KR20160124121A - Ligand binding molecules and uses thereof - Google Patents

Abstract

The present invention relates to ligand binding molecules that regulate angiogenesis and / or lymphangiogenesis and uses thereof.

Description

LIGAND BINDING MOLECULES AND USES THEREOF < RTI ID = 0.0 >

Field of invention

The present invention relates generally to the regulation of vascular growth, particularly in ophthalmology and oncology.

Sequence List

The electronic sequence listing is part of the specification.

Vascular endothelial growth factor (VEGF) proteins and their receptors (VEGFRs) have been implicated in angiogenesis (development of embryonic vasculature from early differentiated endothelial cells), angiogenesis (the process of forming new blood vessels from pre-existing blood vessels) (The process of forming a new lymph vessel). Platelet derived growth factor (PDGF) proteins and their receptors (PDGFR) are involved in the regulation of cell proliferation, survival and migration in several cell types.

Dysfunction of the endothelial cell regulatory system is a key feature of cancer and various diseases associated with abnormal angiogenesis, angiogenesis, and lymphangiogenesis.

Angiogenesis occurs in embryonic development and normal tissue growth, recovery and regeneration, female reproductive cycle, confirmation and maintenance of pregnancy, recovery of wounds and fractures. Besides angiogenesis that occurs in healthy individuals, angiogenesis events are associated with many pathological processes, especially other conditions in which tumor growth and metastasis, and in particular vascular hyperplasia of the microvascular system, is increased, such as diabetic retinopathy, psoriasis and arthropathy. Inhibition of angiogenesis is useful for preventing or alleviating these pathological processes or for delaying their progression.

Although therapies that block VEGF / PDGF signaling through their receptors have shown promise for inhibition of angiogenesis and tumor growth, new or improved compounds and therapies for the treatment of these disorders are still required.

SUMMARY OF THE INVENTION

The present invention relates to a method for inhibiting angiogenesis, which is capable of stimulating abnormal angiogenesis, lymphoid formation, or both, and at least one growth factor receptor tyrosine kinase (i.e., VEGFR-2 or VEGFR-3) (VEGF-C) and vascular endothelial growth factor-D (VEGF-D), and methods of using the same. The compositions of the present invention comprise ligand binding molecules that bind to one or both of human VEGF-C and human VEGF-D. In some embodiments, the ligand binding molecule comprises a polypeptide, e. G., A fragment, of a growth factor receptor tyrosine kinase extracellular domain (ECD). The fragment may differ from the wild-type sequence in a manner that does not eliminate growth factor binding, and the fragment is preferably used in a manner as described herein to improve its properties as a therapeutic agent for administration to a subject / patient in need thereof .

The present invention also provides a nucleic acid encoding said ligand binding molecule. The nucleic acid is useful for expressing the polypeptide ligand binding molecule and, in some embodiments, in a biologically active form, as a therapeutic agent for achieving expression of the polypeptide ligand binding molecule in vivo .

Administration to a patient in need thereof of a composition comprising a ligand binding molecule (or a polynucleotide encoding the same) described herein may inhibit growth factor stimulation of the VEGF receptor (e. G., Inhibit phosphorylation of the receptor) , Inhibits biological responses mediated through the receptor, including, but not limited to, VEGFR-mediated angiogenesis, lymphoid formation, or both.

VEGF-C and D bind with high affinity to at least one VEGF receptor (or receptor heterodimer) selected from VEGFR-2 and VEGFR-3 and stimulate its phosphorylation. These statements refer to the well-known characteristics of the growth factors towards their cognate receptors and do not imply the limiting feature of the ligand binding molecules of the invention per se . However, the preferred ligand binding molecules of the invention do more than merely bind to their target growth factors. Preferred ligand binding molecules also inhibit the growth factor (s) to which it binds to stimulate phosphorylation of at least one (and preferably all) of the receptor tyrosine kinases to which the growth factor (s) bind. Stimulation of tyrosine phosphorylation is in vitro Cell-based assays and anti-phosphotyrosine antibodies. Since phosphorylation of the receptor tyrosine kinase is an early step in the signal transduction cascade, this is a convenient indicator of whether the ligand binding molecule can inhibit growth factor-mediated signaling leading to cell migration, cell growth and other responses to be. Many other cell-based and in vivo assays can be used to confirm the growth factor neutralizing properties of the ligand binding molecules of the invention.

Ligand binding molecules that are "specific" for a particular growth factor are ligand-binding molecules that specifically recognize the active form of the growth factor (e.g., the form found to circulate in the body). Preferably, the ligand binding molecule also specifically binds to another form of the growth factor. By way of example, VEGF-C (and VEGF-D) are translated as prepro-molecules with broad amino-terminal and carboxy-terminal propeptides, which are cleaved to bind to VEGFR-2 and VEGFR- Producing a "fully processed" form of VEGF-C (or VEGF-D). A ligand binding molecule specific for VEGF-C (or VEGF-D) binds to at least a fully processed form of VEGF-C (or VEGF-D), and preferably also to a partially processed form and an unprocessed form .

In one aspect, the ligand-binding molecule described herein is a polynucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 2, SEQ ID NO: 2, SEQ ID NO: : At least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, relative to the amino acid sequence defined by position 47-115 of SEQ ID NO: 2 or position 25-115 of SEQ ID NO: Wherein the polypeptide comprises a first amino acid sequence having at least 96%, or at least 97%, or at least 98%, or at least 99% identity to a human VEGF-A (VEGF), Binding to at least one ligand polypeptide selected from the growth factors of the VEGF or PDGF class, such as VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-B, PDGF- do. SEQ ID NO: 2 contains the amino acid sequence for human VEGFR-3, position 1-24 of SEQ ID NO: 2 corresponds to the putative signal peptide, position 25 after SEQ ID NO: 2 contains the putative signal peptide Corresponding to an assumed mature form of the receptor. The previous segment of SEQ ID NO: 2 roughly corresponds to or comprises the first immunoglobulin-like domain of the ECD of human VEGFR-3 ("D1 of VEGFR-3"). It is particularly contemplated that constructs comprising additional Ig-like domains of VEGFR-3 or other receptors attached in such a way as to cause ligand binding polypeptides, and constructs that bind to different ligands make the ligand binding polypeptides It is constructed by changing the receptor components used. In some variations, the ligand binding polypeptide is based primarily on the extracellular domain of VEGFR-3; in other embodiments, the ligand binding polypeptide is VEGFR-1 and / or VEGFR-2 and / or PDGFR- Or fusion of fragments of other receptor tyrosine kinases, such as PDGFR-β. In embodiments based primarily on VEGFR-3, the at least one ligand is a natural ligand for VEGFR-3, such as a VEGF-C or VEGF-D polypeptide.

In some embodiments, the ligand binding polypeptide is at least 80%, or at least 85%, or at least 90% identical to the amino acid sequence defined by position 154-210 of SEQ ID NO: 2 or position 248-314 of SEQ ID NO: , Or at least 92%, alternatively at least 95%, alternatively at least 96%, alternatively at least 97%, alternatively at least 98%, alternatively at least 99% identical to the first amino acid sequence of the second amino acid sequence, (VEGF), VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-A, or VEGF-B are directly or via a spacer to the C-terminus of the first amino acid sequence. B, PDGF-C, and a growth factor of the VEGF or PDGF class, such as PDGF-D. The amino acid sequence defined by the position of the polypeptide corresponding to positions 154-210 corresponds roughly to or comprises the second immunoglobulin-like domain of the ECD of human VEGFR-3 (" D2 "of " VEGFR-3 "). The amino acid sequence defined by the position of the polypeptide corresponding to positions 248-314 corresponds roughly to or comprises the third immunoglobulin-like domain of the ECD of human VEGFR-3 ("D3 of VEGFR-3"). Wherein the second amino acid sequence comprises a sequence of amino acids that approximately corresponds to or comprises D2 of VEGFR-3, the ligand binding polypeptide comprises a sequence at least 24 amino acids in length, Or at least 95%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: Terminal residue of said third amino acid sequence is linked directly or via a spacer to the C-terminal residue of the second amino acid sequence, said polypeptide comprising human VEGF-A (VEGF), VEGF-B, VEGF Or at least one ligand polypeptide selected from the growth factors of the VEGF or PDGF class, such as VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D. In embodiments wherein the ligand binding polypeptide comprises an amino acid sequence that substantially corresponds to or comprises Dl and D2 of VEGFR-3, the ligand binding polypeptide also substantially corresponds to or comprises D3 of VEGFR-3 Of the amino acid sequence shown in SEQ ID NO.

In embodiments where the ligand binding polypeptide comprises an amino acid sequence that corresponds approximately to two or more component domains of VEGFR-3, the component domains may be directly connected to each other or may be connected through one or more spacers. Preferably, the component domains are connected by one or more spacers. In one embodiment, the spacer comprises at least one peptide sequence between the component domains, which is 1-100 amino acids, preferably 1-50 amino acids in length. In one embodiment, the spacer between the two component domains consists essentially of a peptide sequence that is naturally associated with the component domain in native VEGFR-3.

In an embodiment wherein the ligand binding polypeptide comprises an amino acid sequence that roughly corresponds to or comprises the contiguous component domains of VEGFR-3 (e.g., D1-D2 or D1-D2-D3) Are linked through one or more spacers comprising one or more peptide sequences between the component domains, which are 1-100 amino acids, preferably 1-50 amino acids in length. In one embodiment, the spacer between two component domains substantially consists of a peptide sequence corresponding to linking each successive component domain in native VEGFR-3. In some embodiments, the spacer between two consecutive constituent domains is at least 80%, or at least 85%, or at least 90%, or at least 92% , Or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%.

In one embodiment, when the ligand binding polypeptide comprises an amino acid sequence that approximately corresponds to or comprises D1 and D2 of VEGFR-3, the component domains D1 and D2 are identified by positions 116-153 of SEQ ID NO: 2 At least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% Lt; RTI ID = 0.0 > amino acid < / RTI > Wherein said ligand binding polypeptide comprises an amino acid sequence substantially corresponding to or comprising D1, D2 and D3 of VEGFR-3, said component domains D2 and D3 being selected from the group consisting of amino acids defined by positions 211-247 of SEQ ID NO: 2 , Or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity Spacer amino acid sequence.

In some embodiments, the purified or isolated ligand binding polypeptide has a sequence of SEQ ID NO: 2 with the proviso that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT. 2, position 47-210 of SEQ ID NO: 2, position 47-314 of SEQ ID NO: 2, position 25-314 of SEQ ID NO: 2, or position 47-752 of SEQ ID NO: Or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 95%, or at least 95%, at least 80%, or at least 85% Or at least 97%, or at least 98%, or at least 99% identity to SEQ ID NO: 1, and wherein said polypeptide comprises at least one amino acid sequence selected from human VEGF-A, VEGF-C, VEGF-C, VEGF- Ligand polypeptide. In one variation, the amino acid corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with another amino acid (e.g., glutamine, aspartate, glutamate, arginine and lysine). Positions 47-210 include the two first immunoglobulin-like domains of the human VEGFR-3 ECD, as well as the VEGFR-3 ECD sequence between the two first Ig-like motifs. Sites 47-314 include the three first immunoglobulin-like domains of the human VEGFR-3 ECD, as well as the VEGFR-3 ECD sequence between these Ig-like motifs.

More generally, the ligand binding polypeptides of the present invention comprise at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95% , Or at least 96%, or at least 97%, or at least 98%, or at least 99% identical amino terminal sequence of SEQ ID NO: 2, wherein the amino terminus of said fragment is at positions 25,26, 27,28, 29,30 , 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 and 50; The carboxy terminus of the fragment is located at positions 110-775 of SEQ ID NO: 2 (e.g., at positions 110, 111 (SEQ ID NO: 2)), under the proviso that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT 752, 753, 754, 758, 759, 760, 761, 762, 763, 764, ..., 741, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775. A purified or isolated ligand binding polypeptide. As will be readily apparent from the disclosure herein, the accepted modifications are not those which introduce a new glycosylation sequence that is not found in wild-type VEGFR-3.

In another aspect, the ligand-binding molecule described herein is a polynucleotide comprising a nucleotide sequence selected from the group consisting of positions 47-115 of SEQ ID NO: 2, a nucleotide sequence of SEQ ID NO: The same amino acid sequence as the amino acid sequence defined by 47-210 of SEQ ID NO: 2, 47-314 of SEQ ID NO: 2, 47-752 or 47-775 of SEQ ID NO: 2, or 47-752 of SEQ ID NO: ≪ / RTI > wherein the ligand comprises a sequence selected from the group consisting of SEQ ID NOs. In one variation, the amino acid corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with another amino acid (e.g., glutamine, aspartate, glutamate, arginine and lysine).

In another aspect, the ligand binding molecule described herein is at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 2, Is the putative VEGFR-3 glycation sequence, and the putative glycation sequence is removed from the amino acid sequence of the ligand binding polypeptide. The term "removed " as used in this context means a change (by substitution, deletion or insertion) of the primary amino acid sequence at at least one position to disrupt the N-X-T sequencing motif.

The present invention also encompasses polyhedral ligand binding constructs comprising two or more ligand binding molecules as described herein, which form covalent or non-covalent attachment to each other to form a duplex or multimeric structure. In some variations, the attachment occurs between VEGFR-3-like sequences of the ligand binding polypeptide; In another variation, the attachment occurs between heterologous polypeptides attached to one or both of the VEGFR-3-like sequences.

Reference herein to ligand binding molecules or ligand binding polypeptides described herein refers to the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2, which indicates the N-linked glycosylation sequence in the native VEGFR-3 sequence (Such as a monomer, dimer or larger polymorph) is an Ig-like motif of VEGFR-3 (e.g., about 47 of SEQ ID NO: 2) Lt; RTI ID = 0.0 > Ig-like motif, < / RTI >

In yet another aspect, ligand binding molecules are described herein that are isolated or purified ligand binding polypeptides comprising a first immunoglobulin-like domain of a VEGFR-3ΔN2 polypeptide. As used herein, the term "VEGFR-3.DELTA.N2 polypeptide" means that the NDT which is part of the sequence of the polypeptide corresponding to the glycation sequence on the second putative has an NXS / T sequence Refers to a polypeptide having at least 95% identity to the amino acid sequence that defines the ECD of human VEGFR-3 under the clue that it is mutated to no longer fit into the motif. In some embodiments, the purified polypeptide comprises two first immunoglobulin-like domains of a VEGFR-3ΔN2 polypeptide, and preferably comprises a VEGFR-3 sequence between the domains. In some embodiments, the purified polypeptide comprises three first immunoglobulin-like domains of a VEGFR-3? N2 polypeptide and preferably comprises a VEGFR-3 sequence between the domains.

In another aspect, a ligand-binding molecule is described herein that is a polypeptide comprising an ECD fragment of human VEGFR-3 fused to a fusion partner, wherein the amino acid sequence of the ECD fragment of VEGFR-3 is the second Is modified from wild-type VEGFR-3 to eliminate putative N-linked glycosylation sequences, said polypeptides being soluble in human serum and binding to human VEGF-C or human VEGF-D; The fusion partner improves the solubility or serum half-life of the ECD fragment (e. G., Compared to the same fragment that is not fused to a fusion partner). In some embodiments, the fusion partner is a heterologous polypeptide.

In some embodiments, the ligand binding polypeptide or ligand binding molecule binds human VEGF-C or human VEGF-D. In some embodiments, the ligand binding polypeptide or ligand binding molecule inhibits VEGF-C- or VEGF-D-binding to VEGFR-3 or inhibits VEGFR-3 expression in cells expressing VEGFR- VEGF-C- or VEGF-D-mediated stimulation. The inhibition of the stimulation can be demonstrated, for example, by measuring receptor phosphorylation, by measuring cell growth in vitro or in vivo, or by measuring vascular growth or other tissue-level changes in vivo .

The ligand binding molecule preferably binds to human VEGF-C with a K _d of about 1 nM or less (e.g., 500 pM, 400 pM, 300 pM, 200 pM, 100 pM, 50 pM, 10 pM or less) do. The ligand binding molecule preferably has a K _d of about 5 nM or less (e.g., 2 nM, 1 nM, 500 pM, 400 pM, 300 pM, 200 pM, 100 pM, 50 pM, 10 pM or less) RTI ID = 0.0 > VEGF-D < / RTI >

In yet another aspect, the purified or isolated ligand binding molecule is selected from the group consisting of amino acids 22-290 of SEQ ID NO: 3, amino acids 23-290 of SEQ ID NO: 3, amino acids 23-537 of SEQ ID NO: 3 or SEQ ID NO: 22-537. In another variation, the molecule has at least 80%, or at least 85%, or at least 95% sequence identity to any of the sequences described above, with the proviso that the sequence of the polypeptide corresponding (aligning) to the VEGFR-3 N2 sequence is not a glycosylation sequence 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical amino acid sequence.

As described herein, ligand binding molecules can be chemically modified ( e . G., Glycosylation, pegylation, etc.) to impart desired characteristics while retaining their specific growth factor binding characteristics. The Ig-like domain I-III of VEGFR-3 contains 5 putative N-glycosylation sites (referred to as N1, N2, N3, N4 and N5 sequences, respectively, of VEGFR-3). N1 corresponds to amino acids 33-35 of SEQ ID NO: 2; N2 corresponds to amino acids 104-106 of SEQ ID NO: 2; N3 corresponds to amino acids 166-168 of SEQ ID NO: 2; N4 corresponds to the amino acids 251-253 of SEQ ID NO: 2 and N5 has four N-saccharide sequon sites corresponding to positions 299-301 of SEQ ID NO: 2, a purified or isolated ligand binding poly Peptides. In some embodiments, the ligand binding molecules described herein comprise a modification in the N2 sequence of the molecule. For example, in some embodiments, the amino acid in the ligand binding molecule corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with another amino acid. Conservative substitutions are preferred. In some embodiments, the amino acid corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced by an amino acid selected from the group consisting of glutamine, aspartate, glutamate, arginine, and lysine. In embodiments where the N2 sequence of SEQ ID NO: 2 is modified as described above, the N1, N3, N4 and N5 sequences of SEQ ID NO: 2 are preferably unchanged in terms of amino acid sequence.

As described herein, a ligand binding molecule can be linked directly or via a linker to a fusion partner. The fusion partner may be any heterologous moiety that enhances the functionality of the ligand binding molecule. Exemplary peptide fusion partners include immunoglobulin constant domain (Fc) fragments. In some embodiments, the immunoglobulin constant fragment is at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98% Or at least 99% identity to SEQ ID NO: 3, or an amino acid sequence having 100% identity to amino acids 306-537 of SEQ ID NO: 3.

As described herein, ligand binding molecules can be used to facilitate binding to, for example, fusion partners (e. G., Heterologous peptides) or to impart desired characteristics (e. G., Increase serum half-life To increase solubility in aqueous media and to be able to target specific cell populations, such as tumor cells or retinal cells).

In some embodiments, the ligand binding molecules described herein optionally comprise at least one PEG moiety attached to the molecule. For example, in some embodiments, about 20-40 kDa PEG is attached to the amino terminus of the ligand binding molecule.

In some embodiments, a ligand binding molecule as described herein may optionally comprise a linker that links a fusion partner, such as, for example, a heterologous peptide, to the ligand binding polypeptide, such as the factor Xa linker sequence PIEGRGGGGG (SEQ ID NO: 4) . In another embodiment, the ligand binding molecule comprises a polypeptide wherein the C-terminal amino acid of the ligand binding polypeptide is attached directly to the N-terminal amino acid of the heterologous peptide fusion partner by peptide binding. In some embodiments, the ligand binding polypeptide and the heterologous peptide are attached by an amide bond (either directly or via a linker polypeptide) to form a single polypeptide chain.

In some variations, the ligand binding molecule comprises a signal peptide that directs secretion of the molecule from a cell expressing the molecule.

The nucleic acid (polynucleotide) of the present invention comprises a nucleic acid encoding a polypeptide ligand binding molecule, which can be used in applications such as gene therapy and recombinant in vitro expression of a polypeptide ligand binding molecule. In some embodiments, the nucleic acid is purified or isolated. In some embodiments, the polynucleotide further comprises a promoter sequence operably linked to a nucleotide sequence encoding the polypeptide, wherein the promoter sequence promotes transcription of the polypeptide encoding sequence in the host cell. The polynucleotide may also comprise a polyadenylation signal sequence. In some variations, the nucleic acid has a coding nucleotide sequence similar to the wild-type human VEGFR-3-encoding nucleic acid. For example, the nucleic acid can be at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 80%, at least 90% 96%, or at least 97%, or at least 98%, or at least 99% identity to the coding sequence. By way of example, in the context of a nucleotide sequence encoding the amino acid 47-314 of SEQ ID NO: 2, modified in the N2 sequence, an exemplary nucleic acid is the human nucleic acid sequence shown in position 157-961 of SEQ ID NO: 1, At least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity to the VEGFR- Lt; RTI ID = 0.0 > nucleotide < / RTI >

Aspects of the present invention are also vectors comprising polynucleotides. Such a vector may comprise an expression control sequence operably linked to a sequence encoding said polypeptide. In some variations, the vector is selected to optimize in vitro recombinant expression in selected host cells, e. G. Eukaryotic host cells. In some variations, the vector is selected for in vivo delivery. For example, the vector may be selected from the group consisting of a lentiviral vector, an adeno-associated viral vector, an adenoviral vector, a liposomal vector, and combinations thereof. In some embodiments, the vector comprises a replication-deficient adenovirus, wherein the adenovirus is operably linked to a promoter and comprises a polynucleotide located on the side of the adenoviral polynucleotide sequence.

Host cells comprising the polynucleotides, vectors and other nucleic acids, and methods of using the host cells to express and separate the ligand binding molecules are also aspects of the invention. Eukaryotic host cells, including Chinese hamster ovary (CHO) cells and other mammalian cell lines, comprising the polynucleotides encoding the ligand binding polypeptides or ligand binding molecules described herein are particularly contemplated. In some variations, the cell line is selected or manipulated to introduce human or human-like saccharification to the glycosylation sequence of the polypeptide produced in the cell.

Methods of making the ligand binding polypeptides or molecules described herein are also contemplated. (Such a method may also be described as the use of a polynucleotide or cell of the invention.) In one aspect, the method comprises contacting the polynucleotide with a ligand binding polypeptide or ligand binding molecule encoded by the polynucleotide Lt; RTI ID = 0.0 > transfected < / RTI > or transfected with the polynucleotide or vector described. In some embodiments, the method further comprises purifying or isolating the ligand binding polypeptide or ligand binding molecule from the cell or from the growth medium of the cell. In some embodiments, the method further comprises affixing one or more polyethylene glycols (PEG) or other moieties to the expressed and purified / isolated polypeptide.

The invention also encompasses a composition comprising a polypeptide, a ligand binding molecule or a nucleic acid encoding it, together with a pharmaceutically acceptable diluent, adjuvant or carrier medium. In some embodiments, the composition is formulated for topical administration to the eye (e.g. topical formulation such as ointment or eye drops, or a formulation suitable for intravitreal injection). In other embodiments, the composition can be administered to a tumor or to an organ or organ in which the tumor has been surgically removed, for example, by intravenous injection or direct injection into diseased tissue, or by application through a device during tumor resection Is formulated for topical administration to tissues.

The present invention also relates to the use of the substances (polypeptides, molecules and constructs, polynucleotides and vectors, transformed cells, compositions) described herein for inhibiting vascular growth (blood vessels and / or lymph vessels) in a therapeutic and prophylactic context And the like. Usage methods as described herein may alternatively be characterized by the use of various materials for the above mentioned indications. Exemplary subjects for treatment include humans and other primates, livestock (e.g., cows, horses, pigs), zoo animals (e.g., cats, dogs, hippopotamus, deer), and pets And rodents.

In some variations, the invention includes a method of inhibiting neovascularization in a subject, the method comprising administering to the subject any of the above-mentioned materials or compositions in an amount effective to inhibit neovascularization in the subject do. Exemplary pathogenic neovascularization conditions include pathological neovascularization of the eye, and neovascularization of the tumor.

In some variations, the invention includes a method of inhibiting retinal neovascularization in a subject, said method comprising administering to the subject a substance or composition as described herein in an amount effective to inhibit retinal neovascularization in said subject . In a related variation, the present invention includes a method of treating a subject having an ocular disorder associated with retinal neovascularization, said method comprising administering to said subject an amount effective to inhibit retinal neovascularization, Or < RTI ID = 0.0 > a < / RTI > For example, a composition as described herein can be administered to a subject by, for example, eye drops or other topical administration, by subconjunctival administration (e.g., by injection), by intravitreal injection or by intravitreal injection ≪ / RTI >

The composition preferably binds to VEGFR-2 and / or VEGFR-3 expressed in the eye's cells or vessels of the eye or VEGFR-2 and / or VEGF-D in the eye of the subject, -3 < / RTI > in a dose effective to inhibit < RTI ID = 0.0 > stimulating < / RTI > Such beneficial effects can be measured in terms of slowing or stopping of deterioration / progression in pathological eye conditions (such as macular degeneration, diabetic retinopathy and macular vasculopathy), or improvement of clinical symptoms. This beneficial effect can also be observed in terms of monitoring vascular growth in and around the targeted tissue.

The methods and uses described herein may be practiced in combination with additional therapeutic agents or therapies (e.g., forms of radiation) as described in detail herein.

The methods (or uses) of the invention described herein may be used to treat at least one (or more than one) of the at least one disease associated with one or more ligand binding molecules, or in combination with another therapy Ligand binding molecules. In embodiments for the treatment of a posterior disorder of the ligand binding molecule, additional therapies contemplated include topical laser therapy (or photocoagulation), scatter laser therapy (or retinal photocoagulation), and vitrectomy. In some embodiments, an antibiotic is also administered to a subject receiving the treatment.

In embodiments for use of the ligand-binding molecules described herein for use in the treatment of cancer, the treatment standard treatments contemplated include anti-sense RNA, RNA interference, bispecific antibodies, other antibodies that target growth factors and / Antibody types, and small molecules such as chemotherapeutic agents. Cytokines, radiotherapeutic agents, or radiation therapy may also be used in combination with the ligand binding molecules described herein. The chemotherapeutic or radiotherapeutic agent may be an anti-metabolite; DNA-damaging agents; Cytokines or growth factors; Shared DNA-binding drugs; Topoisomerase inhibitors; Anti-mitotic agents; Anti-tumor antibiotics; Fractionating agent; Alkylating agents; Methylating agents; Hormone or hormone antagonists; Nitrogen mustard; Radioactive sensitizers; ≪ / RTI > and a photosensitizer. Specific examples of these agents are described elsewhere herein. Combination therapies are preferably synergistic, but they need not be synergistic, and adjunctive therapy is also contemplated as an aspect of the present invention.

In addition to their use in methods, the ligand binding molecules can be combined or packaged with other therapeutic agents in a kit or as a unit dose. Neoplastic disease is not the only disease that can be treated with the ligand binding molecule. The ligand binding molecule may be used as a therapeutic agent for any disease associated with abnormal angiogenesis or lymphangiogenesis.

The invention may also be described in the following additional embodiments:

Comprising the same amino acid sequence as the amino acid sequence defined by position 47-115 of SEQ ID NO: 2, under the proviso that the position of the polypeptide corresponding to position 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT. Wherein the polypeptide binds to at least one ligand polypeptide selected from human VEGF-C, VEGF-D, and PlGF.

Comprising the same amino acid sequence as the amino acid sequence defined by position 47-210 of SEQ ID NO: 2, under the proviso that the position of the polypeptide corresponding to position 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT. A purified or isolated ligand binding polypeptide.

In the paragraph [0048], the amino acid sequence defined by position 47-314 of SEQ ID NO: 2 under the proviso that the position of the polypeptide corresponding to position 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT A purified or isolated ligand binding polypeptide comprising the same amino acid sequence.

In the paragraph [0048], under the clue that the position of the polypeptide corresponding to position 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, the amino acid sequence defined by position 47-752 of SEQ ID NO: 2 A purified or isolated ligand binding polypeptide comprising the same amino acid sequence.

In any one of paragraphs [0048] to [0051], positions 33-35 of SEQ ID NO: 2, positions 166-168 of SEQ ID NO: 2, positions 251-253 of SEQ ID NO: 2, and SEQ ID NO: A purified or isolated ligand binding polypeptide having four N-saccharide sequon sites corresponding to positions 299-301.

[0052] A purified or isolated ligand-conjugated polypeptide according to paragraph, which is glycosylated at the four N-glycosylation sites.

A purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0053] which is a soluble polypeptide.

In any one of paragraphs [0048] to [0054], the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, , The same amino acid sequence as the amino acid sequence defined by position 47-210 of SEQ ID NO: 2, position 47-314 of SEQ ID NO: 2, or position 47-752 of SEQ ID NO: 2, Ligand binding polypeptides.

A purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0055] which binds to human VEGF-C or human VEGF-D.

Inhibiting VEGF-C- or VEGF-D-binding to VEGFR-3 or inhibiting VEGF-C- or VEGF-D-mediated stimulation of VEGFR-3 in cells expressing VEGFR- , A purified or isolated ligand binding polypeptide according to paragraph [0056].

A purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0057] which binds human VEGF-C with a Kd of 1 nM or less.

A purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0057] which binds human VEGF-D with a Kd of 5 nM or less.

The purified or isolated ligand-binding polypeptide of any one of paragraphs [0048] to [0057], wherein the amino acid in the polypeptide corresponding to position 104 of SEQ ID NO: 2 is deleted or replaced by another amino acid.

Wherein the amino acid at position 104 of SEQ ID NO: 2 is deleted or substituted with another amino acid selected from the group consisting of glutamine, aspartate, glutamate, arginine, and lysine, a purified or isolated ligand binding poly Peptides.

A purified or isolated ligand-binding polypeptide according to any one of paragraphs [0048] to [0056], comprising the amino acid sequences 23-290 of SEQ ID NO: 3.

A purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0062] further comprising a signal peptide.

A purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0053] further comprising at least one polyethylene glycol moiety attached to said polypeptide.

A purified or isolated ligand binding polypeptide according to paragraph [0064], comprising about 20-40 kDa of polyethylene glycol attached to the amino terminus of the polypeptide.

A ligand binding molecule comprising a ligand binding polypeptide according to any one of paragraphs [0048] to [0065] linked to a heterologous peptide.

A ligand-binding molecule according to paragraph [0066], wherein the heterologous peptide comprises an immunoglobulin constant domain fragment.

The ligand binding molecule according to paragraph [0066], wherein said immunoglobulin constant domain fragment is an IgG constant domain fragment.

The ligand binding molecule according to paragraph [0067], wherein said immunoglobulin constant fragment comprises amino acids 306-537 of SEQ ID NO: 3.

A ligand binding molecule according to paragraph 19, wherein the ligand binding molecule comprises amino acids 22-537 of SEQ ID NO: 3.

[0066] A ligand binding molecule according to any one of paragraphs [0066] to [0070], which optionally comprises a linker connecting said heterologous peptide to said ligand binding polypeptide.

[0066] A ligand-binding molecule according to any one of paragraphs [0066] to [0070], wherein the C-terminal amino acid of said ligand binding polypeptide comprises a polypeptide directly attached to the N-terminal amino acid of said heterologous peptide by peptide binding.

A ligand binding molecule according to any one of paragraphs [0066] to [0072], further comprising a signal peptide that directs secretion of the molecule from the cell expressing the molecule.

A ligand binding molecule according to paragraph [0066], wherein the molecule comprises the amino acid sequence set forth in SEQ ID NO: 3.

The ligand binding molecule according to any one of paragraphs [0066] to [0070], wherein the ligand binding polypeptide and the heterologous peptide are bound by an amide bond to form a single polypeptide chain.

A ligand binding polypeptide according to any of paragraphs [0048] to [0065] further comprising a detectable label or a ligand binding molecule according to any one of paragraphs 19-28.

A ligand comprising a ligand binding polypeptide according to any one of paragraphs 1-18 or a ligand binding molecule according to any of paragraphs [0066] to [0075] and a chemotherapeutic agent.

An isolated polynucleotide comprising a coding nucleotide sequence encoding a ligand binding polypeptide according to any one of paragraphs 1-18 or a ligand binding molecule according to any one of paragraphs [0066] to [0075].

A polynucleotide according to paragraph [0078], further comprising a promoter sequence operably linked to the coding nucleotide sequence to facilitate transcription of the coding nucleotide sequence in the host cell.

[0078] A vector comprising a polynucleotide of paragraph [0078] or paragraph.

The vector according to paragraph [0080], further comprising an expression control sequence operably linked to the coding nucleotide sequence.

Wherein the vector is selected from the group consisting of lentiviral vectors, adeno-associated viral vectors, adenoviral vectors, liposomal vectors, and combinations thereof.

A vector according to paragraph [0080] comprising a replication-deficient adenovirus, wherein said adenovirus is operably linked to a promoter and comprises a polynucleotide located on the side of the adenovirus polynucleotide sequence.

An isolated cell or cell line transformed or transfected with a polynucleotide according to paragraph [0078] or a vector according to paragraphs [0080] to [0083].

Isolated cell or cell line according to paragraph [0084] which is a eukaryotic cell.

An isolated cell or cell line according to paragraph [0084] which is a human cell.

Isolated cell or cell line according to paragraph [0084] which is a Chinese hamster ovary (CHO) cell.

[0087] A method for producing a ligand binding polypeptide comprising growing a cell according to any one of paragraphs [0084] to [0087] under conditions that express the polynucleotide-encoded ligand binding polypeptide or ligand binding molecule.

[0088] The method according to paragraph [0088] further comprising purifying or isolating the ligand binding polypeptide or the ligand binding molecule from the cell or from the growth medium of the cell.

A composition comprising a purified ligand binding polypeptide or ligand binding molecule according to any one of paragraphs [0048] to [0076] and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier.

A polynucleotide or a vector according to any one of paragraphs [0078] to [0083] and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier.

[0090] A composition according to paragraph [0090] or paragraph, formulated for topical administration.

Wherein the composition is in the form of a solid, paste, ointment, gel, liquid, aerosol, mist, polymer, film, emulsion, or suspension.

[0090] A composition according to paragraph [0090] or paragraph, formulated for intravitreal administration.

Comprising administering to a subject a composition according to any one of paragraphs [0090] to [0094] in an amount effective to inhibit neovascularization in a subject.

A method of inhibiting retinal neovascularization in a subject comprising administering to the subject a composition according to any one of paragraphs [0090] to [0094] in an amount effective to inhibit retinal neovascularization in the subject.

Comprising administering to a subject a composition according to any one of paragraphs [0090] to [0095] in an amount effective to inhibit retinal neovascularization in a subject, Way.

Use of a composition according to any one of paragraphs [0090] to [0094] for inhibiting neovascularization, such as retinal neovascularization or tumor neovascularization, in a subject in need thereof.

The method and use according to any one of paragraphs [0096] to [0098], wherein said composition is administered topically to the eye of a subject.

The method and use according to paragraph [0099], wherein said composition is administered by intravitreal injection.

The method and use according to paragraph [0099], wherein said composition is administered by topical administration.

Wherein said composition is administered in an amount effective to inhibit VEGF-C and / or VEGF-D binding to or stimulating VEGFR-2 and / or VEGFR-3 expressed in blood vessels of said eye or eye of said eye ≪ RTI ID = 0.0 > [0010] < / RTI >

The method and use of paragraph [0097] or [0098], wherein said ocular disorder is selected from the group consisting of macular degeneration, diabetic retinopathy and macular vasculopathy.

The method and use according to any one of paragraphs [0096] to [00103], further comprising administering an antibiotic to the subject.

Wherein the antibiotic is selected from the group consisting of amikacin, gentamicin, kanamycin, neomycin, nethylamycin, streptomycin, tobramycin, teicoplanin, vancomycin, azithromycin, clarithromycin, clarithromycin, dilitromycin, erythromycin , Roxithromycin, troreidomycin, amoxicillin, ampicillin, azlocillin, carbenicillin, cloze cilin, dicloxycin, flucosaciline, megiosylline, napsilin, penicillin, piperacillin, Ciprofloxacin, moxifloxacin, norfloxacin, oplazine, trovafloxacin, mephenide, sulphate, ciprofloxacin, ciprofloxacin, ciprofloxacin, ciprofloxacin, But are not limited to, citalopram, cetamid, sulfamethizole, sulfasalazine, sulphosoxazole, trimethoprim, Method according to paragraph [00 104] is selected from the group consisting of lean, and tetracycline.

The method and use according to paragraph [0095] or [0098], wherein said subject is diagnosed as a tumor and said composition is administered in an amount effective to inhibit neovascularization in a tumor.

[00106] A method and its use according to paragraph [00106], wherein said composition is administered locally to a tumor or to an organ or tissue from which said tumor has been surgically removed.

Wherein said composition inhibits VEGF-C and / or VEGF-D binding to VEGFR-2 and / or VEGFR-3 expressed in said tumor cells or to stimulate VEGFR-2 and / or VEGFR-3 in a tumor of a subject [00106] < RTI ID = 0.0 > [00106] < / RTI >

This summary of the invention is not intended to be exhaustive or to limit the invention to the precise form disclosed, and it is to be understood that the invention is not limited to the disclosed embodiments. All such implementations are aspects of the present invention. Moreover, for the sake of brevity, the various details that may be applied to many implementations have not been repeated for all implementations. Modifications that reflect the combination and rearrangement of the embodiments described herein are contemplated as aspects of the present invention. In addition to the foregoing, the present invention contemplates, in an additional aspect, all embodiments of the invention in which the range is narrower in some way than the variants explicitly mentioned above. For example, in the case of aspects described as genus or scope, all subgenuses, subranges, or species are expressly considered as embodiments of the present invention.

Brief Description of Drawings

Figure 1A shows the PK profiles of VGX-300 and VGX-301-DELTA N2 produced by transient CHO expression. Figure IB shows the PK profile of VGX-300 and VGX-301-DELTA N2 produced by transient HEK expression.

Figure 2 demonstrates that both VGX-300 and VGX-301-ΔN2 specifically bind to both VEGF-C and VEGF-D.

Figure 3 shows that VGX-300 blocks VEGF-C and VEGF-D binding and a) cross-linking of VEGFR-2 and b) VEGFR-3.

Figure 4 shows that VGX-300 and VGX-300-N2 block a) VEGF-C and b) VEGF-D binding and cross-linking of VEGFR-3 in a cell-based Ba / F3 assay. The data points represent the mean ± SD of n? 2.

Figure 5 shows pharmacokinetics and ocular bioavailability in rabbits after intravitreal administration

details

The present invention is based on the finding that a fragment of ECD of human VEGFR-3 having one or more modifications in the N-glycan domain of ECD can bind and neutralize human VEGF-C and human VEGF-D in vitro, It is based in part on a study that demonstrates that vascular development can be suppressed in animal models of macular degeneration.

Growth factor receptor tyrosine kinases generally include three major domains: the extracellular domain (ECD), the transmembrane domain, and the intracellular domain. The ECD binds to the ligand, the transmembrane domain immobilizes the receptor to the cell membrane, and the intracellular domain has one or more tyrosine kinase enzyme domains and interacts with downstream signaling molecules. Vascular endothelial growth factor receptors (VEGFRs) bind to their ligands through their ECDs, which contain multiple immunoglobulin-like domains (Ig-like domains). An Ig-like domain is identified herein using the nomenclature "D #". For example, "D1" refers to the first Ig-like domain of a particular receptor ECD. "D1-3" refers to constructs containing at least three first Ig-like domains of a particular ligand binding molecule, and intervening sequences between domains 1 and 2 and 2 and 3.

The complete ECD of VEGFR is not required for ligand (growth factor) binding. The ECD of VEGFR-3 has six intact Ig-like domains and one truncated Ig-like domain - D5 of VEGFR-3 is truncated to post-translationally disulfide-linked subunits leaving VEGFR-3 . Veikkola, T., et al . , Cancer Res. 60: 203-212 (2000). In some embodiments, a receptor fragment comprising at least three first Ig-like domains for its class is sufficient to bind the ligand. Soluble receptors capable of inhibiting VEGF-C or VEGF-D activity and signal transduction via VEGFR-3 by binding to VEGF-C and VEGF-D are also disclosed in WO 2000/023565, WO 2000/021560, / 060950 and WO2005 / 087808, the disclosures of which are incorporated herein by reference in their entirety. The soluble receptors, which are modified with the < RTI ID = 0.0 > N2 < / RTI > sequence change and optionally other variants described herein, are considered aspects of the invention.

Table 1 defines the approximate boundaries of Ig-like domains for human VEGFR-3. These boundaries are important because the selected boundaries can be used to form ligand-binding molecules and thus affect the binding properties of the constructs obtained.

Table 1: Immunoglobulin-like domains for human VEGFR-3

The complete ECD extends to position 775 of SEQ ID NO: 2.

Soluble receptor constructs for use as ligand binding molecules for human VEGF-C or VEGF-D preferably comprise at least seven Ig-like domains of at least one Ig-like domain of VEGFR-3 as set forth in Table 1. The ligand binding molecule will optionally comprise a sequence preceding the most N-terminal Ig-like domain and optionally will comprise a sequence over the most C-terminal Ig-like domain, Lt; RTI ID = 0.0 > domains. ≪ / RTI > Mutants, such as variants having at least one amino acid substitution, addition, or deletion of amino acid residues, are also contemplated. In some embodiments, the ligand binding molecule comprises a fragment of human VEGFR-3 comprising at least three first Ig-like domains of human VEGFR-3.

In some embodiments, the ligand binding molecule is a polypeptide comprising a portion of a human VEGFR-3 ECD, wherein the moiety binds to one or both of human VEGF-C and human VEGF-D, wherein the VEGFR- Wherein the amino acid sequence of the ECD fragment of VEGFR-3 comprises at least a first, a second and a third Ig-like domain, wherein the amino acid sequence of the VEGFR-3 comprises a wild-type VEGFR- 3, which polypeptide lacks the VEGFR-3 Ig-like domain 4-7 and preferably any membrane-through domain and preferably any intracellular domain.

In some embodiments, the ligand binding molecule is a human VEGFR-3 polypeptide having the amino acid sequence of human VEGFR-3 polypeptide as set forth in SEQ ID NO: 2, with the proviso that the position of the ligand binding molecule corresponding to positions 104-106 is not identical to NXS or NXT. 3 polypeptides (SEQ ID NO: 2) or fragments thereof, wherein the ligand binding molecule is a polypeptide comprising one or more growth factors selected from the group consisting of human VEGF-C and human VEGF-D . The fragment contains at least VEGFR-3 sufficient to bind to the ligand and may comprise a complete receptor. ECD fragments are preferred. Preferred polypeptides have at least 80% identical amino acid sequences to their ligand binding fragments. Polypeptides that are more similar, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% Do. Also, fragments that are 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, and 75% are considered. A family of similar polypeptides may alternatively be defined by the ability to encode a polynucleotide that hybridizes to the complement of a nucleotide sequence corresponding to a cDNA sequence encoding a VEGFR-3 receptor.

As is known in the art, the term "identity" refers to the relationship between two or more polypeptide molecules or sequences of two or more nucleic acid molecules, as determined by comparing the sequences. In the art, "identity " also refers to the degree of sequence relatedness of a nucleic acid molecule or polypeptide sequence, as determined by a match between two or more nucleotides or strands of two or more amino acid sequences, as the case may be. "Identity" measures the percentage of identical matches between fewer of two or more sequences using gap alignment (if any) resolved by a particular mathematical model of the computer program (i.e., "algorithm"). Suitable algorithms for determining the percent identity of the present invention include BLASTP and BLASTN, with the most common and acceptable default parameters.

The ligand binding molecule may also be a ligand binding molecule that encodes a ligand binding fragment of VEGFR-3, with the proviso that the position of the ligand binding molecule corresponding to positions 104-106 of the encoded ligand binding fragment of VEGFR-3 is not identical to NXS or NXT Can be described as having an amino acid sequence encoded by a nucleic acid sequence at least 80% identical to the fragment of SEQ ID NO: 1. Polypeptides that are more similar, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% Do. Also, fragments that are 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, and 75% are considered. For example, a preferred ligand-binding molecule is an amino acid sequence encoded by a nucleotide sequence that hybridizes to the complement of SEQ ID NO: 1 under intermediate or very stringent conditions that bind human VEGF-C and / or human VEGF-D and discussed herein Sequence.

In some embodiments, the ligand binding molecule is selected from the group consisting of positions 1-226 or 25-226 of SEQ ID NO: 2 under the proviso that positions 104-106 of the encoded ligand binding fragment of VEGFR-3 are not identical to NXS or NXT 2 (SEQ ID NO: 2) selected from the group consisting of positions 1-229 or 25-229 of SEQ ID NO: 2 and positions 47-247 of SEQ ID NO: 2, and a fragment of human VEGFR- In some embodiments, the ligand-binding molecule comprises a sequence selected from the group consisting of positions 47-224 of SEQ ID NO: 2, SEQ ID NO: 2, SEQ ID NO: 2, SEQ ID NO: 2, position 47-226 of SEQ ID NO: 2, position 47-227 of SEQ ID NO: 2, position 47-228 of SEQ ID NO: 2, position 47-229 of SEQ ID NO: 2, SEQ ID NO: 2, position 47-231, position 47-231 of SEQ ID NO: 2, position 47-232 of SEQ ID NO: 2, position 47-236 of SEQ ID NO: 2, position 47-240 of SEQ ID NO: : 2 of position 47-247. ≪ RTI ID = 0.0 > (SEQ ID NO: 2) < / RTI > In some embodiments, the ligand-binding molecule comprises a sequence selected from the group consisting of positions 47-314 of SEQ ID NO: 2, SEQ ID NO: 2, and SEQ ID NO: 2, with the proviso that positions 104-106 of the encoded ligand-binding fragment of VEGFR-3 are not identical to NXS or NXT. 2 (SEQ ID NO: 2) selected from the group consisting of positions 47-210 of SEQ ID NO: 2, and positions 47-247 of SEQ ID NO: 2.

The ligand binding molecule may also be described as having an amino acid sequence similar or identical to the amino acid sequence set forth in SEQ ID NO: 3. A preferred polypeptide has an amino acid sequence at least 80% identical to the amino acid sequence set forth in SEQ ID NO: 3, with the proviso that positions 80-82 of the polypeptide shown in SEQ ID NO: 3 are not identical to NXS or NXT, The molecule binds to one or more growth factors selected from the group consisting of human VEGF-C and human VEGF-D. Polypeptides that are more similar, such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% Do. Also, fragments that are 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, and 75% are considered. A family of similar polypeptides may alternatively be defined by the ability to encode a polynucleotide that hybridizes to the complement of a nucleotide sequence corresponding to a cDNA sequence encoding a VEGFR-3 receptor.

In some embodiments, the ligand binding molecule comprises an amino acid sequence comprising amino acids 22-290 of SEQ ID NO: 3. In some embodiments, the ligand binding molecule comprises an amino acid sequence comprising amino acids 23-290 of SEQ ID NO: 3. In some embodiments, the ligand binding molecule comprises amino acids 22-537 of SEQ ID NO: 3, or amino acids 23-537 of SEQ ID NO: 3 or amino acids 1-537 of SEQ ID NO: 3.

The term "constituent domain" as used herein refers to a domain within or derived from a protein domain in the extracellular portion of the receptor protein. For example, each Ig-domain (D1-D7) of VEGFR-3 and other tyrosine kinase receptor member members (e.g., VEGFR-1 and VEGFR-2) constitute the component domain. References herein to the component domains include both fully natural wild-type domains and also insertions, deletions and / or substitution variants thereof that substantially retain the functional properties of the intact domain. It will be readily apparent to those skilled in the art that various variants of the domain (e. G., Ig-domain) that will have substantially the same functional properties as the wild-type domain can be obtained.

Growth factor receptors from which ligand binding molecules may be derived include splice variants and naturally occurring allelic variations. Allelic variants are well known in the art and represent alternative forms or nucleic acid sequences that do not result in any substantial functional alteration of the encoded polypeptide, including substitution, deletion or addition of one or more nucleotides. Exemplary allelic variants of VEGFR-3 have been reported in the literature, for example, http < colon > // www.uniprot.org/uniprot/P35916, which includes positions 149, 378, 494, 527, and 641 in the ECD . Standard methods involving site-directed mutagenesis of polynucleotides, or specific enzyme cleavage and ligation, can be readily used to generate the polypeptides. Similarly, the use of peptidomimetic compounds or compounds in which one or more amino acid residues are replaced by non-naturally occurring amino acids or amino acid analogs that retain binding activity is contemplated. Preferably, when an amino acid substitution is used, said substitution is conservative, i.e. one amino acid is replaced by an amino acid having similar size and similar charge characteristics. As used herein, the term "conservative substitution " refers to the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative substitutions include substitution of one hydrophobic residue such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine or methionine, Substitution of arginine with lysine, substitution of glutamic acid with aspartic acid, or substitution of glutamine with asparagine. The neutral hydrophilic amino acids that may be substituted for each other include asparagine, glutamine, serine, and threonine. The term " conservative substitution "also includes the use of substituted amino acids instead of the unsubstituted amino acids.

Alternatively conservative amino acids can be categorized as described in Lehninger, ( Biochemistry , Second Edition; Worth Publishers, Inc. NY: NY, pp. 71-77 (1975)

Non-polar (hydrophobic)

Aliphatic: A, L, I, V, P,

Aromatic: F, W,

Sulfur-containing: M,

Intermediate: G.

Vision - polarity

Hydroxyl: S, T, Y,

Amide: N, Q,

Sulfide drill: C,

Intermediate: G.

Positive charge (basic): K, R, H.

Negative Charge (Acid): D, E.

For the avoidance of doubt, the "constituent domain" includes the domain corresponding to D1 of VEGFR-3 mutated at the N-X-S / T sequencing motif at positions 104-106 of SEQ ID NO:

In embodiments where the ligand binding molecule comprises multiple component domains, such as component domains D1, D2, and D3 of VEGFR-3, the component domains may be directly connected to each other or may be connected through one or more spacers. In general, the term "spacer" means one or more molecules, such as nucleic acids or amino acids, or non-peptide moieties, such as polyethylene glycol or disulfide bridges, that can be inserted between one or more component domains that form a covalent bond it means. Spacer sequences can be used to provide desirable sites of interest between components for ease of manipulation. Spacers can also be used to enhance the expression of a ligand binding polypeptide from a host cell, such that the component or group of components take up the steric hindrance so as to take its optimal tertiary structure and / or properly interact with its / To be reduced. Methods for identifying spacers and preferred spacers are described, for example, in George et al. (2003) Protein Engineering 15: 871-879, which is expressly incorporated herein by reference. The spacer sequence may comprise one or more amino acids that are naturally linked to the receptor component, or may enhance the expression of the ligand binding polypeptide, provide the specific desired site of interest, cause the component domain to form an optimal tertiary structure / RTI &gt; and / or an additional sequence used to enhance the interaction of a component or group of components with its / its target molecule. In one embodiment, the spacer comprises at least one peptide sequence between one or more moieties, which is 1-100 amino acids, preferably 1-50 amino acids in length. In a preferred embodiment, the spacer between two component domains consists essentially of an amino acid that is naturally associated with a receptor component in the wild type receptor. For example, in the case of a ligand binding molecule comprising a plurality of component domains from the same receptor, wherein the domains are adjacent to one another in a natural receptor, such as D3 of D1, D2 and VEGFR-3, Are linked to each other (e.g. from D1 to D2 and from D2 to D3) using spacers corresponding to the naturally occurring amino acid linkage sequence.

In some variations, each ligand binding polypeptide is expressed as a fusion with a fusion partner protein, such as an immunoglobulin constant region, and the heterologous fusion partner is joined to form a ligand binding molecule.

Multimerization, multimerizing components, fusion partners and linkers

The fusion partner is any heterogeneous component that enhances the functionality of the ligand binding molecule. Thus, for example, fusion partners can increase the solubility of the ligand binding polypeptides, control the elimination, facilitate targeting of specific cell or tissue types, enhance biological activity, facilitate production and / or recovery , Improve pharmacological properties, or improve the PK profile. With respect to improving the PK profile, this can be achieved, for example, by improving the serum half-life, tissue permeability, immunogenicity or lack of stability of the ligand binding molecule. In a preferred embodiment, the fusion partner is selected from the group consisting of a polychromatic component, a serum protein or a molecule capable of binding to a serum protein

When the fusion partner is a serum protein or a fragment thereof, it may be an alpha-1-microglobulin, an AGP-1, an orosomucoid, an alpha 1-acid glycoprotein, a vitamin D binding protein (DBP) Human serum albumin (hSA), transferrin, ferritin, afamin, haptoglobin,? -Fetoprotein thyroglobulin,? -2-HS glycoprotein,? -2- glycoprotein, hyaluronan- , C1R, C1qa chain, galectin 3-Mac2 binding protein, fibrinogen, polymeric Ig receptor (PIGR), alpha-2-macroglobulin, urea transfer protein, haptoglobin, IGFBP, macrophage cabin receptor, , Antithrombin III, apolipoprotein A-1, apolipoprotein B, beta-2-microglobulin, ceruloplasmin, complement, alpha-1-antitrypsin Component C3 or C4, CI esterase inhibitor, C-reactive protein, cystatin C, and protein C Is selected from the genus group. In a more specific embodiment, the fusion partner is selected from the group consisting of alpha-1-microglobulin, AGP-1, orosomucoid, alpha-1-acid glycoprotein, vitamin D binding protein (DBP), hemopectin, human serum albumin ), Apamin, and haptoglobin. The inclusion of the fusion partner component can, if desired, extend the serum half-life of the fusion polypeptides of the invention. For example, in the case of serum albumin fusion polypeptides, U. S. Pat. 6,423,512, 5,876,969, 6,593,295, and 6,548,653. hSA is widely distributed throughout the body, particularly intestinal and blood components, and plays an important role in maintaining osmolality and plasma volume. It is slowly cleared in the liver, typically in the human 14-20 day in vivo (Waldmann et al. (1977) Albumin, Structure Function and Uses; Pergamon Press; pp. 255-275).

When the fusion partner is a molecule capable of binding to a serum protein, the molecule may be a nucleic acid, peptide, or oligosaccharide comprising a synthetic nucleic acid such as synthetic small molecule, lipid or liposome, aptamer. The molecule may further be a protein such as, for example, Fc [gamma] Rl, Fc [gamma] R2, Fc [gamma] R3, Polymeric Ig Receptor (PIGR), ScFv, and other antibody fragments specific for serum proteins.

When the fusion partner is a poly-ligation component, it may be operatively linked to another ligand-binding molecule or another poly-lysing component of another ligand-binding molecule to form a higher-order structure, such as a dimer, trimer, Etc. Suitable polylactide components include leucine zipper comprising a leucine zipper domain derived from c-jun or c-fos; A sequence derived from the constant region of kappa or lambda light chain; (Muller et al. (1998) FEBS Lett. 432: 45-49), coil-coil motifs, or other commonly accepted polynucleotide domains known in the art, such as helical-coil-spiral motifs have. In some embodiments, the fusion component comprises, for example, an immunoglobulin-derived domain from human IgG, IgM or IgA.

In one aspect, the ligand binding molecules described herein are produced as polynucleotides. Each subunit of the multimer comprises or consists of a ligand binding molecule, for example, a ligand binding polypeptide. Such a multimer may be a homozygous, heterozygous or multimeric soluble receptor, wherein the multiphosphogenic receptor comprises no more than 9 subunits, preferably no more than 6 subunits, more preferably no more than 3 Subunit, and most preferably two subunits. Preferably, these poly-somatically soluble receptors are homodimers of ligand-binding molecules.

At least two sub-units within the complex are operably connected to each other. The term "operably linked" indicates that the subunit is associated through a shared and / or non-shared association. The subunits can be covalently linked by any suitable means, for example, through linkers such as cross-linking reagents or polypeptide or peptide linkers. In another embodiment, the subunits are combined via a non-shared connection. In some variations, the two subunits (e. G., Two ligand binding polypeptides) are attached by peptide linkage either directly or through a "peptide linker ". The peptide linker is less than or greater than the length of the amino acid residues introduced between the subunits (preferably consisting of small amino acids such as glycine, serine, threonine or alanine), such as 13, 15 Or 16 amino acid residues in length. Preferably, the peptide linker is an immunologically inactive peptide. Gly-Leu-Val-Leu-Gly-Gly-Gln-Phe-Met (SEQ ID NO: 7) of a sequence EFM (Glu-Phe-Met), such as Glu-Phe-Gly-Ala-Gly- ), A 15-amino acid linker sequence consisting of (G4S) 3 (SEQ ID NO: 8), a 16-amino acid linker sequence consisting of GGSGG SGGGG SGGGG S , IgG2, IgG3, or IgG4). In some variations, the two subunits are ligand binding polypeptides comprising two distinct polypeptide chains, for example, disulfide bonds or other bonds joined together.

In some embodiments, the ligand binding molecule is in the form of a fusion protein comprising at least two subunits each comprising a ligand binding polypeptide. In this way, the fusion protein can be produced recombinantly by direct expression of the nucleic acid molecule encoding the fusion protein as a single open reading frame in the host cell.

In some variations, the ligand binding polypeptide is expressed as a fusion with a heterologous protein fusion partner, such as an immunoglobulin constant region, and the heterologous fusion partner is joined to form a polyhedral ligand binding molecule. In one embodiment, the subunit is operatively linked to the multimerization component. The multimerization component includes any natural or synthetic sequence capable of operably linking two or more subunits to form a higher order structure, e. G., Dimers, trimesters, and the like. The multiplexing component may operatively couple two or more subunits by interacting "directly" with the subunit. Alternatively, the multiplexing component for one subunit may interact with another multiplexing component for another subunit to operatively connect the subunit.

In one embodiment, the subunit is operatively linked to an additional amino acid domain that provides for the multipleization of the subunit (in particular, the additional domain includes any functional region that provides dimerization of the subunit do). The term "operably linked" refers to a VEGFR-3 -based subunit, and the additional amino acid domain is associated directly or through a peptide linkage through a "peptide linker" (as described herein) VEGFR-3-based subunit retains ligand binding properties. The additional amino acid domain may be upstream (N-ter) or downstream (C-ter) from the VEGFR-3 subunit sequence. Preferably it is located downstream (i.e. away from the first immunoglobulin-like domain (Ig-I domain)). In this manner, the fusion protein can be produced recombinantly by direct expression in the host cell of the nucleic acid molecule encoding it. In such embodiments, the ligand binding molecules described herein may be conjugated to a ligand binding polypeptide and a fusion protein comprising a multimerization component capable of interacting with a multimerization component present in another fusion protein to form a higher order structure, such as a duplex It is a combination. This type of fusion protein can be prepared by operably linking a VEGFR-3 subunit sequence (i. E., A ligand binding polypeptide) to an isolated domain from another protein to form a dimer, trimer, etc. Examples of protein sequences that allow for the multiplexing of the ligand polypeptides described herein include, but are not limited to, immunoglobulins, hCG (WO 97/30161), collagen X (WO 04/33486), C4BP WO 04/20639), Erb proteins (WO 98/02540) or coiled coil peptides (WO 01/00814), the disclosure of which is incorporated by reference in its entirety Are incorporated herein by reference.

The polychromatic component may be selected, for example, from (i) an amino acid sequence of 1 to about 500 amino acids in length, (ii) a leucine zipper, (iii) a helical ring motif, and (iv) a coil-coil motif. If the polymering component comprises an amino acid sequence from 1 to about 500 amino acids in length, the sequence will form a disulfide bond with the corresponding cysteine residue on another fusion polypeptide comprising a poly-syntizing moiety having at least one cysteine residue Lt; RTI ID = 0.0 &gt; cysteine &lt; / RTI &gt;

In particular aspects, the multimer is a dimer of a ligand binding polypeptide, wherein the polypeptide is operably linked to an immunoglobulin or portion of an immunoglobulin as a fusion partner, which may also act as a multimerization component. The term "operably linked" means that the ligand binding polypeptide and the immunoglobulin or portion thereof are associated either directly or via a "peptide linker" (as defined herein) via a peptide linkage and the ligand binding polypeptide Ligand binding property is retained. In such embodiments, the ligand binding polypeptide is operably linked to all or part of an immunoglobulin, particularly a human immunoglobulin, even more particularly an Fc portion of a human immunoglobulin. Typically, the Fc portion of a human immunoglobulin contains two constant region domains (CH2 and CH3 domains) and a hinge region but lacks a variable region. Such immunoglobulins include any of the major families of immunoglobulins including IgA, IgD, IgE, IgG, and IgM, as well as any sub-series (see, for example, Or isotype, such as IgG1, IgG2, IgG3 and IgG4; IgA-I and IgA-2. In one embodiment, the Fc moiety is a moiety of human IgG4, which is stable in solution and has little or no complement activation activity. In another embodiment, the Fc moiety is a moiety of human IgG1. The Fc portion may be mutated to prevent unwanted activity such as complement binding, binding to Fc receptors, and the like. An amino acid sequence derived from an immunoglobulin can be linked to the C-terminal or N-terminal, preferably C-terminal, of the ligand binding polypeptide. Such fusion proteins can be prepared by transfecting a cell with DNA encoding a VEGFR-3 subunit: Fc fusion protein and expressing the dimer in the cell. In certain embodiments, the ligand binding polypeptides are identical on each monomer subunit (i. E., The dimer is a homodimer). Methods for producing immunoglobulin fusion proteins are described, for example, in Hollenbaugh and Aruffo ("Construction of Immunoglobulin Fusion Proteins", in Current Protocols in Immunology, Suppl. 4, pages 10.19.1-10.19. 11, 1992) or as described in WO 01/03737, which is well known in the art.

Alternatively, a dimer of the ligand binding polypeptide of the invention may be operably linked to the constant region of the immunoglobulin heavy chain and another ligand binding polypeptide operably linked to the constant region of the immunoglobulin light chain And the like. For example, a ligand binding polypeptide can be operably linked to the CH1-hinge-CH2-CH3 region of human IgG1, and another or the same ligand binding polypeptide can be operably linked to the C-kappa region of the Ig kappa light chain have. In one embodiment, the heavy chain constant chain is human y4, which is stable in solution and has little or no complement activation activity. In another embodiment, the heavy chain constant chain is human yl. The heavy chain constant chain may be mutated to prevent unwanted activity such as complement binding, binding to Fc receptors, and the like.

In addition, if desired, the fusion proteins described herein may comprise any functional region that facilitates purification or production. Specific examples of such additional amino acid sequences include the GST sequence or the His tag sequence. In some variations, the area facilitating the purification is removed for formulation of the composition for pharmaceutical use.

An amino acid sequence derived from an immunoglobulin can be linked to the C-terminal or N-terminal, preferably C-terminal, of the ligand binding polypeptide. The cells transfected with the DNA encoding the immunoglobulin light chain fusion protein and the immunoglobulin heavy chain fusion protein each express a heavy chain / light chain heterodimer containing a ligand binding polypeptide. Both ligand-binding polypeptides advantageously include a natural or heterologous signal peptide when initially synthesized to facilitate secretion from the cell, but the signal sequence is cleaved upon secretion. Variations of any of the above-described embodiments involving the signal peptide are contemplated. The native signal peptide of human VEGFR-3 comprises residues 1-24 of SEQ ID NO: 2. Many other signal peptide proteins are taught in the literature.

In another particular aspect of the invention, the ligand binding polypeptides of the polymodal are bound through non-covalent linkages. The non-covalent association of the subunit may be achieved by any suitable means that does not interfere with its biological activity (i.e., the ability to bind human VEGF-C and / or VEGF-D). In particular aspects, these polymorphs are dimers of a ligand binding polypeptide, wherein one ligand binding polypeptide is operably linked to a first compound and another or the same ligand binding polypeptide is non-covalently bound to the first compound And is operably linked to a second compound. Examples of such compounds are biotin and avidin. The dimer of the ligand binding polypeptide may be prepared by operatively linking one VEGFR-3 subunit to biotin and operably linking another ligand binding polypeptide to avidin. Thus, the receptor is formed through non-covalent interaction of biotin with avidin. Other examples include subunits of heterodimeric protein sex hormones. In these embodiments, a DNA construct encoding one ligand binding protein is fused to a DNA construct encoding a heterodimeric proteinaceous hormone, e. G., A subunit of hCG, and a DNA construct that encodes another ligand binding polypeptide Is fused to DNA encoding other heterologous subunits of this heterodimeric protein sex hormone, such as hCG (as disclosed in US 6,193,972). Since each co-expressed sequence contains the corresponding hormone subunit to form a heterodimer upon expression, such DNA construct is co-expressed in the same cell resulting in the expression of the ligand binding molecule. The amino acid sequence derived from the heterodimeric proteinaceous hormone may be linked to the C-terminal or N-terminal, preferably C-terminal, of the ligand binding polypeptide. Both subunits advantageously contain a natural or heterologous signal peptide when initially synthesized to facilitate secretion from the cell, but the signal sequence is cleaved upon secretion.

In one embodiment, the ligand binding molecule is operably linked to a binding unit that does not contain a binding domain derived from a non-VEGFR-3, i.e., a component domain derived from VEGFR-3. Such chimeric ligand binding molecules may include, for example, heterobody binding units based on other tyrosine kinase receptors. In one embodiment, such a heterologous binding unit binds to at least one ligand polypeptide selected from VEGF-A (VEGF), VEGF-B, PlGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D. In a preferred embodiment, such a heterobifunctional unit binds at least to VEGF-A (VEGF).

In one embodiment, such heterobinding unit comprises a component domain derived from VEGFR-1 or VEGFR-2, or both. Examples of heterobifunctional units that can be used in combination with the ligand binding molecules of the present invention in the form of chimeric ligand binding molecules are described, for example, in WO 2000/75319, WO 2005/000895 and WO 2006/088650 VEGF-trap &lt; / RTI &gt; Preferred heterobifunctional units include Ig-domain 2 from VEGFR-1 (R1D2) and Ig-domain 3 from VEGFR-2 (R2D3), optionally immunoglobulin fused to the Fc portion. In one embodiment, a chimeric molecule comprising a ligand binding polypeptide of the invention linked to the Fc portion of an immunoglobulin operably linked to an R1D2R2D3 binding unit fused to the Fc portion of an immunoglobulin is contemplated. The two binding units are operatively linked through a disulfide bond between the two Fc moieties.

Linker

The Ig-like domains of human VEGFR-3 can be attached directly to one another (via peptides, disulfides or other types of covalent bonds) or Ig-like domains of other receptors, but the ligand binding molecules described herein can optionally have two or more (E. G., One or more) linking the different binding units together, e . G., A VEGFR-3 ECD fragment to another VEGFR-3 ECD fragment, or even a copy thereof. The linker may also link one binding unit to the other substituents described herein. In some embodiments, the linker comprises a heterologous polypeptide. For example, in some embodiments, the linker comprises a peptide linking the binding units to form a single continuous peptide that can be expressed as a single ligand binding molecule. The linker may be selected to have a low likelihood of causing an allergic reaction. Polysaccharides or other moieties may also be used to link the binding units to form the ligand binding molecule.

More than one linker per ligand binding molecule may be used. The linker is capable of interacting with a variety of ligand binding units if desired to form an optimal morphology between the various ligand binding units to form, for example , a dimer, or to allow various ligand binding units to interact with the ligand. It can be chosen for freedom. The linker may be linear so that successive binding units are connected in series, or the linker may act as a backbone to which various binding units are attached, for example , as a branched linker. Linkers are also described, for example , in Tam, J. Immunol. Methods 196: 17 (1996). Bonding units may be attached to each other or to the linker framework via N-terminal amino groups, C-terminal carboxyl groups, side chains, chemically modified groups, side chains, or other means.

Linker peptides can be designed to have sequences that allow for the desired characteristics. For example, the use of glycyl residues allows relatively large morphological degrees of freedom, while proline is likely to have the opposite effect. Peptide linkers can be selected to achieve specific secondary and tertiary structures, such as alpha helices, beta sheets or beta barrels. A quaternary structure can also be used to make the linker non-covalently link two linking units. For example, fusing a protein domain having a hydrophobic surface to each binding unit may enable the linking of two binding units through an interaction between the hydrophobic interactions of the two molecules. In some implementations, the linker may provide polarity interaction. For example, the leucine zipper domains of the proto-oncoprotein Myc and Max can be used, respectively. Luscher and Larsson, Ongogene 18: 2955-2966 (1999). In some embodiments, the linker enables the formation of a salt bridge or a disulfide bond. Linkers may include non-natural amino acids, as well as natural amino acids that are not naturally incorporated into the polypeptide. In some embodiments, the linker comprises a coordination complex between a metal or other ion and the various moieties from a plurality of peptides linked thereby.

A linear peptide linker of at least one amino acid residue is contemplated. In some embodiments, the linker has more than 10,000 residues. In some embodiments, the linker has 1-10,000 residues, 1-1000 residues, 1-100 residues, 1-50 residues, or 1-10 residues. In some embodiments, the linear peptide linker comprises a moiety having a relatively inert side chain. The peptide linker amino acid residues do not need to be linked all or in all through the alpha-carboxy and alpha-amino groups. That is, peptides can be linked through the side chain groups of the various moieties.

The linker may affect whether the linker is capable of fusing the fused polypeptide (s) to each other or to another polypeptide. The linker has many functions. Natural receptor monomers confined to approximately two-dimensional planes of the cell membrane have relatively high local concentrations and increase the likelihood of finding partners in the availability of co-receptors (binding units). Free receptors in solutions lacking such an advantage can be aided by linkers that increase the effective concentration of the monomer.

In some embodiments, the ligand binding molecule may comprise more than one type of linker. Suitable linkers may also include the chemical modifications discussed above.

The ligand binding molecules described herein may include additional N-terminal amino acid residues, preferably methionine. Indeed, depending on the expression system and conditions, the polypeptide may be expressed in the recombinant host cell with a starting methionine. These additional amino acids can then be retained in the resulting recombinant protein or can be removed by an exopeptidase such as methionine amino peptidase according to the methods described in the literature (Van Valkenburgh HA and Kahn RA, Methods Enzymol. (2002) 344: 186-93; Ben-Bassate, Bioprocess Technol. (1991) 12: 147-59).

Substituents and other chemical modifications

The ligand binding molecules described herein are optionally chemically modified using a variety of substituents. Such modifications preferably do not substantially reduce the growth factor binding affinity or specificity of the ligand binding molecule. Rather, the chemical modifications impart additional desirable characteristics as discussed herein. Chemical modifications may take many different forms, such as heterologous peptides, polysaccharides, lipids, radioactive isotopes, non-standard amino acid residues and nucleic acids, metal chelates, and various toxins.

The receptor fragment (or "binding unit" or "component domain") and ligand binding molecules described herein may be selectively fused to heterologous fusion partners such as heterologous polypeptides to provide a variety of properties, such as increased solubility, Or targeting of the tissue type. In some embodiments, the receptor fragment is linked to the Fc domain of an IgG or other immunoglobulin. In some embodiments, the receptor fragment is fused to an alkaline phosphatase (AP). Methods for preparing Fc or AP fusion constructs are identified in WO 02/060950. By conjugating the ligand binding polypeptide or molecule with a protein domain having specific properties ( e.g., half life, bioavailability, interaction partners), these properties can be imparted to the ligand binding molecule ( e.g. , Distribution or specific biological half-life). In some embodiments, the ligand binding molecule comprises a co-receptor and a VEGFR fragment.

Certain fusion partners (e. G., Heterologous polypeptides) used in a particular ligand binding molecule may affect whether the VEGR-3 fragment will become dimerized and eventually affect ligand binding.

In the case of a substituent such as the Fc region of human IgG, the fusion may be fused directly to the ligand binding molecule or may be fused via an intervening sequence. For example, the human IgG hinge, CH2 and CH3 regions can be fused to either the N-terminal or the C-terminal of the ligand binding molecule to attach the Fc region. The resulting Fc-fusion construct enables purification via a protein A affinity column (Pierce, Rockford, Ill.). Peptides and proteins fused to the Fc region are substantially larger than in the unfused counterpart in vivo And can exhibit half-life. Fusion to the Fc region allows dimerization / polymorphization of the fusion polypeptide. The Fc region may be a naturally occurring Fc region, or may be modified for better characteristics, such as therapeutic quality, circulation time, reduced aggregation.

Polypeptides may be modified by, for example, glycation, amidation, carboxylation, or phosphorylation, or by the formation of acid addition salts, amides, esters, particularly C-terminal esters, and N-acyl derivatives. The Ig-like domain I-III of VEGFR-3 contains 5 putative N-glycosylation sites (referred to as N1, N2, N3, N4 and N5 sequences or regions of VEGFR-3, respectively). N1 corresponds to amino acids 33-35 of SEQ ID NO: 2; N2 corresponds to amino acids 104-106 of SEQ ID NO: 2; N3 corresponds to amino acids 166-168 of SEQ ID NO: 2; N4 corresponds to amino acids 251-253 of SEQ ID NO: 2 and N5 corresponds to positions 299-301 of SEQ ID NO: 2. In some embodiments, the ligand binding molecule described herein comprises a modification in the N2 region of the molecule. For example, in some embodiments, the amino acid in the ligand binding molecule corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with another amino acid. Conservative substitutions are preferred. In some embodiments, the amino acid corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced by an amino acid selected from the group consisting of glutamine, aspartate, glutamate, arginine, and lysine. In another variation, position 106 is substituted to remove the N2 sequence. In an embodiment wherein the N2 sequence of SEQ ID NO: 2 is modified as described above, the N1, N3, N4 and N5 sequences of SEQ ID NO: 2 are preferably not modified.

The protein may also be modified to produce a peptide derivative by forming a covalent or noncovalent complex with another moiety. Covalently bonded complexes can be prepared by linking the chemical moiety to a functional group on the side chain of the amino acid of the polypeptide, or a functional group at the N- or C-terminus.

Polypeptides may be conjugated to a reporter group, including, but not limited to, radioactive labels, fluorescent labels, enzymes ( such as enzymes that catalyze a calorimetry or fluorescence measurement reaction), a substrate, a solid matrix, or a carrier such as biotin or avidin Can be bonded. Examples of analogs are described in WO 98/28621 and Olofsson, et al . , Proc . Nat'l . Acad . Sci . USA , 95: 11709-11714 (1998), U.S. Pat. Nos. 5,512,545 and 5,474,982; U.S. Patent Application Nos. 20020164687 and 20020164710.

Cysteinyl moieties are most commonly reacted with haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to produce carboxymethyl or carbothiamidomethyl derivatives. The cysteinyl moieties may also be substituted with at least one of bromotrifluoroacetone, alpha -bromo- (5-imidazolyl) propionic acid, chloroacetyl phosphate, N-alkylmaleimide, 3-nitro- 4-nitrophenol, orthochloro-7-nitrobenzo-2-oxa-1,3-diazole in the presence of a base such as triethylamine or triethylamine.

Histidyl residues are derivatized by reaction with diethyl carbonate at pH 5.5-7.0, since this agent is relatively specific to the histidyl side chain. Para-bromophenacyl bromide is also useful, and the reaction is preferably carried out in 0.1M sodium chocodilate at pH 6.0.

The lysinyl and amino terminal moieties react with succinic or carboxylic acid anhydrides. Derivatization with these agents has the effect of reversing the charge of the lysine residues. Other suitable reagents for derivatizing the [alpha] -amino-containing moiety include imidoesters such as methyl picolinimidate; Pyridoxal phosphate; Pyridoxal; Chloroborohydride; Trinitrobenzenesulfonic acid; O-methylisourea; 2,4 pentanedione; And an amino-transferase catalyzed reaction using glyoxylate.

Arginine residues are modified by reaction with one or several conventional reagents, especially phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin. The derivatization of the arginine residue requires that the reaction be carried out under alkaline conditions due to the high pH of the guanidine functional group. Moreover, these reagents can react with arginine epsilon-amino groups as well as lysine groups.

Certain modifications of the tyrosyl residues themselves have been extensively studied and are of particular interest in introducing spectroscopic labels into the tyrosyl residues by reaction with aromatic diazonium compounds or tetranitromethane. Most commonly, N-acetylimidizole and tetranitromethane are used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively. The tyrosyl residue is iodinated using 125I or 131I to produce a labeled protein for use in radioimmunoassay.

Carboxylic side groups (aspartyl or glutamyl) are carbodiimides (R1) such as 1-cyclohexyl-3- (2-morpholinyl- (4-ethyl) carbodiimide or 1-ethyl- 4,4-dimethylpentyl) carbodiimide. Furthermore, aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.

Derivatization with a bi-functional agent is useful for cross-linking the ligand binding molecule to a water insoluble support matrix. Such derivatization can provide a linker capable of linking adjacent binding elements, or binding elements, within the ligand binding molecule to a heterologous peptide, such as an Fc fragment. Commonly used cross-linking agents are, for example , 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters such as, for example, Esters, homo-bifunctional imido esters including di-succinimidyl esters such as 3,3'-dithiobis (succinimidyl propionate) and bifunctional maleimides such as bis-N-maleimido- Octane. Derivatizing agents, such as methyl-3 - [(p-azidophenyl) dithio] propioimidate, produce a photoactivatable intermediate capable of forming cross-linking in the presence of light. Alternatively, cyanogen bromide-activated carbohydrates and U.S. Patent No. 3,969,287, incorporated herein by reference; 3,691, 016; 4,195,128; 4,247,642; 4,229,537; And a reactive water-insoluble matrix, such as the reactive substrate described in U. S. Pat. No. 4,330,440, are used for protein immobilization.

The glutaminyl and asparaginyl residues are often deamidated with the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Any one of these moieties is within the scope of the present invention.

Other modifications include hydroxylation of proline and lysine, phosphorylation of the hydroxyl group of the seryl or threonyl moiety, methylation of the a-amino group of lysine, arginine, and histidine side chains (TE Creighton, Proteins: Structure and Molecule Properties , WH Freeman & Co., San Francisco, pp. 79-86, 1983), acetylation of the N-terminal amine and, in some cases, amidation of the C-terminal carboxyl group. Such derivatives are chemically modified polypeptide compositions in which the ligand-binding molecule polypeptide is linked to a polymer. The selected polymer is typically water soluble so that the protein to which the polymer is attached is not precipitated in an aqueous environment, such as a physiological environment. The selected polymer is generally modified to have a single reactive group, such as an active ester for acylation or an aldehyde for alkylation, so that the degree of polymerization can be controlled when provided for the process of the present invention. The polymer may be of any molecular weight and may be branched or unbranched. A mixture of polymers is included within the scope of the ligand-binding molecule polypeptide polymer. Preferably, for therapeutic use of the final-product formulation, the polymer will be pharmaceutically acceptable.

Each of the polymers may be of any molecular weight and may be branched or unbranched. Each of the polymers typically has an average molecular weight of from about 2 kDa to about 100 kDa (the term " about "indicates that, in the preparation of a water soluble polymer, some molecules are heavier or slightly lighter than the molecular weights mentioned above). The average molecular weight of each polymer is from about 5 kDa to about 50 kDa, more preferably from about 12 kDa to about 40 kDa, and most preferably from about 20 kDa to about 35 kDa.

Suitable water-soluble polymers or mixtures thereof include, but are not limited to, N-linked or O-linked carbohydrates, sugars, phosphates, carbohydrates; Party; phosphate; Including the form of PEG which has been used to derivatize a protein, including polyethylene glycol (PEG) (mono- (C1-C10) alkoxy- or aryloxy-polyethylene glycol); Monomethoxy-polyethylene glycol; Dextran (e.g., a low molecular weight dextran of about 6 kD), cellulose; cellulose; But are not limited to, other carbohydrate-based polymers, poly- (N-vinylpyrrolidone) polyethylene glycols, propylene glycol homopolymers, polypropylene oxide / ethylene oxide co-polymers, polyoxyethylated polyols such as glycerol, . Bifunctional cross-linking molecules which can also be used to prepare covalently attached polyols are encompassed by the present invention.

In general, chemical derivatization can be performed under any suitable conditions used to react the protein with the activated polymer molecule. The method for producing a chemical derivative of a polypeptide generally comprises: (a) contacting the activated polymer molecule (the reactive ester or aldehyde derivative of the polymer molecule) with the polypeptide under conditions that the ligand binding molecule is attached to the at least one polymer molecule, , And (b) obtaining the reaction product (s). The optimal reaction conditions will be determined based on known parameters and desired results. For example, the larger the proportion of polymer molecule: protein, the larger the amount of polymer molecule attached. In one embodiment, the ligand-binding molecule polypeptide derivative may have a single polymer molecule moiety at the amino terminus. (See, for example , U.S. Patent No. 5,234,784).

A particularly preferred water-soluble polymer for use herein is polyethylene glycol (PEG). As used herein, polyethylene glycol is meant to encompass any of the forms of PEG that can be used to derivatize other proteins such as mono- (C1-C10) alkoxy- or aryloxy-polyethylene glycol. PEG is a linear or branched neutral polyether, available in a wide range of molecular weights, and is soluble in water and most organic solvents. PEG, when present in water, is effective in eliminating other polymers or peptides, primarily through its active chain mobility and hydrophilic properties, to produce water shells or hydration spheres when attached to other protein or polymer surfaces. PEG is non-toxic, non-immunogenic and approved by the US Food and Drug Administration for in vivo consumption.

Proteins or enzymes conjugated to PEG have demonstrated biological activity, non-antigenic properties, and reduced erasure rate when administered to animals. Veronese FM, etc., Preparation and Properties of Monomethoxypoly (ethylene glycol) -modified Enzymes for Therapeutic Applications, in JM Harris ed, Poly (Ethylene Glycol) Chemistry -. Biotechnical and Biomedical Applications, 127-36, 1992, incorporated herein by reference . This phenomenon is due to the exclusion of PEG in preventing recognition by the immune system. PEG has also been widely used in surface modification processes to reduce protein adsorption and improve blood compatibility. SW Kim et al . , Ann. NY . Acad . Sci . 516: 116-30 1987; Jacobs et al . , Artif . Organs 12: 500-501, 1988; Park et al . , J. Poly. Sci. , Part A 29: 1725-31, 1991, incorporated herein by reference. Hydrophobic polymer surfaces, such as polyurethanes and polystyrenes, can be modified by grafting of PEG (MW 3,400) and used as anti-thrombogenic surfaces. The surface properties (contact angle) can be better matched to the hydrophilic surface due to the hydration effect of the PEG. More importantly, the adsorption of proteins (albumin and other plasma proteins) can be greatly reduced, resulting from the high chain mobility, hydration sphere, and protein excretion characteristics of PEG.

PEG (MW 3,400) was determined as the optimal size in surface immobilization studies, while Park et al . , J. Biomed . Mat. Res. 26: 739-45, 1992, PEG (MW 5,000) was most beneficial in reducing protein antigenicity. (FM Veronese et al., In JM Harris, et al., Poly (Ethylene Glycol) Chemistry - Biotechnical and Biomedical Applications , 127-36.

The method of preparing a pegylated ligand binding molecule generally comprises the steps of (a) reacting said polypeptide with polyethylene glycol (e.g., a reactive ester or aldehyde derivative of PEG) under conditions wherein said ligand molecule is attached to one or more PEG groups And (b) obtaining the reaction product (s). In general, the optimum reaction conditions for the acylation reaction will be determined based on known parameters and the desired result. For example, the greater the ratio of PEG: protein, the greater the percentage of poly-pegylated product. In some embodiments, the ligand binding molecule will have a single PEG moiety at the N-terminus. See U.S. Patent No. 8,234,784, incorporated herein by reference. In some embodiments, the ligand binding molecules described herein optionally comprise at least one PEG moiety attached to the molecule. For example, in some embodiments, about 20-40 kDa PEG is attached to the amino terminus of the ligand binding molecule.

The derivatized ligand binding molecules disclosed herein may have additional activity, increased or decreased biological activity, or other characteristics, such as increased or decreased half-life compared to non-derivatized molecules.

Polynucleotides encoding the ligand binding molecules and expression systems

The present invention includes not only the ligand binding molecules, binding units, and polypeptides described herein but also nucleic acids encoding the molecules, vectors comprising the molecules, and host cells comprising the vectors. Methods using any of the above molecules, units, polypeptides, nucleic acids, vectors and host cells are all considered aspects of the present invention.

An exemplary human VEGFR-3 coding sequence is shown in SEQ ID NO: 1 and a fragment of SEQ ID NO: 1 (modified in the N2 sequence) is considered a coding sequence for the ligand binding polypeptides described herein. (For example, fragments encoding all or part of the VEGFR-3 ECD are considered.) Due to well-known degeneracy of the genetic code, many equivalent coding sequences for any polypeptide-encoding sequence are possible And all such equivalents are considered as aspects of the present invention.

Moreover, as noted above, when amino acid sequence variations from the VEGFR-3 wild-type ECD are considered, nucleic acid sequence variations are also contemplated. The nucleic acid sequence variation may be characterized by a contrast percent identity (e.g., at least 80, 85, 90, 92, 93, 94, 95, 96, 97, 98, or 99% identity) to SEQ ID NO:

The nucleotide sequence variation may also be characterized by the ability to hybridize to the complement of the desired coding sequence. The nucleic acid molecule may be an ECD-encoding sequence of a nucleic acid molecule as set forth in SEQ ID NO: 1, or an ECD-encoding sequence of a molecule encoding a polypeptide comprising a receptor tyrosine kinase amino acid sequence as set forth in SEQ ID NOs: 2 and 3, Or an ECD-encoding sequence of a nucleic acid fragment encoding a polypeptide as described herein, or a nucleotide that hybridizes under stringent conditions of intermediate or higher stringency as defined herein, do.

The term "high stringency conditions" refers to conditions designed to allow hybridization of highly complementary strands of DNA, and to exclude hybridization of significantly mismatched DNAs. Hybridization severity is mainly determined by the temperature, the ionic strength, and the concentration of the denaturant such as formamide. Examples of "high stringency conditions" for hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at 65-68 ° C. Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, NY 1989); And Anderson et al., Nucleic Acid Hybridization: a Practical Approach, Ch. 4, IRL Press Limited (Oxford, England). Limited, Oxford, England]. Other agents may be included in the hybridization and wash buffer to reduce non-specific and / or background hybridization. Examples are 0.1% bovine serum albumin, 0.1% polyvinyl-pyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium dodecyl sulfate (NaDodSO ₄ Or SDS), Ficoll, dendritic solution, sonicated salmon sperm DNA (or other non-complementary DNA), and dextran sulfate, and other suitable agents may also be used. The concentration and type of these additives may be varied without substantially affecting the stringency of the hybridization conditions. Hybridization experiments can generally be performed at pH 6.8-7.4; At typical ionic strength conditions, the hybridization rate is almost independent of pH. Nucleic Acid Hybridization: a Practical Approach, Ch. 4, IRL Press Limited (Oxford, England).

Factors affecting the stability of the DNA duplex include base composition, length, and base pair mismatch. Hybridization conditions may be adjusted by one skilled in the art to accommodate these variables and to allow DNAs with different sequence associations to form the hybrid. The melting temperature of a perfectly matched DNA duplex can be estimated by the following equation:

Tm (C) = 81.5 + 16.6 (log [Na +]) + 0.41 (% G + C) - 600 / N - 0.72 (% formamide)

Where Na is the length of the formed duplex, [Na +] is the molar concentration of sodium ions in the hybridization or washing solution, and% G + C is the percentage of (guanine + cytosine) base in the hybrid. For incompletely matched hybrids, the melt temperature is reduced by approximately 1 &lt; 0 &gt; C for each 1% mismatch.

The term "intermediate" stringent conditions "refers to conditions under which DNA duplexes with greater degree of base pair mismatches than can occur under" high stringency conditions " 0.015 M sodium chloride, 0.0015 M sodium citrate or 0.015 M sodium chloride at 37-50 ° C, 0.0015 M sodium citrate and 20% formamide For example, a "medium stringent" condition at 50 ° C in 0.015 M sodium ion It will allow about 21% mismatch.

A good estimate of the melting temperature at 1 M NaCl ^* for oligonucleotide probes up to about 20 nt is given by:

Tm = 2 ° C per A-T base pair + 4 ° C per G-C base pair

^* The sodium ion concentration in 6x sodium citrate (SSC) is 1 M. Suggs et al., Developmental Biology Using Purified Genes, p. 683, Brown and Fox (eds.) (1981).

High stringency wash conditions for oligonucleotides are generally 0-5 ° C. below the Tm of the oligonucleotide at 6 × SSC, 0.1% SDS. Differences in the nucleic acid sequence may result in conservative and / or non-conservative modifications of the amino acid sequence to the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3. The present invention also relates to isolated and / or purified DNA that hybridizes under any of the DNA sequences described above, or under stringent conditions with any of the DNA sequences described above.

Nucleic acid molecules encoding all or part of the polypeptides of the invention, such as the ligand binding molecules or binding units described herein, can be used in a variety of ways, including but not limited to, chemical synthesis, cDNA or genomic library screening, expression library screening, and / Including, but not limited to, PCR amplification of DNA. Such methods and other methods useful for isolating the DNA are described in, for example, Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Et al., Eds., &Quot; Methods In Enzymology: Guide To Molecular Cloning Techniques, "vol. 152, Academic Press, Inc., San Diego, Calif. (1987). Preferred nucleic acid sequences are mammalian sequences such as human, rat, and mouse.

Chemical synthesis of nucleic acid molecules is described in Engels, et al . , Angew . Chem . Intl . Ed. , 28: 716-734 (1989), which is well known in the art. Such methods include, inter alia , the phosphotriester, phosphoramidite and H-phosphonate methods of nucleic acid synthesis. Nucleic acids larger than about 100 nucleotides in length can be synthesized as several fragments up to about 100 nucleotides in length. The fragment may then be ligated as described below to form the desired full-length nucleic acid. A preferred method is polymer-supported synthesis using standard phosphoramidite chemistry.

Refers to a nucleic acid molecule amplification, replication, and / or expression vehicle, often derived from or in the form of a plasmid or viral DNA or RNA system, wherein the plasmid or viral DNA or RNA is expressed in a selected host cell, Yeast, plant, invertebrate, and / or mammalian host cells. The vector may be maintained independently of the host cell genomic DNA or may be integrated in whole or in part with the genomic DNA. The vector will contain all the necessary elements to be functional in any host cell that is compatible. Such factors are presented below.

If the nucleic acid encoding the polypeptide or fragment thereof comprises an isolated, in order to increase the copy number of the gene and / or in suitable host cells express the encoded polypeptide and / or transformed cells in the target organism (in vivo in order to express the polypeptide), in said nucleic acid is inserted into the preferably amplification and / or expression vector. Although "make-to-order" vectors may also be used, many commercially available vectors are suitable. The vector is selected to be functional in a particular host cell or host tissue ( i . E., For replication and / or expression). The polypeptides or fragments thereof may be amplified and / or expressed in prokaryotic and / or eukaryotic host cells, such as yeast, insect (baculovirus system), plant, and mammalian cells. The choice of host cell will depend, at least in part, on whether the polypeptide or fragment thereof will be glycosylated. If so, yeast, insect, or mammalian host cells are preferred; If a glycation site is present on the amino acid sequence, yeast and mammalian cells will glycosylate the polypeptide.

Typically, the vector used in any host cell will comprise a complete intron sequence containing the 5 ' entry sequence and other regulatory elements such as enhancer (s), promoter, origin of replication elements, transcription termination elements, donor and acceptor splice sites, A signal peptide sequence, a ribosome binding site element, a polyadenylation sequence, a polylinker region for inserting a nucleic acid encoding the polypeptide to be expressed, and a selectable marker element. Alternatively, the vector may contain an oligonucleotide sequence located at the 5 &apos; or 3 &apos; end of the coding sequence encoding the "tag" sequence, i.e. , polyhex (e.g., hexahex) or another small immunogenic sequence . Such a tag will be expressed with the protein and may serve as an affinity tag for purification of the polypeptide from the host cell. Optionally, the tag can be subsequently removed from the purified polypeptide by a variety of methods, e.g., using a selected peptidase.

The vector / expression construct may optionally contain elements such as a 5 'accession sequence, a replication origin, a transcription termination sequence, a selectable marker sequence, a ribosome binding site, a signal sequence, and one or more intron sequences. The 5 'cheukjeop sequence is homologous (i. E., Host cells and from the same species and / or strain), heterogeneous (i.e., from the host cell species or strain and other species), mixed oxides (i.e., 5 from the source of more than one , Or it may be a natural polypeptide 5 'recession sequence. As such, the source of the 5 'accession sequence may be any single-cell prokaryotic or eukaryotic organism, any vertebrate or invertebrate organism, or any other single-cell prokaryotic or eukaryotic organism, as long as the 5' accession sequence is functional in the host cell machinery, It can be any plant.

The transcription termination element is typically located 3 ' at the end of the polypeptide coding sequence and serves to terminate the transcription of the polypeptide. Generally, in prokaryotic cells, the transcription termination element is the poly T sequence next to the G-C abundant fragment. The elements can be cloned from a library, commercially available as part of a vector, and can be readily synthesized.

The selectable marker gene encodes the protein necessary for survival and growth of the host cell in the selective culture medium. Typical selectable marker genes are those that (a) confer resistance to ampicillin, tetracycline, or kanamycin in the case of antibiotics or other toxins, such as prokaryotic host cells, or (b) supplement deficiencies in the cellular nutrient requirements; Or (c) encodes a protein that supplies critical nutrients that are not available from the complex medium.

A ribosome binding element, commonly referred to as the Shine-Dalgano sequence (prokaryote) or the Kozak sequence (eukaryote), is required for the translation initiation of mRNA. The element is typically located 3 'of the promoter and 5' of the coding sequence of the polypeptide to be synthesized. The Shine-Dalgano sequence is varied, but typically is polypurine ( i.e. , has a high AG content). Many Shine-Dalgarno sequences have been identified, each of which can be readily synthesized using the methods described above.

As well as all of the elements presented above, other elements useful in the present invention are well known to those skilled in the art and are described, for example, in Sambrook, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Berger, et al., Eds., "Guide To Molecular Cloning Techniques," Academic Press, Inc., San Diego, Calif. (1987).

In the case of this embodiment of the invention where the recombinant polypeptide is secreted, the signal sequence is preferably included to direct secretion from the cell from which it is synthesized. Typically, the polynucleotide encoding the signal sequence is located at the 5 ' end of the coding region. A number of signal sequences have been identified, and any of these functional groups in the target cell or species may be used with the transgene.

In many cases, gene transcription is increased by the presence of one or more introns on said vector. The intron may be naturally occurring, particularly when the transgene is a full-length or fragment of a genomic DNA sequence. The intron may be homologous or heterologous to the transgene and / or to the transgenic mammal to which the gene is to be inserted. The position of the intron relative to the promoter and the transgene is important because the intron must be transcribed to be effective. The preferred position for the intron is 3 'for the transcription start site and 5' for the polyA transcription termination sequence. For cDNA transgenes, the intron is located on one or the other side of the transgene coding sequence ( i . e. , 5 ' or 3 &apos;). Any intron from any source, including any viral, prokaryotic and eukaryotic (plant or animal) organisms, may be used to express the polypeptide if it is compatible with the host cell (s) into which it is to be inserted. Synthetic introns are also included herein. Optionally, more than one intron may be used in the vector.

Exemplary vectors for recombinant expression are vectors compatible with bacterial, insect, and mammalian host cells. Such vectors include, among others, pCRII (Invitrogen Company, San Diego, Calif.), PBSII (Stratagene Company, La Jolla, Calif.), And pETL (BlueBacII; Invitrogen).

After the vector is constructed and the nucleic acid is inserted into the appropriate region of the vector, the completed vector may be inserted into a suitable host cell for amplification and / or polypeptide expression. It is commonly used include: gram negative or gram positive prokaryotes such as bacteria, i.e., E. coli, Bacillus, any strain such as Streptomyces, Saccharomyces to my process, Salmonella; Eukaryotic cells such as CHO (Chinese hamster ovary) cells; Human kidney 293 cells; COS-7 cells; Insect cells such as Sf4, Sf5, Sf9, and Sf21 and High 5 (all from Invitrogen Company, San Diego, Calif.); Various yeast cells such as Pichia my process and a plant cell and Saccharomyces. Any transformable or transfectable cell or cell line derived from any organism, such as bacteria, yeast, fungi, monocotyledonous plants and dicotyledonous plants, plant cells, and animals, is suitable.

The insertion of a vector into a selected host cell (also referred to as "transformation" or "transfection") can be accomplished using methods such as calcium chloride, electroporation, microinjection, lipofection or DEAE-dextran methods. The selected method will be a function of the type of host cell to be used in part. These and other suitable methods are well known to those skilled in the art and are described, for example, in Sambrook, et al., Supra.

Host cells containing the vector ( i . E., Transformed or transfected) may be cultured using standard media well known to the skilled artisan. The medium will generally contain all the nutrients needed for cell growth and survival. Suitable media for culturing E. coli cells are, for example, Luria medium (LB) and / or Terrific medium (TB). Suitable media for culturing eukaryotic cells are RPMI 1640, MEM, DMEM, all of which can be supplemented with the serum and / or growth factors required by the particular cell line to be cultured. A suitable medium for insect culture is Grace's medium supplemented with yeastolate, lactalbumin hydrolyzate, and / or fetal calf serum, if necessary.

Typically, antibiotics or other compounds useful for the selective growth of only transformed cells are added to the medium as a supplement. The compound to be used will be determined by the selectable marker element present on the host cell-transformed plasmid. For example, if the selectable marker element is kanamycin resistant, the compound added to the culture medium will be kanamycin.

The amount of polypeptide produced in the host cell can be assessed using standard methods known in the art. Such methods include, but are not limited to, Western blot analysis, SDS-polyacrylamide gel electrophoresis, non-denaturing gel electrophoresis, HPLC separation, immunoprecipitation, and / or binding assays.

If the polypeptide is designed to be secreted from the host cell, it is likely that the majority of the polypeptide will be found in the cell culture medium. However, if the polypeptide is not secreted from the host cell, it will be present in the cytoplasm (for eukaryotes, gram-positive bacteria, and insect host cells) or the surrounding cytoplasm (for gram negative bacterial host cells).

In the case of intracellular polypeptides, the host cell is first mechanically or osmotically destroyed to release the cytoplasmic contents into the buffer. The polypeptide is then isolated from the solution.

For long-term, high-yield production of the recombinant polypeptide, stable expression is preferred. For example, a cell line stably expressing a polypeptide of interest may be transformed using an expression vector that may contain the viral replication origin and / or endogenous expression elements and a selectable marker gene on the same vector or on separate vectors . After the introduction of the vector, the cells can be grown for 1-2 days in a concentrated medium, which is then converted to a selective medium. The purpose of the selectable marker is to tolerate selection, and its presence enables the growth and recovery of cells that successfully express the introduced sequence. Resistant clones of stably transfected cells can be propagated using tissue culture techniques appropriate for the cell type. Substantially concentrated cell lines in such cells can then be isolated to provide a stable cell line.

A particularly preferred high yield production method of the recombinant polypeptides of the present invention is the use of methotrexate at a continuously increasing level as described in US 4,889,803 to inhibit dihydrofolate reductase (DHFR) amplification in DHFR-deficient CHO cells It is through use. The polypeptide obtained may be in glycated form.

Purification of polypeptides from solutions can be accomplished using a variety of techniques. If the polypeptide is synthesized to contain a tag such as hexa histidine or other small peptide at its carboxyl or amino terminus, it may be added directly to the tag or to the polypeptide ( i . E., Specific for the polypeptide By passing it through an affinity column with high affinity). &Lt; RTI ID = 0.0 &gt;&lt; / RTI &gt; For example, polyhistidine binds with high substitution and specificity for nickel, so an affinity column of nickel (e.g., Qiagen nickel column) can be used for the purification of the het-tagged polypeptide. (See, for example, Ausubel et al., Eds., Current Protocols In Molecular Biology, Section 10.11.8, John Wiley &amp; Sons, New York (1993)).

The strong affinity of the ligand to its receptor allows affinity purification of ligand binding molecules using ligand binding molecules, and affinity matrices using complementary binding partners. Affinity chromatography can be performed, for example , by contacting a native binding partner ( e. G., A ligand when purifying a ligand binding molecule having affinity for the partner) or a standard procedure ( e . G. , A mouse, rabbit or other animal with a suitable polypeptide , &Lt; / RTI &gt; which can be used with antibodies that are produced using the antibody. The peptides of the invention may be used to generate such antibodies. Antibodies against known antibodies or known growth factor receptors can be used when they share an epitope with the targeted ligand binding molecule.

Other well known processes for purification may also be used. Such processes include, but are not limited to, ion exchange chromatography, molecular sieve chromatography, HPLC, natural gel electrophoresis in combination with gel elution, and fractional isotope focusing ("isoprim" machinery / technology, Hoefer Scientific). In some cases, two or more of these techniques may be combined to achieve increased purity. Preferred purification methods include polyhistidine tagging and ion exchange chromatography in combination with fractional isoelectric focusing.

A polypeptide found in the surrounding cytoplasmic space of a bacterium or in the cytoplasm of a eukaryotic cell; if the processed polypeptide forms the complex, the surrounding cytoplasmic or cytoplasmic contents, including inclusion bodies (bacteria), can be detected by any standard known to the skilled artisan &Lt; / RTI &gt; technique. For example, the host cell may be lysed by french pressing, homogenization, and / or sonication to release the contents of the surrounding cytoplasm. The homogenate can then be centrifuged.

If the polypeptide forms an inclusion body in the surrounding cytoplasm, the inclusion body can often bind to internal and / or external cell membranes and will therefore predominantly be found in the pellet material after centrifugation. The pellet material can then be treated with a chaotropic agent such as guanidine or urea to release, split and dissolve the inclusion body. The solubilized polypeptides can then be analyzed using gel electrophoresis, immunoprecipitation, and the like. If it is desired to isolate the polypeptide, the following and Marston, et al . , Meth . Enz . , 182: 264-275 (1990)).

Gene therapy

In some embodiments, the polynucleotides of the invention further comprise additional sequences that facilitate gene therapy. In one embodiment, a "naked" transgene (ie, transfection-facilitating virus, liposome, or other vector-free transgene) encoding the ligand binding molecule described herein is used for gene therapy .

Vectors are also useful in "gene therapy" therapy therapies in which a polypeptide encoding a ligand-binding polypeptide or molecule, in a form that causes cells in a subject to express a ligand-binding molecule of the invention in vivo , Is administered into a subject in need of inhibition. The gene therapy aspects described in U.S. Patent Nos. 2002/0151680 and WO 01/62942, which are incorporated herein by reference, are also applicable herein.

Any suitable vector may be used to introduce the polynucleotide encoding the ligand binding molecule described herein into the host. Exemplary vectors described in the literature include, but are not limited to, replication deficient retroviral vectors (Kim et al., J. Virol., 72 (1): 811-816, 1998; Kingsman & Johnson, Scrip Magazine, October, 1998, pp. 43-46); Adeno-associated virus (AAV) vectors (U.S. Patents 5,474,935, 5,139,941, 5,622,856, 5,658,776, 5,773,289, 5,789,390, 5,834,441, 5,863,541, 5,851,521, 5,252,479 ; Gnatenko et al., J. Invest. Med., 45: 87-98, 1997); Adenovirus (AV) vectors (US Patents 5,792,453, 5,824,544, 5,707,618, 5,693,509, 5,670,488, 5,585,362, Quantin et al., Proc. Natl. Acad. 2584, 1992; Stratford Perricadet et al., J. Clin. Invest., 90: 626-630, 1992; and Rosenfeld et al., Cell, 68: 143-155, 1992); Adenovirus adeno-associated virus chimeras (U.S. Patent No. 5,856,152) or vaccinia virus or herpes virus (U.S. Patents 5,879,934, 5,849,571, 5,830,727, 5,661,033, 5,328,688); Lipofectin mediated gene transfer (BRL); Liposome vectors (U.S. Patent No. 5,631,237, Liposomes containing Sendai virus proteins); And combinations thereof. All of the foregoing documents are incorporated herein by reference in their entirety.

Other non-viral delivery mechanisms contemplated include but are not limited to calcium phosphate precipitation (Graham and Van Der Eb, Virology, 52: 456-467, 1973; Chen and Okayama, Mol. Cell Biol., 7: 2745-2752, De-Ester-Dextran (Gopal, Mol. Cell Biol. 5: 1188-1190, 1985), electroporation (Tur-Kaspa et al., Mol Direct microinjection (Harland and Weintraub, J. Cell Biol., 101 (1986), Cell Biol., 6: 716-718, 1986; Potter et al., Proc. Nat. Acad. Sci. USA, 81: 7161-7165, : 1094-1099, 1985.), DNA-loaded liposomes (Nicolau and Sene, Biochim. Biophys. Acta, 721: 185-190, 1982; Fraley et al., Proc. Natl. Acad. Sci. USA, 76: Felchner, Hum Gene Ther. 7 (15): 1791-3, 1996), cell sonication (Fechheimer et al., Proc. Natl. Acad USA, 84: 8463-8467, 1987), genetic shock using high-speed microprojectiles (Yang et al., Proc. Natl. Acad. Sci USA, 87: 9568-9572, 1990), and receptor-mediated transfection(Wu and Wu, J. Biol. Chem., 262: 4429-4432, 1987; Wu and Wu, Biochemistry, 27: 887-892, 1988; Wu and Wu, Adv. Drug Delivery Rev., 12: 159-167 , 1993).

The expression construct (or indeed the ligand binding molecules described herein) can be captured by liposomes. Liposomes are vesicle structures characterized by a phospholipid bilayer membrane and an internal aqueous medium. The multi-layered liposomes have a plurality of lipid layers separated by an aqueous medium. They form spontaneously when the phospholipid is suspended in an excess of aqueous solution. The lipid component undergoes self-rearrangement prior to formation of the closed structure and captures water and dissolved solutes between lipid bilayers (Ghosh and Bachhawat, In: Liver diseases, targeted diagnosis and therapy using specific receptors and ligands, Wu G, Wu C ed., New York: Marcel Dekker, pp. 87-104, 1991). The addition of DNA to cationic liposomes leads to a topological transition from liposomes to selectively birefringent liquid-crystalline condensed oligomers (Radler et al., Science, 275 (5301): 810-4, 1997). Such DNA-lipid complexes are potential non-viral vectors for use in gene therapy and delivery.

Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro was successful. Various commercial approaches are also contemplated in the present invention, including "lipofection" techniques. In some embodiments of the invention, the liposome may be complexed with hemagglutinating virus (HVJ). It has been shown to facilitate fusion with cell membranes and to promote the uptake of liposome-encapsulated DNA into cells (Kaneda et al., Science, 243: 375-378, 1989). In other embodiments, the liposomes can be complexed or used with the non-nuclear histone chromosome protein (HMG-1) (Kato et al., J. Biol. Chem., 266: 3361-3364, 1991). In another embodiment, the liposomes can be complexed or utilized with both HVJ and HMG-1. Such expression constructs are applicable to the present invention in that they have been used successfully in vitro and in vivo in the delivery and expression of nucleic acids.

Yet another embodiment of the present invention for delivering a naked DNA expression construct into a cell may include particle impact. This method relies on the ability to accelerate DNA-coated micro-propellants at high speeds, allowing them to penetrate cell membranes and enter cells without killing them (Klein et al., Nature, 327: 70-73, 1987). Several devices have been developed to accelerate small particles. One such device relies on high voltage discharges to generate current, which ultimately provides the driving force (Yang et al., Proc. Natl. Acad. Sci USA, 87: 9568-9572, 1990). The micro-propellant used has consisted of a biologically inert material such as tungsten or gold beads.

In embodiments using viral vectors, preferred polynucleotides still include suitable promoters and polyadenylation sequences as described above. Moreover, in these embodiments, it will be readily apparent that the polynucleotide further comprises a vector polynucleotide sequence operatively linked to a sequence encoding the polypeptide of the invention (e. G., An adenovirus polynucleotide sequence).

Therapeutic uses of ligand binding molecules

The ligand binding polypeptides and molecules described herein and the polynucleotides and vectors encoding them are useful for inhibiting cellular processes that are mediated through endothelial growth factors that induce signaling through VEGFR-2 or VEGFR-3, (E. G., Various ocular disorders and cancers) that are stimulated by the action of the growth factor on the pathology of the disease. The ligand binding polypeptides and molecules described herein, and polynucleotides and vectors encoding them, can be used to treat any disease, disorder or condition that is ameliorated, improved, suppressed, or prevented by the elimination, inhibition or reduction of VEGF-C and / or VEGF- Or to treat or prevent a condition. A non-limiting list of specific conditions ameliorated by the inhibition or reduction of VEGF-C and / or VEGF-D (and in particular at least VEGF-C) include: hypervascular endothelial cell proliferation, vascular permeability, edema or inflammation Brain edema associated with injury, stroke or tumor; Arthritis including edema associated with inflammatory disorders, such as psoriasis or rheumatoid arthritis; asthma; General edema associated with burns; Ascites and pleural effusion associated with tumors, inflammation or trauma; Chronic airway inflammation; Capillary leak syndrome; blood poisoning; Kidney disease associated with increased leakage of protein; And eye disorders, such as age-related macular degeneration and diabetic retinopathy.

For simplicity, although many methods have been described in connection with compositions comprising ligand binding molecules, any of the constructs described herein, including ligand binding polypeptides, molecules, and constructs, and polynucleotides, Other polymer coalescent, etc.) is contemplated for the practice of the invention.

An exemplary therapeutic use is a method of inhibiting neovascularization in a subject in need thereof, comprising administering to the subject an amount of a composition comprising a ligand binding molecule described herein in an amount effective to inhibit neovascularization in the subject . In some embodiments, the renal vessel formation comprises choroidal or retinal neovascularization. In some embodiments, the neovascularization is tumor neovascularization that occurs in malignant cancer and other tumors.

In another aspect, a method of preventing or treating ocular disorders associated with neovascularization, comprising administering a composition comprising a ligand binding molecule described herein to a subject in need of such prevention or treatment for ocular disorders, .

In another aspect, a method of preventing or treating ocular disorders resulting in retinal edema comprising administering a composition comprising a ligand-binding molecule described herein to a subject in need of prevention or treatment for an ocular disorder or disease Lt; / RTI &gt;

Examples of ocular disorders that can be treated include choroidal neovascularization, diabetic macular edema, age-related macular degeneration, proliferative diabetic retinopathy, retinal vein occlusion, and corneal neovascularization / graft rejection. Preferably, the amount of ligand binding molecule used is a combination of VEGF-C and / or VEGF-D ligand to VEGFR-3 (and preferably also VEGFR-2) or VEGFR-3 (and preferably also VEGFR- 2 &lt; / RTI &gt; to VEGF-C and / or VEGF-D.

In one embodiment, the ocular disorder is age-related macular degeneration. Examples of age-related macular degeneration are non-angiogenic (also known as "dry") and angiogenesis (also known as "habits") macular degeneration. In a preferred embodiment, the ocular disorder is wet age-related macular degeneration. Treatment or prevention of wet age-associated macular degeneration also includes treating or preventing choroidal neovascularization or pigment epithelial detachment.

In one embodiment, the ocular disorder is choroidal vasculopathy. The choroidal vasculopathy is characterized by lesions from the inner choroidal vascular network of vessels ending with aneurysmal bulge or outward projection (Ciardella et al. (2004) Surv Ophthalmol. 49: 25-37).

In one embodiment, the ocular disorder is a condition associated with choroidal neovascularization. Examples of conditions associated with choroidal neovascularization include degenerative, inflammatory, mental traumatic or idiopathic conditions. Treatment or prevention of degenerative disorders associated with choroidal neovascularization also includes treatment or prevention of genetic degenerative disorders. Examples of genetic degenerative disorders include vitelliform macular dystrophy, fundus flavimaculatus, and optic nerve head drusen. Examples of degenerative conditions associated with choroidal neovascularization include myopic degeneration or angioid streaks. The treatment or prevention of inflammatory disorders associated with choroidal neovascularization may also be used to treat or prevent inflammatory disorders associated with choroidal neovascularization including, but not limited to, ocular histoplasmosis syndrome, polyglossal chorioamnionitis, plaque choroiditis, toxoplasmosis, toxoplasmosis, rubella, Syndrome or migraine headache syndrome. Treatment or prevention of psychotic traumatic disorders associated with choroidal neovascularization also includes treating or preventing mental trauma caused by choroidal rupture or intense photocoagulation.

In one embodiment, the ocular disorder is hypertensive retinopathy.

In one embodiment, the ocular disorder is diabetic retinopathy. Diabetic retinopathy can be non-proliferative or proliferative diabetic retinopathy. Examples of non-proliferative diabetic retinopathy include macular edema and macular ischemia.

In one embodiment, the ocular disorder is sickle cell retinopathy.

In one embodiment, the ocular disorder is a condition associated with peripheral retinal neovascularization. Examples of conditions associated with peripheral retinal neovascularization include ischemic vascular disease, inflammatory diseases associated with possible ischemia, pigmentation, pigmented retinitis, retinal detachment or chronic retinal detachment.

Examples of ischemic vascular disease include proliferative diabetic retinopathy, branch retinal vein occlusion, branch retinal artery occlusion, carotid cavernous fistula, sick hemoglobinopathy, non-sick hemoglobinopathy, IRVAN syndrome (idiopathic retinopathy, Aneurysms, and optic nerve retinitis), retinal occlusion, retinopathy of prematurity, familial exudative vitreoretinopathy, oligomerism syndrome, aortic arch syndrome, or schizophrenia. Examples of sick hemoglobinopathies include hemoglobinopathy (SS) and hemochromatosis (SC). Examples of non-sick hemoglobinopathies include AC hypochloremia and AS hypochloremia. Examples of oligomerism syndromes include leukemia, Vandenstein macroglobulinemia, multiple myeloma, erythropoiesis or myeloproliferative disorders.

Treating or preventing an inflammatory disease with possible ischemia also includes treating or preventing retinal vasculitis associated with systemic disease, retinal vasculitis associated with an infectious agent, uveitis, or birdshot retinopathy. Examples of systemic diseases include systemic lupus erythematosus, Behcet's disease, inflammatory bowel disease, sarcoidosis, multiple sclerosis, Wegener's granulomatosis and nodular polyarteritis. Examples of infectious agents are syphilis, tuberculosis, Lyme disease or a cause for the disease to cats Swipes factors, bacterial agents, viruses such as herpes viruses, or Toxoplasma Kara Cannes Or toxoplasma Gondii include parasites such as these . Examples of uveitis include pars planitis or Puccal uveitis syndrome.

In one embodiment, the ocular disorder is retinopathy of prematurity. Retinopathy of prematurity can result from the abnormal growth of blood vessels in the developing vascular bed supporting the cornea (Pollan C (2009) Neonatal Netw. 28: 93-101).

In one embodiment, the ocular disorder is venous obstruction. Examples of venous obstruction include branch retinal vein occlusion and central retinal vein occlusion. Branch retinal vein occlusion may be the blockage of the part of the circulation that drains the retina of the blood. This blockage can cause back-up pressure in the capillary, which can lead to bleeding and also leakage of fluids and other components of the blood.

In one embodiment, the ocular disorder is an arterial occlusive disease. Examples of arterial occlusive disease include branch retinal artery occlusion, central retinal artery occlusion or ocular ischemic syndrome. Branch retinal artery occlusion (BRAO) can occur when one of the branches of arterial supply to the retina is obstructed.

In one embodiment, the ocular disorder is central serous chorioretinopathy (CSC). In one embodiment, the CSC is characterized by leakage of fluid from the central macula.

In one embodiment, the ocular disorder is cystoid macular edema (CME). In one embodiment, CME affects the central retina or macula. In another embodiment, CME occurs after cataract surgery.

In one embodiment, the ocular disorder is retinal capillary dilatation. In one embodiment, retinal capillary vasculature is characterized by swelling and tortuosity of retinal vessels and formation of multiple aneurysms. Three types of idiopathic JXT, Leber's miliary aneurysm, and Cotes's disease are retinal capillaries.

In one embodiment, the ocular disorder is arterial vasculature.

In one embodiment, the ocular disorder is retinal hemangioma. In one embodiment, retinal hemangiomas occur when the ocular blood vessels form multiple hemangiomas.

In one embodiment, the ocular disorder is radiation-induced retinopathy (RIRP). In one embodiment, the RIRP may exhibit symptoms such as macular edema and non-proliferative and proliferative retinopathy.

In one embodiment, the ocular disorder is rubeosis iridis. In another embodiment, iris xanthomas causes the formation of angiogenic glaucoma. In another embodiment, the iris is caused by diabetic retinopathy, central retinal vein occlusion, ocular ischemic syndrome, or chronic retinal detachment.

In one embodiment, the ocular disorder is neoplasm. Examples of neoplasms include tumors of the eyelid, conjunctival tumors, choroidal tumors, iris tumors, optic neuritis, retinal tumors, invasive intraocular tumors or orbital tumors. Examples of eyelid tumors include basal cell carcinoma, squamous cell carcinoma, sebaceous carcinoma, malignant melanoma, capillary hemangioma, solitary cyst, nevus or seborrheic keratosis. Examples of conjunctival tumors include Kaposi sarcoma of the conjunctiva, squamous cell carcinoma, intraepithelial neoplasia of conjunctiva, ophthalmopathy, conjunctival lymphoma, melanoma, screen, or pterygium. Examples of choroidal tumors include choroidal nevi, choroidal hemangioma, metastatic choroidal tumor, choroidal oval, choroidal melanoma, ciliary melanoma or nevus of Ota. Examples of iris tumors include anterior uveal metastasis, iris cyst, iris pigmentary cell tumor, iris melanoma, or pearl cyst of iris. Examples of optic nerve tumors include optic nerve papilloma, optic nerve sheath tumors, choroidal melanoma affecting optic nerve, or peripapillary metastasis with optic neuropathy. Examples of retinal tumors include retinal pigment epithelium (RPE) hypertrophy, RPE adenoma, RPE carcinoma, retinosarcoma, RPE hamartoma, or von Hippel angioma. Examples of invasive intraocular tumors include chronic lymphocytic leukemia, invasive choroidal disease, or intraocular lymphoma. Examples of orbital tumors include adenocarcinoma of the lacrimal gland, spongy hemangioma of the orbit, lymphangioma of the orbit, orbital bursa, orbital pseudotumor, orbital rhabdomyosarcoma, childhood perivascular hemangioma, or cystic orbital pseudotumor.

In a further aspect, the invention features a method of treating eye damage, comprising topically administering to a subject in need thereof an effective amount of a ligand binding molecule described herein to improve or ameliorate eye damage. Preferably, said eye damage is corneal injury or conjunctival injury and said method of treatment reduces angiogenesis and inflammation associated with said eye injury. In some embodiments, the method is useful for treating acute and sub-acute corneal damage or conjunctival damage. Acute corneal damage can be treated within 24 hours of onset, including corneal damage or conjunctival damage caused by penetrating objects, foreign matter, or chemical damage or burns. Subacute injuries can be treated for up to two weeks after injury and may include infection pathologies as well as those listed above. In some embodiments, the eye damage is caused by a mental trauma, such as surgical injury, chemical burn, keratoplasty, infectious or inflammatory disease.

The length of treatment will vary with impairment, but the duration of treatment may be as short as a maximum of one month, which may include 3-6 months of observation while a retreat can be provided. Administration also includes an immunosuppressant, for example, a second agent such as one or more corticosteroids, dexamethasone, or cyclosporin A. Topical administration includes, for example, administration of a ligand binding molecule in an eye drop to be applied to the eye, or subconjunctival injection of the eye.

In a further aspect, there is described herein a method of treating eye damage, comprising topically administering an effective amount of a ligand binding molecule described herein to a subject in need thereof, in order to heal eye damage.

In a further aspect, there is provided a method for reducing or improving angiogenesis associated with eye damage, comprising administering to a subject in need thereof an effective amount of a ligand binding molecule described herein, Methods of improvement are described herein.

In a further aspect, there is provided a method of reducing or ameliorating inflammation associated with eye damage, including topically administering to a subject in need thereof an effective amount of a ligand binding molecule described herein to reduce or ameliorate inflammation associated with eye damage Methods are described herein.

In a further aspect, the present invention provides a method for treating angiogenesis and / or inflammation associated with eye damage or infection, including topical administration with an eye drop comprising the ligand binding molecules described herein, or subconjunctival administration by injection or infusion, Lt; RTI ID = 0.0 &gt; of the &lt; / RTI &gt; ligand binding molecule of the invention.

In a further aspect, an effective amount of a pharmaceutical composition containing a ligand-binding molecule described herein is administered to a patient (thereby inhibiting angiogenesis and / or lymphangiogenesis in the patient's cornea) to prolong corneal graft survival after corneal transplantation in a patient Are described herein.

Capacitance response studies enable the precise determination of the appropriate amount of ligand binding molecule used. An effective amount can be determined, for example, by measuring the binding affinity of the polypeptide to the target receptor, measuring the amount of receptor present on the target cell, the expected dilution volume (e.g., patient body weight and blood volume for in vivo embodiments) &Lt; / RTI &gt; and the measurement of polypeptide clearing ratios. For example, the existing literature relating to the administration of known VEGF-C antibodies also provides guidance on administration of the ligand binding molecules described herein. Literature describing the administration of Regeneron, a ligand trap based on VEGFR-1 / VEGFR-2, can also be used to provide guidance for administration of the therapeutic molecules described herein.

In some embodiments, when administered by intravitreal injection, the ligand binding molecule may be administered at a dose of from about 2 mg to about 4 mg (or from about 1 mg to about 3 mg, or from about 1 mg to about 4 mg, or about 3 mg, mg to about 4 mg, or about 1 mg to about 2 mg per eye). In some embodiments, the ligand binding molecule is administered at a concentration of about 1 mg, or about 2 mg, or about 3 mg, or about 4 mg, or about 5 mg, or about 6 mg per dose. In some embodiments, the ligand-binding molecule is selected from the group consisting of 10, 15, 20, 25, 30, 35, 40, 95 [mu] l or 100 [mu] l in any volume listed above. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4 mg / 50 μl.

The ligand binding molecules described herein are useful in the treatment of neovascularization in subjects at risk of developing neovascularization-associated eye diseases (e.g., diabetic retinopathy, macular degeneration) for the purpose of inhibiting neovascularization in the eye of a subject in need thereof As a prophylactic therapeutic agent for preventing angiogenesis, or as a therapeutic agent for a subject suffering from an eye disease.

Subjects at risk of developing diabetic retinopathy or macular degeneration are those older than 50 years; A subject with rheumatoid arthritis, a subject with diabetes, a subject with thyroid disorders, a subject with asthma, a subject with cataracts, a subject with glaucoma, a subject with lupus, a subject with hypertension and a subject with retinal detachment . Other risk factors include genetics, diet, smoking and light exposure.

In some embodiments, for a subject in need thereof, comprising screening a subject for one or more symptoms of an ocular disorder associated with retinal neovascularization and prescribing administration of a subject comprising a composition comprising a ligand binding molecule as described herein Methods for selecting therapeutic regimens are described herein. In another embodiment, there is provided a method of treating a subject suffering from an ocular disorder associated with retinal neovascularization, comprising administering to the subject a composition comprising a ligand binding molecule identified as having a subject having one or more symptoms of an ocular disorder Methods are described herein. Symptoms associated with retinal neovascularization-associated ocular disorders include, but are not limited to, blurry vision and slow vision loss over time, small particles floating in the eye, shadows or missing areas of vision, astigmatism and night blindness do.

In some embodiments, the methods described herein further comprise administering (or administering) a treatment standard therapy for the treatment of dry eye disease. In the context of the methods described herein, a "treatment standard" refers to a treatment generally accepted by a clinician for a particular type of patient in which one type of disease has been diagnosed. For diabetic retinopathy and macular degeneration, for example, an aspect of the invention is to improve therapeutic standard therapy by co-therapy with a ligand binding molecule described herein that inhibits retinal neovascularization. Exemplary therapeutic standard treatments for diabetic retinopathy and macular degeneration include, but are not limited to, eyelid hygiene, topical antibiotics (including but not limited to erythromycin or bacitracin ointment), oral tetracycline (tetracycline, Minocycline), anti-inflammatory compounds (including, but not limited to, cyclosporin), corticosteroids, laser photocoagulation and photodynamic therapy.

A method of treating a mammalian subject having an ocular disorder associated with retinal neovascularization that is less responsive to treatment standard therapies for the treatment of ocular disorders comprising administration of a ligand binding molecule to a subject in an amount effective to treat ocular disorders Also considered.

The mammalian subject is preferably a human subject. The practice of the methods of the invention in mammals (e.g., primates, pigs, dogs, or rabbit animals) that are commonly used as models for demonstrating therapeutic efficacy in other mammalian subjects, particularly humans, is also contemplated.

Combination therapy and additional active agents

Combination therapies and prophylactic embodiments of the present invention include products and methods. Exemplary compounds that may be administered in combination with one or more of the ligand binding molecules described herein include, but are not limited to, the compounds provided in Table 2 below.

The ligand binding molecule may be administered in combination with one or more additional active compounds or therapies, including second receptor trap molecules, cytotoxic agents, surgery, catheter devices and radiation. Exemplary combination products include two or more formulations packaged together as a single composition or packaged together in a separate composition, e.g., as a unit dose package or kit. Exemplary combination methods include the administration of two or more agents, either simultaneously or concurrently or at staggered times (i.e., sequentially).

The term "cytotoxic agent " as used herein refers to a substance that inhibits or prevents the function of the cell and / or causes destruction of the cell. The term is intended to encompass a range of toxins, including radioisotopes (e.g., I ¹³¹ , I ¹²⁵ , Y ⁹⁰ and Re ¹⁸⁶ ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, .

A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents are alkylating agents such as thiotepa and cyclosporamid (Cytoxan); Alkyl sulphonates such as the sulphate, impor sulphate and povosulphane; Aziridine, such as benzodopa, carboquin, metouredopa, and uredopa; Ethylene imines and methyl rammelamines such as altretamine, triethylene melamine, triethylene phosphoramide, triethylenethiophosphoramide and trimethylolmelamine; Nitrogen mustard, such as chlorambucil, clonazapine, chlorophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novolacin, penestherin, Mustin, Troposphamide, Uracil Mustard; Nitrosourea, such as carmustine, chlorozotocin, potemustine, lomustine, nimustine, lambmustine; Antibiotics such as acclinomycin, actinomycin, auramycin, azaserine, bleomycin, cactinomycin, calitheamicin, carabicin, carminomycin, carzinophilin, chromomycin, Norovirin, doxorubicin, epirubicin, esorubicin, dirubicin, marcelomycin, mitomycin, mycophenolic acid, nogalamycin, oligo Streptozygous, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; and a pharmaceutically acceptable salt thereof. Anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); Folic acid analogues such as denonfterin, methotrexate, pteropterin, trimectrexate; Purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; Pyrimidine analogs such as ancitabine, azacytidine, 6-azauridine, camopur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, phloxuridine; Androgens such as carrousosterone, dromoglomerolone propionate, epithiostanol, meptiostane, testolactone; Anti-adrenals such as aminogluteglutetimide, mitotan, trilostane; Folic acid supplements, such as proline acid; Acetic acid; Aldopo-spasmolglycoside; Aminolevulinic acid; Amsacrine; Best La Vucil; Bisanthrene; Edatroxate; Depopamin; Demecolinate; Diazin; Elformin; Elliptinium acetate; Etoglucide; Gallium nitrate; Hydroxyurea; Lentinan; Ronidamin; Mitoguazone; Mitoxantrone; Fur damol; Nitracrin; Pentostatin; Fenamate; Pyra rubicin; Grapefinal acid; 2-ethyl hydrazide; Procarbazine; PSK®; Lauric acid; Cyopyran; Spirogermanium; Tenuazonic acid; Triaziquan; Arabinoside ("Ara-C"); 2,2 ', 2 "-trichlorotriethylamine; Urethane; Vindesin; Dacarbazine; Mannomustine; Mitobronitol; MitoLol; Pipobroman; (Taxol ®, Bristol - Myers Squibb Oncology, Princeton, NJ) and Taxotere ® (Aventis Antony, France), chlorambucil, gemcitabine, 6 - thioguanine, and cyclophosphamide. (VP-16), mitomycin C, mitoxantrone, vincristine, vinorelbine, naproxen, and the like. CPT-11, topoisomerase inhibitor RFS 2000, difluoromethylornithine (DMFO), retinoic acid, S-glucosamine, N-acetylglucosamine, N-acetylglucosamine, &Lt; RTI ID = 0.0 &gt; ferramycin &lt; / RTI &gt; Antagonists such as anti-estrogens such as tamoxifen, raloxifene, aromatase inhibitor 4 (&lt; RTI ID = 0.0 &gt; 5-imidazole, 4-hydroxy tamoxifen, trioxifene, koxifene, LY 117018, onafristone, and toremifen; and anti-androgens such as flutamide, nilutamide, bicalutamide , Leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the foregoing.

As used herein, "growth inhibitory agent" is in vitro or In vivo, cells, and particularly it refers to a compound or composition to inhibit the growth of cancer cells. Examples of growth inhibitors include agents that block cell cycle progression (at sites other than S phase), such as agents that induce G 1 arrest and M-group arrest. Traditional M-based blockers include vinca (vincristine and vinblastine), Taxol®, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. DNA alkylating agents such as the above agents that stop G 1, such as tamoxifen, prednisone, takavazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara- do.

VEGF-A (VEGF) inhibitor product

In some embodiments, the methods described herein optionally include administering a therapeutic activity that inhibits VEGF-A binding to one or more of its receptors, particularly VEGFR-2. The VEGF-A inhibitor product may be administered in combination with one or more of the ligand binding molecules described herein. In some embodiments, the VEGF-A inhibitor product and the ligand binding molecule are co-administered in a single composition. In another embodiment, the VEGF-A inhibitor product is administered as a separate composition from the ligand binding molecule.

In one embodiment, the VEGF-A inhibitor product is selected from the group consisting of ranibizumab, bevacizumab, influenzacepha, KH902 VEGF receptor-Fc fusion protein, 2C3 antibody, ORA102, pegaptanib, bevacilanib, SIRNA-027, decursin , Decursinol, peakropephilin, guluc sterone, PLG101, eicosanoid LXA4, PTK787, pazopanib, acctinib, CDDO-Me, CDDO-Imm, shuconin, beta -hydroxyisobalylsuccinine , BL2 antibody, VEGF-related protein, sFLT01, sFLT02, peptide B3, TG100801, sorapenib, or G6-TG1001, GluG1203, DC101 antibody, Mab25 antibody, Mab73 antibody, 4A5 antibody, 4E10 antibody, 5F12 antibody, 31 antibody, or a pharmaceutically acceptable salt of any of the foregoing.

The cDNA and amino acid sequences of human VEGFR-2 ECD are set forth in SEQ ID NOS: 5 and 6, respectively. The "VEGF-A inhibitor product" acts as a specificity that reduces VEGF-A / VEGFR-2 interaction, for example, by blocking VEGF-A binding to VEGFR-2 or by reducing the expression of VEGFR- Can be any molecule. As used herein, the term "VEGF-A" refers to a vascular endothelial growth factor that induces angiogenesis or angiogenesis, including VEGF ₁₂₁ , VEGF ₁₆₅ And VEGF ₁₈₉ , as well as various splice variants of VEGF induced by alternative splicing of the VEGF-A gene. The term "VEGF" may be used to refer to a "VEGF" polypeptide or "VEGF" encoding gene or nucleic acid.

The term "VEGF-A inhibitor product" refers to an agent that partially or completely decreases or inhibits the activity or production of VEGF-A. The VEGF-A inhibitor product can directly or indirectly reduce or inhibit the activity or production of a particular VEGF-A, such as VEGF ₁₆₅ . Moreover, "VEGF-A inhibitor product" includes agents that act on the VEGF-A ligand or its kin receptor to decrease or inhibit VEGF-A associated receptor signaling. Examples of "VEGF-A inhibitor product" include an antisense molecule targeting a VEGF-A nucleic acid, ribozyme or RNAi; VEGF-A Aptamer; VEGF-A antibody; A soluble VEGF receptor decoy that prevents binding of VEGF-A to its cognate receptor; RNAi targeting an antisense molecule, a ribozyme, or a homologous VEGF-A receptor (VEGFR-1 and / or VEGFR-2) nucleic acid; VEGFR-1 and VEGFR-2 aptamers or VEGFR-1 and VEGFR-2 antibodies; And VEGFR-1 and / or VEGFR-2 tyrosine kinase inhibitors.

Wherein said VEGF-A inhibitor is a soluble VEGFR-2 ECD fragment (amino acids 20-764 of SEQ ID NO: 6) that binds to VEGF; Soluble VEGFR-1 ECD fragments, soluble ligand traps based on VEGFR-1 / R2, such as Regeneron; VEGFR-2 anti-sense polynucleotide or short interfering RNA (siRNA); Anti-VEGFR-2 antibody; A VEGFR-2 inhibitor polypeptide comprising an antigen-binding fragment of an anti-VEGFR-2 antibody that inhibits binding between VEGFR-2 and VEGF; A polypeptide comprising an aptamer that inhibits binding between VEGFR-2 and VEGF-A. In some variations, the VEGFR-2 based ligand trap comprises a fusion protein comprising a soluble VEGFR-2 polypeptide fragment fused to an immunoglobulin constant region fragment (Fc). In some embodiments, the VEGFR-2 polypeptide fragment is fused to an alkaline phosphatase (AP). Methods for preparing Fc or AP fusion constructs are identified in WO 02/060950, the disclosure of which is incorporated herein by reference in its entirety.

A number of VEGF-A antibodies have been described, see, for example, U.S. Patent Nos. 8,349,322; 8,236,312; 8,216,571; 8,101,177; 8092797; 8,088,375; 8,034,905; 5,730,977; 6,342,219, 6,524,583, 6,451,764, 6,448,077, 6,416,758, 6,342,221, and PCT publications WO 96/30046, WO 97/44453, and WO 98/45331 , The contents of which are hereby incorporated by reference in their entirety. Exemplary VEGF-A antibodies include bevacizumab (Avastin®) and ranibizumab (Lucentis®). In some embodiments, at least one of the ligand binding molecules described herein is administered in combination with bevacizumab. In some embodiments, at least one of the one or more ligand binding molecules described herein is administered in combination with ranibizumab.

In some embodiments, the VEGF-A inhibitor is EYE001 (previously also referred to as NX1838), which is a modified, pegylated app timer that binds to a highly soluble human VEGF subtype with high and specific affinity (U.S. Patent No. 6,011,020 No. 6,051,698; and 6,147,204). The aptamers bind to and inactivate VEGF in a manner similar to that of high-affinity antibodies to VEGF. Another useful VEGF aptamer is EYE001 in its non-pegylated form.

In a preferred embodiment, one or more of the ligand binding molecules described herein is administered in combination with an ELEVLEA (Holash et al., Proc. Natl. Acad. Sci. USA, 99: 11393-11398, 2002, The disclosure of which is incorporated herein by reference in its entirety).

A number of VEGFR-2 antibodies have been described, see, for example, U.S. Patent No. 6,334,339 and U.S. Patent Publications 2002/0064528, 2005/0214860, and 2005/0234225 Incorporated herein by reference). Antibodies are useful for modulating VEGFR-2 / VEGF interactions due to their ability to readily generate antibodies with relative affinity and due to continuous improvement in techniques employing antibodies to human therapy. Thus, the present invention provides antibodies that are specific for VEGFR-2 (such as monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, bi-functional / bispecific antibodies, humanized antibodies, human antibodies, Consideration is given to the use of complementarity determining region (CDR) -transfected antibodies comprising a compound comprising a CDR sequence that specifically recognizes the peptide. Human antibodies can also be produced using a variety of techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991)). Cole et al. And Boerner et al. Are also available for the production of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol. 147 (1): 86 95 (1991)]. Similarly, human antibodies can be produced by introducing a human immunoglobulin locus into a transgenic animal, such as a mouse in which the endogenous immunoglobulin gene is partially or completely inactivated. Upon attack, human antibody production is observed, which is very similar to that observed in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent No. 5,545,807; Lonberg et al., Nature 368 856 859 (1994); Morrison et al., Proc. Nos. 5,545,806, 5,569,825, 5,625,126, 5,633,425, 5,661,016 and the following scientific references: Marks et al., Bio / Technology 10, 779 783 , Nature 368, 812-13 (1994); Fis Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995).

PDGF inhibitor product

In some embodiments, the methods described herein optionally include administering a therapeutic agent that is active in inhibiting PDGF binding to one or more of its receptors. The PDGF inhibitor product inhibitor product may be administered in combination with one or more of the ligand binding molecules described herein. In some embodiments, the PDGF inhibitor product and the ligand binding molecule are co-administered as a single composition. In another embodiment, the PDGF inhibitor product is administered as a separate composition from the ligand binding molecule .

The term "PDGF" refers to a platelet-derived growth factor that regulates cell growth or division. As used herein, the term "PDGF" is intended to include but is not limited to PDGF-B, PDGF-A, PDGF-C, PDGF-D, variant forms thereof and PDGF-AA, PDGF- Lt; RTI ID = 0.0 &gt; PDGF &lt; / RTI &gt; including its dimer forms including -DD. Platelet-derived growth factors are involved in the formation of A-chains (" PDGFR &quot;) that exert their action through binding to two related receptor tyrosine kinase platelet-derived growth factor cell surface receptors (i.e., PDGFR), PDGFR-a and PDGFR- PDGF-A) and the B-chain (PDGF-B). Also, two additional protease-activated ligands have been identified for PDGF-C and PDGF-D, the PDGFR complex (Li et al., (2000) Nat. Cell. Biol. 2: 302-9; (2001) Nat. Cell Biol . 3: 512-6 and Uutele et al., (2001) Circulation 103: 2242-47). Due to the different ligand binding specificities of PDGFR, PDGFR-alpha / alpha binds to PDGF-AA, PDGF-BB, PDGF-AB, and PDGF-CC; PDGFR-β / β binds to PDGF-BB and PDGF-DD; It is known that PDGFR-α / β binds to PDGF-AB, PDGF-BB, PDGF-CC, and PDGF-DD (Betsholtz et al., (2001) BioEssays 23: 494-507). As used herein, the term "PDGF" also refers to members of the family of growth factors that induce DNA synthesis and mitogenesis through binding and activation of PDGFR to reactive cell types. PDGF, for example: directed cell migration (chemotactic) and cell activation; Phospholipase activation; Increased phosphatidylinosine reversal and prostaglandin metabolism; Stimulation of both collagen and collagenase synthesis by reactive cells; Changes in cellular metabolic activity including matrix synthesis, cytokine production, and lipid protein uptake; Indirect induction of proliferative responses in PDGF receptor-deficient cells; And strong vasoconstrictor activity. The term "PDGF" may be used to refer to a "PDGF" polypeptide, "PDGF" encoding gene or nucleic acid, or a dimerized form thereof.

The term "PDGF inhibitor product" refers to an agent that partially or completely decreases or inhibits the activity or production of PDGF. The PDGF inhibitor product can directly or indirectly reduce or inhibit the activity or production of a particular PDGF, such as PDGF-B. Moreover, "PDGF inhibitor product" includes agents that act on the PDGF ligand or its kin receptor to decrease or inhibit PDGF-associated receptor signaling. Examples of "PDGF inhibitor product" include an antisense molecule targeting the PDGF nucleic acid, ribozyme or RNAi; PDGF aptamer, PDGF antibody to PDGF itself or its receptor, or soluble PDGF receptor decoy to prevent binding of PDGF to its cognate receptor; An antisense molecule targeting a homologous PDGF receptor (PDGFR) nucleic acid, ribozyme or RNAi; A PDGFR aptamer or PDGFR antibody that binds to a cognate PDGFR receptor; And PDGFR tyrosine kinase inhibitors.

In one embodiment, the PDGF inhibitor product is selected from: A, B, C, D, or E as described and defined in US 2012/0100136, the entire content of which is incorporated herein by reference. P1B3 antibody, CDP860, IMC-3G3, 162.62 antibody, 163.31 antibody, 169.14 antibody, 169.31 antibody, αR1 antibody, 2A1E2 antibody, M4TS.11 antibody, M4TS.22 antibody, Hyb 120.1.2.1.2 antibody, Hyb 121.6 Hyb 1.17.1 antibody, Hyb 127.1.7.1 antibody, Hyb 127.8.2.2.2 antibody, Hyb 1.6.1 antibody, Hyb 1.11.1 antibody, Hyb 1.17.1 antibody, Hyb 1.18.1 antibody, Hyb 1.19.1 Hyb 1.24 antibody, Hyb 1.24 antibody, Hyb 1.24 antibody, Hyb 1.9 antibody, Hyb 1.33 antibody, Hyb 1.38 antibody, Hyb 1.38 antibody, Hyb 1.40 antibody, Hyb 1.40 antibody, Hyb 1.46 antibody, Hyb 1.46 antibody, Antibody, Hyb 1.51 antibody, Hyb 6.4.1 antibody, F3 antibody, humanized F3 antibody, C1 antibody, humanized C1 antibody, 6.4 antibody, anti-mPDGF-C goat IgG antibody, C3.1 antibody, PDGFR-B1 monoclonal antibody Antibody, PDGFR-B2 monoclonal antibody HYB 9610 monoclonal antibody, HYB 9612 monoclonal antibody, or HYB 9613 monoclonal antibody, or a monoclonal antibody, such as HYB 9612 monoclonal antibody, PRB2123 monoclonal antibody, PR292 monoclonal antibody, HYB 9610 monoclonal antibody, A pharmaceutically acceptable salt thereof.

In a preferred embodiment, one or more of the ligand binding molecules described herein are conjugated to PDGFR-beta antibodies (such as those developed by Regeneron for ocular signs) or anti-PDGF aptamers (e.g., by Ophthotech for ocular signs 0.0 &gt; E10030). &Lt; / RTI &gt;

Antibody fragments of the VEGF-A and PGDF inhibitor products, including for example Fab, Fab ', F (ab') 2, Fv, scFv, are also contemplated. The term "specific to " as used herein to describe an antibody of the invention refers to a polypeptide that exclusively recognizes and binds a polypeptide of interest to a variable region of an antibody of the invention (i. E., Localized sequence identity, homology, The measurable difference in binding affinity allows the polypeptide of interest to be distinguished from other known polypeptides of the same family). A specific antibody may also interact with other proteins (e. G. , Other antibodies in staphylococcal protein A or ELISA techniques) through interactions with sequences outside the variable region of the antibody, and in particular with sequences within the constant region of the molecule. Will be understood. Screening assays to determine the binding specificity of the antibodies of the present invention are well known and routinely practiced in the art. For a comprehensive discussion of the above analysis, see Harlow et al. (Eds.), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor, NY (1988), Chapter 6]. The antibodies of the present invention may be produced using any method well known and commonly practiced in the art.

In another embodiment, the methods described herein optionally include administering to the subject an anti-sense (e.g. antisense to VEGFR-2) nucleic acid molecule. An antisense nucleic acid molecule for a particular protein (e. G., VEGFR-2) is therapeutically useful to inhibit translation of mRNA encoding the protein (e. G., VEGFR-2) It is accompanied by a demand to downgrade his level. VEGFR-2 anti-sense RNA may be useful as a VEGFR-2 antagonist, for example, in the treatment of diseases in which VEGFR-2 is involved, for example, as a causative agent of inflammatory diseases.

The antisense nucleic acid comprises a nucleotide sequence complementary to a "sense" nucleic acid encoding the protein (e.g., complementary to the coding strand of the double-stranded cDNA molecule or complementary to the mRNA sequence). (See, for example, the VEGFR-3 cDNA sequence of SEQ ID NO: 1). See, for example, Lima et al . ( J Biol Chem ; 272: 626-38. 1997) and Kurreck et al. ( Nucleic Acids Res .; 30: 1911-8. 2002) for methods of designing and optimizing antisense nucleotides. In particular aspects, there is provided an antisense nucleic acid molecule comprising a sequence complementary to at least about 10, 25, 50, 100, 250 or 500 nucleotides or a coding strand of the entire protein (e.g., VEGFR-2), or portion thereof. Antisense nucleic acids complementary to nucleic acid molecules or protein (VEGFR-2) nucleic acid sequences encoding fragments, homologs, derivatives and analogs of proteins (e.g., VEGFR-2) are also contemplated.

In one embodiment, the antisense nucleic acid molecule is antisense to the "coding region" of the coding strand of the nucleotide sequence encoding a protein such as, for example, VEGFR-2. The term "coding region" refers to a region of a nucleotide sequence that includes codons that are translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is antisense to a "conceding region" of a coding strand of a nucleotide sequence encoding a protein, such as VEGFR-2. The term "contending region" refers to 5 ' and 3 ' sequences (i.e., 5 ' and 3 ' non-translated regions) on the side of the coding region that are not translated into amino acids.

The antisense nucleic acid of the present invention can be designed according to the rules of Watson and Creek or Hugsteen base pairs. The antisense nucleic acid molecule may be complementary to the entire coding region of the protein mRNA, but more preferably is an oligonucleotide that is only antisense to a portion of the coding or noncoding region of the protein mRNA. The antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides in length. The antisense nucleic acid of the present invention can be produced using a chemical synthesis or an enzymatic ligation reaction using a process known in the art. For example, antisense nucleic acids (e. G., Antisense oligonucleotides) can be used to increase the biological stability of a molecule or to increase the physical stability of a duplex formed between the antisense and sense nucleic acids, either naturally occurring nucleotides or variously modified nucleotides (E.g., phosphorothioate derivatives and acridine substituted nucleotides may be used).

Examples of modified nucleotides that can be used to generate antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthin, xanthine, 4 -Acetyl cytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyl uracil, dihydrouracil, beta-D- galactosylquosine, N6-isopentenyl adenine, 1-methyl guanine, 1-methyl inosine, 2,2-dimethyl guanine, 2- methyl adenine, 2- methylguanine, 3-methyl cytosine, Methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylquosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, (V), wybutoxosine, pseudouracil, quiosine, 2-te &lt; RTI ID = 0.0 &gt; Methyl-2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v) -Thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector in which the nucleic acid is subcloned in the antisense orientation.

The antisense nucleic acid molecules are typically administered to a subject or generated in situ, so that they inhibit expression of the protein by binding the protein (e. G. VEGFR-2) cells which encode the mRNA and / or genomic DNA and hybridization, or In (E. G., By inhibiting transcription and / or translation). The hybridization may be effected by conventional nucleotide complementarity to form a stable duplex or by a specific interaction in the major groove of a double helix, for example, in the case of an antisense nucleic acid molecule that binds to a DNA duplex Lt; / RTI &gt;

In another embodiment , protein RNA is used to introduce RNA interference (RNAi) using double-stranded (dsRNA) (Fire et al . , Nature 391 : 806-811. 1998) or short-interfering RNA (Yu et al., Proc Natl Acad Sci USA . 99: 6047-52, 2002). "RNAi" is a process by which dsRNA induces homology-dependent degradation of complementary mRNA. In one embodiment, the nucleic acid molecules of the invention are hybridized by complementary base pairing with the "sense" ribonucleic acid of the present invention to form double stranded RNA. There are provided dsRNA antisense and sense nucleic acid molecules that correspond to at least about 20, 25, 50, 100, 250 or 500 nucleotides or to a whole protein (e.g., VEGFR-2) coding strand or only to a portion thereof. In an alternative embodiment, the siRNA is less than 30 nucleotides in length, and more preferably 21- to 23-nucleotides, characterized in that the 2- to 3-fold nucleotide produced by ribonuclease III cleavage from the longer dsRNA, Nucleotide 3'-overhang end. See, for example, Tuschl T. ( Nat Biotechnol . 20: 446-48. 2002). The manufacture and use of RNAi compounds is described in U.S. Patent Publication No. 2004/0023390, the disclosure of which is incorporated herein by reference in its entirety.

Intracellular transcription of small RNA molecules can usually be accomplished by cloning the siRNA template into RNA polymerase III (Pol III) transcription units that encode small nuclear RNA (snRNA) U6 or human RNAse P RNA H1. Two approaches can be used to express the siRNA: in one embodiment, the sense and antisense strands that make up the siRNA duplexes are transcribed by a separate promoter (Lee, et al . , Nat. Biotechnol . 20, 500-505. 2002) ; In an alternative embodiment, the siRNA is expressed as a stem-ring hairpin RNA structure to produce siRNA after intracellular processing (Brummelkamp et al., Science 296: 550-553. 2002), incorporated herein by reference.

The dsRNA / siRNA is most often administered by in vitro annealing the sense and antisense RNA strands prior to delivery to the organism. In an alternative embodiment, RNAi may be performed by administering the sense and antisense nucleic acids of the invention in the same solution without annealing prior to administration, and may also be performed by administering the nucleic acid in a separate vehicle within a very short period of time. Also contemplated are nucleic acid molecules encoding fragments, homologs, derivatives and analogs of proteins (such as VEGFR-2) or antisense nucleic acids complementary to the mVEGFR-2 nucleic acid sequence.

Aptamers are another nucleic acid-based method for interfering with the interaction of receptors and their cognate ligands such as VEGFR-2 and VEGF-A and PDGFR and PGDF. An aptamer is a DNA or RNA molecule that has been selected from a random pool based on their ability to bind to other molecules. Nucleic acids, proteins, small organic compounds, and even aptamers that bind to whole organisms have been selected. Methods and compositions for identifying and producing aptamers are known to those skilled in the art and are described, for example, in U.S. Patent No. 5,840,867 and U.S. Patent No. 5,582,981, each of which is incorporated herein by reference in its entirety.

Recent advances in the field of combinatorial science have identified short polymer sequences with high affinity and specificity for a given target. For example, SELEX technology has been used to identify DNA and RNA aptamers with binding properties that compete with mammalian antibodies, and immunology has produced antibody or antibody fragments that bind to a myriad of compounds, Have been used to discover new peptide sequences with favorable binding properties. Based on the success of these molecular evolution techniques, it is certain that molecules that bind to any target molecule can be generated. The ring structure is often associated with imparting the desired binding properties as in the following case: an aptamer often employing hairpin rings generated from short regions without complementary base pairing, using a combination arrangement of cyclized super-variable regions A new phage display library using cyclic peptides showing improved results compared to naturally occurring antibodies and linear peptide phage display results. Thus, sufficient evidence has been generated to suggest that high affinity ligands can be generated and identified by combinatorial molecular evolution techniques. In the case of the present invention, molecular evolution techniques can be used to isolate ligand binding molecules specific for the ligands described herein. For more information on AppTamers, see generally, Gold, L., Singer, B., He, Y. Y., Brody. E., "Aptamers As Therapeutic And Diagnostic Agents," J. Biotechnol. 74: 5-13 (2000). A related technique for generating an app tamer is described in U.S. Patent No. 6,699,843, which is incorporated herein by reference in its entirety.

In some embodiments, the aptamer produces a library of nucleic acids; A library of said nucleic acids is contacted with growth factors wherein a nucleic acid having a greater binding affinity (relative to other library nucleic acids) for said growth factor is selected and amplified to provide a relatively higher affinity and specificity for said growth factor Can be produced by producing a mixture of concentrated nucleic acids. The process can be repeated, and the selected nucleic acid can be mutated and re-screened, thereby identifying a growth factor aptamer.

In another variation, the VEGF-A inhibitor product comprises a soluble ECD fragment of VEGFR-1 that binds to VEGF and inhibits VEGF binding to VEGFR-2. The cDNA and amino acid sequences for VEGFR-1 are shown in SEQ ID NOS: 10 and 11. Exemplary ECD fragments of VEGFR-1 are described in U.S. Patent Publication No. 2006/0030000 and International Patent Publication No. WO 2005/087808, the disclosure of which is incorporated herein by reference in its entirety.

Anti-inflammatory agent

In another embodiment, the methods described herein optionally comprise administering to the subject one or more anti-inflammatory agents. In some embodiments, the anti-inflammatory agent and the ligand binding molecule are co-administered in a single composition. In another embodiment, the anti-inflammatory agent is administered as a separate composition from the ligand binding molecule. Ligand binding molecules, VEGF-A inhibitor products, and anti-inflammatory agents are specifically contemplated. As used herein, the term "anti-inflammatory agent" generally refers to any agent that reduces inflammation or swelling in a subject. Although many exemplary anti-inflammatory agents are referred to herein, it will be appreciated that there may be additional suitable anti-inflammatory agents that are not explicitly mentioned herein but which are encompassed by the present invention.

In one variation, the anti-inflammatory agent is a non-steroidal anti-inflammatory drug (NSAID). Exemplary NSAIDs include, but are not limited to, aspirin, Sulfasalazine ^TM , Asacol ^TM , Dipendtum ^TM , Pentasa ^TM , Anaprox ^TM , Anaprox DS ^TM (naproxen sodium); Ansaid ^TM (flurobiprofen); Arthrotec ^TM (Diclofenac sodium + misoprostil misoprostil); Cataflam ^TM / Voltaren ^TM (Diclofenac potassium); Clinoril ^TM (Sulindax); Daypro ^TM (oxaprocin); Disalcid ^TM (salsalate); Dolobid ^TM (Diflunisal); EC Naprosyn ^TM (sodium naproxen); Feldene ^TM (Piroxycam); Indocin ^TM , Indocin SR ^TM (indomethacin); Lodine ^TM , Lodine XL ^TM (etomolac); Motrin ^TM (ibuprofen); Naprelan ^TM (naproxen); Naprosyn ^TMM (naproxen); Orudis ^TM , (ketoprofen); Oruvail ^TM (ketoprofen); Relafen ^TM (Nabumetone); Tolectin ^TM , (tolmetin sodium); Trilisate ^TM (choline magnesium trisalicylate); Cox-1 inhibitors; Cox-2 inhibitors such as Vioxx ^TM (ropeckoxim); Arcoxia ^tm (etoricoxim), Celebrex ^TM (celecoximab); Mobic ^TM (Meloxicam); Bextra ^™ (valdecoximab), Dynastat ^™ paracoximab sodium; Prexige ^TM (lumiracoxim), and southern methane. Additional suitable NSAIDs include, but are not limited to, 5-aminosalicylic acid (5-ASA, mesamin, resalazine), ε-acetamidocaproic acid, S-adenosylmethionine, 3-amino 4-hydroxybutyric acid, amicentrin, anthraazapene, anthraphenin, vendas, bendaricinates, benzydamine, beprozin, boperamol, bucolome, bupzanol, ciproquazone, clock But are not limited to, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, camphor, , Leupetramine HCl, leflunomide, rotopazole, lysine cloniksinate, lysine clonikinate, lysine clonikinate, lysine clonikinate, lysine clonikinate, Mesclavone, nabumetone, nick tindol, nimesulide, orotane, orphanosine, oxaceprom, oxapyr, Wherein the at least one compound is selected from the group consisting of at least one compound selected from the group consisting of at least one compound selected from the group consisting of at least one compound selected from the group consisting of at least one compound selected from the group consisting of at least one compound selected from the group consisting of at least one compound selected from the group consisting of phthalocyanine, And BF540C, CHINOIN 127, CN100, EB382, EL508, F1044, FK-506, GV3658, ITF182, KCNTEI6090, KME4, LA2851, AH8001, AH771, AFP802, AFP860, AI77B, AP504, (4-benzoyl-1-indanecarboxylic acid), TVX2706 (4-benzoyl-1-indanecarboxylic acid), MR714, MR897, MY309, ONO3144, PR823, PV102, PV108, R830, RS2131, SCR152, SH440, SIR133, SPAS510, SQ27239, ST281, SY6001, TA60, , U60257, UR2301 and WY41770.

In another variation, the anti-inflammatory agent comprises a compound that inhibits the interaction of inflammatory cytokines with their receptors. Examples of cytokine inhibitors useful in combination with the specific binding agents of the present invention include, but are not limited to, antagonists (e. G., Remicade) of TGF-a, such as Remicade, as well as antagonists Antibody). Such interleukins are described herein and preferably include but are not limited to IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL- 12, IL - 13, IL-17, and IL-18. Feghali, et al., Frontiers in Biosci . , 2: 12-26 (1997).

In another variation, the anti-inflammatory agent is a corticosteroid. Exemplary corticosteroids include, but are not limited to, but are not limited to, the following compounds: dihydroloxane diacetate, clobetasol propionate, halobetasol propionate, betamethasone, betamethasone dipropionate, budesonide, cortisone, dexamethasone, But are not limited to, Nocide dexamethasone, triamcinolone, fluticasone propionate, fluorocinolone acetonide, fluoranthrenolide, mometasone furoate, betamethasone, fluticasone propionate, fluorocinone acetonide, Clomethasone dipropionate, methylprednisolone, prednisolone, prednisone, triamcinolone, desonide, and hydrocortisone.

In another variation, the anti-inflammatory agent is a cyclosporin.

Antibiotic

In another embodiment, the methods described herein optionally further comprise administering an antibiotic to the subject. In some embodiments, the antibiotic and the ligand binding molecule are co-administered as a single composition. In another embodiment, the antibiotic is administered as a separate composition from the ligand binding molecule. Exemplary antibiotics include, but are not limited to, tetracyclines, aminoglycosides, penicillins, cephalosporins, sulfonamide drugs, chloramphenicol sodium succinate, erythromycin, vancomycin, lincomycin, clindamycin, nistatin, amphotericin B, But are not limited to, but are not limited to, dexamethasone, dexine, dodecyldodec, p-aminosalicylic acid, isoniazid, rifampin, antinomycin D, mitramycin, daunomycin, adriamycin, bleomycin, vinblastine, vincristine, Amide.

Tyrosine kinase inhibitor

In another embodiment, the methods described herein further comprise administering a tyrosine kinase inhibitor optionally inhibiting VEGFR-2 and / or VEGFR-3 activity.

Exemplary tyrosine kinase inhibitors for use in the methods described herein include, but are not limited to, AEE788 (TKI, VEGFR-2, EGFR: Novartis); ZD6474 (TKI, VEGFR-1, -2, -3, EGFR: Zactima: AstraZeneca); AZD2171 (TKI, VEGFR-1, -2: AstraZeneca); SU 11248 (TKI, VEGFR-1, -2, PDGFR: suinitinib: Pfizer); AG13925 (TKI, VEGFR-1, -2: Pfizer); AG013736 (TKI, VEGFR-1, -2: Pfizer); CEP-7055 (TKI, VEGFR-1, -2, -3: Cephalon); CP-547,632 (TKI, VEGFR-1, -2: Pfizer); GW7S6024 (TKL VEGFR-1, -2, -3: GlaxoSmithKline); GW786034 (TKI, VEGFR-1, -2, -3: GlaxoSmithKline); Sorafenib (TKI, Bay 43-9006, VEGFR-1, -2, PDGFR: Bayer / Onyx); SU4312 (TKI, VEGFR-2, PDGFR: Pfizer); AMG706 (TKI, VEGFR-1, -2, -3: Amgen); XL647 (TKI, EGFR, HER2, VEGFR, ErbB4: Exelixis); XL999 (TK1, FGFR, VEGFR, PDGFR, Fll-3: Exelixis); PKC412 (TKI, KIT, PDGFR, PKC, FLT3, VEGFR-2: Novartis); AEE788 (TKI, EGFR, VEGFR2, VEGFR-1: Novartis): OSI-030 (TKI, c-cl, VEGFR: OSI Pharmaceuticals); OS1-817 (TKI c-kit, VEGFR: OSI Pharmaceuticals); DMPQ (TKI, ERGF, PDGFR, ErbB2, p56, pKA, pKC); MLN518 (TKI, Flt3, PDGFR, c-KIT (T53518: Millennium Pharmaceuticals), Lestaurinib (TKI, FLT3, CEP-701, Cephalon); ZD 1839 (TKI, EGFR: Gefitinib, Iressa: AstraZcneca); (TKI, ErbB-2, EGFR, and GD-2016: Tykerb: GlaxoSmithKline), as well as OSI-774 (TKI, EGFR; erlotinib; Tarceva; OSI Pharmaceuticals).

In some embodiments, the methods described herein further comprise administering to the subject a tyrosine kinase inhibitor that inhibits angiogenesis. Exemplary anti-angiogenic tyrosine kinase inhibitors and their targets are provided in Table 2 below.

The ligand binding molecule may be administered in combination with more than one additional active compound or therapy. In one embodiment, a ligand binding molecule of the invention is administered in combination with a PDGF inhibitor product and a VEGF-A inhibitor product. For example, a ligand binding molecule (e. G., Comprising the amino acid sequence of SEQ ID NO: 3) can be used to detect (i) an Evella® and (ii) a PDGFR antibody Or PDGF aptamer (e.g., E10030 (Fovista ^TM ), which is being developed by Ophthotech for ocular signs.

Administration of combination therapy

Combination therapy with one or more additional active agents described herein may be effected by administering to the subject a single composition or pharmacological formulation comprising said ligand binding molecule and said at least one additional active agent, Molecules and the other composition may be achieved by administering two (or more) distinct compositions or formulations simultaneously containing an additional active agent.

Alternatively, combination therapies employing the ligand-binding molecules described herein may precede or follow the second agent treatment at intervals ranging from several minutes to several weeks. In embodiments in which the second agent and the ligand binding molecule are administered separately, it is ensured that the agent and the ligand binding molecule still have a significant combined effect and that a significant amount of time has not elapsed between each delivery time something to do. In such a case, it is contemplated to administer the two forms within about 12-24 hours of each other, and more preferably within about 6-12 hours of each other, with a delay time of only about 12 hours being most preferred. In some circumstances, it may be desirable to increase the duration of treatment considerably, but it may be desirable to increase the number of days (2, 3, 4, 5, 6 or 7) 8) may be elapsed. Repeated treatments with one or both agents are specifically contemplated.

Formulations and pharmaceutically acceptable carriers

The present invention also provides a pharmaceutical composition comprising a ligand binding molecule of the invention. Such compositions comprise a therapeutically effective amount of one or more ligand binding molecules and a pharmaceutically acceptable carrier. In one embodiment, such compositions comprise one or more ligand binding molecules and, optionally, one or more additional active agents (in the case of combination therapy). In one embodiment, such a composition comprises at least one additional active agent selected from one or more ligand binding molecules and optionally a PDGF inhibitor product and a VEGF-A inhibitor product. In another embodiment, a composition comprising one or more ligand-binding molecules of the invention and another composition comprising a PDGF inhibitor product or a VEGF-A inhibitor product is administered.

The term "pharmacologically acceptable" means enumerated in a generally recognized pharmacopeia for approval by a federal or state government agency or for use in the United States Pharmacopoeia or animal, and more particularly, human. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle to be administered with the therapeutic agent. Such pharmaceutical carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Suitable pharmaceutical excipients include, but are not limited to, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, Water, ethanol, and the like. The composition may, if desired, also contain small amounts of wetting or emulsifying agents, or pH buffering agents.

The composition may be in the form of a solution, suspension, emulsion, tablet, pill, capsule, powder, granule, gel, paste, ointment, cream, delivery device, sustained release formulation, suppository, injection, Lt; / RTI &gt; Compositions comprising a ligand binding molecule, one or more additional active agents, or both, can be formulated according to conventional pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy, (20th ed. AR Gennaro, 2000, Lippincott Williams & Wilkins,. Philadelphia, Pa. and Encyclopedia of Pharmaceutical Technology, eds, J. Swarbrick and JC Boylan, 1988-2002, Marcel Dekker, New York). An example of a suitable pharmaceutical carrier is described in Remington ' s Pharmaceutical Sciences by EW Martin.

Administration of the composition may be by any suitable means which results in an amount of ligand binding molecule and / or additional active agent effective in the treatment or prevention of the particular disease or disorder. Each ligand-binding molecule can be mixed, for example, with a suitable carrier material, and is generally present in an amount of 1-95% by weight of the total weight of the composition. The composition may be provided in a dosage form suitable for ophthalmic, oral, parenteral (e.g. intravenous, intramuscular, subcutaneous), rectal, transdermal, nasal, or inhalation administration. In one embodiment, the composition is in a form suitable for direct injection into the eye.

When present in the ligand binding molecules of the invention, and in combination therapies, the one or more additional active agents can be formulated in neutral or salt form. Pharmaceutically acceptable salts include those formed with free amino groups, such as those derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., and those formed with sodium, potassium, ammonium, calcium, iron hydroxide, isopropylamine, And free carboxyl groups such as those derived from triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

The ligand binding molecules and additional active agents of the present invention may have functional groups that are sufficiently basic to react with many inorganic and organic acids to form pharmaceutically acceptable salts. Pharmaceutically-acceptable acid addition salts are prepared from pharmaceutically-acceptable acids, as is well known in the art. Such salts are described in the Journal of Pharmaceutical Sciences, 66, 2-19 (1977) and The Handbook of Pharmaceutical Salts; Properties, Selection, and Use. P. H. Stahl and C. G. Wermuth (eds.), Verlag, Zurich (Switzerland) 2002), the entirety of which is hereby incorporated by reference in its entirety.

Pharmaceutically acceptable salts include, but are not limited to, sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, But are not limited to, lactose, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, , Glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, pamoate, phenylacetate, trifluoroacetate, acrylate, chlorobenzoate, dinitrobenzoate, hydroxy Benzoate, methoxybenzoate, methylbenzoate, o-acetoxybenzoate, naphthalene- 2-benzoate, isobutyrate, phenylbutyrate, .alpha.-hydroxybutyrate, butyne-1,4-dicarboxylate, hexyne-1,4-dicarboxylate, caprate, caprylate, cinnamate, glycol The present invention relates to the use of a compound selected from the group consisting of citric acid, citric acid, citric acid, citric acid, citric acid, citric acid, citric acid, citric acid, citric acid, citric acid, , Suverate, p-bromobenzene sulfonate, chlorobenzene sulfonate, ethyl sulfonate, 2-hydroxyethyl sulfonate, methyl sulfonate, naphthalene-1-sulfonate, naphthalene- , 5-sulfonate, xylene sulfonate, and tartrate salt.

The term " pharmaceutically acceptable salts "also refers to salts of additional active agents having an acidic functional group, such as a ligand binding molecule and a carboxylic acid functional group, and a base. Suitable bases include, but are not limited to, hydroxides of alkali metals such as sodium, potassium, and lithium; Hydroxides of alkaline earth metals such as calcium and magnesium; Hydroxides of other metals such as aluminum and zinc; Organic amines such as ammonia, and unsubstituted or hydroxy-substituted mono-, di-, or tri-alkylamines, dicyclohexylamine; Tributylamine; Pyridine; N-methyl, N-ethylamine; Diethylamine; Triethylamine; Mono-, bis- or tris- (2-OH-lower alkylamines) such as mono-, bis- or tris- (2-hydroxyethyl) amine, 2-hydroxy- (Hydroxymethyl) methylamine, N, N-di-lower alkyl-N (hydroxyl-lower alkyl) -amine such as N, N-dimethyl- 2-hydroxyethyl) amine; N-methyl-D-glucamine; And amino acids such as arginine, lysine, and the like. The term " pharmaceutically acceptable salts "also includes the hydrates of the compounds of the present invention.

The composition may, in one useful aspect, be administered parenterally (e.g., intramuscularly, intraperitoneally, intravenously, intraocularly, intravitreally, retro-bulbar, subconjunctival, subtenon, By injection) or systemically. Formulations for parenteral or systemic administration include sterile aqueous or non-aqueous solutions, suspensions, or emulsions. Various aqueous carriers, such as water, buffered water, saline, and the like, may be used. Examples of other suitable vehicles include polypropylene glycol, polyethylene glycol, vegetable oil, gelatin, hydrogel, hydrogenated naphthalene, and injectable organic esters such as ethyl oleate. The formulations may also contain adjuvants such as preservatives, wetting agents, buffers, emulsifiers, and / or dispersants. Biocompatible, biodegradable lactide polymers, lactide / glycolide copolymers, or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of the active ingredient.

Alternatively, the composition may be administered by oral ingestion. Compositions for oral use may be prepared in solid or liquid form, according to any method known in the art of pharmaceutical composition manufacture.

Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. Generally, these pharmaceutical preparations contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients. These include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, sucrose, glucose, mannitol, cellulose, starch, calcium phosphate, sodium phosphate, kaolin and the like. Binders, buffers, and / or lubricants (e.g., magnesium stearate) may also be used. Tablets and pills may additionally be prepared using enteric coatings. The composition may optionally contain sweeteners, flavors, coloring agents, fragrances, and preservatives to provide a more tasty preparation.

Solid dosage forms may be useful in the treatment of ocular disorders. Compositions useful for ocular use include tablets comprising one or more ligand binding molecules in admixture with pharmaceutically acceptable excipients. Such excipients include, for example, inert diluents or fillers (such as sucrose and sorbitol), lubricants, lubricants, and antiadhesive agents such as magnesium stearate, zinc stearate, stearic acid, silica, hydrogenated vegetable oils , Or talc).

The compositions of the present invention can be administered into the eye by intravitreal injection by the eye as well as subconjunctival and posterior subtenon injection. Other routes of administration include transmucosal, retroperitoneal, intraperitoneal, intramuscular, and intravenous. Alternatively, the composition can be administered using a drug delivery device or an intraocular implant.

Liquid dosage forms for oral administration may include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and soft gelatine capsules. Such forms may contain inert diluents commonly used in the art, such as water or oil media, and may also include adjuvants such as wetting agents, emulsifying agents, and suspending agents.

In some cases, the composition may also be administered locally, by patch or direct application to an area, such as the epidermis or eye, that is sensitive to or affected by vascular disorders, or by iontophoresis.

In the case of combination therapies of the present invention, the ligand binding molecule and one or more additional active agents may be mixed in tablets or other vehicles, or may be divided. In one example, the ligand binding molecule is contained within the tablet and the additional active agent is external, whereby a substantial portion of the additional active agent is released prior to release of the contained ligand binding molecule.

In one embodiment, a composition comprising a ligand binding molecule (and optionally one or more additional active agents) may comprise one or more pharmaceutically acceptable excipients. In one embodiment, the excipient includes, but is not limited to, buffers, non-ionic surfactants, preservatives, isotonic agents, amino acids, sugars and pH-adjusting agents. Suitable buffering agents include, but are not limited to, monobasic sodium phosphate, dibasic sodium phosphate, and sodium acetate. Suitable non-ionic surfactants include, but are not limited to, polyoxyethylene sorbitan fatty acid esters such as polysorbate 20 and polysorbate 80. Suitable preservatives include, but are not limited to, benzyl alcohol. Suitable isotonic agents include, but are not limited to, sodium chloride, mannitol, and sorbitol. Suitable sugars include, but are not limited to, alpha, alpha-trehalose anhydrides. Suitable amino acids include, but are not limited to, glycine and histidine. Suitable pH-adjusting agents include, but are not limited to, hydrochloric acid, acetic acid, and sodium hydroxide. In one embodiment, the pH-adjusting agent or modulators are present in an amount effective to provide a pH of from about 3 to about 8, from about 4 to about 7, from about 5 to about 6, from about 6 to about 7, or from about 7 to about 7.5. do. In one embodiment, a composition comprising a ligand binding molecule does not comprise a preservative. In another embodiment, a composition comprising a ligand binding molecule does not comprise an antimicrobial agent. In another embodiment, the composition comprising a ligand binding molecule does not comprise a bacterial growth inhibitor.

In one embodiment, a composition comprising a ligand binding molecule (and optionally one or more additional active agents) is in the form of an aqueous solution suitable for injection. In one embodiment, the composition comprises a ligand binding molecule, a buffer, a pH-adjusting agent, and water for injection. In another embodiment, the composition comprises a ligand binding molecule, monobasic sodium phosphate, dibasic sodium phosphate, sodium chloride, hydrochloric acid, and sodium hydroxide. In another embodiment, the composition comprises a ligand binding molecule, a phosphate (such as monobasic sodium phosphate), trehalose, sodium chloride and polysorbate.

Aqueous compositions useful in practicing the methods of the invention in an ocular environment have an ophthalmically compatible pH and osmotic pressure. One or more ophthalmically acceptable pH adjusting agents and / or buffers may be included in the compositions of the present invention, including acids such as acetic acid, boric acid, citric acid, lactic acid, phosphoric acid and hydrochloric acid; Bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, and sodium lactate; And citrate / dextrose, sodium hydrogen carbonate and ammonium chloride. Such acids, bases, and buffers are included in amounts necessary to maintain the pH of the composition in an ophthalmically acceptable range. One or more ophthalmically acceptable salts may be included in the composition in an amount sufficient to adjust the osmotic pressure of the composition to an ophthalmically acceptable range. Such salts include those with sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anion.

In some embodiments, a composition comprising a ligand binding molecule of the invention is formulated for delivery to the eye of a subject. Suitable eye carriers are known to those skilled in the art, and all such conventional carriers can be used in the present invention. Exemplary compounds incorporated to facilitate and facilitate transdermal delivery of a topical composition into the eye or adnexal tissue include, but are not limited to, alcohols (ethanol, propanol, and nonanol), fatty acid alcohols (laureth alcohol), fatty acids Propionic acid, butanoic acid), fatty acid esters (isopropyl myristate and isopropyl n-hexanoate), alkyl esters (ethyl acetate and butyl acetate), polyols (propylene glycol, propanedione and hexanetriol) , Sulfoxides (dimethyl sulfoxide and decyl methyl sulfoxide), amides (urea, dimethylacetamide and pyrrolidone derivatives), surfactants (sodium lauryl sulfate, cetyltrimethylammonium bromide, poloxamer, span, And lecithin), terpenes (d-limonene, alpha terpenol, 1,8-cineol and mentone), and alkanones (N-heptane and N-nonane) do. Moreover, topically administered compositions include, but are not limited to, surface-mountable molecular modulators, including cardelin antagonists, celecutin antagonists, and integrin antagonists. Thus, a particular carrier may take the form of sterile, ophthalmic ointments, creams, gels, solutions, or suspensions. Also included as suitable ophthalmic carriers are western polymers such as "Ocusert" polymers, "Hydron" polymers and the like.

Exemplary ophthalmic viscosity enhancers that may be used in this formulation include: carboxymethylcellulose sodium; Methylcellulose; Hydroxypropylcellulose; Hydroxypropylmethylcellulose; Hydroxyethylcellulose; Polyethylene glycol 300; Polyethylene glycol 400; Polyvinyl alcohol; And povidone.

Some natural products such as veegum, alginate, xanthan gum, gelatin, acacia and tragacanth may also be used to increase the viscosity of the ophthalmic solution.

Tension is important because low-tension eye drops cause edema of the cornea and high-tension eye drops cause deformation of the cornea. The ideal tension is about 300 mOsM. Such tensions can be achieved by the methods described in Remington: The Science and Practice of Pharmacy, which is known to those skilled in the art.

For example, stabilizers such as chelating agents such as EDTA may also be used. Antioxidants such as sodium bisulfite, sodium thiosulfite, 8-hydroxyquinolone or ascorbic acid may also be used. Sterilization will typically be maintained by conventional ophthalmic preservatives such as, for example, chloro butanol, benzalkonium chloride, cetylpyridinium chloride, phenylmercuric salts, thimerosal, etc., for aqueous formulations, Is used in an amount ranging from 0.001 to about 0.1% by weight. Conventional preservatives for ointments include methyl and propyl paraben. Typical ointment bases include white petrolatum and mineral oil or liquid petrolatum. However, a preserved aqueous carrier is preferred. The solution may be delivered in a suitable dosage form, for example, by hand into the eye with eye drops, or, typically, by a suitable microdrop or spray device that allows a metered dose of the drug. Examples of suitable ocular carriers are sterile, substantially isotonic, aqueous solutions containing less than about 5% by weight of hydroxypropylmethylcellulose, polyvinyl alcohol, carboxymethylcellulose, hydroxyethylcellulose, glycerin and EDTA . The solution is preferably maintained at a substantially neutral pH and isotonicity using a suitable amount of a conventional buffer, e.g., phosphate, borate, acetate, tris.

In some embodiments, a permeation enhancer is added to the ophthalmic carrier.

The amount of one ligand binding molecule that is effective for its intended therapeutic use can be determined by standard clinical techniques based on the present specification. In addition, in vitro to help determine the optimal dosage range Analysis can optionally be used. The amount of ligand binding molecule that is mixed with the carrier material to produce a single dosage may vary depending upon the mammal to be treated and the particular mode of administration.

Administration of the ligand binding molecule may depend on several factors including the severity of the condition, whether the condition is to be treated or prevented, and the age, weight and health of the person to be treated. In addition, genomic pharmacology (effects of genotypes on the pharmacokinetic, pharmacodynamic, or efficacy profile of the therapeutic agent) information for a particular patient can affect dosages used. Moreover, the exact individual dosage will depend upon the particular combination regimen administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disease being treated (such as the particular ocular disorder being treated), the severity of the disorder, May be adjusted to some extent according to various factors, including anatomical location. Some variation in the dosage can be expected.

Generally, when orally administered to a mammal, the dosage of the ligand binding molecules of the present invention will generally be from 0.001 mg / kg / day to 100 mg / kg / day, from 0.01 mg / kg / day to 50 mg / kg / , Or 0.1 mg / kg / day to 10 mg / kg / day. Generally, when orally administered to humans, administration of the antagonist of the present invention is generally 0.001 mg to 300 mg per day, 1 mg to 200 mg per day, or 5 mg to 50 mg per day. A maximum dose of 200 mg per day may be required.

For administration of the antagonist of the present invention by parenteral injection, the dose is generally from 0.1 mg to 250 mg per day, from 1 mg to 20 mg per day, or from 3 mg to 5 per day. The injection can be provided up to four times a day.

In general, when administered orally or parenterally, the dosage of the ligand binding molecule for use in the invention will generally be from 0.1 mg to 1500 mg per day, or from 0.5 mg to 10 mg per day, or from 0.5 mg to 5 mg per day mg. A dose of up to 3000 mg per day may be administered.

The administration of the ligand binding molecule per dose per administration is generally 0.003 mg, 0.03 mg, 0.03 mg, 0.1 mg or 0.5 mg to 5.0 mg, 4 mg, 3 mg per dose, for example, intramuscularly, mg, 2 mg or 1 mg, or 0.5 mg to 1.0 mg. Administration of the ligand-binding molecule is generally from 0.003 mg to 5.0 mg per dose, or from 0.03 mg to 4.0 mg per dose, or from 0.1 mg to 4.0 mg per dose, or from 0.03 mg to 3.0 mg per dose, per administration, From 0.1 mg to 3.0 mg per eye or from 0.1 mg to 1.0 mg per dose or from 0.5 mg to 4.0 mg per dose per dose or from 0.5 mg to 3.0 mg per dose per dose or from 0.5 mg to 2.0 mg per dose per dose, 1.0 mg to 4.0 mg per dose, or 1.0 mg to 3.0 mg per dose, or 1.0 mg to 2.0 mg per dose. In some embodiments, the ligand binding molecule is administered at a concentration of about 1 mg, or about 2 mg, or about 3 mg, or about 4 mg, or about 5 mg, or about 6 mg per dose per dose. In some embodiments, the ligand-binding molecule is selected from the group consisting of 10, 15, 20, 25, 30, 35, 40, 95 [mu] l or 100 [mu] l in any volume listed above. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4 mg / 50 μl. The dosage volume may range from 0.01 mL to 0.2 mL administered per eye, or from 0.03 mL to 0.15 mL administered per eye, or from 0.05 mL to 0.10 mL administered per eye.

In some embodiments, when administered by intravitreal injection, the ligand binding molecule may be administered at a dose of from about 2 mg to about 4 mg (or from about 1 mg to about 3 mg, or from about 1 mg to about 4 mg, or about 3 mg, mg to about 4 mg, or about 1 mg to about 2 mg per eye). In some embodiments, the ligand binding molecule is administered at a concentration of about 1 mg, or about 2 mg, or about 3 mg, or about 4 mg, or about 5 mg, or about 6 mg per dose. In some embodiments, the ligand-binding molecule is selected from the group consisting of 10, 15, 20, 25, 30, 35, 40, 95 [mu] l or 100 [mu] l in any volume listed above. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4 mg / 50 μl.

In general, a suitable dosage range for intravenous administration is generally about 50-5000 micrograms of active compound per kilogram body weight. A suitable dosage range for intranasal administration is generally from about 0.01 pg / kg body weight to 1 mg / kg body weight. Effective capacity in vitro Or extrapolated from a dose response curve derived from an animal model test system.

For systemic administration, therapeutically effective doses are initially administered in vitro Can be estimated from the analysis. For example, the dose may be formulated in an animal model to achieve a circulating concentration range that includes an IC50 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. The initial dose can be determined in vivo using techniques well known in the art Can be estimated from data, such as animal models. Those of ordinary skill in the art can readily optimize administration to humans based on animal data.

Dosages and intervals may be adjusted individually to provide plasma levels of the compound sufficient to maintain therapeutic effectiveness. For topical administration or selective absorption, the effective local concentration of the compound may not be related to the plasma concentration. Those of ordinary skill in the art will be able to optimize therapeutically effective topical doses without undue experimentation.

The amount of the compound administered will, of course, depend on the subject being treated, the weight of the subject, the severity of the disease, the mode of administration, and the judgment of the prescription. The therapy may be intermittently repeated even if the condition is detectable or even not detectable. The therapy may be provided alone or in combination with other drugs.

When present in combination with the ligand binding molecule and the combination regimen, the administration of the additional agent is, independently, 1 to 4 times per day or 1 to 4 times per month or 1 to 6 times per year or 2, 3, 4 It may be once every year or every five years. Administration may be 1 day or 1 month, 2 months, 3 months, 6 months, 1 year, 2 years, 3 years, or even a lifetime of the patient. In one embodiment, the administration is performed once a month for three months. In many cases, chronic, prolonged administration is recommended. The dose can be administered as a single dose or divided into multiple doses. Generally, the desired dose may be administered at regular intervals for extended periods of time, generally at least weeks or months, although longer doses of several months or even years may be necessary.

In addition to treating already existing disorders, the compositions can be prophylactically administered to prevent or slow the onset of these disorders. In prophylactic applications, the compositions may be administered to a patient susceptible to, or otherwise at risk for, certain disorders, such as ocular disorders.

Route of administration

Compositions containing the ligand binding molecules described herein can be administered to the patient in a variety of ways depending in part on the type of agent to be administered and the history, risk factors, and symptoms of the patient. Suitable routes of administration for the methods of the present invention include both systemic and topical administration. As used herein, the term "systemic administration" refers to a mode of administration that essentially results in the delivery of a pharmaceutical composition throughout the body of a patient. Exemplary systemic administration routes include, but are not limited to, intravenous injection and oral administration. As used herein, the term "topical administration" refers to a mode of administration that delivers significantly more pharmaceutical compositions to the eye or around the eyes than to areas remote from the eye (or tumors or other target tissues).

Systemic and topical routes of administration useful in the methods of the invention include, but are not limited to, oral gavage; Intravenous injection; Intraperitoneal injection; Intramuscular injection; Subcutaneous injection; Transdermal diffusion and electrophoresis; Topical eye drops and ointments; Intraocular and intraocular injections including subconjunctival injection; An extended release delivery device including a locally inserted elongated release device; And biocompatible and biodegradable and reservoir-based inserts.

Thus, in one aspect, a method of treating an ocular disorder associated with retinal neovascularization is performed by topically administering the ligand binding molecule to a subject. For example, in some embodiments, the pharmaceutical composition comprising the ligand-binding molecule is administered locally, or by local injection (e.g., intra-ocularly, such as intravitreally, by injection), or biodegradable or storage - based insert such as in the eye or around the eye. The composition preferably binds to VEGFR-2 and / or VEGFR-3 expressed in the cells of the eye or blood vessels of the eye, or VEGFR-2 and / or VEGFR- Or &lt; / RTI &gt; stimulating VEGFR-3.

In the case of combination therapy, administration of the ligand-binding molecule and the additional agent may occur at a continuous time or at the same time. When administered sequentially, each administration can be by the same or different routes. In one embodiment, an additional agent (such as a VEGF-A or PDGF inhibitor product) is administered at 90 days, 30 days, 10 days, 5 days, 24 hours, 1 hour, 30 minutes, 10 minutes, 5 Min or 1 minute. When the additional agent is administered prior to the ligand binding molecule, the ligand binding molecule is capable of inhibiting the total amount of the additional agent and the ligand binding molecule within a time effective to treat or prevent a targeted indication, e.g., . When the ligand binding molecule is administered prior to the additional agent, the additional agent is administered within a time effective to treat or prevent a targeted indication, such as an ocular disorder, and the amount of the ligand binding molecule .

The pharmaceutical compositions according to the present invention can be formulated to release the ligand binding molecules and optionally additional agents in combination therapy, either substantially immediately upon administration, or at any predetermined time after administration, using controlled release formulations . For example, the pharmaceutical composition may be provided in a sustained release form. The use of immediate or extended compositions depends on the nature of the condition being treated. If the condition is an acute disorder, treatment using a quadratic formula may be used rather than an extended release composition. For certain aphasic or prolonged treatments, a sustained release composition may also be appropriate.

Administration of both the ligand binding molecule or the ligand binding molecule and the at least one additional agent in a controlled release formulation can be accomplished by administering the ligand binding molecule alone or in combination (i) with a narrow therapeutic index (e.g., causing a deleterious side effect or toxic response In general, the therapeutic index TI is defined as the ratio of the median effective dose (ED50) to the median lethal dose (LD50)); (ii) a narrow absorption window in the gastrointestinal tract; Or (iii) may have a short biological half-life, frequent administration for one day is necessary to maintain plasma levels at therapeutic levels.

Many strategies can be pursued to obtain controlled release where the rate of release is greater than the rate of degradation or metabolism of the active ingredient. For example, controlled release can be obtained by appropriate selection of formulation parameters and ingredients, including appropriate controlled release compositions and coatings. Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, nanoparticles, patches, and liposomes. Methods for producing such sustained or controlled release formulations are well known in the art.

The ligand-binding molecules and, if present, additional agents can also be delivered using drug-delivery devices such as inserts. As used herein, the term "implant" refers to any material that does not significantly migrate from the insertion site after insertion. The insert may be biodegradable, non-biodegradable, or may be composed of biodegradable and non-biodegradable materials. The non-biodegradable insert may, if desired, comprise a fillable reservoir. Inserts useful in the methods of the present invention may be of any shape and size, including, for example, patches, particles, sheets, plaques, microcapsules, and the like, compatible with the selected insertion site, It may be posterior chamber, anterior chamber, suprachoroid, or subconjunctival. Inserts useful in the present invention are generally understood to release the inserted pharmaceutical composition at an effective dose to the eye of the patient for an extended period of time.

Various ocular inserts and extended release formulations suitable for ocular release can be found, for example, in US Pat. Nos. 5,869,079 and 5,443,505, the disclosures of which are incorporated herein by reference in their entirety, It is known. An ocular drug delivery device may be inserted into the anterior chamber, such as the anterior or posterior chamber, or it may be inserted in or on a sclera, a choroidal space, or a non-blood-capped area outside the body of the vitreous. In one embodiment, in order to allow diffusion of the ligand binding molecules and any additional agents into the desired treatment site, such as the intraocular space and the black spots of the eye, the implant may be placed on an avascular area such as above the sclera Can be located. Moreover, the site of diffusion of the transmucosal membrane can be proximal to the site of neovascularization, such as the proximal site of the black spots. Suitable drug delivery devices are described, for example, in U.S. Publication Nos. 2008/0286334; 2008/0145406; 2007/0184089; 2006/0233860; 2005/0244500; 2005/0244471; And 2005/0244462, and U.S. Patent Nos. 6,808,719 and 5,322,691, each of which is incorporated herein by reference in its entirety.

In another embodiment, the ligand binding molecule described herein is applied to the eye via a liposome. In another embodiment, the ligand binding molecule is contained in a continuous or selective-emitting device, such as, but not limited to, those used in the Ocusert System (Alza Corp., Palo Alto, Calif.). In an additional embodiment, the ligand binding molecule is contained in, carried by, or attached to a contact lens located above the eye. In another embodiment, the ligand binding molecule is contained within a swab or sponge that can be applied to the ocular surface. Another embodiment of the present invention includes a ligand binding molecule contained within a liquid spray which may be applied to an ocular surface.

In one embodiment, the insert comprises a ligand binding molecule, optionally dispersed in a biodegradable polymer matrix, and, if present, an additional agent. The matrix may comprise PLGA (polylactic acid-polyglycolic acid copolymer), ester-end capped polymer, acid end-capped polymer, or mixtures thereof. In another embodiment, the insert comprises a ligand binding molecule and optionally, if present, additional agents, surfactants and lipophilic compounds. The lipophilic compound may be present in an amount of about 80-99% by weight of the implant. Suitable lipophilic compounds include, but are not limited to, glyceryl palmitostearate, diethylene glycol monostearate, propylene glycol monostearate, glyceryl monostearate, glyceryl monolinoleate, glyceryl monooleate, Glyceryl monostearate, glyceryl monostearate, glyceryl monostearate, glyceryl monostearate, glyceryl monostearate, glyceryl monostearate, glyceryl monostearate, glyceryl monostearate, glyceryl monostearate, Glyceryl monooleate, glyceryl monooleate, glyceryl monoarabic acid, glyceryl monooleate, glyceryl monooleate, glyceryl monooleate, glyceryl monooleate, glyceryl monooleate, glyceryl monoarabidate, Nate, and mixtures thereof. In another embodiment, the insert comprises a ligand-binding molecule and optionally, if present, an additional agent, in a hollow sleeve. The ligand binding molecule and, if present, an additional agent, if present, are delivered to the eye by inserting the sleeve into the eye, releasing the insert from the sleeve into the eye, and then removing the sleeve from the eye . Examples of such delivery devices are described in U.S. Publication No. 2005/0244462, which is incorporated herein by reference in its entirety.

In one embodiment, the insert is a flexible eye insertion device adapted for controlled release of ligand binding molecules to the eye, and optionally, if present, additional formulation. In one embodiment, the device comprises a elongate body of polymeric material in the form of a rod or tube containing a ligand binding molecule and optionally, if present, an additional agent, and extends radially outward from the body At least two fixing protrusions. The device may have a length of at least 8 mm and the diameter of its body portion including the protrusions does not exceed 1.9 mm. Sustained mechanisms may be, for example, by diffusion or by osmotic or bioerosion. The insertion device may be inserted into the upper or lower eye of the eye to be independent of eye movement by a form anatomy. The protrusions may take various forms, for example, ribs, screws, threads, recesses, protrusions, truncated cone-shaped portions or wraps. In a further embodiment, the polymeric material for the body is selected as expanding in a liquid environment. Thus, smaller initial size devices can be used. The insertion device may be of a size and arrangement so that when inserted into the upper or lower jaw, the device is kept in place for extended use and is kept out of sight so that it is not perceived by the audience. The device may be held in an upper or lower bay for 7 to 14 days or more. An example of such a device is described in U.S. Patent No. 5,322,691, which is incorporated herein by reference in its entirety.

In another aspect, a method of inhibiting neovascularization in a subject diagnosed with a tumor is performed by topically administering the ligand binding molecule to a subject. For example, in some embodiments, the pharmaceutical composition comprising the ligand binding molecule is administered locally to the tumor or to an organ or tissue from which the tumor has been surgically removed. In such embodiments, the composition is preferably administered in an amount effective to inhibit neovascularization in the tumor.

When the ligand binding molecule is a nucleic acid molecule, administration of the pharmaceutical composition containing the nucleic acid molecule can be performed using one of many methods well known in the art of gene therapy. Such methods include, but are not limited to, lentiviral transformation, adenoviral transformation, cytomegalovirus transformation, microinjection, and electroporation.

Kit  And a unit capacity

The present invention also relates to kits and instructions comprising one or more pharmaceutical compositions. The ligand binding molecule can be packaged or formulated together with other ligand binding molecules or other therapeutic agents described herein, e.g., in a kit or package or unit dose, to enable co-administration; These two components can be formulated together (i. E., Mixed) or in separate compositions (i. E. Without mixing) and in individual doses. Each of the compositions of the kit may be contained in one container. In some embodiments, the two components for the kit / unit dose are packaged together with instructions for administering the two compounds to a human subject for the treatment of one of the disorders and diseases described herein.

The kit may comprise a container. The container may be used to separate components, for example, a divided bottle or a divided foil packet. The separate compositions may also, if desired, be contained in a single, undivided container. The kit comprises instructions for administration of the components. The kit is particularly advantageous when the separate components are administered in different dosage forms, when administered at different dosage levels, or when titration of each antagonist is desired.

All publications and patents mentioned herein are incorporated herein by reference in their entirety, as if each individual article or patent was expressly and individually indicated to be incorporated herein by reference. In the event of a conflict, the present application, including any definitions herein, will control it.

Example

Example  One - VEGFR  Protein ECD  snippet.

Experiments were conducted to identify fragments and variants and fusions of VEGFR-3 and / or VEGFR-2 and / or VEGFR-1 effective to bind to a target ligand such as VEGF-C and / or VEGF-D and / or VEGF- Respectively. WO 2005/087808, WO 2005/000895, WO 2006/088650, WO 2006/099154, WO 2004/106378, WO 2005/123104, and U.S. Patent No. 7,855,178 , All of which are incorporated herein by reference in their entirety. These studies demonstrate that the ECDs of these receptors can be cleaved and that domains from different receptors can be recombined to form ligand binding molecules.

Example  2 - VGX -301- ΔN2  Generation of Ligand Binding Molecules

A ligand binding molecule (referred to herein as "VGX-300") comprising an Ig-like domain I-III of VEGFR-3 is described by Makinen et al., Nat. Med., 7: 199-205, 2001).

The key feature of the VGX-300 molecule is that it contains 12 glycosylation sites (2 x 6 potential N-linked glycosylation sites, each receptor fragment (VEGFR-3 Ig-like domains I, II, and III) And one on each Fc region gamma chain). There is no evidence for O-linked glycation.

Although glycation traits may affect PK, Fc glycans have little effect on PK (Jones et al, Glycobiology, 17 (5), 2007 pp. 529-540). In summary, an asialoglycoprotein receptor binds to a complex-type N-linked glycan structure with no more than two sialic acids and the underlying galactose (Gal) residue is a terminal polysaccharide. In addition, the Mann receptor recognizes high-mannose N-linked glycans and terminal N-acetylglucosamine (tGlcNAc) residues. Both of these receptors can cause rapid metabolic clearance of the protein.

To confirm that the glycation site is important for product activity, consecutive deletions of each of the five putative N-linked sites were performed. A single mutation was introduced into the VGX-300 coding region using five primer pairs to break the consensus attachment for each of the five N-linked glycans (N-Q).

The primer pairs used are as follows:

N1 sense: 5 'GACCCCCCCGACCTTGCAGATCACGGAGGAGTCACAC 3' (SEQ ID NO: 12)

N1 anti-sense: 5 'GTGTGACTCCTCCGTGATCTGCAAGGTCGGGGGGGTC 3' (SEQ ID NO: 13)

N2 sense: 5 'CTGCACGAGGTACATGCCCAGGACACAGGCAGCTACGTC 3' (SEQ ID NO: 14)

N2 anti-sense: 5 'GACGTAGCTGCCTGTGTCCTGGGCATGTACCTCGTGCAG 3' (SEQ ID NO: 15)

N3 sense: 5 'GTCCATCCCCGGCCTCCAAGTCACGCTGCGCTCGC 3' (SEQ ID NO: 16)

N3 anti-sense: 5 'GCGAGCGCAGCGTGACTTGGAGGCCGGGGATGGAC 3' (SEQ ID NO: 17)

N4 sense: 5 'GGGAGAAGCTGGTCCTCCAGTGCACCGTGTGGGCTGA 3' (SEQ ID NO: 18)

N4 anti-sense: 5 'TCAGCCCACACGGTGCACTGGAGGACCAGCTTCTCCC 3' (SEQ ID NO: 19)

N5 sense: 5 'AGCATCCTGACCATCCACCAGGTCAGCCAGCACGACCT 3' (SEQ ID NO: 20)

N5 anti-sense: 5 'AGGTCGTGCTGGCTGACCTGGTGGATGGTCAGGATGCT 3' (SEQ ID NO: 21)

The plasmid vector was transiently transfected into 293T cells (HEK) and the presence of the mutation was confirmed by sequencing. Cultured samples were analyzed by Western blot. The viable constructs were then forwarded to transient suspension-adapted 293F cells (HEK) and the supernatants were purified by ProSepA chromatography and gel filtration and analyzed by enzyme-linked immunosorption assay (ELISA) and BaF / 3 bio Additional yield was determined by analysis to determine yield and activity. Table 3 below summarizes the expression data and activity of each obtained mutation.

Table 3

Table 3 shows that only the N2 mutation (herein referred to as "VGX-301-ΔN2") exhibited superior expression and activity characteristics relative to the parent molecule (ie, VGX-300). VGX-301-ΔN2 and VGX-300 were produced in CHO and HEK cells by transient expression, and the pharmacokinetics (PK) of each molecule was examined as follows. Sprague-Dawley rats were assigned to groups of 2, 3 or 5 per compound in each experiment. Rats in each group received a single dose of VGX-300 or VGX-301-ΔN2 via intravenous administration as bolus injections at a dose concentration of 1 mg / kg. Intermediate blood samples were collected by lateral tail vein puncture at a total of 12 time points after the administration, ranging from -1 day (before dosing) to 5 to 14 days after the initial treatment. Serum samples from each blood sample were prepared and tested using a quantitative VEGF-C ligand-capture ELISA to determine the circulating concentration of each compound. The results of these analyzes were then used to calculate the pharmacokinetic parameters. PK data of VGX-300 and VGX-301-DELTA N2 are provided in Table 4 below.

Table 4.

The PK curve provided in Figure 1 and the data from Table 4 Suggesting that VGX-301-ΔN2 may have beneficial effects on PK compared to VGX-300 produced in the same expression system.

Example  3 - VGX -301- ? N2 VEGF -C VEGF -D to Join

To determine the specificity of the VGX-300 and VGX-301-ΔN2 binding to VEGF-C and VEGF-D, VEGF-C or VEGF-D (2 μg / mL) was precoated on ELISA plates, . An increasing concentration of VGX-300 or VGX-301-ΔN2 (0-10 μg / mL) was applied to the plate and detected with a rabbit anti-human IgG-horse radish peroxidase conjugate using a tetramethylbenzidine substrate kit Respectively. The results showed that both VGX-300 and VGX-301-ΔN2 bound to both VEGF-C and VEGF-D. See FIG. Surprisingly, VGX-301-ΔN2 demonstrated stronger binding to both ligands than VGX-300.

Example  4 - VGX -300 and VGX -301- ΔN2  Binding affinity

The binding of VEGF-C and VEGF-D to VGX-300 or VGX-301-ΔN2 was analyzed by surface plasmon resonance (SPR) performed using a ProteOn XPR36 biosensor (Bio-Rad). VGX-300 or VGX-301-DELTA N2 was captured onto the protein G 'immobilized on the GLM sensor chip and the affinity of the molecule for VEGF-C or VEGF-D was measured. The results of the affinity experiments are provided in Table 5.

Table 5.

The data provided in Table 5 above shows that the VGX-300 and VGX-301-ΔN2 samples bind to human VEGF-C and VEGF-D with nearly identical affinity and that the two molecules have stronger binding to VEGF-C than VEGF-D Respectively.

Example  5 - VGX -301- ? N2 VEGF -C VEGF -D bond and VEGFR -3 &lt; / RTI &gt; Cut off

Cell-based assays have been developed to assess the ability of VEGF family ligands to bind and cross-link to VEGFR-2 and VEGFR-3. These bioassays have been used to study the neutralizing activity of VGX-300 and VGX-301-ΔN2. The bioassay cell line was stably transfected with a chimeric receptor composed of ECD of VEGFR-2 or VEGFR-3 fused in-frame to the transmembrane and intracellular domains of mouse erythropoietin receptor, mouse IL- 3 dependent pro-B cell line Ba / F3, the disclosure of which is incorporated herein by reference in its entirety, as described in Example 5 of WO 2005/087808. In the absence of IL-3, these cells survive and proliferate only in the presence of growth factors capable of binding and cross-linking to the ECD of each VEGFR.

Briefly, Ba / F3 cells (10,000 cells / well; 96 well plate) transfected with VEGFR-2 or VEGFR-3 were incubated with increasing concentrations of VGX-300 of VGX-301- 100 [mu] g / mL) in VEGF-C or VEGF-D supplemented medium. Cell proliferation was measured using WST 1 reagent; Cells were incubated with WST-1 for 4 h at 37 ° C and absorbance was measured at 450 nm (n = 3; error bars = standard error of mean, SEM).

The results showed that VGX-300 neutralized the activity of VEGF-C and VEGF-D, as evidenced by dose-responsive inhibition of VEGF-C and VEGF-D in VEGFR-2 and VEGFR-3 Ba / F3 bioassays . VGX-300 showed enhanced efficacy in neutralizing VEGF-C compared to VEGF-D in both VEGFR-2 and -3 assays. See FIGS. 3 and 4.

Analysis of VGX-301-ΔN2 demonstrated that this molecule was also able to block the binding of VEGF-C and VEGF-D to VEGFR-3. The neutralizing activity of VGX-301-N2 was slightly stronger than that of VGX-300. See FIG. Table 6 shows the binding of VGX-300 and VGX-301-ΔN2 (IC50) to VEGF-C and VEGF-D in the VEGFR-3 Ba / F3 bioassay.

Table 6

Example  6 - Intravitreal  After administration VGX -300 and VGX - 301? N2  Ocular distribution and Pharmacokinetics

This study was undertaken to investigate the ocular distribution and pharmacokinetics of VGX-300, VGX-301-ΔN2, and influenzacept (EYLEA) after a single intravitreal dose to pigmented rabbits.

The study design consisted of three groups, with eight female rabbits assigned per group. Animals are dosed with 500 μg of radiolabeled VGX-300, VGX-301-ΔN2, or influenzacept, through a 50 μL bolus intravitreal injection into both eyes.

One animal per group was euthanized at 1, 12, 24, 72, 168, 366, 504 and 672 hours after dosing. Serum-processed blood, and selected eye tissue were collected at each time point and the concentration of radioactivity was determined by radiometric analysis. The collected ocular tissues can be used for various purposes such as manipulation, choroid, cornea, ICB, lens, optic nerve, retina, RPE, sclera, trabecular meshwork and vitreous humor ). Figure 5 shows the average concentration of radioactivity in various tissues and serum over the time observed.

The experimental product, [ ¹²⁵ I] VGX-300, [ ¹²⁵ I] influenzacept (EYLEA) and [ ¹²⁵ I] VGX-301-ΔN2 were well tolerated and stable in the vitreous solution, Had an extended exposure to. Both [ ¹²⁵ I] VGX-300 and [ ¹²⁵ I] VGX-301-ΔN2, although there was a difference in serum exposure between [ ¹²⁵ I] VGX-300 and [ ¹²⁵ I] VGX-301- Had only a small systemic exposure as compared to that of the influenzacept (EYLEA), probably as a result of absorption into the choroid and also by eradication by the infusion solution. PK and biodistribution of [ ¹²⁵ I] VGX-300 and [ ¹²⁵ I] VGX-301-ΔN2 observed in this study were similar to those of the two compounds and were comparable to [ ¹²⁵ I] influenzacept (EYLEA).

Example 7 - Retinopathy of prematurity model

The following examples are exemplary analyzes evaluating the ability of VGX-300 and VGX-301-DELTA N2 to inhibit initiation of retinal neovascularization using the ROP model. In this model, the mice are exposed to oxygen excess (75% oxygen) for 7 days (P7) after birth (up to P12) for 5 days. After over-oxygen exposure, the P12 mice were returned to the oxygen steady state and incubated with human isotype control antibodies, VGX-300, VGX-301-ΔN2, Eylea (VEGF-Trap), VGX-300 + Eylea or VGX-301-ΔN2 + Eylea Intravitreal injection is administered. All mice are then raised for 5 days under normoxic conditions, sacrificed on P17, and the eyeballs removed and fixed in 10% formalin / PBS. H & E and / or IHC staining methods will be used to quantify blood vessels in each group.

Example 8 - Argon laser-induced choroidal neovascularization (CNV)

In this model of age-related macular degeneration (AMD), CNV is induced by argon laser-induced rupture of Bruch's membrane in mice at day 0 (3 burns per mouse). Groups of 10 mice were studied and weekly intravitreal injections of human isotype control antibodies, VGX-301-ΔN2, VGX-300, Eylea (VEGF-Trap), VGX-301-ΔN2 + Eylea or VGX- (0 day and 7 days). On day 14, animals are sacrificed and choroidal flat mounts are prepared and stained with ICAM-2 to visualize renal vascular formation by fluorescence microscopy.

As a single agent, it is contemplated that VGX-301-DELTA N2 will significantly inhibit choroidal neovascularization in a murine model of angiogenesis-producing AMD, which is comparable to that demonstrated by Eylea®.

Example  9 - VEGF -C Mediated  Inhibitory effect of ligand binding molecules on tumor growth and metastasis

To demonstrate the ability of the ligand binding molecules described herein to inhibit tumor growth and / or metastasis, any accepted tumor model may be used. Exemplary models include animals that have a tendency to develop various types of cancer, cells that express the same or different species, optionally including cells transformed to recombinantly overexpress one or more growth factors, such as VEGF-C, or VEGF-D Lt; RTI ID = 0.0 &gt; tumor &lt; / RTI &gt; cells or tumor cell lines. To provide an in vivo tumor model capable of detecting multiple growth factors, a tumor cell line can be transformed with exogenous DNA, which results in the expression of multiple growth factors.

The ligand binding molecules described herein can be administered directly, for example , by intravenous infusion, or in the form of a protein by an inserted micropump, or in the form of a nucleic acid as part of gene therapy. Subjects are preferably classified by sex, weight, age, and medical history to help minimize variations between subjects.

Efficacy is measured by tumor, size (volume) and weight loss. It can also investigate the effects of tumor size, spread (metastasis), and number of tumors on the effects. For example, the effects on lymphangiogenesis versus angiogenesis, VEGF-A binding constructs expected to have a greater effect on angiogenesis, and VEGF-C binding constructs expected to have a greater effect on lymphangiogenesis The use of a specific cell marker may be used. The survival time and weight change of the animal as a whole can be observed. Tumors and specimens were examined for evidence of angiogenesis, lymphangiogenesis, and / or necrosis.

SCID mice can be used as a subject for the ability of the ligand binding molecules described herein to inhibit or prevent tumor growth. The ligand binding molecule used in the therapy is generally selected so that the molecule binds to a growth factor ligand expressed in the tumor cell, particularly a growth factor that is overexpressed by the tumor cell relative to a non-neoplastic cell in the subject. In the SCID model, tumor cells, such as MCF-7 cells, can be transfected with a virus that encodes a particular growth factor under the control of a promoter or other expression control sequence that provides overexpression of the growth factor as described in WO 02/060950 . Alternatively, other cell lines, such as, for example, HT-1080, as described in U.S. Patent No. 6,375,929, may be used. A tumor cell line capable of transfecting said tumor cells with as many growth factor ligands as intended to over-express or already over-expressing one or more growth factor ligands of interest can be selected. One group of subjects is inserted into cells co-transfected, i . E., With a vector lacking the growth factor ligand insert.

The subject is treated with a specific ligand binding molecule prior to, concurrently with, or subsequent to the introduction of a tumor of the aforementioned cell. There are many different ways of administering the ligand binding molecules. In vivo and / or ex vivo gene therapy may be used. For example, a cell can be inserted into an adenovirus encoding the ligand binding molecule, or a tumor cell that is transfected with another vector and expresses the growth factor (s), and the transfected cell with the ligand binding molecule is grown May be identical to that transformed with factor (s) (or that already overexpresses said growth factor (s)). In some embodiments, the adenovirus encoding the ligand binding molecule is injected in vivo , such as intravenously. In some embodiments, the ligand binding molecule itself ( e . G., In protein form) is administered systemically or locally, for example, using a micropump. When testing the efficacy of a particular binding construct, at least one control group is commonly used. For example, in the case of vector-based therapy, a vector with a co-insert or LacZ may be used, or a ligand comprising the complete ECD of VEGFR-3 capable of binding to the binding VEGF-C or VEGF-D Binding molecule, and such a control can utilize more than one ECD construct if necessary ( e.g. , to bind to multiple ligands when a binding construct having multiple ligand binding affinities is used).

A. An exemplary process

Preparation of plasmid expression vectors, transfection of cells, and their tests

CDNA encoding VEGF-C or VEGF-D or a combination thereof is introduced into the pEBS7 plasmid (Peterson and Legerski, Gene , 107: 279-84, 1991.). This same vector can be used for the expression of the ligand binding molecule.

The MCF-7S1 subclone of the human MCF-7 breast carcinoma cell line is transfected with plasmid DNA by electroporation and a stable cell pool is selected and cultured as previously described (Egeblad and Jaattela, Int . J. Cancer , 86: 617-25,2000). The cells are metabolically labeled (Redivue Pro-Mix, Amersham Pharmacia Biotech) in methionine and cysteine-free MEM (Gibco) supplemented with 100 μCi / ml [35S] -methionine and [35S] -cysteine. The labeled growth factor is immunoprecipitated from the conditioned medium using an antibody against the expressed growth factor (s). The immune complexes and binding complexes were precipitated using Protein A Sepharose (Amersham Pharmacia Biotech), washed twice with 0.5% BSA in PBS, 0.02% Tween 20 and once in PBS, and subjected to SDS-PAGE under reducing conditions Is analyzed.

Manufacture and treatment of objects

Cells (20,000 / well) are plated in 4-wells in 24-wells and trypsinized on duplicate plates after 1, 4, 6, or 8 days and counted using a hemocytometer. Fresh media is provided after 4 and 6 days. For tumorigenic assays, sub-confluent cultures were collected by trypsinization, washed twice, and 10 ⁷ cells in PBS were treated with 0.72 mg of 17 [beta] -estradiol (Innovative Research of America) In a fat pad of a second (axillar) mammalian ovariectomized SCID mouse with subcutaneous 60-day sustained release. Ovariectomy and pellet insertion are performed 4-8 days prior to tumor cell inoculation.

The cDNA encoding the binding construct (s) is subcloned into the pAdBglII plasmid and adenoviruses are produced as previously described (Laitinen et al . , Hum. Gene Ther . , 9: 1481-6, 1998). The binding molecule (s) or control LacZ (Laitinen, etc., Hum Gene Ther, 9:. . 1481-6, 1998) and injected intravenously into SCID mice with adenovirus, 10 ⁹ pfu / mouse 3 hours prior to tumor cell inoculation .

Analysis of therapeutic efficacy

Tumor length and width are measured twice weekly in a blinded fashion and the tumor volume is calculated as length x width x depth x 0.5 assuming the tumor is semi-elliptical and equal in depth and width (Benz et al., Breast Cancer Res. Treat . , 24: 85-95, 1993).

The tumor is resected, fixed in 4% formaldehyde (pH 7.0) for 24 hours, and embedded in paraffin. VEGFR-2, VEGFR-3 (Kubo et al., Blood , 96: 546-553, 2000) or PCNA (Zymed Laboratories), PDGFR (Juberk et al., J Cell Biol, 144: 789-801, 1999), VEGF-C (Joukov et al., EMBO J. , 16: 3898-911, 1997) or monoclonal antibody to LGF- ), Laminin according to the published protocol (Partanen et al., Cancer , 86: 2406-12, 1999), or with a polyclonal antibody to any growth factor. The average number of PECAM-1 positive blood vessels is determined from three regions (60x magnification) of the largest vascular hot spots in the section. All histological analyzes are performed using blind tumor samples.

Three weeks after injection of the adenovirus construct and / or protein therapy, four mice from each group are anesthetized, the abdominal skin is opened, and several microliters of 3% Evan blue dye in PBS is injected into the tumor. And macroscopically track the drainage of the dye from the tumor.

Imaging or monitoring of blood and blood proteins that provide an indication of the health of the subject and of the degree of tumor vasculature can also be performed.

Example  Effects of 10-Ligand Binding Molecule and Chemotherapeutic Agents on Tumor Progression in a Subject

This study is conducted to test the efficacy of the ligand binding molecules described herein in combination with other anti-cancer therapies. Such therapies include monoclonal antibodies to chemotherapy, radiation therapy, anti-sense therapy, RNA interference, and cancer targets. The combined effect may be additive but is preferably synergistic in its anticancer effects, such as prevention, suppression, degeneration, and elimination of cancer, prolongation of the cancer, and / or reduction of side effects.

The subject is divided into a group receiving a chemotherapeutic agent, a group receiving a ligand binding molecule, and a group receiving both a chemotherapeutic agent and a ligand binding molecule, at regular intervals, for example , daily, weekly, or monthly. In human studies, the subject is generally classified by sex, weight, age, and history to help minimize variations between subjects. Ideally, the subject was diagnosed with the same type of cancer. In human or non-human subjects, progression can be traced by measuring tumor size, metastasis, weight gain / decrease, vascularization in the tumor, and leukocyte cell number.

Biopsies of tumors are taken at regular intervals before and after initiation of treatment. For example, a biopsy may be taken immediately before, one week, after, or whenever possible, e.g., when the tumor is incised. Biopsies are evaluated for cell markers and overall cell and tissue morphology to assess the efficiency of treatment. Additionally, or alternatively, imaging techniques may be used.

For non-human animal studies, additional placebo controls may be used. Animal studies performed in accordance with the NIH guidelines also provide for the insertion of a relatively uniform population of cancer cells and the advantage of tumors that selectively produce and produce more than one growth factor targeted by the ligand binding molecule.

<110> Vegenics Pty Limited          Commonwealth Scientific and Industrial Research          Organization <120> LIGAND BINDING MOLECULES AND USES THEREOF <130> 28967 / 47459A <160> 21 <170> KoPatentin 3.0 <210> 1 <211> 4195 <212> DNA <213> Homo sapiens <220> <221> CDS &Lt; 222 > (20) .. (3913) <400> 1 ccacgcgcag cggccggag atg cag cgg ggc gcc gcg ctg tgc ctg cga ctg 52                       Met Gln Arg Gly Ala Ala Leu Cys Leu Arg Leu                         1 5 10 tgg ctc tgc ctg gga ctc ctg gac ggc ctg gtg agt ggc tac tcc atg 100 Trp Leu Cys Leu Gly Leu Leu Asp Gly Leu Val Ser Gly Tyr Ser Met              15 20 25 acc ccc ccg acc ttg aac atc acg gag gag tca cac gtc atc gac acc 148 Thr Pro Pro Thr Leu Asn Ile Thr Glu Glu Ser His Val Ile Asp Thr          30 35 40 ggt gac agc ctg tcc atc tcc tgc agg gga cag cac ccc ctc gag tgg 196 Gly Asp Ser Leu Ser Ile Ser Cys Arg Gly Gln His Pro Leu Glu Trp      45 50 55 gct tgg cca gga gct cag gag gcg cca gcc acc gga gac aag gac agc 244 Ala Trp Pro Gly Ala Gln Glu Ala Pro Ala Thr Gly Asp Lys Asp Ser  60 65 70 75 gag gac gg ggg gtg gg gg gc gac gg Glu Asp Thr Gly Val Val Arg Asp Cys Glu Gly Thr Asp Ala Arg Pro                  80 85 90 tac tgc aag gtg ttg ctg ctg cac gag gta cat gcc aac gac aca ggc 340 Tyr Cys Lys Val Leu Leu Leu His Glu Val His Ala Asn Asp Thr Gly              95 100 105 agc tac gc tc tac tac tac aac tac atc aag gca cgc atc gag ggc acc 388 Ser Tyr Val Cys Tyr Tyr Lys Tyr Ile Lys Ala Arg Ile Glu Gly Thr         110 115 120 acg gcc gcc agc tcc tac gtg ttc gtg aga gac ttt gag cag cca ttc 436 Thr Ala Ser Ser Tyr Val Phe Val Arg Asp Phe Glu Gln Pro Phe     125 130 135 atc aac aag cct gac acg ctc ttg gtc aac agg aag gac gcc atg tgg 484 Ile Asn Lys Pro Asp Thr Leu Leu Val Asn Arg Lys Asp Ala Met Trp 140 145 150 155 gtg ccc tgt ctg gtg tcc atc ccc ggc ctc aat gtc acg ctg cgc tcg 532 Val Pro Cys Leu Val Ser Ile Pro Gly Leu Asn Val Thr Leu Arg Ser                 160 165 170 caa agc tcg gtg ctg tgg cca gac ggg cag gag gtg gtg tgg gat gac 580 Gln Ser Ser Val Leu Trp Pro Asp Gly Gln Glu Val Val Trp Asp Asp             175 180 185 cgg cgg ggc atg ctc gtg tcc acg cca ctg ctg cac gat gcc ctg tac 628 Arg Arg Gly Met Leu Val Ser Thr Pro Leu Leu His Asp Ala Leu Tyr         190 195 200 ctg cag tgc gag acc acc tgg gga gac cag gac ttc ctt tcc aac ccc 676 Leu Gln Cys Glu Thr Thr Trp Gly Asp Gln Asp Phe Leu Ser Asn Pro     205 210 215 ttc ctg gtg cac atc aca ggc aac gag ctc tat gac atc cag ctg ttg 724 Phe Leu Val His Ile Thr Gly Asn Glu Leu Tyr Asp Ile Gln Leu Leu 220 225 230 235 ccc agg aag tcg ctg gag ctg ctg gta ggg gag aag ctg gtc ctg aac 772 Pro Arg Lys Ser Leu Glu Leu Leu Val Gly Glu Lys Leu Val Leu Asn                 240 245 250 tgc acc gtg tgg gct gag ttt aac tca ggt gtc acc ttt gac tgg gac 820 Cys Thr Val Trp Ala Glu Phe Asn Ser Gly Val Thr Phe Asp Trp Asp             255 260 265 tac cca ggg aag cag ga gag cgg ggt aag tgg gtg ccc gag cga cgc 868 Tyr Pro Gly Lys Gln Ala Glu Arg Gly Lys Trp Val Pro Glu Arg Arg         270 275 280 tcc cag cag ac cac aca gaa ctc tcc agc atc ctg acc atc cac aac 916 Ser Gln Gln Thr His Thr Glu Leu Ser Ser Le Leu Thr Ile His Asn     285 290 295 gtc agc cag cac gac ctg ggc tcg tat gtg tgc aag gcc aac aac ggc 964 Val Ser Gln His Asp Leu Gly Ser Tyr Val Cys Lys Ala Asn Asn Gly 300 305 310 315 atc cag cga ttt cgg gag agc acc gag gtc att gt cat gaa aat ccc 1012 Ile Gln Arg Phe Arg Glu Ser Thr Glu Val Ile Val His Glu Asn Pro                 320 325 330 ttc atc agc gtc gag tgg ctc aaa gga ccc atc ctg gag gcc acg gca 1060 Phe Ile Ser Val Glu Trp Leu Lys Gly Pro Ile Leu Glu Ala Thr Ala             335 340 345 gga gac gag ctg gtg aag ctg ccc gtg aag ctg gca gcg tac ccc ccg 1108 Gly Asp Glu Leu Val Lys Leu Pro Val Lys Leu Ala Ala Tyr Pro Pro         350 355 360 ccc gag ttc cag tgg tac aag gat gga aag gca ctg tcc ggg cgc cac 1156 Pro Glu Phe Gln Trp Tyr Lys Asp Gly Lys Ala Leu Ser Gly Arg His     365 370 375 agt cca cat gcc ctg gtg ctc aag gag gtg aca gag gcc agc aca ggc 1204 Ser Pro His Ala Leu Val Leu Lys Glu Val Thr Glu Ala Ser Thr Gly 380 385 390 395 acc tac acc ctc gcc ctg tgg aac tcc gct gct ggc ctg agg cgc aac 1252 Thr Tyr Thr Leu Ala Leu Trp Asn Ser Ala Ala Gly Leu Arg Arg Asn                 400 405 410 atc agc ctg gag ctg gtg gtg aat gtg ccc ccc cag cat cat gag aag 1300 Ile Ser Leu Glu Leu Val Val Asn Val Pro Pro Gln Ile His Glu Lys             415 420 425 gag gcc tcc tcc ccc agc atc tac tcg cgt cac agc cgc cag gcc ctc 1348 Glu Ala Ser Ser Ser Ile Ser Ser His Ser Ser Gln Ala Leu         430 435 440 acc tgc acg gcc tac ggg gtg ccc ctg cct ctc agc atc cag tgg cac 1396 Thr Cys Thr Ala Tyr Gly Val Pro Leu Pro Leu Ser Ile Gln Trp His     445 450 455 tgg cgg ccc tgg aca ccc tgc aag atg ttt gcc cag cgt agt ctc cgg 1444 Trp Arg Pro Trp Thr Pro Cys Lys Met Phe Ala Gln Arg Ser Leu Arg 460 465 470 475 cgg cgg cag cag caa gac ctc atg cca cag tgc cgt gac tgg agg gcg 1492 Arg Arg Gln Gln Gln Asp Leu Met Pro Gln Cys Arg Asp Trp Arg Ala                 480 485 490 gtg acc acg cag gat gcc gtc aac ccc atc gag agc ctg gac acc tgg 1540 Val Thr Gln Asp Ala Val Asn Pro Ile Glu Ser Leu Asp Thr Trp             495 500 505 acc gag ttt gtg gag gga aag aat aag act gtg agc aag ctg gtg atc 1588 Thr Glu Phe Val Glu Gly Lys Asn Lys Thr Val Ser Lys Leu Val Ile         510 515 520 cag aat gcc aac gtg tct gcc atg tac aag tgt gtg gtc tcc aac aag 1636 Gln Asn Ala Asn Val Ser Ala Met Tyr Lys Cys Val Val Ser Asn Lys     525 530 535 gtg ggc cag gat gag cgg ctc atc tac ttc tat gtg acc acc atc ccc 1684 Val Gly Gln Asp Glu Arg Leu Ile Tyr Phe Tyr Val Thr Thr Ile Pro 540 545 550 555 gac ggc ttc acc atc gaa tcc aag cca tcc gag gag cta cta gag ggc 1732 Asp Gly Phe Thr Ile Glu Ser Lys Pro Ser Glu Glu Leu Leu Glu Gly                 560 565 570 cag ccg gtg ctc ctg agc tgc caa gcc gac agc tac aag tac gag cat 1780 Gln Pro Val Leu Leu Ser Cys Gln Ala Asp Ser Tyr Lys Tyr Glu His             575 580 585 ctg cgc tgg tac cgc ctc aac ctg tcc acg ctg cac gat gcg cac ggg 1828 Leu Arg Trp Tyr Arg Leu Asn Leu Ser Thr Leu His Asp Ala His Gly         590 595 600 aac ccg ctt ctg ctc gac tgc aag aac gtg cat ctg ttc gcc acc cct 1876 Asn Pro Leu Leu Leu Asp Cys Lys Asn Val His Leu Phe Ala Thr Pro     605 610 615 ctg gcc gcc agc ctg gag gag gtg gca cct ggg gcg cgc cac gcc acg 1924 Leu Ala Ala Ser Leu Glu Glu Val Ala Pro Gly Ala Arg His Ala Thr 620 625 630 635 ctc agc ctg agt atc ccc cgc gtc gcg ccc gag cac gag ggc cac tat 1972 Leu Ser Leu Ser Ile Pro Arg Val Ala Pro Glu His Glu Gly His Tyr                 640 645 650 gtg tgc gaa gtg caa gac cgg cgc agc cat gac aag cac tgc cac aag 2020 Val Cys Glu Val Gln Asp Arg Arg Ser His Asp Lys His Cys His Lys             655 660 665 aag tac ctg tcg gtg cag gcc ctg gaa gcc cct cgg ctc acg cag aac 2068 Lys Tyr Leu Ser Val Gln Ala Leu Glu Ala Pro Arg Leu Thr Gln Asn         670 675 680 ttg acc gac ctc ctg gtg aac gtg agc gac tcg ctg gag atg cag tgc 2116 Leu Thr Asp Leu Leu Val Asn Val Ser Asp Ser Leu Glu Met Gln Cys     685 690 695 ttg gtg gcc gga gcg cac gcg ccc agc atc gtg tgg tac aaa gac gag 2164 Leu Val Ala Gly Ala His Ala Pro Ser Ile Val Trp Tyr Lys Asp Glu 700 705 710 715 agg ctg ctg gag gaa aag tct gga gtc gac ttg gcg gac tcc aac cag 2212 Arg Leu Leu Glu Glu Lys Ser Gly Val Asp Leu Ala Asp Ser Asn Gln                 720 725 730 aag ctg agc atc cag cgc gtg cgc gag gag gat gcg gga cgc tat ctg 2260 Lys Leu Ser Ile Gln Arg Val Val Glu Glu Asp Ala Gly Arg Tyr Leu             735 740 745 tgc agc gtg tgc aac gcc aag ggc tgc gtc aac tcc tcc gcc agc gtg 2308 Cys Ser Val Cys Asn Ala Lys Gly Cys Val Asn Ser Ser Ala Ser Val         750 755 760 gcc gtg gaa ggc tcc gag gat aag ggc agc atg gag atc gtg atc ctt 2356 Ala Val Glu Gly Ser Glu Asp Lys Gly Ser Glu Ile Val Ile Leu     765 770 775 gtc ggt acc ggc gtc atc gct gtc ttc ttc tgg gtc ctc ctc ctc ctc 2404 Val Gly Thr Gly Val Ile Ala Val Phe Phe Trp Val Leu Leu Leu Leu 780 785 790 795 atc ttc tgt aac atg agg agg ccg gcc cac gca gac atc aag acg ggc 2452 Ile Phe Cys Asn Met Arg Arg Pro Ala His Ala Asp Ile Lys Thr Gly                 800 805 810 tac ctg tcc atc atc atg gac ccc ggg gag gtg cct ctg gag gag caa 2500 Tyr Leu Ser Ile Ile Met Asp Pro Gly Glu Val Pro Leu Glu Glu Gln             815 820 825 tgc gaa tac ctg tcc tac gat gcc agc cag tgg gaa ttc ccc cga gag 2548 Cys Glu Tyr Leu Ser Tyr Asp Ala Ser Gln Trp Glu Phe Pro Arg Glu         830 835 840 cgg ctg cac ctg ggg aga gtg ctc ggc tac ggc gcc ttc ggg aag gtg 2596 Arg Leu His Leu Gly Arg Val Leu Gly Tyr Gly Ala Phe Gly Lys Val     845 850 855 gtg gaa gcc tcc gct ttc ggc atc cac aag ggc agc agc tgt gac acc 2644 Val Glu Ala Ser Ala Phe Gly Ile His Lys Gly Ser Ser Cys Asp Thr 860 865 870 875 gtg gcc gtg aaa atg ctg aaa gag ggc gcc acg gcc agc gag cac cgc 2692 Val Ala Val Lys Met Leu Lys Glu Gly Ala Thr Ala Ser Glu His Arg                 880 885 890 gcg ctg atg tcg gag ctc aag atc ctc att cac atc ggc aac cac ctc 2740 Ala Leu Met Ser Glu Leu Lys Ile Leu Ile His Ile Gly Asn His Leu             895 900 905 aac gtg gtc aac ctc ctc ggg gcg tgc acc aag ccg cag ggc ccc ctc 2788 Asn Val Val Asn Leu Leu Gly Ala Cys Thr Lys Pro Gln Gly Pro Leu         910 915 920 atg gtg atc gtg gag ttc tgc aag tac ggc aac ctc tcc aac ttc ctg 2836 Met Val Ile Val Glu Phe Cys Lys Tyr Gly Asn Leu Ser Asn Phe Leu     925 930 935 cgc gcc aag cgg gac gcc ttc agc ccc tgc gcg gag aag tct ccc gag 2884 Arg Ala Lys Arg Asp Ala Phe Ser Pro Cys Ala Glu Lys Ser Pro Glu 940 945 950 955 cag cgc gga cgc ttc cgc gcc atg gtg gag ctc gcc agg ctg gat cgg 2932 Gln Arg Gly Arg Phe Arg Ala Met Val Glu Leu Ala Arg Leu Asp Arg                 960 965 970 agg cgg ccg ggg agc agc gac agg gtc ctc ttc gcg cgg ttc tcg aag 2980 Arg Arg Pro Gly Ser Ser Asp Arg Val Leu Phe Ala Arg Phe Ser Lys             975 980 985 acc gag ggc gga gcg agg cgg gct tct cca gac caa gaa gct gag gac 3028 Thr Glu Gly Gly Ala Arg Arg Ala Ser Pro Asp Gln Glu Ala Glu Asp         990 995 1000 ctg tgg ctg agc ccg ctg acc atg gaa gat ctt gtc tgc tac agc ttc 3076 Leu Trp Leu Ser Pro Leu Thr Met Glu Asp Leu Val Cys Tyr Ser Phe    1005 1010 1015 cg gtg gcc aga ggg atg gag ttc ctg gct tcc cga aag tgc atc cac 3124 Gln Val Ala Arg Gly Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His 1020 1025 1030 1035 aga gac ctg gct gct cgg aac att ctg ctg tcg gaa agc gac gtg gtg 3172 Arg Asp Leu Ala Ala Arg Asn Ile Leu Leu Ser Glu Ser Asp Val Val                1040 1045 1050 aag atc tgt gac ttt ggc ctt gcc cgg gac atc tac aaa gac cct gac 3220 Lys Ile Cys Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp            1055 1060 1065 tac gtc cgc aag ggc agt gcc cgg ctg ccc ctg aag tgg atg gcc cct 3268 Tyr Val Arg Lys Gly Ser Ala Arg Leu Pro Leu Lys Trp Met Ala Pro        1070 1075 1080 gaa agc atc ttc gac aag gtg tac acc acg cag agt gac gtg tgg tcc 3316 Glu Ser Ile Phe Asp Lys Val Tyr Thr Thr Gln Ser Asp Val Trp Ser    1085 1090 1095 ttt ggg gtg ctt ctc tgg gag atc ttc tct ctg ggg gcc tcc ccg tac 3364 Phe Gly Val Leu Leu Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr 1100 1105 1110 1115 cct ggg gtg cag atc aat gag gag ttc tgc cag cgg ctg aga gac ggc 3412 Pro Gly Val Gln Ile Asn Glu Glu Phe Cys Gln Arg Leu Arg Asp Gly                1120 1125 1130 aca agg atg agg gcc ccg gag ctg gcc act ccc gcc ata cgc cgc atc 3460 Thr Arg Met Arg Ala Pro Glu Leu Ala Thr Pro Ala Ile Arg Arg Ile            1135 1140 1145 atg ctg aac tgc tgg tcc gga gac ccc aag gcg aga cct gca ttc tcg 3508 Met Leu Asn Cys Trp Ser Gly Asp Pro Lys Ala Arg Pro Ala Phe Ser        1150 1155 1160 gag ctg gtg gag atc ctg ggg gac ctg ctc cag ggc agg ggc ctg caa 3556 Glu Leu Val Glu Ile Leu Gly Asp Leu Leu Gln Gly Arg Gly Leu Gln    1165 1170 1175 gag ga gag gag gtc tgc atg gcc ccg cgc agc tct cag agc tca gaa 3604 Glu Glu Glu Glu Val Cys Met Ala Pro Arg Ser Ser Gln Ser Ser Glu 1180 1185 1190 1195 gag ggc agc ttc tcg cag gtg tcc acc atg gcc cta cac atc gcc cag 3652 Glu Gly Ser Phe Ser Gln Val Ser Thr Met Ala Leu His Ile Ala Gln                1200 1205 1210 gct gac gct gag agc ccg cca agc ctg cag cgc cac agc ctg gcc 3700 Ala Asp Ala Glu Asp Ser Pro Pro Ser Leu Gln Arg His Ser Leu Ala            1215 1220 1225 gcc agg tat tac aac tgg gtg tcc ttt ccc ggg tgc ctg gcc aga ggg 3748 Ala Arg Tyr Tyr Asn Trp Val Ser Phe Pro Gly Cys Leu Ala Arg Gly        1230 1235 1240 gct gag acc cgt ggt tcc tcc agg atg aag aca ttt gag gaa ttc ccc 3796 Ala Glu Thr Arg Gly Ser Ser Arg Met Lys Thr Phe Glu Glu Phe Pro    1245 1250 1255 atg acc cca acg acc tac aaa ggc tct gtg gac aac cag aca gac agt 3844 Met Thr Pro Thr Thr Tyr Lys Gly Ser Val Asp Asn Gln Thr Asp Ser 1260 1265 1270 1275 ggg atg gtg ctg gcc tcg gag gag ttt gag cag ata gag agc agg cat 3892 Gly Met Val Leu Ala Ser Glu Glu Phe Glu Gln Ile Glu Ser Arg His                1280 1285 1290 aga caa gaa agc ggc ttc agg tagctga agcagagaga gagaaggcag 3940 Arg Gln Glu Ser Gly Phe Arg            1295 catacgtcag cattttcttc tctgcactta taagaaagat caaagacttt aagactttcg 4000 ctatttcttc tactgctatc tactacaaac ttcaaagagg aaccaggagg acaagaggag 4060 catgaaagtg gacaaggagt gtgaccactg aagcaccaca gggaaggggt taggcctccg 4120 gatgactgcg ggcaggcctg gataatatcc agcctcccac aagaagctgg tggagcagag 4180 tgttccctga ctcct 4195 <210> 2 <211> 1298 <212> PRT <213> Homo sapiens <400> 2 Met Gln Arg Gly Ala Ala Leu Cys Leu Arg Leu Trp Leu Cys Leu Gly   1 5 10 15 Leu Leu Asp Gly Leu Val Ser Gly Tyr Ser Met Thr Pro Pro Thr Leu              20 25 30 Asn Ile Thr Glu Glu Ser His Val Ile Asp Thr Gly Asp Ser Leu Ser          35 40 45 Ile Ser Cys Arg Gly Gln His Pro Leu Glu Trp Ala Trp Pro Gly Ala      50 55 60 Gln Glu Ala Pro Ala Thr Gly Asp Lys Asp Ser Glu Asp Thr Gly Val  65 70 75 80 Val Arg Asp Cys Glu Gly Thr Asp Ala Arg Pro Tyr Cys Lys Val Leu                  85 90 95 Leu Leu His Glu Val His Ala Asn Asp Thr Gly Ser Tyr Val Cys Tyr             100 105 110 Tyr Lys Tyr Ile Lys Ala Arg Ile Glu Gly Thr Thr Ala Ala Ser Ser         115 120 125 Tyr Val Phe Val Arg Asp Phe Glu Gln Pro Phe Ile Asn Lys Pro Asp     130 135 140 Thr Leu Leu Val Asn Arg Lys Asp Ala Met Trp Val Pro Cys Leu Val 145 150 155 160 Ser Ile Pro Gly Leu Asn Val Thr Leu Arg Ser Ser Gln Ser Ser Val Leu                 165 170 175 Trp Pro Asp Gly Gln Glu Val Val Trp Asp Asp Arg Arg Gly Met Leu             180 185 190 Val Ser Thr Pro Leu Leu His Asp Ala Leu Tyr Leu Gln Cys Glu Thr         195 200 205 Thr Trp Gly Asp Gln Asp Phe Leu Ser Asn Pro Phe Leu Val His Ile     210 215 220 Thr Gly Asn Glu Leu Tyr Asp Ile Gln Leu Leu Pro Arg Lys Ser Leu 225 230 235 240 Glu Leu Leu Val Gly Glu Lys Leu Val Leu Asn Cys Thr Val Trp Ala                 245 250 255 Glu Phe Asn Ser Gly Val Thr Phe Asp Trp Asp Tyr Pro Gly Lys Gln             260 265 270 Ala Glu Arg Gly Lys Trp Val Pro Glu Arg Arg Ser Gln Gln Thr His         275 280 285 Thr Glu Leu Ser Ser Ile Leu Thr Ile His Asn Val Ser Gln His Asp     290 295 300 Leu Gly Ser Tyr Val Cys Lys Ala Asn Asn Gly Ile Gln Arg Phe Arg 305 310 315 320 Glu Ser Thr Glu Val Ile Val His Glu Asn Pro Phe Ile Ser Val Glu                 325 330 335 Trp Leu Lys Gly Pro Ile Leu Glu Ala Thr Ala Gly Asp Glu Leu Val             340 345 350 Lys Leu Pro Val Lys Leu Ala Ala Tyr Pro Pro Pro Glu Phe Gln Trp         355 360 365 Tyr Lys Asp Gly Lys Ala Leu Ser Gly Arg His Ser Pro His Ala Leu     370 375 380 Val Leu Lys Glu Val Thr Glu Ala Ser Thr Gly Thr Tyr Thr Leu Ala 385 390 395 400 Leu Trp Asn Ser Ala Gla Leu Arg Arg Asn Ile Ser Leu Glu Leu                 405 410 415 Val Val Asn Val Pro Pro Gln Ile His Glu Lys Glu Ala Ser Ser Pro             420 425 430 Ser Ile Tyr Ser Arg His Ser Arg Gln Ala Leu Thr Cys Thr Ala Tyr         435 440 445 Gly Val Pro Leu Pro Leu Ser Ile Gln Trp His Trp Arg Pro Trp Thr     450 455 460 Pro Cys Lys Met Phe Ala Gln Arg Ser Leu Arg Arg Gl Gln Gln Gln 465 470 475 480 Asp Leu Met Pro Gln Cys Arg Asp Trp Arg Ala Val Thr Thr Gln Asp                 485 490 495 Ala Val Asn Pro Ile Glu Ser Leu Asp Thr Trp Thr Glu Phe Val Glu             500 505 510 Gly Lys Asn Lys Thr Val Ser Lys Leu Val Ile Gln Asn Ala Asn Val         515 520 525 Ser Ala Met Tyr Lys Cys Val Val Ser Asn Lys Val Gly Gln Asp Glu     530 535 540 Arg Leu Ile Tyr Phe Tyr Val Thr Thr Ile Pro Asp Gly Phe Thr Ile 545 550 555 560 Glu Ser Lys Pro Ser Glu Glu Leu Leu Glu Gly Gln Pro Val Leu Leu                 565 570 575 Ser Cys Gln Ala Asp Ser Tyr Lys Tyr Glu His Leu Arg Trp Tyr Arg             580 585 590 Leu Asn Leu Ser Thr Leu His Asp Ala His Gly Asn Pro Leu Leu Leu         595 600 605 Asp Cys Lys Asn Val His Leu Phe Ala Thr Pro Leu Ala Ala Ser Leu     610 615 620 Glu Glu Val Ala Pro Gly Ala Arg His Ala Thr Leu Ser Leu Ser Ile 625 630 635 640 Pro Arg Val Ala Pro Glu His Glu Gly His Tyr Val Cys Glu Val Gln                 645 650 655 Asp Arg Arg Ser His Asp Lys His Cys His Lys Lys Tyr Leu Ser Val             660 665 670 Gln Ala Leu Glu Ala Pro Arg Leu Thr Gln Asn Leu Thr Asp Leu Leu         675 680 685 Val Asn Val Ser Asp Ser Leu Glu Met Gln Cys Leu Val Ala Gly Ala     690 695 700 His Ala Pro Ser Ile Val Trp Tyr Lys Asp Glu Arg Leu Leu Glu Glu 705 710 715 720 Lys Ser Gly Val Asp Leu Ala Asp Ser Asn Gln Lys Leu Ser Ile Gln                 725 730 735 Arg Val Arg Glu Glu Asp Ala Gly Arg Tyr Leu Cys Ser Val Cys Asn             740 745 750 Ala Lys Gly Cys Val Asn Ser Ser Ala Ser Val Ala Val Glu Gly Ser         755 760 765 Glu Asp Lys Gly Ser Met Glu Ile Val Ile Leu Val Gly Thr Gly Val     770 775 780 Ile Ala Val Phe Phe Trp Val Leu Leu Leu Leu Ile Phe Cys Asn Met 785 790 795 800 Arg Arg Pro Ala His Ala Asp Ile Lys Thr Gly Tyr Leu Ser Ile Ile                 805 810 815 Met Asp Pro Gly Glu Val Pro Leu Glu Glu Gln Cys Glu Tyr Leu Ser             820 825 830 Tyr Asp Ala Ser Gln Trp Glu Phe Pro Arg Glu Arg Leu His Leu Gly         835 840 845 Arg Val Leu Gly Tyr Gly Ala Phe Gly Lys Val Val Glu Ala Ser Ala     850 855 860 Phe Gly Ile His Lys Gly Ser Ser Cys Asp Thr Val Ala Val Lys Met 865 870 875 880 Leu Lys Glu Gly Ala Thr Ala Ser Glu His Arg Ala Leu Met Ser Glu                 885 890 895 Leu Lys Ile Leu Ile His Ile Gly Asn His Leu Asn Val Val Asn Leu             900 905 910 Leu Gly Ala Cys Thr Lys Pro Gln Gly Pro Leu Met Val Ile Val Glu         915 920 925 Phe Cys Lys Tyr Gly Asn Leu Ser Asn Phe Leu Arg Ala Lys Arg Asp     930 935 940 Ala Phe Ser Pro Cys Ala Glu Lys Ser Pro Glu Gln Arg Gly Arg Phe 945 950 955 960 Arg Ala Met Val Glu Leu Ala Arg Leu Asp Arg Arg Arg Pro Gly Ser                 965 970 975 Ser Asp Arg Val Leu Phe Ala Arg Phe Ser Lys Thr Glu Gly Gly Ala             980 985 990 Arg Arg Ala Ser Pro Asp Gln Glu Ala Glu Asp Leu Trp Leu Ser Pro         995 1000 1005 Leu Thr Met Glu Asp Leu Val Cys Tyr Ser Phe Gln Val Ala Arg Gly    1010 1015 1020 Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His Arg Asp Leu Ala Ala 1025 1030 1035 1040 Arg Asn Ile Leu Leu Ser Glu Ser Asp Val Val Lys Ile Cys Asp Phe                1045 1050 1055 Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp Tyr Val Arg Lys Gly            1060 1065 1070 Ser Ala Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Ser Ile Phe Asp        1075 1080 1085 Lys Val Tyr Thr Thr Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu    1090 1095 1100 Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr Pro Gly Val Gln Ile 1105 1110 1115 1120 Asn Glu Glu Phe Cys Gln Arg Leu Arg Asp Gly Thr Arg Met Arg Ala                1125 1130 1135 Pro Glu Leu Ala Thr Pro Ala Ile Arg Arg Ile Met Leu Asn Cys Trp            1140 1145 1150 Ser Gly Asp Pro Lys Ala Arg Pro Ala Phe Ser Glu Leu Val Glu Ile        1155 1160 1165 Leu Gly Asp Leu Leu Glu Gly Arg Gly Leu Gln Glu Glu Glu Glu Val    1170 1175 1180 Cys Met Ala Pro Arg Ser Ser Gln Ser Ser Glu Glu Gly Ser Phe Ser 1185 1190 1195 1200 Gln Val Ser Thr Met Ala Leu His Ile Ala Gln Ala Asp Ala Glu Asp                1205 1210 1215 Ser Pro Pro Ser Leu Gln Arg His Ser Leu Ala Ala Arg Tyr Tyr Asn            1220 1225 1230 Trp Val Ser Phe Pro Gly Cys Leu Ala Arg Gly Ala Glu Thr Arg Gly        1235 1240 1245 Ser Ser Arg Met Lys Thr Phe Glu Glu Phe Pro Met Thr Pro Thr Thr    1250 1255 1260 Tyr Lys Gly Ser Val Asp Asn Gln Thr Asp Ser Gly Met Val Leu Ala 1265 1270 1275 1280 Ser Glu Glu Phe Glu Glu Ile Glu Ser Arg His Glu Gn Glu Ser Gly                1285 1290 1295 Phe Arg         <210> 3 <211> 537 <212> PRT <213> Homo sapiens <400> 3 Tyr Ser Met Thr Pro Pro Thr Leu Asn Ile Thr Glu Glu Ser His Val   1 5 10 15 Ile Asp Thr Gly Asp Ser Leu Ser Ile Ser Cys Arg Gly Gln His Pro              20 25 30 Leu Glu Trp Ala Trp Pro Gly Ala Gln Glu Ala Pro Ala Thr Gly Asp          35 40 45 Lys Asp Ser Glu Asp Thr Gly Val Val Arg Asp Cys Glu Gly Thr Asp      50 55 60 Ala Arg Pro Tyr Cys Lys Val Leu Leu Leu His Glu Val His Ala Gln  65 70 75 80 Asp Thr Gly Ser Tyr Val Cys Tyr Tyr Lys Tyr Ile Lys Ala Arg Ile                  85 90 95 Glu Gly Thr Thr Ala Ala Ser Ser Tyr Val Phe Val Arg Asp Phe Glu             100 105 110 Gln Pro Phe Ile Asn Lys Pro Asp Thr Leu Leu Val Asn Arg Lys Asp         115 120 125 Ala Met Trp Val Pro Cys Leu Val Ser Ile Pro Gly Leu Asn Val Thr     130 135 140 Leu Arg Ser Ser Gln Ser Val Leu Trp Pro Asp Gly Gln Glu Val Val 145 150 155 160 Trp Asp Arg Arg Gly Met Leu Val Ser Thr Pro Leu Leu His Asp                 165 170 175 Ala Leu Tyr Leu Gln Cys Glu Thr Thr Trp Gly Asp Gln Asp Phe Leu             180 185 190 Ser Asn Pro Phe Leu Val His Ile Thr Gly Asn Glu Leu Tyr Asp Ile         195 200 205 Gln Leu Leu Pro Arg Lys Ser Leu Glu Leu Leu Val Gly Glu Lys Leu     210 215 220 Val Leu Asn Cys Thr Val Trp Ala Glu Phe Asn Ser Gly Val Thr Phe 225 230 235 240 Asp Trp Asp Tyr Pro Gly Lys Gln Ala Glu Arg Gly Lys Trp Val Pro                 245 250 255 Glu Arg Arg Ser Gln Gln Thr His Thr Glu Leu Ser Ser Ile Leu Thr             260 265 270 Ile His Asn Val Ser Gln His Asp Leu Gly Ser Tyr Val Cys Lys Ala         275 280 285 Asn Asn Gly Ile Gln Arg Phe Arg Glu Ser Thr Glu Val Ile Val His     290 295 300 Glu Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 305 310 315 320 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys                 325 330 335 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val             340 345 350 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr         355 360 365 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu     370 375 380 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 385 390 395 400 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys                 405 410 415 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln             420 425 430 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu         435 440 445 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro     450 455 460 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 465 470 475 480 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu                 485 490 495 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val             500 505 510 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln         515 520 525 Lys Ser Leu Ser Leu Ser Pro Gly Lys     530 535 <210> 4 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic linker <400> 4 Pro Ile Glu Gly Arg Gly Gly Gly Gly Gly   1 5 10 <210> 5 <211> 2292 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) (2292) <400> 5 atg gag agc aag gtg ctg ctg gcc gtc gcc ctg tgg ctc tgc gtg gag 48 Met Glu Ser Lys Val Leu Leu Ala Val Ala Leu Trp Leu Cys Val Glu   1 5 10 15 acc cgg gcc gcc tct gtg ggt ttg cct agt gtt tct ctt gat ctg ccc 96 Thr Arg Ala Ala Ser Val Gly Leu Pro Ser Val Ser Leu Asp Leu Pro              20 25 30 agg ctc agc ata caa aaa gac ata ctt aca att aag gct aat aca act 144 Arg Leu Ser Ile Gln Lys Asp Ile Leu Thr Ile Lys Ala Asn Thr Thr          35 40 45 ctt caa att act tgc agg gga cag agg gac ttg gac tgg ctt tgg ccc 192 Leu Gln Ile Thr Cys Arg Gly Gln Arg Asp Leu Asp Trp Leu Trp Pro      50 55 60 aat aat cag agt ggc agt gag caa agg gtg gag gtg act gag tgc agc 240 Asn Asn Gln Ser Gly Ser Glu Gln Arg Val Glu Val Thr Glu Cys Ser  65 70 75 80 gat ggc ctc ttc tgt aag aca ctc aca att cca aaa gtg atc gga aat 288 Asp Gly Leu Phe Cys Lys Thr Leu Thr Ile Pro Lys Val Ile Gly Asn                  85 90 95 gac act gga gcc tac aag tgc ttc tac cgg gaa act gac ttg gcc tcg 336 Asp Thr Gly Ala Tyr Lys Cys Phe Tyr Arg Glu Thr Asp Leu Ala Ser             100 105 110 gtc att tt gc tt tt ct ga tac aga tct cc ttt att gct tct 384 Val Ile Tyr Val Tyr Val Gln Asp Tyr Arg Ser Pro Phe Ile Ala Ser         115 120 125 gtt agt gac caa cat gga gtc gtg tac att act gag aac aaa aac aaa 432 Val Ser Asp Gln His Gly Val Val Tyr Ile Thr Glu Asn Lys Asn Lys     130 135 140 act gtg gtg att cca tgt ctc ggg tcc att tca aat ctc aac gtg tca 480 Thr Val Ile Pro Cys Leu Gly Ser Ile Ser Asn Leu Asn Val Ser 145 150 155 160 ctt tgt gca aga tac cca gaa aag aga ttt gtt cct gat ggt aac aga 528 Leu Cys Ala Arg Tyr Pro Glu Lys Arg Phe Val Pro Asp Gly Asn Arg                 165 170 175 att tcc tgg gac agc aag aag ggc ttt act att ccc agc tac atg atc 576 Ile Ser Trp Asp Ser Lys Lys Gly Phe Thr Ile Pro Ser Tyr Met Ile             180 185 190 agc tat gct ggc atg gtc ttc tgt gaa gca aaa att aat gat gaa agt 624 Ser Tyr Ala Gly Met Val Phe Cys Glu Ala Lys Ile Asn Asp Glu Ser         195 200 205 tac cag tct att tt tac ata gtt gtc gtt gta ggg tat agg att tat 672 Tyr Gln Ser Ile Met Tyr Ile Val Val Val Val Gly Tyr Arg Ile Tyr     210 215 220 gat gtg gtt ctg agt ccg tct cat gga att gaa cta tct gtt gga gaa 720 Asp Val Val Leu Ser Pro Ser Gly Ile Glu Leu Ser Val Gly Glu 225 230 235 240 aag ctt gtc tta aat tgt aca gca aga act gaa cta aat gtg ggg att 768 Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile                 245 250 255 gac ttc aac tgg gaa tac cct tct tcg aag cat cag cat aag aaa ctt 816 Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu             260 265 270 gta aac cga gac cta aaa acc cag tct ggg agt gag atg aag aaa ttt 864 Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe         275 280 285 ttg agc acc tta act ata gat ggt gta acc cgg agt gac caa gga ttg 912 Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu     290 295 300 tac acc tgt gca gca tcc agt ggg ctg atg acc aag aag aac agc aca 960 Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr 305 310 315 320 ttt gtc agg gtc cat gaa aaa cct ttt gtt gct ttt gga agt ggc atg 1008 Phe Val Arg Val Gly Lys Pro Phe Val Ala Phe Gly Ser Gly Met                 325 330 335 gaa tct ctg gtg gaa gcc acg gtg ggg gag cgt gtc aga atc cct gcg 1056 Glu Ser Leu Val Glu Ala Thr Val Gly Glu Arg Val Val Ile Pro Ala             340 345 350 aag tac ctg cg cc cca cca gaa ata aaa tgg tat aaa aat gga 1104 Lys Tyr Leu Gly Tyr Pro Pro Pro Glu Ile Lys Trp Tyr Lys Asn Gly         355 360 365 ata ccc ctt gag tcc aat cac aca aaa gcg ggg cat gta ctg acg 1152 Ile Pro Leu Glu Ser Asn His Thr Ile Lys Ala Gly His Val Leu Thr     370 375 380 att atg gaa gtg agt gaa aga gac aca gga aat tac act gtc atc ctt 1200 Ile Met Glu Val Ser Glu Arg Asp Thr Gly Asn Tyr Thr Val Ile Leu 385 390 395 400 acc aat ccc att tca aag gag aag cag agc cat gtg gtc tct ctg gtt 1248 Thr Asn Pro Ile Ser Lys Glu Lys Gln Ser His Val Val Ser Leu Val                 405 410 415 gtg taste gtc cca ccc cag att ggt gag aaa tct cta atc tct cct gtg 1296 Val Tyr Val Pro Pro Gln Ile Gly Glu Lys Ser Leu Ile Ser Pro Val             420 425 430 gat tcc tac cag tac ggc acc act caa acg ctg aca tgt acg gtc tat 1344 Asp Ser Tyr Gln Tyr Gly Thr Thr Gln Thr Leu Thr Cys Thr Val Tyr         435 440 445 gcc cct ccc ccg cat cac atc cac tgg tat tgg cag ttg gag gaa 1392 Ala Ile Pro Pro His His His Ile His Trp Tyr Trp Gln Leu Glu Glu     450 455 460 gag tgc gcc aac gag ccc agc caa gct gtc tca gtg aca aac cca tac 1440 Glu Cys Ala Asn Glu Pro Ser Gln Ala Val Ser Val Thr Asn Pro Tyr 465 470 475 480 cct tgt gaa gaa tgg aga agt gtg gag gac ttc cag gga gga aat aaa 1488 Pro Cys Glu Glu Trp Arg Ser Val Glu Asp Phe Gln Gly Gly Asn Lys                 485 490 495 att gaa gtt aat aaa aat caa ttt gct cta att gaa gga aaa aac aaa 1536 Ile Glu Val Asn Lys Asn Gln Phe Ala Leu Ile Glu Gly Lys Asn Lys             500 505 510 act gta agt acc ctt gtt atc caa gcg gca aat gtg tca gct ttg tac 1584 Thr Val Ser Thr Leu Val Ile Gln Ala Ala Asn Val Ser Ala Leu Tyr         515 520 525 aaa tgt gaa gcg gtc aac aaa gtc ggg aga gga gag agg gtg atc tcc 1632 Lys Cys Glu Ala Val Asn Lys Val Gly Arg Gly Glu Arg Val Ile Ser     530 535 540 ttc cac gtg acc agg ggt cct gaa att act ttg caa cct gac atg cag 1680 Phe His Val Thr Arg Gly Pro Glu Ile Thr Leu Gln Pro Asp Met Gln 545 550 555 560 ccc act gag cag gag agc gtg tct ttg tgg tgc act gca gac aga tct 1728 Pro Thr Glu Gln Glu Ser Val Ser Leu Trp Cys Thr Ala Asp Arg Ser                 565 570 575 acg ttt gag aac ctc aca tgg tac aag ctt ggc cca cag cct ctg cca 1776 Thr Phe Glu Asn Leu Thr Trp Tyr Lys Leu Gly Pro Gln Pro Leu Pro             580 585 590 atc cat gtg gga gag ttg ccc aca cct gtt tgc aag aac ttg gat act 1824 Ile His Val Gly Glu Leu Pro Thr Pro Val Cys Lys Asn Leu Asp Thr         595 600 605 ctt tgg aaa ttg aat gcc acc atg ttc tct aat agc aca aat gac att 1872 Leu Trp Lys Leu Asn Ala Thr Met Phe Ser Asn Ser Thr Asn Asp Ile     610 615 620 ttg atc atg gag ctt aag aat gcc tcc ttg cag gac caa gga gac tat 1920 Leu Ile Met Glu Leu Lys Asn Ala Ser Leu Gln Asp Gln Gly Asp Tyr 625 630 635 640 gtc tgc ctt gct caa gac agg aag acc aag aaa aga cat tgc gtg gtc 1968 Val Cys Leu Ala Gln Asp Arg Lys Thr Lys Lys Arg His Cys Val Val                 645 650 655 agg cag ctc aca gtc cta gag cgt gtg gca ccc acg atc aca gga aac 2016 Arg Gln Leu Thr Val Leu Glu Arg Val Ala Pro Thr Ile Thr Gly Asn             660 665 670 ctg gag aat cag acg aca agt att ggg gaa agc atc gaa gtc tca tgc 2064 Leu Glu Asn Gln Thr Thr Ser Ile Gly Glu Ser Ile Glu Val Ser Cys         675 680 685 acg gc tct ggg aat ccc cct cca cag atc atg tgg ttt aaa gat aat 2112 Thr Ala Ser Gly Asn Pro Pro Pro Gln Ile Met Trp Phe Lys Asp Asn     690 695 700 gag acc ctt gta gaa gac tca ggc att gta ttg aag gat ggg aac cgg 2160 Glu Thr Leu Val Glu Asp Ser Gly Ile Val Leu Lys Asp Gly Asn Arg 705 710 715 720 aac ctc act atc cgc aga gtg agg aag gag gac gaa ggc ctc tac acc 2208 Asn Leu Thr Ile Arg Arg Val Val Lys Glu Asp Glu Gly Leu Tyr Thr                 725 730 735 tgc cag gca tgc agt gtt ctt ggc tgt gca aaa gtg gag gca ttt ttc 2256 Cys Gln Ala Cys Ser Val Leu Gly Cys Ala Lys Val Glu Ala Phe Phe             740 745 750 ata ata gaa ggt gcc cag gaa aag acg aac ttg gaa 2292 Ile Ile Glu Gly Ala Gln Glu Lys Thr Asn Leu Glu         755 760 <210> 6 <211> 764 <212> PRT <213> Homo sapiens <400> 6 Met Glu Ser Lys Val Leu Leu Ala Val Ala Leu Trp Leu Cys Val Glu   1 5 10 15 Thr Arg Ala Ala Ser Val Gly Leu Pro Ser Val Ser Leu Asp Leu Pro              20 25 30 Arg Leu Ser Ile Gln Lys Asp Ile Leu Thr Ile Lys Ala Asn Thr Thr          35 40 45 Leu Gln Ile Thr Cys Arg Gly Gln Arg Asp Leu Asp Trp Leu Trp Pro      50 55 60 Asn Asn Gln Ser Gly Ser Glu Gln Arg Val Glu Val Thr Glu Cys Ser  65 70 75 80 Asp Gly Leu Phe Cys Lys Thr Leu Thr Ile Pro Lys Val Ile Gly Asn                  85 90 95 Asp Thr Gly Ala Tyr Lys Cys Phe Tyr Arg Glu Thr Asp Leu Ala Ser             100 105 110 Val Ile Tyr Val Tyr Val Gln Asp Tyr Arg Ser Pro Phe Ile Ala Ser         115 120 125 Val Ser Asp Gln His Gly Val Val Tyr Ile Thr Glu Asn Lys Asn Lys     130 135 140 Thr Val Ile Pro Cys Leu Gly Ser Ile Ser Asn Leu Asn Val Ser 145 150 155 160 Leu Cys Ala Arg Tyr Pro Glu Lys Arg Phe Val Pro Asp Gly Asn Arg                 165 170 175 Ile Ser Trp Asp Ser Lys Lys Gly Phe Thr Ile Pro Ser Tyr Met Ile             180 185 190 Ser Tyr Ala Gly Met Val Phe Cys Glu Ala Lys Ile Asn Asp Glu Ser         195 200 205 Tyr Gln Ser Ile Met Tyr Ile Val Val Val Val Gly Tyr Arg Ile Tyr     210 215 220 Asp Val Val Leu Ser Pro Ser Gly Ile Glu Leu Ser Val Gly Glu 225 230 235 240 Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile                 245 250 255 Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu             260 265 270 Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe         275 280 285 Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu     290 295 300 Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr 305 310 315 320 Phe Val Arg Val Gly Lys Pro Phe Val Ala Phe Gly Ser Gly Met                 325 330 335 Glu Ser Leu Val Glu Ala Thr Val Gly Glu Arg Val Val Ile Pro Ala             340 345 350 Lys Tyr Leu Gly Tyr Pro Pro Pro Glu Ile Lys Trp Tyr Lys Asn Gly         355 360 365 Ile Pro Leu Glu Ser Asn His Thr Ile Lys Ala Gly His Val Leu Thr     370 375 380 Ile Met Glu Val Ser Glu Arg Asp Thr Gly Asn Tyr Thr Val Ile Leu 385 390 395 400 Thr Asn Pro Ile Ser Lys Glu Lys Gln Ser His Val Val Ser Leu Val                 405 410 415 Val Tyr Val Pro Pro Gln Ile Gly Glu Lys Ser Leu Ile Ser Pro Val             420 425 430 Asp Ser Tyr Gln Tyr Gly Thr Thr Gln Thr Leu Thr Cys Thr Val Tyr         435 440 445 Ala Ile Pro Pro His His His Ile His Trp Tyr Trp Gln Leu Glu Glu     450 455 460 Glu Cys Ala Asn Glu Pro Ser Gln Ala Val Ser Val Thr Asn Pro Tyr 465 470 475 480 Pro Cys Glu Glu Trp Arg Ser Val Glu Asp Phe Gln Gly Gly Asn Lys                 485 490 495 Ile Glu Val Asn Lys Asn Gln Phe Ala Leu Ile Glu Gly Lys Asn Lys             500 505 510 Thr Val Ser Thr Leu Val Ile Gln Ala Ala Asn Val Ser Ala Leu Tyr         515 520 525 Lys Cys Glu Ala Val Asn Lys Val Gly Arg Gly Glu Arg Val Ile Ser     530 535 540 Phe His Val Thr Arg Gly Pro Glu Ile Thr Leu Gln Pro Asp Met Gln 545 550 555 560 Pro Thr Glu Gln Glu Ser Val Ser Leu Trp Cys Thr Ala Asp Arg Ser                 565 570 575 Thr Phe Glu Asn Leu Thr Trp Tyr Lys Leu Gly Pro Gln Pro Leu Pro             580 585 590 Ile His Val Gly Glu Leu Pro Thr Pro Val Cys Lys Asn Leu Asp Thr         595 600 605 Leu Trp Lys Leu Asn Ala Thr Met Phe Ser Asn Ser Thr Asn Asp Ile     610 615 620 Leu Ile Met Glu Leu Lys Asn Ala Ser Leu Gln Asp Gln Gly Asp Tyr 625 630 635 640 Val Cys Leu Ala Gln Asp Arg Lys Thr Lys Lys Arg His Cys Val Val                 645 650 655 Arg Gln Leu Thr Val Leu Glu Arg Val Ala Pro Thr Ile Thr Gly Asn             660 665 670 Leu Glu Asn Gln Thr Thr Ser Ile Gly Glu Ser Ile Glu Val Ser Cys         675 680 685 Thr Ala Ser Gly Asn Pro Pro Pro Gln Ile Met Trp Phe Lys Asp Asn     690 695 700 Glu Thr Leu Val Glu Asp Ser Gly Ile Val Leu Lys Asp Gly Asn Arg 705 710 715 720 Asn Leu Thr Ile Arg Arg Val Val Lys Glu Asp Glu Gly Leu Tyr Thr                 725 730 735 Cys Gln Ala Cys Ser Val Leu Gly Cys Ala Lys Val Glu Ala Phe Phe             740 745 750 Ile Ile Glu Gly Ala Gln Glu Lys Thr Asn Leu Glu         755 760 <210> 7 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Synthetic linker <400> 7 Glu Phe Gly Ala Gly Leu Val Leu Gly Gly Gln Phe Met   1 5 10 <210> 8 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Synthetic linker <400> 8 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser   1 5 10 15 <210> 9 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Synthetic linker <400> 9 Gly Gly Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser   1 5 10 15 <210> 10 <211> 5777 <212> DNA <213> Homo sapiens <220> <221> misc_feature (222) (4263) <223> VEGFR-1 <220> <221> CDS (222) (4263) <400> 10 gcggacactc ctctcggctc ctccccggca gcggcggcgg ctcggagcgg gctccggggc 60 tcgggtgcag cggccagcgg gcctggcggc gaggattacc cggggaagtg gttgtctcct 120 ggctggagcc gcgagacggg cgctcagggc gcggggccgg cggcggcgaa cgagaggacg 180 gactctggcg gccgggtcgt tggccggggg agcgcgggca ccgggcgagc aggccgcgtc 240 gcgctcacc atg gtc agc tac tgg gac acc ggg gtc ctg ctg tgc gcg ctg 291            Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu              1 5 10 ctc agc tgt ctg ctt ctc aca gga tct agt tca ggt tca aaa tta aaa 339 Leu Ser Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys  15 20 25 30 gat cct gaa ctg agt tta aaa ggc acc cag cac atc atg caa gca ggc 387 Asp Pro Glu Leu Ser Leu Lys Gly Thr Gln His Ile Met Gln Ala Gly                  35 40 45 cag aca ctg cat ctc caa tgc agg ggg gaa gca gcc cat aaa tgg tct 435 Gln Thr Leu His Leu Gln Cys Arg Gly Glu Ala Ala His Lys Trp Ser              50 55 60 ttg cct gaa atg gtg agt aag gaa agc gaa agg ctg agc ata act aaa 483 Leu Pro Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys          65 70 75 tct gcc tgt gga aga aat ggc aaa caa ttc tgc agt act tta acc ttg 531 Ser Ala Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu      80 85 90 aac aca gct caa gca aac cac act ggc ttc tac agc tgc aaa tat cta 579 Asn Thr Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu  95 100 105 110 gct cct act tca aag aag aag gaa aca gaa tct gca atc tat ata 627 Ala Val Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile                 115 120 125 ttt att agt gat aca ggt aga cct ttc gta gag atg tac agt gaa atc 675 Phe Ile Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile             130 135 140 ccc gaa att ata cac atg act gaa gga agg gag ctc gtc att ccc tgc 723 Pro Glu Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys         145 150 155 cgg gtt acg tca cct aac atc act gtt act tta aaa aag ttt cca ctt 771 Arg Val Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu     160 165 170 gac act ttg atc cct gat gga aaa cgc ata atc tgg gac agt aga aag 819 Asp Thr Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys 175 180 185 190 ggc ttc atc ata tca aat gca acg tac aaa gaa ata ggg ctt ctg acc 867 Gly Phe Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr                 195 200 205 tgt gaa gca aca gtc aat ggg cat ttg tat aag aca aac tat ctc aca 915 Cys Glu Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr             210 215 220 cat cga caa acc aat aca atc ata gat gtc caa ata agc aca cca cgc 963 His Arg Gln Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg         225 230 235 cca gtc aaa tta ctt aga ggc cat act ctt gtc ctc aat tgt act gct 1011 Pro Val Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys Thr Ala     240 245 250 acc act ccc ttg aac acg aga gtt caa atg acc tgg agt tac cct gat 1059 Thr Thr Pro Leu Asn Thr Arg Val Gln Met Thr Trp Ser Tyr Pro Asp 255 260 265 270 gaa aaa aat aag aga gct tcc gta agg cga cga att gac caa agc aat 1107 Glu Lys Asn Lys Arg Ala Ser Val Arg Arg Arg Ile Asp Gln Ser Asn                 275 280 285 tcc cat gcc aac ata ttc tac agt gtt ctt act att gac aaa atg cag 1155 Ser His Ala Asn Ile Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln             290 295 300 aac aaa gac aaa gga ctt tat act tgt cgt gta agg agt gga cca tca 1203 Asn Lys Asp Lys Gly Leu Tyr Thr Cys Arg Val Val Arg Ser Gly Pro Ser         305 310 315 ttc aaa tct gtt aac acc tca gtg cat ata tat gat aaa gca ttc atc 1251 Phe Lys Ser Val Asn Thr Ser Val His Ile Tyr Asp Lys Ala Phe Ile     320 325 330 act gtg aaa cat cga aaa cag cag gtg ctt gaa acc gta gct ggc aag 1299 Thr Val Lys His Arg Lys Gln Gln Val Leu Glu Thr Val Ala Gly Lys 335 340 345 350 cgg tct tac cgg ctc tct atg aaa gtg aag gc ttt ccc tcg ccg gaa 1347 Arg Ser Tyr Arg Leu Ser Met Lys Val Lys Ala Phe Pro Ser Pro Glu                 355 360 365 gtt gta tgg tta aaa gat ggg tta cct gcg act gag aaa tct gct cgc 1395 Val Val Trp Leu Lys Asp Gly Leu Pro Ala Thr Glu Lys Ser Ala Arg             370 375 380 tat ttg act cgt ggc tac tcg tta att atacag gac gta act gaa gag 1443 Tyr Leu Thr Arg Gly Tyr Ser Leu Ile Ile Lys Asp Val Thr Glu Glu         385 390 395 gat ga gat aat tat aca atc ttg ctg agc ata aaa cag tca aat gtg 1491 Asp Ala Gly Asn Tyr Thr Ile Leu Leu Ser Ile Lys Gln Ser Asn Val     400 405 410 ttt aaa aac ctc act gcc act cta att gtc aat gta aaa ccc cag att 1539 Phe Lys Asn Leu Thr Ala Thr Leu Ile Val Asn Val Lys Pro Gln Ile 415 420 425 430 tac gaa aag gcc gtg tca tcg ttt cca gac ccg gct ctc tac cca ctg 1587 Tyr Glu Lys Ala Val Ser Ser Phe Pro Asp Pro Ala Leu Tyr Pro Leu                 435 440 445 ggc agc aga caa atc ctg act tgt acc gca tat ggt atc cct caa cct 1635 Gly Ser Arg Gln Ile Leu Thr Cys Thr Ala Tyr Gly Ile Pro Gln Pro             450 455 460 aca atc aag tgg ttc tgg cac ccc tgt aac cat aat cat tcc gaa gca 1683 Thr Ile Lys Trp Phe Trp His Pro Cys Asn His Asn His Ser Glu Ala         465 470 475 agg tgt gac ttt tgt tcc aat aat gaa gag tcc ttt atc ctg gat gct 1731 Arg Cys Asp Phe Cys Ser Asn Asn Glu Glu Ser Phe Ile Leu Asp Ala     480 485 490 gac agc aac atg gga aac aga att gag agc atc act cag cgc atg gca 1779 Asp Ser Asn Met Gly Asn Arg Ile Glu Ser Ile Thr Gln Arg Met Ala 495 500 505 510 ata ata gaa gga aag aat aag atg gct agc acc ttg gtt gtg gct gac 1827 Ile Ile Glu Gly Lys Asn Lys Met Ala Ser Thr Leu Val Val Ala Asp                 515 520 525 tct aga att tct gga atc tac att tgc ata gct tcc aat aaa gtt ggg 1875 Ser Arg Ile Ser Gly Ile Tyr Ile Cys Ile Ala Ser Asn Lys Val Gly             530 535 540 act gtg gga aga aac ata agc ttt tat atc aca gat gtg cca aat ggg 1923 Thr Val Gly Arg Asn Ile Ser Phe Tyr Ile Thr Asp Val Pro Asn Gly         545 550 555 ttt cat gtt aac ttg gaa aaa atg ccg acg gaa gga gag gac ctg aaa 1971 Phe His Val Asn Leu Glu Lys Met Pro Thr Glu Gly Glu Asp Leu Lys     560 565 570 ctg tct tgc aca gtt aac aag ttc tta tac aga gac gtt act tgg att 2019 Leu Ser Cys Thr Val Asn Lys Phe Leu Tyr Arg Asp Val Thr Trp Ile 575 580 585 590 tta ctg cgg aca gtt aat aac aga aca atg cac tac agt att agc aag 2067 Leu Leu Arg Thr Val Asn Asn Arg Thr Met His Tyr Ser Ile Ser Lys                 595 600 605 caa aaa atg gcc atc act aag gag cac tcc atc act ctt aat ctt acc 2115 Gln Lys Met Ala Ile Thr Lys Glu His Ser Ile Thr Leu Asn Leu Thr             610 615 620 atc atg aat gt tcc ctg caa gat tca ggc acc tat gcc tgc aga gcc 2163 Ile Met Asn Val Ser Leu Gln Asp Ser Gly Thr Tyr Ala Cys Arg Ala         625 630 635 agg aat gta tac aca ggg gaa gaa atc ctc cag aag aaa gaa att aca 2211 Arg Asn Val Tyr Thr Gly Glu Glu Ile Leu Gln Lys Lys Glu Ile Thr     640 645 650 atc aga gat cag gaa gca cca tac ctc ctg cga aac ctc agt gat cac 2259 Ile Arg Asp Gln Glu Ala Pro Tyr Leu Leu Arg Asn Leu Ser Asp His 655 660 665 670 aca gtg gcc atc agc agt tcc acc act tta gac tgt cat gct aat ggt 2307 Thr Val Ala Ile Ser Ser Thr Thr Leu Asp Cys His Ala Asn Gly                 675 680 685 gtc ccc gag cct cag atc act tgg ttt aaa aac aac cac aaa ata caa 2355 Val Pro Glu Pro Gln Ile Thr Trp Phe Lys Asn Asn His Lys Ile Gln             690 695 700 caa gag cct gga att tta gga cca gga agc agc acg ctg ttt att 2403 Gln Glu Pro Gly Ile Ile Leu Gly Pro Gly Ser Ser Thr Leu Phe Ile         705 710 715 gaa aga gtc aca gaa gag gat gaa ggt gtc tat cac tgc aaa gcc acc 2451 Glu Arg Val Thr Glu Glu Asp Glu Gly Val Tyr His Cys Lys Ala Thr     720 725 730 aac cag aag ggc tct gtg gaa agt tca gca tac ctc act gtt caa gga 2499 Asn Gln Lys Gly Ser Val Glu Ser Ser Ala Tyr Leu Thr Ser Gln Gly 735 740 745 750 acc tcg gac aag tct aat ctg gag ctg atc act cta aca tgc acc tgt 2547 Thr Ser Asp Lys Ser Asn Leu Glu Leu Ile Thr Leu Thr Cys Thr Cys                 755 760 765 gtg gct gcg act ctc ttc tgg ctc cta tta acc ctc ctt atc cga aaa 2595 Val Ala Ala Thr Leu Phe Trp Leu Leu Leu Thr Leu Leu Ile Arg Lys             770 775 780 atg aaa agg tc tct tct gaa ata aag act gac tac cta tca att ata 2643 Met Lys Arg Ser Ser Ser Glu Ile Lys Thr Asp Tyr Leu Ser Ile Ile         785 790 795 atg gac cca gat gaa gtt cct ttg gat gag cag tgt gag cgg ctc cct 2691 Met Asp Pro Asp Glu Val Pro Leu Asp Glu Gln Cys Glu Arg Leu Pro     800 805 810 tat gat gcc agc aag tgg gag ttt gcc cgg gag aga ctt aaa ctg ggc 2739 Tyr Asp Ala Ser Lys Trp Glu Phe Ala Arg Glu Arg Leu Lys Leu Gly 815 820 825 830 aaa tca ctt gga aga ggg gct ttt gga aaa gtg gta caa gca tca gca 2787 Lys Ser Leu Gly Arg Gly Ala Phe Gly Lys Val Val Gln Ala Ser Ala                 835 840 845 ttt ggc att aag aaa tca cct acg tgc cgg act gtg gct gtg aaa atg 2835 Phe Gly Ile Lys Lys Ser Pro Thr Cys Arg Thr Val Ala Val Lys Met             850 855 860 ctg aaa gag ggg gcc acg gcc agc gag tac aaa gct ctg atg act gag 2883 Leu Lys Glu Gly Ala Thr Ala Ser Glu Tyr Lys Ala Leu Met Thr Glu         865 870 875 cta aaa atc ttg acc cac att ggc cac cat ctg aac gtg gtt aac ctg 2931 Leu Lys Ile Leu Thr His Ile Gly His His Leu Asn Val Val Asn Leu     880 885 890 ctg gga gcc tgc acc aag caa gga ggg cct ctg atg gtg att gtt gaa 2979 Leu Gly Ala Cys Thr Lys Gln Gly Gly Pro Leu Met Val Ile Val Glu 895 900 905 910 tac tgc aaa tat gga aat ctc tcc aac tac ctc aag agc aaa cgt gac 3027 Tyr Cys Lys Tyr Gly Asn Leu Ser Asn Tyr Leu Lys Ser Lys Arg Asp                 915 920 925 tta ttt ttt ctc aac aag gat gca gca cta cac atg gag cct aag aaa 3075 Leu Phe Phe Leu Asn Lys Asp Ala Ala Leu His Met Glu Pro Lys Lys             930 935 940 gaa aaa atg gag cca ggc ctg gaa caa ggc aag aaa cca aga cta gat 3123 Glu Lys Met Glu Pro Gly Leu Glu Gln Gly Lys Lys Pro Arg Leu Asp         945 950 955 agc gtc acc agc agc gaa agc ttt gcg agc tcc ggc ttt cag gaa gat 3171 Ser Val Thr Ser Ser Glu Ser Phe Ala Ser Ser Gly Phe Gln Glu Asp     960 965 970 aaa agt ctg agt gat gtt gag gaa gag gag gat tct gac ggt ttc tac 3219 Lys Ser Leu Ser Asp Val Glu Glu Glu Glu Asp Ser Asp Gly Phe Tyr 975 980 985 990 aag gag ccc atc act atg gaa gat ctg att tct tac agt ttt caa gtg 3267 Lys Glu Pro Ile Thr Met Glu Asp Leu Ile Ser Tyr Ser Phe Gln Val                 995 1000 1005 gcc aga ggc atg gag ttc ctg tct tcc aga aag tgc att cat cgg gac 3315 Ala Arg Gly Met Glu Phe Leu Ser Ser Arg Lys Cys Ile His Arg Asp            1010 1015 1020 ctg gca gcg aga aac att ctt tta tct gag aac aac gtg gtg aag att 3363 Leu Ala Ala Arg Asn Ile Leu Leu Ser Glu Asn As Val Val Lys Ile        1025 1030 1035 tgt gat ttt ggc ctt gcc cgg gat att tat aag aac ccc gat tat gtg 3411 Cys Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asn Pro Asp Tyr Val    1040 1045 1050 aga aaa gga gat act cga ctt cct ctg aaa tgg atg gct ccc gaa tct 3459 Arg Lys Gly Asp Thr Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Ser 1055 1060 1065 1070 atc ttt gac aaa atc tac agc acc aag agc gac gtg tgg tct tac gga 3507 Ile Phe Asp Lys Ile Tyr Ser Thr Lys Ser Asp Val Trp Ser Tyr Gly                1075 1080 1085 gta ttg ctg tgg gaa atc ttc tcc tta ggt ggg tct cca tac cca gga 3555 Val Leu Leu Trp Glu Ile Phe Ser Leu Gly Gly Ser Pro Tyr Pro Gly            1090 1095 1100 gta caa atg gat gag gac ttt tgc agt cgc ctg agg gaa ggc atg agg 3603 Val Gln Met Asp Glu Asp Phe Cys Ser Arg Leu Arg Glu Gly Met Arg        1105 1110 1115 atg aga gct cct gag tac tct act cct gaa atc tat cag atc atg ctg 3651 Met Arg Ala Pro Glu Tyr Ser Thr Pro Glu Ile Tyr Gln Ile Met Leu    1120 1125 1130 gac tgc tgg cac aga gac cca aaa gaa agg cca aga ttt gca gaa ctt 3699 Asp Cys Trp His Arg Asp Pro Lys Glu Arg Pro Arg Phe Ala Glu Leu 1135 1140 1145 1150 gtg gaa aaa cta ggt gat ttg ctt caa gca aat gta caa cag gat ggt 3747 Val Glu Lys Leu Gly Asp Leu Leu Gln Ala Asn Val Gln Gln Asp Gly                1155 1160 1165 aaa gac tac atc cca atc aat gcc ata ctg aca gga aat agt ggg ttt 3795 Lys Asp Tyr Ile Pro Ile Asn Ale Ile Leu Thr Gly Asn Ser Gly Phe            1170 1175 1180 aca tac tca act cct gcc ttc tct gag gac ttc ttc aag gaa agt att 3843 Thr Tyr Ser Thr Pro Ala Phe Ser Glu Asp Phe Phe Lys Glu Ser Ile        1185 1190 1195 tca gct ccg aag ttt aat tca gga agc tct gat gat gtc aga tat gta 3891 Ser Ala Pro Lys Phe Asn Ser Gly Ser Ser Asp Val Val Arg Tyr Val    1200 1205 1210 aat gct ttc aag ttc atg agc ctg gaa aga atc aaa acc ttt gaa gaa 3939 Asn Ala Phe Lys Phe Met Ser Leu Glu Arg Ile Lys Thr Phe Glu Glu 1215 1220 1225 1230 ctt tta ccg aat gcc acc tcc atg ttt gat gac tac cag ggc gac agc 3987 Leu Leu Pro Asn Ala Thr Ser Met Phe Asp Asp Tyr Gln Gly Asp Ser                1235 1240 1245 agc act ctg ttg gcc tct ccc atg ctg aag cgc ttc acc tgg act gac 4035 Ser Thr Leu Leu Ala Ser Pro Met Leu Lys Arg Phe Thr Trp Thr Asp            1250 1255 1260 agc aaa ccc aag gcc tcg ctc aag att gac ttg aga gta acc agt aaa 4083 Ser Lys Pro Lys Ala Ser Leu Lys Ile Asp Leu Arg Val Thr Ser Lys        1265 1270 1275 agt aag gag tcg ggg ctg tct gat gtc agc agg ccc agt ttc tgc cat 4131 Ser Lys Glu Ser Gly Leu Ser Asp Ser Ser Arg Pro Ser Phe Cys His    1280 1285 1290 tcc agc tgt ggg cac gtc agc gaa ggc aag cgc agg ttc acc tac gac 4179 Ser Ser Cys Gly His Val Ser Glu Gly Lys Arg Arg Phe Thr Tyr Asp 1295 1300 1305 1310 cac gct gag ctg gaa agg aaa atc gcg tgc tgc tcc ccg ccc cca gac 4227 His Ala Glu Leu Glu Arg Lys Ile Ala Cys Cys Ser Pro Pro Pro Asp                1315 1320 1325 tac aac tcg gtg gtc ctg tac tcc acc cca ccc atc tagagtt 4270 Tyr Asn Ser Val Val Leu Tyr Ser Thr Pro Pro Ile            1330 1335 tgacacgaag ccttatttct agaagcacat gtgtatttat acccccagga aactagcttt 4330 tgccagtatt atgcatatat aagtttacac ctttatcttt ccatgggagc cagctgcttt 4390 ttgtgatttt tttaatagtg cttttttttt ttgactaaca agaatgtaac tccagataga 4450 gaaatagtga caagtgaaga acactactgc taaatcctca tgttactcag tgttagagaa 4510 atccttccta aacccaatga cttccctgct ccaacccccg ccacctcagg gcacgcagga 4570 ccagtttgat tgaggagctg cactgatcac ccaatgcatc acgtacccca ctgggccagc 4630 cctgcagccc aaaacccagg gcaacaagcc cgttagcccc aggggatcac tggctggcct 4690 gagcaacatc tcgggagtcc tctagcaggc ctaagacatg tgaggaggaa aaggaaaaaa 4750 agcaaaaagc aagggagaaa agagaaaccg ggagaaggca tgagaaagaa tttgagacgc 4810 accatgtggg cacggagggg gacggggctc agcaatgcca tttcagtggc ttcccagctc 4870 tgacccttct acatttgagg gcccagccag gagcagatgg acagcgatga ggggacattt 4930 tctggattct gggaggcaag aaaaggacaa atatcttttt tggaactaaa gcaaatttta 4990 gacctttacc tatggaagtg gttctatgtc cattctcatt cgtggcatgt tttgatttgt 5050 agcactgagg gtggcactca actctgagcc catacttttg gctcctctag taagatgcac 5110 tgaaaactta gccagagtta ggttgtctcc aggccatgat ggccttacac tgaaaatgtc 5170 acattctatt ttgggtatta atatatagtc cagacactta actcaatttc ttggtattat 5230 tctgttttgc acagttagtt gtgaaagaaa gctgagaaga atgaaaatgc agtcctgagg 5290 agagttttct ccatatcaaa acgagggctg atggaggaaa aaggtcaata aggtcaaggg 5350 aagaccccgt ctctatacca accaaaccaa ttcaccaaca cagttgggac ccaaaacaca 5410 ggaagtcagt cacgtttcct tttcatttaa tggggattcc actatctcac actaatctga 5470 aaggatgtgg aagagcatta gctggcgcat attaagcact ttaagctcct tgagtaaaaa 5530 ggtggtatgt aatttatgca aggtatttct ccagttggga ctcaggatat tagttaatga 5590 gccatcacta gaagaaaagc ccattttcaa ctgctttgaa acttgcctgg ggtctgagca 5650 tgatgggaat agggagacag ggtaggaaag ggcgcctact cttcagggtc taaagatcaa 5710 gtgggccttg gatcgctaag ctggctctgt ttgatgctat ttatgcaagt tagggtctat 5770 gtattta 5777 <210> 11 <211> 1338 <212> PRT <213> Homo sapiens <400> 11 Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser   1 5 10 15 Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys Asp Pro              20 25 30 Glu Leu Ser Leu Lys Gly Thr Gln His Ile Met Gln Ala Gly Gln Thr          35 40 45 Leu His Leu Gln Cys Arg Gly Glu Ala Ala His Lys Trp Ser Leu Pro      50 55 60 Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys Ser Ala  65 70 75 80 Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu Asn Thr                  85 90 95 Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu Ala Val             100 105 110 Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile Phe Ile         115 120 125 Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu     130 135 140 Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val 145 150 155 160 Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr                 165 170 175 Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe             180 185 190 Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu         195 200 205 Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg     210 215 220 Gln Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg Pro Val 225 230 235 240 Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys Thr Ala Thr Thr                 245 250 255 Pro Leu Asn Thr Arg Val Gln Met Thr Trp Ser Tyr Pro Asp Glu Lys             260 265 270 Asn Lys Arg Ala Ser Val Arg Arg Ile Asp Gln Ser Asn Ser His         275 280 285 Ala Asn Ile Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln Asn Lys     290 295 300 Asp Lys Gly Leu Tyr Thr Cys Arg Val Val Arg Ser Gly Pro Ser Phe Lys 305 310 315 320 Ser Val Asn Thr Ser Val His Ile Tyr Asp Lys Ala Phe Ile Thr Val                 325 330 335 Lys His Arg Lys Gln Gln Val Leu Glu Thr Val Ala Gly Lys Arg Ser             340 345 350 Tyr Arg Leu Ser Met Lys Val Lys Ala Phe Pro Ser Pro Glu Val Val         355 360 365 Trp Leu Lys Asp Gly Leu Pro Ala Thr Glu Lys Ser Ala Arg Tyr Leu     370 375 380 Thr Arg Gly Tyr Ser Leu Ile Ile Lys Asp Val Thr Glu Glu Asp Ala 385 390 395 400 Gly Asn Tyr Thr Ile Leu Leu Ser Ile Lys Gln Ser Asn Val Phe Lys                 405 410 415 Asn Leu Thr Ala Thr Leu Ile Val Asn Val Lys Pro Gln Ile Tyr Glu             420 425 430 Lys Ala Val Ser Ser Phe Pro Asp Pro Ala Leu Tyr Pro Leu Gly Ser         435 440 445 Arg Gln Ile Leu Thr Cys Thr Ala Tyr Gly Ile Pro Gln Pro Thr Ile     450 455 460 Lys Trp Phe Trp His Pro Cys Asn His Asn His Ser Glu Ala Arg Cys 465 470 475 480 Asp Phe Cys Ser Asn Asn Glu Glu Ser Phe Ile Leu Asp Ala Asp Ser                 485 490 495 Asn Met Gly Asn Arg Ile Glu Ser Ile Thr Gln Arg Met Ala Ile Ile             500 505 510 Glu Gly Lys Asn Lys Met Ala Ser Thr Leu Val Val Ala Asp Ser Arg         515 520 525 Ile Ser Gly Ile Tyr Ile Cys Ile Ala Ser Asn Lys Val Gly Thr Val     530 535 540 Gly Arg Asn Ile Ser Phe Tyr Ile Thr Asp Val Pro Asn Gly Phe His 545 550 555 560 Val Asn Leu Glu Lys Met Pro Thr Glu Gly Glu Asp Leu Lys Leu Ser                 565 570 575 Cys Thr Val Asn Lys Phe Leu Tyr Arg Asp Val Thr Trp Ile Leu Leu             580 585 590 Arg Thr Val Asn Asn Arg Thr Met His Tyr Ser Ile Ser Lys Gln Lys         595 600 605 Met Ala Ile Thr Lys Glu His Ser Ile Thr Leu Asn Leu Thr Ile Met     610 615 620 Asn Val Ser Leu Gln Asp Ser Gly Thr Tyr Ala Cys Arg Ala Arg Asn 625 630 635 640 Val Tyr Thr Gly Glu Glu Ile Leu Gln Lys Lys Glu Ile Thr Ile Arg                 645 650 655 Asp Gln Glu Ala Pro Tyr Leu Leu Arg Asn Leu Ser Asp His Thr Val             660 665 670 Ala Ile Ser Ser Thr Thr Leu Asp Cys His Ala Asn Gly Val Pro         675 680 685 Glu Pro Gln Ile Thr Trp Phe Lys Asn Asn His Lys Ile Gln Gln Glu     690 695 700 Pro Gly Ile Ile Leu Gly Pro Gly Ser Ser Thr Leu Phe Ile Glu Arg 705 710 715 720 Val Thr Glu Glu Asp Glu Gly Val Tyr His Cys Lys Ala Thr Asn Gln                 725 730 735 Lys Gly Ser Val Glu Ser Ser Ala Tyr Leu Thr Val Gln Gly Thr Ser             740 745 750 Asp Lys Ser Asn Leu Glu Leu Ile Thr Leu Thr Cys Thr Cys Val Ala         755 760 765 Ala Thr Leu Phe Trp Leu Leu Leu Thr Leu Leu Ile Arg Lys Met Lys     770 775 780 Arg Ser Ser Ser Glu Ile Lys Thr Asp Tyr Leu Ser Ile Ile Met Asp 785 790 795 800 Pro Asp Glu Val Pro Leu Asp Glu Gln Cys Glu Arg Leu Pro Tyr Asp                 805 810 815 Ala Ser Lys Trp Glu Phe Ala Arg Glu Arg Leu Lys Leu Gly Lys Ser             820 825 830 Leu Gly Arg Gly Ala Phe Gly Lys Val Val Gln Ala Ser Ala Phe Gly         835 840 845 Ile Lys Lys Ser Pro Thr Cys Arg Thr Val Ala Val Lys Met Leu Lys     850 855 860 Glu Gly Ala Thr Ala Ser Glu Tyr Lys Ala Leu Met Thr Glu Leu Lys 865 870 875 880 Ile Leu Thr His Ile Gly His His Leu Asn Val Val Asn Leu Leu Gly                 885 890 895 Ala Cys Thr Lys Gln Gly Gly Pro Leu Met Val Ile Val Glu Tyr Cys             900 905 910 Lys Tyr Gly Asn Leu Ser Asn Tyr Leu Lys Ser Lys Arg Asp Leu Phe         915 920 925 Phe Leu Asn Lys Asp Ala Ala Leu His Met Glu Pro Lys Lys Glu Lys     930 935 940 Met Glu Pro Gly Leu Glu Gln Gly Lys Lys Pro Arg Leu Asp Ser Val 945 950 955 960 Thr Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser                 965 970 975 Leu Ser Asp Val Glu Glu Glu Glu Asp Ser Asp Gly Phe Tyr Lys Glu             980 985 990 Pro Ile Thr Met Glu Asp Leu Ile Ser Tyr Ser Phe Gln Val Ala Arg         995 1000 1005 Gly Met Glu Phe Leu Ser Ser Arg Lys Cys Ile His Arg Asp Leu Ala    1010 1015 1020 Ala Arg Asn Ile Leu Leu Ser Glu Asn Asn Val Val Lys Ile Cys Asp 1025 1030 1035 1040 Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asn Pro Asp Tyr Val Arg Lys                1045 1050 1055 Gly Asp Thr Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Ser Ile Phe            1060 1065 1070 Asp Lys Ile Tyr Ser Thr Lys Ser Asp Val Trp Ser Tyr Gly Val Leu        1075 1080 1085 Leu Trp Glu Ile Phe Ser Leu Gly Gly Ser Pro Tyr Pro Gly Val Gln    1090 1095 1100 Met Asp Glu Asp Phe Cys Ser Arg Leu Arg Glu Gly Met Arg Arg Arg 1105 1110 1115 1120 Ala Pro Glu Tyr Ser Thr Pro Glu Ile Tyr Gln Ile Met Leu Asp Cys                1125 1130 1135 Trp His Arg Asp Pro Lys Glu Arg Pro Arg Phe Ala Glu Leu Val Glu            1140 1145 1150 Lys Leu Gly Asp Leu Leu Gln Ala Asn Val Gln Gln Asp Gly Lys Asp        1155 1160 1165 Tyr Ile Pro Ile Asn Ale Ile Leu Thr Gly Asn Ser Gly Phe Thr Tyr    1170 1175 1180 Ser Thr Pro Ala Phe Ser Glu Asp Phe Phe Lys Glu Ser Ile Ser Ala 1185 1190 1195 1200 Pro Lys Phe Asn Ser Gly Ser Ser Asp Val Val Arg Tyr Val Asn Ala                1205 1210 1215 Phe Lys Phe Met Ser Leu Glu Arg Ile Lys Thr Phe Glu Glu Leu Leu            1220 1225 1230 Pro Asn Ala Thr Ser Met Phe Asp Asp Tyr Gln Gly Asp Ser Ser Thr        1235 1240 1245 Leu Leu Ala Ser Pro Met Leu Lys Arg Phe Thr Trp Thr Asp Ser Lys    1250 1255 1260 Pro Lys Ala Ser Leu Lys Ile Asp Leu Arg Val Thr Ser Lys Ser Lys 1265 1270 1275 1280 Glu Ser Gly Leu Ser Ser Val Ser Ser Pro Ser Ser Phe Cys His Ser Ser                1285 1290 1295 Cys Gly His Val Ser Glu Gly Lys Arg Arg Phe Thr Tyr Asp His Ala            1300 1305 1310 Glu Leu Glu Arg Lys Ile Ala Cys Cys Ser Pro Pro Pro Asp Tyr Asn        1315 1320 1325 Ser Val Val Leu Tyr Ser Thr Pro Pro Ile    1330 1335 <210> 12 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 12 gacccccccg accttgcaga tcacggagga gtcacac 37 <210> 13 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 13 gtgtgactcc tccgtgatct gcaaggtcgg gggggtc 37 <210> 14 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 14 ctgcacgagg tacatgccca ggacacaggc agctacgtc 39 <210> 15 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 15 gacgtagctg cctgtgtcct gggcatgtac ctcgtgcag 39 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 16 gtccatcccc ggcctccaag tcacgctgcg ctcgc 35 <210> 17 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 17 gcgagcgcag cgtgacttgg aggccgggga tggac 35 <210> 18 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 18 gggagaagct ggtcctccag tgcaccgtgt gggctga 37 <210> 19 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 19 tcagcccaca cggtgcactg gaggaccagc ttctccc 37 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 20 agcatcctga ccatccacca ggtcagccag cacgacct 38 <210> 21 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 21 aggtcgtgct ggctgacctg gtggatggtc aggatgct 38

Claims (62)

A purified or isolated ligand binding polypeptide comprising an amino acid sequence having 95% identity to the amino acid sequence defined by position 47-115 of SEQ ID NO: 2, provided that at positions 104-106 of SEQ ID NO: 2 The position of the corresponding polypeptide is not the same as NXS or NXT,
Wherein said polypeptide binds to at least one ligand polypeptide selected from human VEGF-C, VEGF-D, and PlGF. 3. A polypeptide according to claim 1 comprising an amino acid sequence having 95% identity to the amino acid sequence defined by position 47-210 of SEQ ID NO: 2, with the proviso that the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 A purified or isolated ligand binding polypeptide wherein the site is not identical to NXS or NXT. 2. The polynucleotide of claim 1 comprising an amino acid sequence having at least 95% identity to the amino acid sequence defined by position 47-314 of SEQ ID NO: 2, with the proviso that the poly A purified or isolated ligand binding polypeptide wherein the position of the peptide is not identical to NXS or NXT. 2. The polynucleotide of claim 1 comprising an amino acid sequence having at least 95% identity to the amino acid sequence defined by position 47-752 of SEQ ID NO: 2, with the proviso that the poly A purified or isolated ligand binding polypeptide wherein the position of the peptide is not identical to NXS or NXT. 5. The method according to any one of claims 1 to 4, wherein positions 33-35 of SEQ ID NO: 2, positions 166-168 of SEQ ID NO: 2, positions 251-253 of SEQ ID NO: 2, and SEQ ID NO: A purified or isolated ligand binding polypeptide having four N-saccharide sequon sites corresponding to positions 299-301. 6. The purified or isolated ligand binding polypeptide of claim 5, wherein said ligand binding polypeptide is glycosylated at said four N-glycosylation sites. 7. A purified or isolated ligand binding polypeptide according to any one of claims 1 to 6, which is a soluble polypeptide. The method according to any one of claims 1 to 7, wherein position 47-115 of SEQ ID NO: 2, position 47-210 of SEQ ID NO: 2, position 47-314 of SEQ ID NO: 2, Wherein the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, wherein the amino acid sequence defined by position 47-752 is identical to NXS or NXT, Ligand binding polypeptides. 9. A purified or isolated ligand binding polypeptide according to any one of claims 1 to 8, which binds to human VEGF-C or human VEGF-D. The method of claim 9, wherein the VEGF-C- or VEGF-D-binding of VEGFR-3 is inhibited in cells that inhibit VEGF-C- or VEGF-D- binding to VEGFR- A purified or isolated ligand binding polypeptide that inhibits mediated stimulation. 11. A purified or isolated ligand binding polypeptide according to any one of claims 1 to 10, which binds to human VEGF-C with a K _d of 1 nM or less. 11. A purified or isolated ligand binding polypeptide according to any one of claims 1 to 10, which binds to human VEGF-D with a K _d of 5 nM or less. 13. A purified or isolated ligand binding polypeptide according to any one of claims 1 to 12, wherein the amino acid in the polypeptide corresponding to position 104 of SEQ ID NO: 2 is deleted or replaced by another amino acid. 9. The purified or isolated ligand binding polypeptide of claim 8, wherein the amino acid at position 104 of SEQ ID NO: 2 is deleted or substituted with another amino acid selected from the group consisting of glutamine, aspartate, glutamate, arginine and lysine . 10. The purified or isolated ligand binding polypeptide of any one of claims 1 to 9, wherein said polypeptide comprises amino acids 23-290 of SEQ ID NO: 3. 16. A purified or isolated ligand binding polypeptide according to any one of claims 1 to 15, further comprising a signal peptide. 17. A purified or isolated ligand binding polypeptide according to any one of claims 1 to 16, further comprising at least one polyethylene glycol moiety attached to the polypeptide. 18. The purified or isolated ligand binding polypeptide of claim 17, comprising about 20-40 kDa of polyethylene glycol attached to the amino terminus of the polypeptide. 19. A ligand binding molecule comprising a ligand binding polypeptide according to any one of claims 1 to 18 linked to a heterologous peptide. 20. The ligand binding molecule of claim 19, wherein the heterologous peptide comprises an immunoglobulin constant domain segment. 20. The ligand binding molecule of claim 19, wherein the immunoglobulin constant domain fragment is an IgG constant domain fragment. 21. The ligand binding molecule of claim 20, wherein the immunoglobulin constant fragment comprises amino acids 306-537 of SEQ ID NO: 3. 20. The ligand binding molecule of claim 19, wherein the ligand binding molecule comprises amino acids 23-537 of SEQ ID NO: 3. 24. A ligand binding molecule according to any one of claims 19 to 23, which optionally comprises a linker connecting said heterologous peptide to said ligand binding polypeptide. 24. A ligand binding molecule according to any one of claims 19 to 23, wherein the C-terminal amino acid of the ligand binding polypeptide is attached directly to the N-terminal amino acid of the heterologous peptide by a peptide bond. 26. A ligand binding molecule according to any one of claims 19 to 25, further comprising a signal peptide that directs secretion of the molecule from the cell expressing the molecule. 20. The ligand binding molecule of claim 19, wherein the molecule comprises the amino acid sequence set forth in SEQ ID NO: 3 below. 24. The ligand binding molecule according to any one of claims 19 to 23, wherein the ligand binding polypeptide and the heterologous peptide are linked by an amide bond to form a single polypeptide chain. A ligand binding polypeptide according to any one of claims 1 to 18 or a ligand binding molecule according to any one of claims 19 to 28, further comprising a detectable label. A conjugate comprising a ligand binding polypeptide according to any one of claims 1 to 18 or a ligand binding molecule according to any one of claims 19 to 28 and a chemotherapeutic agent. An isolated polynucleotide comprising a coding nucleotide sequence encoding a ligand binding polypeptide according to any one of claims 1 to 18 or a ligand binding molecule according to any one of claims 19 to 28. 32. The polynucleotide of claim 31, further comprising a promoter sequence operably linked to said coding nucleotide sequence to facilitate transcription of said coding nucleotide sequence in a host cell. 31. A vector comprising the polynucleotide of claim 31 or 32. 34. The vector of claim 33, further comprising an expression control sequence operably linked to the coding nucleotide sequence. 34. The vector of claim 33, wherein the vector is selected from the group consisting of a lentivirus vector, an adeno-associated viral vector, an adenoviral vector, a liposomal vector, and combinations thereof. 34. The vector of claim 33, wherein the vector comprises a replication-deficient adenovirus, wherein the adenovirus is operably linked to a promoter and is flanked by an adenovirus polynucleotide sequence. An isolated cell or cell line transformed or transfected with a polynucleotide according to claim 31 or 32 or a vector according to any of claims 33 to 36. 38. An isolated cell or cell line according to claim 37, which is a eukaryotic cell. 38. An isolated cell or cell line according to claim 37, which is a human cell. 38. An isolated cell or cell line according to claim 37, which is a Chinese hamster ovary (CHO) cell. 40. A method for producing a ligand-binding polypeptide, comprising culturing a cell according to any one of claims 37 to 40 under conditions in which said ligand-binding polypeptide or ligand-binding molecule encoded by said polynucleotide is expressed. 42. The method of claim 41, further comprising purifying or isolating the ligand binding polypeptide or ligand binding molecule from the cell or from the growth medium of the cell. 29. A composition comprising a purified ligand binding polypeptide or ligand binding molecule according to any one of claims 1 to 29 and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier. 36. A composition comprising a polynucleotide or a vector according to any one of claims 31-36 and a pharmaceutically acceptable diluent, adjuvant, excipient or carrier. 44. The composition of claim 43 or 44, formulated for topical administration. 46. The composition of claim 45, which is in the form of a solid, paste, ointment, gel, liquid, aerosol, mist, polymer, film, emulsion, or suspension. 44. The composition of claim 43 or 44, formulated for intravitreal administration. 47. A method of inhibiting neovascularization in a subject comprising administering to the subject a composition according to any one of claims 43 to 47 in an amount effective to inhibit neovascularization in the subject. 47. A method of inhibiting choroidal or retinal neovascularization in a subject comprising administering to the subject a composition according to any one of claims 43 to 47 in an amount effective to inhibit retinal neovascularization in the subject. 48. A method of treating a subject having an ocular disorder associated with retinal neovascularization, comprising administering to the subject a composition according to any one of claims 43 to 48 in an amount effective to inhibit retinal neovascularization in the subject, Way. 47. Use of a composition according to any one of claims 43 to 47 for inhibiting neovascularization such as retinal neovascularization, choroidal neovascularization or tumor neovascularization in a subject in need thereof. 52. A method or use according to any one of claims 49 to 51 wherein said composition is administered topically to the eye of a subject. 53. The method or use of claim 52, wherein said composition is administered by intravitreal injection. 53. The method or use of claim 52, wherein said composition is administered by an intravitreal implant. 53. The method or use of claim 52, wherein said composition is administered by topical administration. 55. The composition of any one of claims 49 to 55, wherein said composition is VEGF-C and / or VEGF-D expressed in cells of said eye or in the blood vessels of said eye and / or VEGFR -3 or is administered in an amount effective to inhibit VEGFR-2 and / or VEGFR-3 stimulation. 52. A method or use according to claim 50 or 51, wherein the ocular disorder is selected from the group consisting of macular degeneration, diabetic retinopathy and macular vasculopathy. 57. A method or use according to any one of claims 49 to 57, further comprising administering an antibiotic to the subject. 59. The method of claim 58, wherein said antibiotic is selected from the group consisting of amikacin, gentamicin, kanamycin, neomycin, nethymycin, streptomycin, tobramycin, teicoplanin, vancomycin, azithromycin, clarithromycin, clarithromycin, Amoxicillin, ampicillin, azulocillin, carbenicillin, clozapine, dicloxacin, flucosaciline, megiosylline, napsilin, penicillin, erythromycin, erythromycin, erythromycin, Porphylacin, Ticarcillin, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxasin, Gatifloxacin, Levofloxacin, Lomexocracin, Moxifloxacin, Norfloxacin, , Mephenide, sulfacecetamide, sulfamethizole, sulfasalazine, sulfaisoxazole, trimethoprim, cotreexazol, demeclocycline, cyclic cyclin, minocycline, Oxytetracycline, and tetracycline. 52. A method or use according to claim 48 or 51 wherein said subject is diagnosed with a tumor and said composition is administered in an amount effective to inhibit renal angiogenesis in said tumor. 61. The method or use of claim 60, wherein said composition is administered locally to said tumor or to an organ or tissue from which said tumor has been surgically removed. 60. The method of claim 60, wherein said composition is capable of binding VEGFR-2 and / or VEGFR-3 and / or VEGFR-2 and / or VEGFR-3 expressed in tumor cells to VEGF- 3 &lt; / RTI &gt;

Images