was added. The reaction was carried out under the dark condition and the temperature condition of 37 ° C for 1 hour and terminated by treating with 1 ml of chloroform. The absorbance of the extracted bilirubin was measured at 464 nm and 530 nm to confirm the difference. The results are shown in FIG. 7B.

As shown in FIG. 7B, when the CoPP promoting the expression of HO-1, which is a positive control group, was treated, it was found that the activity of HO-1 was remarkably increased as compared with the control group without any treatment, In the case of treatment with G, the activity of HO-1 was increased in a concentration-dependent manner. When 20 μM was treated, it was found to be as significant as in the case of CoPP as a positive control. In case of treatment with 40 μM, , And the activity of HO-1 was slightly decreased when 50 .mu.M of the 40 .mu.M Phellinamine G and SnPP, an inhibitor of HO-1, were treated together , And was found to have higher activity than the control group without any treatment.

As to the production of HO-1, Western blot analysis for HO-1 was carried out as in Example 2-1, and the presence or absence of HO-1 protein production according to the treatment concentration and treatment time of paclhelamine G The results are shown in Fig.

First, the amount of HO-1 produced according to the throughput of paclcamin G is shown in Fig. 8a. As shown in FIG. 8A, in the case of treatment with paclhelamine G, the amount of HO-1 produced increased in a concentration-dependent manner, and when 20 μM was treated, it was found to be as significant as in the case of the positive control, CoPP . In addition, the amount of HO-1 produced according to the treatment time in the case where 20 μM, which has been confirmed to have the highest production amount, is shown in FIG. 8B. As shown in FIG. 8B, it was confirmed that HO-1 was generated after 6 hours from the treatment with paclhelamine G, and a clearly increased band was observed at 18 hours, and HO -1 was increased with the lapse of time according to the treatment with paclcamin G treatment.

In addition, we confirmed the nuclear translocation of Nrf2, a regulator closely related to the production and activation of HO-1.

First, as in Example 2-1, 40 μM perchelamine G was treated in rat-derived macrophages, and after 30 minutes, 1 hour, and 1 hour and 30 minutes had passed, as in Example 2-1, The cytosolic fraction and the nuclear and cytoplasmic fractions were collected.

The content of Nrf2 in the collected cytoplasmic fractions, nuclear and cytoplasmic fractions was measured by Western blot analysis using an antibody. As a comparative group, β-Actin rich in cytoplasm and Lamin B enriched in nuclei were used. Respectively.

As shown in FIG. 9, in the case of treatment with paclcaminin G, although the content of β-Actin and the content of Lamin B did not change in both the cytoplasmic fraction and the nuclear fraction, The content of Nrf2 in the nuclear fraction was increased while the content of Nrf2 was decreased and it was confirmed that Phellcellamine G induces the migration of Nrf2 to the nucleus and consequently induces the expression and production of HO-1.

Example  2-5. Identification of the inhibitory effect of inflammation-related substances

In order to confirm the anti-inflammatory effect of the above-identified pellucillamine G, in particular, the anti-inflammatory effect related to the expression, production and activation of HO-1, the mediator of inflammation using perchloramine G and SnPP, an inhibitor of HO- NO, PGE ₂ , TNF-α and IL-1β. The effect on NO, PGE ₂ , TNF-α and IL-1β was examined by the following experimental method.

First, paclitaxel G (40 μM) was treated with SnPP (50 μM) alone or in the absence of SnPP and cultured for 12 hours in rat-derived macrophages. After the above culture, centrifugation was carried out at 13,000 x g and 4 ° C for 2 minutes, and the supernatant was collected. The secretion amount of NO in the collected supernatant was measured according to the protocol provided by Promega using Griess reagent system (Promega, USA) as in Example 2-2. The secretion amount of PGE ₂ in the collected supernatant was measured as in Example 2-2 using commercially available PGE ₂ (R & D Systems, USA) according to the protocol provided by the manufacturer. The amount of secretion of TNF-α and IL-1β in the collected supernatant was measured using a commercially available assay kit (R & D Systems, USA) according to the manufacturer's protocol ). The measurement results are shown in Figs. 10A to 10D.

As shown in FIGS. 10A and 10D, the amount of NO, PGE ₂ , TNF-α and IL-1β produced was very low in the control group without addition of LPS, It was confirmed that the addition of paclhelamine G significantly inhibited the production of NO, PGE ₂ , TNF-α and IL-1β. In addition, when SnPP, an inhibitor of HO-1, was added, the amount of NO, PGE ₂ , TNF-α and IL-1β produced was lower than that of the control, It was confirmed that the anti-inflammatory effect of paclhelamine G was related to HO-1.

In addition, in order to confirm the anti-inflammatory effect of paclitaxel G, particularly, the anti-inflammatory effect related to the expression, production and activation of HO-1, κB (p65) on nuclear translocation was performed by the following method.

First, as in Example 2-1, paclitaxel G was treated with 20 μM or 40 μM of SnPP (50 μM) alone or in the absence of SnPP in rat-derived macrophages and cultured for 12 hours. Then, LPS 1 μg / ml was treated and further cultured for 1 hour to induce an inflammatory reaction. After the culture, cytosolic fraction and nuclear and cytoplasmic fractions were collected as in Example 2-1.

In the collected cytoplasmic fractions, the content of IκB-α and the content of p65 in the nuclear and cytoplasmic fractions were measured by Western blot analysis as in Example 2-4 using antibodies against each, and the results are shown in FIG. 11a. In addition, the binding activity of NF-κB to DNA in the collected nuclear and cytoplasmic fractions was measured using a TransAM kit (TransAM kit, Active Motif, USA) according to the manufacturer's protocol And the results are shown in FIG. 11B.

As shown in FIG. 11A, it was confirmed that the band of IκB-α was remarkably blurred in the treatment group treated with LPS compared with the group without any treatment, but when puckeramine G was added, the band of IκB-α When SnPP, an inhibitor of HO-1, was added, the band was stronger than that of the control group, but weak band was observed compared to the case of treatment with pellucillamine G alone. In addition, the band of p65, that is, NF-κB, was clearly observed in the nuclear fraction of the treated group treated with LPS compared with the group treated with no treatment, whereas when treated with paclhelamine G, the concentration of p65 When the band was gradually dimmed and SnPP, which is an inhibitor of HO-1, was added, the band was weaker than that of the control group, but a strong band was observed compared with the case of only treatment with pellucillamine G alone.

From the above results, it was confirmed that paclitaxel G inhibits the induction of inflammation by LPS, that is, the activation of IκB-α, and inhibits the inhibition of NF-κB migration into the nucleus. , It was again confirmed that the anti-inflammatory effect of paclhelamine G was related to HO-1.

In addition, as shown in FIG. 11B, the DNA binding activity of NF-κB in the treated group treated with LPS was increased about 4-fold compared to that in the untreated group. On the other hand, When treated with SnPP, the degree of DNA binding of NF-κB was decreased in a concentration-dependent manner, and decreased to about 50% in a sample treated with 40 μM. However, in the case of SnPP treatment, When 20 μM of Chelamin G was treated, it was almost similar to that of the experimental group treated with LPS alone. From these results, it can be seen that paclhelamine G inhibits the degradation of IκB-α in cells, inhibits the activation of IκB-α, inhibits the migration of NF-κB into the nucleus, and the degree of DNA binding of NF-κB DNA binding activity, and this action is inhibited by SnPP, confirming that the anti-inflammatory effect of paclhelamine G is related to HO-1.

Therefore, the above results show that the expression and activity of iNOS and COX-2 associated with inflammation in macrophages, that is, immune cells, are decreased as the throughput or treatment time of pulcherolamin G is increased, NO, PGE ₂ , TNF-α, and IL-1β, and inhibits the migration of NF-κB (p65) to the nucleus and DNA binding, inhibits the activation of IκB-α, -1, and thus it has been confirmed that the paclhelamine G is highly effective for the treatment, improvement or prevention of inflammatory diseases.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, Of the right.

Claims (5)

A pharmacologically acceptable salt thereof, and a combination thereof, as an active ingredient. An anti-inflammatory agent comprising any one selected from the group consisting of Pulchelamin G, a pharmaceutically acceptable salt thereof, and a combination thereof. A pharmaceutical composition for preventing or treating an inflammatory disease comprising, as an active ingredient, any one selected from the group consisting of Pulchelamin G, a pharmaceutically acceptable salt thereof, and a combination thereof. The method of claim 3,
Wherein the inflammatory disease is any one selected from the group consisting of dermatitis, allergy, systemic lupus erythematosus, retinitis, gastritis, hepatitis, enteritis, pancreatitis, nephritis and combinations thereof. A pharmacologically acceptable salt thereof, and a combination thereof, as an active ingredient. The present invention also provides a cosmetic composition having anti-inflammatory activity.

Images