KR102213653B1 - Ligand binding molecules and uses thereof - Google Patents

Abstract

The present invention relates to ligand binding molecules and uses thereof that modulate angiogenesis and/or lymphangiogenesis.

Description

Ligand binding molecule and its use {LIGAND BINDING MOLECULES AND USES THEREOF}

Field of invention

The present invention relates generally to the regulation of vascular growth, particularly in ophthalmology and oncology.

Sequence list

The electronic sequence listing forms part of the specification.

Vascular endothelial growth factor (VEGF) protein and its receptor (VEGFR) are characterized by angiogenesis (development of embryonic vasculature from early differentiated endothelial cells), angiogenesis (the process of forming new blood vessels from existing blood vessels), and lymphangiogenesis. It plays an important role in (the process of forming new lymphatic vessels). Platelet derived growth factor (PDGF) proteins and their receptors (PDGFR) are involved in the regulation of cell proliferation, survival and migration of several cell types.

Dysfunction of the endothelial cell regulatory system is a key feature of cancer and various diseases associated with abnormal angiogenesis, angiogenesis and lymphangiogenesis.

Angiogenesis occurs in embryonic development and normal tissue growth, recovery, and regeneration, the female reproductive cycle, confirmation and maintenance of pregnancy, and recovery of wounds and fractures. In addition to angiogenesis occurring in healthy individuals, angiogenic events are associated with many pathological processes, in particular tumor growth and metastasis, and other conditions in which blood vessel proliferation of the microvascular system is increased, such as diabetic retinopathy, psoriasis and arthrosis. Inhibition of angiogenesis is useful in preventing or alleviating these pathological processes or slowing their progression.

Although therapies that block VEGF/PDGF signaling through their receptors have shown promise for inhibition of angiogenesis and tumor growth, there is still a need for new or improved compounds and therapies for the treatment of these diseases.

Summary of the invention

The present invention relates to abnormal angiogenesis, lymphangiogenesis or inhibition of both, and vascular endothelial growth capable of stimulating their phosphorylation by binding to at least one growth factor receptor tyrosine kinase (i.e., VEGFR-2 or VEGFR-3), respectively. It relates to novel compositions and methods of use thereof for the inhibition of factor-C (VEGF-C) and other effects of vascular endothelial growth factor-D (VEGF-D). The composition of the present invention comprises a ligand binding molecule that binds to one or both of human VEGF-C and human VEGF-D. In some embodiments, the ligand binding molecule comprises a polypeptide, such as a fragment, of a growth factor receptor tyrosine kinase extracellular domain (ECD). The fragment may differ from the wild-type sequence in a manner that does not remove growth factor binding, and the fragment is preferably in the manner described herein to improve its properties as a therapeutic agent for administration to a subject/patient in need thereof. It is manipulated.

The present invention also provides a nucleic acid encoding the ligand binding molecule. The nucleic acid is useful for expressing the polypeptide ligand binding molecule and, in some embodiments, in a biologically active form, as a therapeutic agent for achieving expression of the polypeptide ligand binding molecule in vivo .

Administration of a composition comprising a ligand binding molecule (or a polynucleotide encoding it) described herein to a patient in need thereof inhibits growth factor stimulation of the VEGF receptor (e.g., inhibits phosphorylation of the receptor), thereby , Including, but not limited to, VEGFR-mediated angiogenesis, lymphangiogenesis, or both.

VEGF-C and D bind with high affinity to at least one VEGF receptor (or receptor heterodimer) selected from VEGFR-2 and VEGFR-3 and stimulate their phosphorylation. This statement refers to the well-known properties of these growth factors towards their cognate receptors, and does not imply, per se , the limiting features of the ligand binding molecules of the present invention. However, preferred ligand binding molecules of the present invention do more than simply bind to their target growth factors. Preferred ligand binding molecules also inhibit the growth factor(s) to which they bind stimulate phosphorylation of at least one (and preferably all) of the receptor tyrosine kinases to which the growth factor(s) bind. Stimulation of tyrosine phosphorylation is in vitro Easily measured using cell-based assays and anti-phosphotyrosine antibodies. Since phosphorylation of the receptor tyrosine kinase is an early stage in the signaling cascade, this is a convenient indicator as to whether the ligand binding molecule can inhibit growth factor-mediated signaling that causes cell migration, cell growth and other responses. to be. Many other cell-based and in vivo assays can be used to confirm the growth factor neutralizing properties of the ligand binding molecules of the invention.

Ligand binding molecules that are “specific” for a particular growth factor are those that specifically recognize the active form of the growth factor (eg, a form that has been found to circulate in the body). Preferably, the ligand binding molecule also specifically binds to other forms of the growth factor. As an example, VEGF-C (and VEGF-D) is translated as a prepro-molecule with a wide range of amino-terminal and carboxy-terminal propeptides, which are cleaved to bind and stimulate VEGFR-2 and VEGFR-3. Produces a "fully processed" form of VEGF-C (or VEGF-D). Ligand binding molecules specific for VEGF-C (or VEGF-D) bind at least to the fully processed form of VEGF-C (or VEGF-D), and preferably also partially processed and unprocessed forms. Combine.

In one aspect, the ligand binding molecule described herein is SEQ ID NO: Under the clue that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT (X represents any amino acid), SEQ ID NO: : At least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95% relative to the amino acid sequence defined by positions 47-115 of 2 or positions 25-115 of SEQ ID NO: 2, or A purified or isolated ligand binding polypeptide comprising a first amino acid sequence having at least 96%, or at least 97%, or at least 98%, or at least 99% identity, wherein the polypeptide is human VEGF-A (VEGF), Binding to at least one ligand polypeptide selected from VEGF or PDGF family growth factors, such as VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-B, PDGF-C, and PDGF-D do. SEQ ID NO: 2 contains the amino acid sequence for human VEGFR-3, and positions 1-24 of SEQ ID NO: 2 correspond to the putative signal peptide, and after position 25 of SEQ ID NO: 2 the putative signal peptide is lacking. Corresponds to the putative mature form of the receptor. The preceding segment of SEQ ID NO: 2 approximately corresponds to or comprises the first immunoglobulin-like domain of the ECD of human VEGFR-3 (“D1 of VEGFR-3”). Particularly contemplated are constructs comprising additional Ig-like domains of VEGFR-3 or other receptors that are attached in a manner that results in a ligand-binding polypeptide, and constructs that bind different ligands make the ligand-binding polypeptides. It is built by changing the receptor components used. In some variations, the ligand binding polypeptide is primarily based on the extracellular domain of VEGFR-3, and in other embodiments, the ligand binding polypeptide is VEGFR-1 and/or VEGFR-2 and/or PDGFR-α and/or Or based on the fusion of segments of other receptor tyrosine kinases, such as PDGFR-β. In embodiments based primarily on VEGFR-3, the at least one ligand is a natural ligand for VEGFR-3, such as VEGF-C or VEGF-D polypeptide.

In some embodiments, the ligand binding polypeptide is at least 80%, or at least 85%, or at least 90 of the sequence of amino acids defined by positions 154-210 of SEQ ID NO: 2 or positions 248-314 of SEQ ID NO: 2 %, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to a second amino acid sequence comprising an N-terminal residue of said second amino acid sequence Is linked to the C-terminus of the first amino acid sequence directly or through a spacer, and the polypeptide is human VEGF-A (VEGF), VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF- It binds to at least one ligand polypeptide selected from VEGF or PDGF family growth factors such as B, PDGF-C, and PDGF-D. The amino acid sequence defined by the position of the polypeptide corresponding to positions 154-210 approximately corresponds to or comprises the second immunoglobulin-like domain of the ECD of human VEGFR-3 (“D2 of VEGFR-3”). The amino acid sequence defined by the position of the polypeptide corresponding to positions 248-314 approximately corresponds to or comprises the third immunoglobulin-like domain of the ECD of human VEGFR-3 (“D3 of VEGFR-3”). When the second amino acid sequence approximately corresponds to D2 of VEGFR-3 or comprises a sequence of an amino acid comprising the same, the ligand binding polypeptide is at least the sequence of amino acids defined by positions 248-314 of SEQ ID NO: 2 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical third amino acid sequence. Preferably, the N-terminal residue of the third amino acid sequence is linked to the C-terminal residue of the second amino acid sequence directly or through a spacer, and the polypeptide is human VEGF-A (VEGF), VEGF-B, VEGF -C, VEGF-D, PlGF, PDGF-A, PDGF-B, PDGF-C, and at least one ligand polypeptide selected from VEGF or PDGF family growth factors such as PDGF-D. In reduction, in embodiments in which the ligand binding polypeptide comprises an amino acid sequence that approximately corresponds to or comprises D1 and D2 of VEGFR-3, the ligand binding polypeptide also approximately corresponds to or comprises D3 of VEGFR-3. It is preferable to include an amino acid sequence.

In embodiments in which the ligand-binding polypeptide comprises an amino acid sequence that approximately corresponds to two or more component domains of VEGFR-3, the component domains may be linked directly to each other or via one or more spacers. Preferably, the component domains are linked by one or more spacers. In one embodiment, the spacer comprises one or more peptide sequences between the component domains, which are 1-100 amino acids, preferably 1-50 amino acids long. In one embodiment, the spacer between the two constituent domains consists essentially of a peptide sequence that is naturally linked to the constituent domain in native VEGFR-3.

In embodiments in which the ligand-binding polypeptide comprises an amino acid sequence that approximately corresponds to or comprises contiguous component domains of VEGFR-3 (e.g., D1-D2 or D1-D2-D3), the component domain Are linked through one or more spacers comprising one or more peptide sequences between the component domains, which are 1-100 amino acids, preferably 1-50 amino acids long. In one embodiment, the spacer between the two constituent domains consists essentially of a peptide sequence corresponding to linking each contiguous constituent domain in native VEGFR-3. In some embodiments, the spacer between two contiguous component domains is at least 80%, or at least 85%, or at least 90%, or at least 92% relative to the sequence of amino acids connecting the contiguous domains in native VEGFR-3. , Or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical amino acid sequences.

In one embodiment, when the ligand binding polypeptide comprises an amino acid sequence that approximately corresponds to or comprises D1 and D2 of VEGFR-3, the component domains D1 and D2 are by positions 116-153 of SEQ ID NO: 2 At least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% relative to the sequence of the defined amino acids It is linked through a spacer amino acid sequence with identity. When the ligand binding polypeptide comprises an amino acid sequence that approximately corresponds to or comprises D1, D2 and D3 of VEGFR-3, the component domains D2 and D3 are amino acids defined by positions 211-247 of SEQ ID NO: 2 At least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity to the sequence of It is linked through a spacer amino acid sequence.

In some embodiments, the purified or isolated ligand-binding polypeptide is the position of SEQ ID NO: 2 under the proviso that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT. 47-210, or positions 25-210 of SEQ ID NO: 2, or positions 47-314 of SEQ ID NO: 2, or positions 25-314 of SEQ ID NO: 2, or positions 47-752 or 47- of SEQ ID NO: 2 775, or at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96% with respect to the sequence of amino acids defined by positions 25-752 of SEQ ID NO: 2, Or an amino acid sequence having at least 97%, or at least 98%, or at least 99% identity, wherein the polypeptide is at least one selected from human VEGF-A, VEGF-C, VEGF-C, VEGF-D and PlGF. It binds to the ligand polypeptide. In one variation, the amino acid corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with another amino acid (eg, glutamine, aspartate, glutamate, arginine and lysine). Positions 47-210 comprise the two first immunoglobulin-like domains of human VEGFR-3 ECD, as well as the VEGFR-3 ECD sequence between the two first Ig-like motifs. Positions 47-314 comprise the three first immunoglobulin-like domains of the human VEGFR-3 ECD, as well as the VEGFR-3 ECD sequence between these Ig-like motifs.

More generally, the ligand binding polypeptide of the present invention is at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95% for a fragment of the VEGFR-3 amino acid sequence set forth in SEQ ID NO: 2. , Or at least 96%, or at least 97%, or at least 98%, or at least 99% identical amino acid sequence, wherein the amino terminus of the fragment is at positions 25, 26, 27, 28, 29, 30 of SEQ ID NO: 2 , 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; The carboxy end of the fragment is, under the clue that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, positions 110-775 of SEQ ID NO: 2 (e.g., positions 110, 111 , 112, 113, 114, 115, 116, …,… 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775). As will be readily apparent from the specification herein, an acceptable modification is not a modification that introduces a new glycosylation sequence not found in wild-type VEGFR-3.

In another aspect, the ligand binding molecule described herein is, under the proviso that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, positions 47-115 of SEQ ID NO: 2, Amino acids identical to the amino acid sequence defined by the amino acid sequence defined by 47-210 of SEQ ID NO: 2, 47-314 of SEQ ID NO: 2, 47-752 or 47-775 of SEQ ID NO: 2, or positions 47-752 of SEQ ID NO: 2 A purified or isolated ligand binding polypeptide comprising a sequence. In one variation, the amino acid corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with another amino acid (eg, glutamine, aspartate, glutamate, arginine and lysine).

In another aspect, the ligand binding molecule described herein is at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least with respect to the amino acid sequence defined by positions 47-115 of SEQ ID NO: 2 A purified or isolated ligand binding polypeptide comprising an amino acid sequence having 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity, and positions 104-106 of SEQ ID NO: 2 The position of the polypeptide corresponding to is a putative VEGFR-3 glycosylation sequence, and the putative glycosylation sequence is removed from the amino acid sequence of the ligand binding polypeptide. The term “removed” as used in this context means an alteration (by substitution, deletion or insertion) of the primary amino acid sequence at at least one position to disrupt the N-X-T sequence motif.

The invention also encompasses multimeric ligand binding constructs comprising two or more ligand binding molecules as described herein that are covalently or non-covalently attached to each other to form a dimer or multimeric structure. In some variations, the attachment occurs between VEGFR-3-like sequences of the ligand binding polypeptide; In another variation, the attachment occurs between heterologous polypeptides attached to one or both of the VEGFR-3 like sequences.

Reference herein to a ligand binding molecule or ligand binding polypeptide described herein refers to the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 (represents an N-linked glycosylation sequence in the native VEGFR-3 sequence. ) Is not identical to NXS or NXT, the ligand binding polypeptide or molecule (whether it is a monomer, a dimer or a larger multimer) is an Ig-like motif of VEGFR-3 (e.g., about 47 of SEQ ID NO: 2). -115) and, under the clue that it contains at least one Ig-like motif similar to or identical to -115), references to variants thereof as defined above are included.

In another aspect, described herein is a ligand binding molecule that is an isolated or purified ligand binding polypeptide comprising a first immunoglobulin-like domain of a VEGFR-3ΔN2 polypeptide. As used herein, the term "VEGFR-3ΔN2 polypeptide" refers to the NDT, which is the portion of the sequence of the polypeptide corresponding to the second putative glycosylation sequence, for example, due to a substitution at the one position, the NXS/T sequence. It refers to a polypeptide having at least 95% identity to the amino acid sequence that defines the ECD of human VEGFR-3, under the clue that it is mutated to no longer fit the motif. In some embodiments, the purified polypeptide comprises two first immunoglobulin-like domains of a VEGFR-3ΔN2 polypeptide, preferably a VEGFR-3 sequence between the domains. In some embodiments, the purified polypeptide comprises the first three immunoglobulin-like domains of the VEGFR-3ΔN2 polypeptide, and preferably comprises a VEGFR-3 sequence between the domains.

In another aspect, described herein is a ligand binding molecule, which is a polypeptide comprising an ECD fragment of human VEGFR-3 fused to a fusion partner, wherein the amino acid sequence of the ECD fragment of VEGFR-3 is the second of wild-type VEGFR-3. Modified from wild-type VEGFR-3 to remove the putative N-linked glycosylation sequence, the polypeptide being soluble in human serum and binding to human VEGF-C or human VEGF-D; The fusion partner improves the solubility or serum half-life of the ECD fragment (eg, compared to the same fragment not fused to the fusion partner). In some embodiments, the fusion partner is a heterologous polypeptide.

In some embodiments, the ligand binding polypeptide or ligand binding molecule binds human VEGF-C or human VEGF-D. In some embodiments, the ligand binding polypeptide or ligand binding molecule inhibits VEGF-C- or VEGF-D-binding to VEGFR-3, or inhibits VEGFR-3 expression in cells expressing VEGFR-3 on its surface. Inhibits VEGF-C- or VEGF-D-mediated stimulation. Inhibition of this stimulation can be demonstrated, for example, by measuring receptor phosphorylation, or by measuring cell growth in vitro or in vivo, or by measuring blood vessel growth or other tissue-level changes in vivo. .

The ligand binding molecule preferably binds to human VEGF-C with a K _d of about 1 nM or less (e.g., 500 pM, 400 pM, 300 pM, 200 pM, 100 pM, 50 pM, 10 pM or less). do. The ligand binding molecule preferably has a K _d of about 5 nM or less (e.g., 2 nM, 1 nM, 500 pM, 400 pM, 300 pM, 200 pM, 100 pM, 50 pM, 10 pM or less). Binds to human VEGF-D.

In another aspect, the purified or isolated ligand binding molecule is of amino acids 22-290 of SEQ ID NO: 3, amino acids 23-290 of SEQ ID NO: 3, amino acids 23-537 of SEQ ID NO: 3, or Includes 22-537. In another variation, the molecule is at least 80%, or at least 85%, or at least in any one of the aforementioned sequences, under the proviso that the sequence of the polypeptide (aligning) corresponding to the VEGFR-3 N2 sequence is not a glycosylation sequence. 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical amino acid sequences.

As described herein, ligand binding molecules may be chemically modified ( eg , glycosylation, pegylation, etc.) to impart desired characteristics while maintaining their specific growth factor binding properties. The Ig-like domains I-III of VEGFR-3 contain five putative N-glycosylation sites (referred to as the N1, N2, N3, N4 and N5 sequences of VEGFR-3, respectively). N1 corresponds to amino acids 33-35 of SEQ ID NO: 2; N2 corresponds to amino acids 104-106 of SEQ ID NO: 2; N3 corresponds to amino acids 166-168 of SEQ ID NO: 2; N4 corresponds to amino acids 251-253 of SEQ ID NO: 2 and N5 is a purified or isolated ligand binding poly having 4 N-glycosylation sequence sites corresponding to positions 299-301 of SEQ ID NO: 2 Peptide. In some embodiments, a ligand binding molecule described herein comprises a modification in the N2 sequence of the molecule. For example, in some embodiments, the amino acid in the ligand binding molecule corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with another amino acid. Conservative substitutions are preferred. In some embodiments, the amino acid corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with an amino acid selected from the group consisting of glutamine, aspartate, glutamate, arginine and lysine. In embodiments in which the N2 sequence of SEQ ID NO: 2 is modified as described above, the N1, N3, N4 and N5 sequences of SEQ ID NO: 2 are preferably unchanged in terms of amino acid sequence.

As described herein, the ligand binding molecule can be linked directly or through a linker to the fusion partner. The fusion partner can be any heterologous component that enhances the functionality of the ligand binding molecule. Exemplary peptide fusion partners include immunoglobulin constant domain (Fc) fragments. In some embodiments, the immunoglobulin constant fragment is at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, Or an amino acid sequence having at least 99% identity, or 100% identity to amino acids 306-537 of SEQ ID NO: 3.

As described herein, the ligand binding molecule is, for example, to facilitate binding to a fusion partner (e.g., a heterologous peptide) or to impart a desired characteristic (e.g., increase serum half-life. And can be chemically modified) to increase solubility in aqueous media and allow targeting to specific cell populations, such as tumor cells or retinal cells.

In some embodiments, a ligand binding molecule described herein optionally comprises at least one PEG moiety attached to the molecule. For example, in some embodiments, about 20-40 kDa of PEG is attached to the amino terminus of the ligand binding molecule.

In some embodiments, a ligand binding molecule as described herein optionally comprises a linker, e.g., a factor Xa linker sequence PIEGRGGGGG (SEQ ID NO: 4) that connects a fusion partner such as a heterologous peptide to the ligand binding polypeptide. Include. In another embodiment, the ligand binding molecule includes a polypeptide in which the C-terminal amino acid of the ligand binding polypeptide is directly attached to the N-terminal amino acid of the heterologous peptide fusion partner by peptide bond. In some embodiments, the ligand binding polypeptide and the heterologous peptide are attached by an amide bond to form a single polypeptide chain (directly or via a linker polypeptide).

In some variations, the ligand binding molecule comprises a signal peptide that directs the secretion of the molecule from cells expressing the molecule.

The nucleic acid (polynucleotide) of the present invention includes a nucleic acid encoding a polypeptide ligand binding molecule, which can be used in applications such as gene therapy and recombinant in vitro expression of a polypeptide ligand binding molecule. In some embodiments, the nucleic acid is purified or isolated. In some embodiments, the polynucleotide further comprises a promoter sequence operably linked to a nucleotide sequence encoding the polypeptide, the promoter sequence promoting transcription of the sequence encoding the polypeptide in the host cell. The polynucleotide may also comprise a polyadenylation signal sequence. In some variations, the nucleic acid has a coding nucleotide sequence similar to a wild-type human VEGFR-3-encoding nucleic acid. For example, the nucleic acid comprises at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least for the human VEGFR-3 sequence set forth in SEQ ID NO: 1, or a fragment thereof. 96%, or at least 97%, or at least 98%, or at least 99% identity. By way of example, in the context of the nucleotide sequence encoding amino acids 47-314 of SEQ ID NO: 2, modified in the N2 sequence, an exemplary nucleic acid is a human set forth at positions 157 to 961 of SEQ ID NO: 1 corresponding to codons 47-314. At least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity to the VEGFR-3 sequence It includes a coding nucleotide sequence having.

An aspect of the invention is also a vector comprising a polynucleotide. Such a vector may comprise an expression control sequence operably linked to a sequence encoding the polypeptide. In some variations, the vector is selected to optimize recombinant expression in vitro in a selected host cell, such as a eukaryotic host cell. In some variations, the vector is selected for in vivo delivery. For example, the vector may be selected from the group consisting of lentiviral vectors, adeno-associated viral vectors, adenovirus vectors, liposome vectors, and combinations thereof. In some embodiments, the vector comprises a replication-deficient adenovirus, and the adenovirus comprises a polynucleotide operably linked to a promoter and flanked by an adenovirus polynucleotide sequence.

Host cells comprising the polynucleotides, vectors and other nucleic acids, and methods of using the host cells to express and isolate the ligand binding molecules are also aspects of the present invention. Particularly contemplated are eukaryotic host cells, including Chinese hamster ovary (CHO) cells and other mammalian cell lines comprising polynucleotides encoding a ligand binding polypeptide or ligand binding molecule described herein. In some variations, the cell line is selected or engineered to introduce human or human-like glycosylation into the glycosylation sequence of the polypeptide produced in the cell.

Methods of making the ligand binding polypeptides or molecules described herein are also contemplated. (Such methods can also be described as the use of a polynucleotide or cell of the present invention.) In one aspect, the method is described herein under conditions in which the ligand binding polypeptide or ligand binding molecule encoded by the polynucleotide is expressed. And growing cells transformed or transfected with the described polynucleotides or vectors. In some embodiments, the method further comprises purifying or isolating the ligand binding polypeptide or ligand binding molecule from the cell or from the growth medium of the cell. In some embodiments, the method further comprises attaching one or more polyethylene glycol (PEG) or other moieties to the expressed and purified/isolated polypeptide.

The invention also includes compositions comprising a polypeptide, a ligand binding molecule or a nucleic acid encoding the same, together with a pharmaceutically acceptable diluent, adjuvant, or carrier medium. In some embodiments, the composition is formulated for topical administration to the eye (eg, a topical formulation such as an ointment or eye drop, or a formulation suitable for intravitreal injection). In another embodiment, the composition is applied to a tumor or an organ from which the tumor has been surgically removed, such as by intravenous injection or direct injection into the diseased tissue, or by application through a device during tumor resection, or Formulated for topical administration to the tissue.

The present invention also uses the substances described herein (polypeptides, molecules and constructs, polynucleotides and vectors, transformed cells, compositions) to inhibit vascular growth (vascular and/or lymphatic) in therapeutic and prophylactic contexts. Includes how to use. Methods of use as described herein can alternatively be characterized by the use of various substances for the above-mentioned indications. Exemplary subjects for treatment include humans and other primates, livestock (e.g. cows, horses, pigs), zoo animals (e.g. cats, dogs, pachyderm, deeraceae), and pets (e.g. dogs, cats), And rodents.

In some variations, the present invention includes a method of inhibiting neovascularization in a subject, the method comprising administering to the subject any of the foregoing substances or compositions in an amount effective to inhibit neovascularization in the subject. do. Exemplary pathogenic neoangiogenic conditions include ocular pathogenic neoangiogenic conditions, and tumor neovascularization.

In some variations, the invention includes a method of inhibiting retinal neovascularization in a subject, the method comprising administering to a subject a substance or composition as described herein in an amount effective to inhibit retinal neovascularization in the subject. Includes doing. In a related variation, the present invention comprises a method of treating a subject having an ocular disorder associated with retinal neovascularization, the method described herein and summarized above in an amount effective to inhibit retinal neovascularization in the subject. And administering to the subject a substance or composition as described above. For example, a composition as described herein can be administered to a subject, e.g., by eye drops or other topical administration, by subconjunctival administration (e.g., injection), by intravitreal injection, or by an intravitreal implant. It is administered topically to the eye of the child.

The composition is preferably VEGF-C and / or VEGF-D in the eye of the subject binds to VEGFR-2 and / or VEGFR-3 expressed in the cells of the eye or blood vessels of the eye or VEGFR-2 and / or VEGFR It is administered in an amount effective to inhibit irritation -3 and with the frequency and duration of repeated dosing. Such beneficial effects can be measured in terms of aggravation/delay or arrest of progression in pathological ocular conditions (such as macular degeneration, diabetic retinopathy and macular telangiectasia), or improvement of clinical symptoms. This beneficial effect can also be observed in terms of monitoring blood vessel growth in and around the targeted tissue.

The methods and uses described herein can be practiced in combination with additional therapeutic agents or treatments (eg, in the form of radiation) as detailed herein.

The methods (or uses) of the invention described herein use one or more ligand binding molecules, or in combination with another therapy (e.g., standard therapy for treatment of cancer or disorders behind the eye) at least one It can be done using ligand binding molecules. In embodiments where the ligand binding molecule is for the treatment of disorders in the back of the eye, contemplated additional therapies include local laser treatment (or photocoagulation), scatter laser treatment (or panretinal photocoagulation) and vitrectomy. In some embodiments, antibiotics are also administered to the subject receiving treatment.

In embodiments for the ligand binding molecules described herein for use in the treatment of cancer, contemplated therapeutic standard therapeutics target growth factors and/or their receptors, anti-sense RNA, RNA interference, bispecific antibodies, other Antibody types, and small molecules such as chemotherapeutic agents. Cytokines, radiotherapy agents, or radiation therapy can also be used in combination with the ligand binding molecules described herein. The chemotherapeutic agent or radiotherapy agent is an anti-metabolite; DNA-damaging agents; Cytokines or growth factors; Covalent DNA-binding drugs; Topoisomerase inhibitors; Anti-mitotic agents; Anti-tumor antibiotics; Differentiation agents; Alkylating agents; Methylating agents; Hormones or hormone antagonists; Nitrogen mustard; Radiosensitizers; And it may be one of the drug class including a photosensitizing agent. Specific examples of these agents are described elsewhere herein. Combination therapies are preferably synergistic, but they need not be synergistic, and additional therapies are also contemplated as aspects of the invention.

In addition to their use in the method, the ligand binding molecules can be combined or packaged with other therapeutic agents in kits or as unit doses. New disease is not the only disease that can be treated with the ligand binding molecule. The ligand binding molecule can be used as a therapeutic agent for any disease associated with abnormal angiogenesis or lymphangiogenesis.

The invention can also be described in the following additional embodiments:

Under the proviso that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, the above comprising an amino acid sequence identical to the amino acid sequence defined by positions 47-115 of SEQ ID NO: 2 The polypeptide is a purified or isolated ligand binding polypeptide that binds to at least one ligand polypeptide selected from human VEGF-C, VEGF-D, and PlGF.

Under the proviso that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, comprising an amino acid sequence identical to the amino acid sequence defined by positions 47-210 of SEQ ID NO: 2, Purified or isolated ligand binding polypeptides.

In paragraph [0048], under the proviso that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, in the amino acid sequence defined by positions 47-314 of SEQ ID NO: 2 Purified or isolated ligand binding polypeptides comprising the same amino acid sequence.

In paragraph [0048], under the proviso that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, in the amino acid sequence defined by positions 47-752 of SEQ ID NO: 2 Purified or isolated ligand binding polypeptides comprising the same amino acid sequence.

The method according to any one of paragraphs [0048] to [0051], of positions 33-35 of SEQ ID NO: 2, positions 166-168 of SEQ ID NO: 2, positions 251-253 of SEQ ID NO: 2, and A purified or isolated ligand binding polypeptide having four N-glycosylation sequence sites corresponding to positions 299-301.

Glycosylated at the four N-glycosylation sequence sites, according to paragraph [0052], a purified or isolated ligand binding polypeptide.

Purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0053] which is a soluble polypeptide.

In any one of paragraphs [0048] to [0054], under the clue that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is not identical to NXS or NXT, positions 47-115 of SEQ ID NO: 2 , A purified or isolated amino acid sequence comprising an amino acid sequence identical to an amino acid sequence defined by positions 47-210 of SEQ ID NO: 2, positions 47-314 of SEQ ID NO: 2, or positions 47-752 of SEQ ID NO: 2 Ligand binding polypeptide.

Purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0055] that binds to human VEGF-C or human VEGF-D.

Inhibiting VEGF-C- or VEGF-D-binding to VEGFR-3 or inhibiting VEGF-C- or VEGF-D-mediated stimulation of VEGFR-3 in cells expressing VEGFR-3 on its surface , Purified or isolated ligand binding polypeptide according to paragraph [0056].

Purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0057], which binds to human VEGF-C with a Kd of 1 nM or less.

Purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0057], which binds to human VEGF-D with a Kd of 5 nM or less.

The purified or isolated ligand-binding polypeptide according to any one of paragraphs [0048] to [0057], wherein an amino acid in the polypeptide corresponding to position 104 of SEQ ID NO: 2 has been deleted or replaced with another amino acid.

In paragraph [0055], the amino acid at position 104 of SEQ ID NO: 2 is deleted or substituted with another amino acid selected from the group consisting of glutamine, aspartate, glutamate, arginine and lysine, purified or isolated ligand-binding poly Peptide.

A purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0056], comprising amino acid sequences 23-290 of SEQ ID NO: 3.

Purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0062] further comprising a signal peptide.

Purified or isolated ligand binding polypeptide according to any one of paragraphs [0048] to [0063], further comprising at least one polyethylene glycol moiety attached to the polypeptide.

A purified or isolated ligand-binding polypeptide according to paragraph [0064], comprising polyethylene glycol of about 20-40 kDa attached to the amino terminus of the polypeptide.

A ligand binding molecule comprising the ligand binding polypeptide according to any one of paragraphs [0048] to [0065] linked to a heterologous peptide.

The ligand binding molecule according to paragraph [0066], wherein the heterologous peptide comprises an immunoglobulin constant domain fragment.

The ligand binding molecule according to paragraph [0066], wherein the immunoglobulin constant domain fragment is an IgG constant domain fragment.

The ligand binding molecule according to paragraph [0067], wherein the immunoglobulin constant fragment comprises amino acids 306-537 of SEQ ID NO: 3.

The ligand binding molecule according to paragraph 19, wherein the ligand binding molecule comprises amino acids 22-537 of SEQ ID NO: 3.

The ligand-binding molecule according to any one of paragraphs [0066] to [0070], optionally comprising a linker connecting the heterologous peptide to the ligand-binding polypeptide.

The ligand binding molecule according to any one of paragraphs [0066] to [0070], comprising a polypeptide in which the C-terminal amino acid of the ligand-binding polypeptide is directly attached to the N-terminal amino acid of the heterologous peptide by peptide bond.

The ligand binding molecule according to any one of paragraphs [0066] to [0072], further comprising a signal peptide that directs the secretion of the molecule from the cell expressing the molecule.

The ligand binding molecule according to paragraph [0066], wherein the molecule comprises the amino acid sequence set forth in SEQ ID NO: 3.

The ligand-binding molecule according to any one of paragraphs [0066] to [0070], wherein the ligand-binding polypeptide and the heterologous peptide are joined by an amide bond to form a single polypeptide chain.

The ligand binding polypeptide according to any one of paragraphs [0048] to [0065] or a ligand binding molecule according to any one of paragraphs 19-28 further comprising a detectable label.

A conjugate comprising the ligand-binding polypeptide according to any one of paragraphs 1-18 or the ligand-binding molecule according to any one of paragraphs [0066] to [0075], and a chemotherapeutic agent.

An isolated polynucleotide comprising a coding nucleotide sequence encoding a ligand binding polypeptide according to any one of paragraphs 1-18 or a ligand binding molecule according to any one of paragraphs [0066] to [0075].

The polynucleotide according to paragraph [0078], further comprising a promoter sequence operably linked to the coding nucleotide sequence to facilitate transcription of the coding nucleotide sequence in a host cell.

A vector comprising the polynucleotide of paragraph [0078] or paragraph [0079].

The vector according to paragraph [0080], further comprising an expression control sequence operably linked to the coding nucleotide sequence.

A vector according to paragraph [0080] selected from the group consisting of lentiviral vectors, adeno-associated viral vectors, adenovirus vectors, liposome vectors, and combinations thereof.

A vector according to paragraph [0080] comprising a replication-deficient adenovirus, wherein the adenovirus is operably linked to a promoter and comprises a polynucleotide flanked by an adenovirus polynucleotide sequence.

An isolated cell or cell line transformed or transfected with a polynucleotide according to paragraph [0078] or [0079] or a vector according to paragraphs [0080] to [0083].

An isolated cell or cell line according to paragraph [0084] which is a eukaryotic cell.

An isolated cell or cell line according to paragraph [0084] which is a human cell.

Isolated cells or cell lines according to paragraph [0084], which are Chinese hamster ovary (CHO) cells.

A method for producing a ligand-binding polypeptide comprising growing a cell according to any one of paragraphs [0084] to [0087] under conditions in which the ligand-binding polypeptide or the ligand-binding molecule encoded by the polynucleotide is expressed.

The method according to paragraph [0088], further comprising purifying or isolating the ligand binding polypeptide or the ligand binding molecule from the cell or from the growth medium of the cell.

A composition comprising a purified ligand-binding polypeptide or ligand-binding molecule according to any one of paragraphs [0048] to [0076] and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier.

A composition comprising a polynucleotide or vector according to any one of paragraphs [0078] to [0083] and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier.

A composition according to paragraph [0090] or paragraph [0091], formulated for topical administration.

The composition according to paragraph [0092], in the form of a solid, paste, ointment, gel, liquid, aerosol, mist, polymer, film, emulsion, or suspension.

A composition according to paragraph [0090] or paragraph [0091], formulated for intravitreal administration.

A method of inhibiting neovascularization in a subject, comprising administering to the subject a composition according to any one of paragraphs [0090] to [0094] in an amount effective to inhibit neovascularization in the subject.

A method of inhibiting retinal neovascularization in a subject, comprising administering to the subject a composition according to any one of paragraphs [0090] to [0094] in an amount effective to inhibit retinal neovascularization in the subject.

Treating a subject having an ocular disorder associated with retinal neovascularization, comprising administering to the subject a composition according to any one of paragraphs [0090] to [0095] in an amount effective to inhibit retinal neovascularization in the subject, Way.

In a subject in need thereof, the use of the composition according to any one of paragraphs [0090] to [0094] for inhibiting neovascularization such as retinal neovascularization or tumor neovascularization.

The method and use according to any one of paragraphs [0096] to [0098], wherein the composition is administered topically to the eye of a subject.

The method and use according to paragraph [0099], wherein the composition is administered by intravitreal injection.

The method and use according to paragraph [0099], wherein the composition is administered by topical administration.

The composition is administered in an amount effective to inhibit VEGF-C and/or VEGF-D from binding to or stimulating VEGFR-2 and/or VEGFR-3 expressed in cells or blood vessels of the eye in the eye of a subject. The method and use according to any one of paragraphs [0096] to [00101].

The ocular disorder is selected from the group consisting of macular degeneration, diabetic retinopathy and macular telangiectasia, the method and use of paragraph [0097] or [0098].

The method and use according to any one of paragraphs [0096] to [00103], further comprising administering an antibiotic to the subject.

The antibiotics are amikaycin, gentamicin, kanamycin, neomycin, netilmycin, streptomycin, tobramycin, teicoplanin, vancomycin, azithromycin, clarithromycin, clarithromycin, dirithromycin, erythromycin , Oxythromycin, troleandomycin, amoxicillin, ampicillin, azlosillin, carbenicillin, clozacillin, dicloxacillin, flucozacillin, megiocillin, napsillin, penicillin, piperacillin, ticar Cylin, bacitracin, colistin, polymyxin B, ciprofloxacin, enoxacin, gatifloxacin, levofloxacin, lomefloxacin, moxifloxacin, norfloxacin, oplasacin, trobafloxacin, mapenide, sulfa In paragraph [00104] selected from the group consisting of cetamide, sulfamethizol, sulfasalazine, sulfisoxazole, trimetoprim, cotrimoxazole, demeclocycline, soxicycline, minocycline, oxytetracycline, and tetracycline How to follow.

The method and use according to paragraph [0095] or [0098], wherein the subject has been diagnosed with a tumor, and the composition is administered in an amount effective to inhibit neovascularization in the tumor.

The method and use according to paragraph [00106], wherein the composition is administered topically to a tumor or to an organ or tissue from which the tumor has been surgically removed.

The composition inhibits VEGF-C and/or VEGF-D from binding to VEGFR-2 and/or VEGFR-3 expressed in the tumor cells or stimulating VEGFR-2 and/or VEGFR-3 in a subject's tumor The method and use according to paragraph [00106], administered in an amount effective to.

This summary of the invention is not limited or comprehensive, and additional embodiments, including examples, are described in the drawings and detailed description. All such embodiments are aspects of the invention. Moreover, for brevity, various details that may apply to multiple implementations have not been repeated for all implementations. Variations reflecting the combinations and rearrangements of the embodiments described herein are intended as aspects of the invention. In addition to the foregoing, the invention contemplates, as an additional aspect, all embodiments of the invention that are in any way narrower in scope than the variants expressly recited above. For example, for aspects described as a genus or range, all subgenus, subrange or species are expressly contemplated as embodiments of the present invention.

Brief description of the drawing

1A shows the PK profiles of VGX-300 and VGX-301-ΔN2 produced by transient CHO expression. 1B shows the PK profile of VGX-300 and VGX-301-ΔN2 produced by transient HEK expression.

Figure 2 demonstrates that both VGX-300 and VGX-301-ΔN2 specifically bind to both VEGF-C and VEGF-D.

Figure 3 shows that VGX-300 blocks VEGF-C and VEGF-D binding and a) cross-linking of VEGFR-2 and b) VEGFR-3.

4 shows that VGX-300 and VGX-300-N2 block a) VEGF-C and b) VEGF-D binding and cross-linking of VEGFR-3 in a cell-based Ba/F3 assay. Data points represent mean±SD of n≥2.

Figure 5 shows the pharmacokinetics and ocular biodistribution in rabbits after intravitreal administration

details

The present invention allows a fragment of the ECD of human VEGFR-3 with one or more modifications in the N-glycan region of the ECD to bind and neutralize human VEGF-C and human VEGF-D in vitro, and also age-related. It is based in part on studies demonstrating that it can inhibit vascular development in animal models of macular degeneration.

Growth factor receptor tyrosine kinases generally comprise three major domains: an extracellular domain (ECD), a transmembrane domain, and an intracellular domain. The ECD binds to the ligand, the transmembrane domain anchors the receptor to the cell membrane, and the intracellular domain has one or more tyrosine kinase enzyme domains and interacts with downstream signaling molecules. Vascular endothelial growth factor receptor (VEGFR) binds to their ligands via their ECD, which contains a number of immunoglobulin-like domains (Ig-like domains). Ig-like domains are identified herein using the nomenclature “D#”. For example “D1” refers to the first Ig-like domain of a particular receptor ECD. “D1-3” refers to a construct containing at least three first Ig-like domains of a particular ligand binding molecule, and an intervening sequence between domains 1 and 2 and 2 and 3.

The complete ECD of VEGFR is not required for ligand (growth factor) binding. The ECD of VEGFR-3 has 6 intact Ig-like domains and 1 truncated Ig-like domain-D5 of VEGFR-3 is post-translationally cleaved into disulfide-linked subunits, leaving VEGFR-3 . Veikkola, T., et al . , Cancer Res. 60:203-212 (2000). In some embodiments, a receptor fragment comprising at least three first Ig-like domains for a class thereof is sufficient to bind the ligand. Soluble receptors capable of binding to VEGF-C and VEGF-D and inhibiting VEGF-C or VEGF-D activity and signaling through VEGFR-3 are also known as WO2000/023565, WO2000/021560, WO2002 /060950 and WO2005/087808, the disclosures of which are incorporated herein by reference in their entirety. These soluble receptors, modified with ΔN2 sequence changes and optionally other modifications described herein, are contemplated as aspects of the present invention.

Table 1 defines the approximate boundaries of the Ig-like domain for human VEGFR-3. These boundaries are important because the selected boundaries can be used to form ligand binding molecules and thus can affect the binding properties of the resulting construct.

Table 1: Immunoglobulin-like domain for human VEGFR-3

The complete ECD extends to position about 775 of SEQ ID NO: 2.

Soluble receptor constructs for use as ligand binding molecules for human VEGF-C or VEGF-D comprise at least one Ig-like domain of VEGFR-3 as described in Table 1, preferably as many as seven. The ligand binding molecule will optionally comprise a sequence preceding the most N-terminal Ig-like domain, optionally a sequence beyond the most C-terminal Ig-like domain, and optionally also the Ig- It will contain sequences between similar domains. The variants with variants, for example, one or more amino acid substitutions of amino acid residues, additions, or deletions are also contemplated. In some embodiments, the ligand binding molecule comprises a fragment of human VEGFR-3 comprising at least three first Ig-like domains of human VEGFR-3.

In some embodiments, the ligand binding molecule is a polypeptide comprising a portion of human VEGFR-3 ECD, the portion binding to one or both of human VEGF-C and human VEGF-D, and It comprises at least the first, second and third Ig-like domains, and the amino acid sequence of the ECD fragment of VEGFR-3 is wild-type VEGFR- to eliminate the second putative N-linked glycosylation sequence of wild-type VEGFR-3. 3, and the polypeptide lacks the VEGFR-3 Ig-like domain 4-7 and preferably any transmembrane domain and preferably any intracellular domain.

In some embodiments, the ligand binding molecule is human VEGFR- under the clue that the position of the ligand binding molecule corresponding to positions 104-106 of the human VEGFR-3 polypeptide set forth in SEQ ID NO: 2 is not identical to NXS or NXT. 3 A polypeptide (SEQ ID NO: 2) or a fragment thereof and a polypeptide having a similar or identical amino acid sequence, and the ligand-binding molecule is applied to one or more growth factors selected from the group consisting of human VEGF-C and human VEGF-D. Combine. The fragment contains at least enough VEGFR-3 to bind the ligand and may contain a complete receptor. ECD fragments are preferred. A preferred polypeptide has an amino acid sequence that is at least 80% identical to its ligand binding fragment. More similar, e.g. 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% polypeptides are highly preferred. Do. In addition, fragments that are 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, and 75% are contemplated. Genus of similar polypeptides can alternatively be defined by the ability to encode a polynucleotide that hybridizes to the complement of a nucleotide sequence corresponding to a cDNA sequence encoding the VEGFR-3 receptor.

As is known in the art, the term “identity” refers to the relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by comparing sequences. In the art, “identity” also refers to the degree of sequence relevance of a nucleic acid molecule or polypeptide sequence, as determined by a match between two or more nucleotides or two or more strands of amino acid sequences, as the case may be. "Identity" measures the percentage of identical matches between fewer of two or more sequences using gap alignment (if any) that is resolved by a particular mathematical model (ie, "algorithm") of a computer program. Appropriate algorithms for determining percent identity of the present invention include BLASTP and BLASTN, using the most common and accepted default parameters.

Ligand binding molecule also encodes the ligand binding fragment of VEGFR-3, under the proviso that the position of the ligand binding molecule corresponding to positions 104-106 of the encoded ligand binding fragment of VEGFR-3 is not identical to NXS or NXT. It can be described as having an amino acid sequence encoded by a nucleic acid sequence that is at least 80% identical to a fragment of SEQ ID NO: 1. More similar, e.g. 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% polypeptides are highly preferred. Do. In addition, fragments that are 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, and 75% are contemplated. For example, a preferred ligand binding molecule is an amino acid encoded by a nucleotide sequence that binds to human VEGF-C and/or human VEGF-D and hybridizes to the complement of SEQ ID NO: 1 under moderate or very stringent conditions discussed herein. Include sequence.

In some embodiments, the ligand binding molecule is, under the proviso that positions 104-106 of the encoded ligand binding fragment of VEGFR-3 are not identical to NXS or NXT, positions 1-226 or 25-226 of SEQ ID NO: 2 , It is a polypeptide comprising a fragment of human VEGFR-3 (SEQ ID NO: 2) selected from the group consisting of positions 1-229 or 25-229 of SEQ ID NO: 2 and positions 47-247 of SEQ ID NO: 2. In some embodiments, the ligand binding molecule is, under the proviso that positions 104-106 of the encoded ligand binding fragment of VEGFR-3 are not identical to NXS or NXT, positions 47-224 of SEQ ID NO: 2, SEQ ID NO: Positions 47-225 of 2, positions 47-226 of SEQ ID NO: 2, positions 47-227 of SEQ ID NO: 2, positions 47-228 of SEQ ID NO: 2, positions 47-229 of SEQ ID NO: 2, SEQ ID NO: Positions 47-230 of 2, positions 47-231 of SEQ ID NO: 2, positions 47-232 of SEQ ID NO: 2, positions 47-236 of SEQ ID NO: 2, positions 47-240 of SEQ ID NO: 2, and SEQ ID NO : It is a polypeptide containing a fragment of human VEGFR-3 (SEQ ID NO: 2) selected from the group consisting of positions 47-247 of 2. In some embodiments, the ligand binding molecule is, under the proviso that positions 104-106 of the encoded ligand binding fragment of VEGFR-3 are not identical to NXS or NXT, positions 47-314 of SEQ ID NO: 2, SEQ ID NO: It is a polypeptide comprising a fragment of human VEGFR-3 (SEQ ID NO: 2) selected from the group consisting of positions 47-210 of 2 and positions 47-247 of SEQ ID NO: 2.

Ligand binding molecules may also be described as having an amino acid sequence similar or identical to the amino acid sequence set forth in SEQ ID NO: 3. Preferred polypeptides have an amino acid sequence that is at least 80% identical to the amino acid sequence set forth in SEQ ID NO: 3, under the proviso that positions 80-82 of the polypeptide set forth in SEQ ID NO: 3 are not identical to NXS or NXT, and the ligand binding The molecule binds to one or more growth factors selected from the group consisting of human VEGF-C and human VEGF-D. More similar, e.g. 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% polypeptides are highly preferred. Do. In addition, fragments that are 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, and 75% are contemplated. Genus of similar polypeptides can alternatively be defined by the ability to encode a polynucleotide that hybridizes to the complement of a nucleotide sequence corresponding to a cDNA sequence encoding the VEGFR-3 receptor.

In some embodiments, the ligand binding molecule comprises an amino acid sequence comprising amino acids 22-290 of SEQ ID NO: 3. In some embodiments, the ligand binding molecule comprises an amino acid sequence comprising amino acids 23-290 of SEQ ID NO: 3. In some embodiments, the ligand binding molecule comprises amino acids 22-537 of SEQ ID NO: 3, or amino acids 23-537 of SEQ ID NO: 3 or amino acids 1-537 of SEQ ID NO: 3.

As used herein, the term “component domain” refers to a domain within a ligand binding molecule based on or from a protein domain within the extracellular portion of a receptor protein. For example, each Ig-domain of VEGFR-3 (D1-D7) and other tyrosine kinase receptor class members (such as VEGFR-1 and VEGFR-2) constitute a component domain. References herein to component domains include both the fully native wild-type domain and also insertion, deletion and/or substitutional variants thereof that substantially retain the functional properties of the intact domain. It will be readily apparent to those skilled in the art that various variants of such domains (such as Ig-domains) can be obtained that will retain substantially the same functional properties as the wild-type domain.

Growth factor receptors from which ligand binding molecules can be derived include splice variants and naturally occurring allelic variants. Allelic variants are well known in the art, and represent alternative forms or nucleic acid sequences that include substitution, deletion or addition of one or more nucleotides, but do not cause any substantial functional alteration of the encoded polypeptide. Exemplary allelic variants of VEGFR-3 have been reported in the literature, e.g. at http<colon>//www.uniprot.org/uniprot/P35916, which locates positions 149, 378, 494, 527, and 641 in the ECD. Include. Standard methods including site-directed mutagenesis of polynucleotides, or specific enzymatic cleavage and ligation, can be readily used to generate the polypeptides. Similarly, the use of peptidomimetic compounds or compounds in which one or more amino acid residues have been replaced with non-naturally occurring amino acids or amino acid analogs retaining binding activity is contemplated. Preferably, when an amino acid substitution is used, the substitution is conservative, ie one amino acid is replaced by an amino acid having a similar size and similar charge characteristics. As used herein, the term “conservative substitution” refers to the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative substitutions are substitution of one hydrophobic residue with another such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine or methionine, or another of one polar residue. Substitution, for example, arginine for lysine, glutamic acid for aspartic acid, glutamine for asparagine, and the like. Neutral hydrophilic amino acids that may be substituted with each other include asparagine, glutamine, serine and threonine. The term “conservative substitution” also includes the use of substituted amino acids in place of unsubstituted amino acids.

Alternatively, conservative amino acids can be classified as described in Lehninger, ( Biochemistry , Second Edition; Worth Publishers, Inc. NY:NY, pp. 71-77 (1975)) as shown below:

Non-polar (hydrophobic)

Aliphatic: A, L, I, V, P,

Aromatic: F, W,

Sulfur-containing: M,

Middle: G.

Uncharged-polarity

Hydroxyl: S, T, Y,

Amide: N, Q,

Sulfhydryl: C,

Middle: G.

Positive charge (basic): K, R, H.

Negative charge (acid): D, E.

For the avoidance of doubt, "constituent domains" include domains whose N-X-S/T sequence motif at positions 104-106 of SEQ ID NO: 2 corresponds to D1 of VEGFR-3, eg, mutated due to substitution.

In embodiments in which the ligand binding molecule comprises multiple component domains, for example component domains D1, D2 and D3 of VEGFR-3, the component domains can be linked directly to each other or via one or more spacers. In general, the term “spacer” refers to one or more molecules, such as nucleic acids or amino acids, or non-peptide moieties, such as polyethylene glycol or disulfide bridges, which may be inserted between one or more component domains forming a covalent bond. it means. Spacer sequences can be used to provide desired sites of interest between components for ease of manipulation. The spacer can also be steric hindrance so that the component or group of components takes on its/their optimal tertiary structure and/or interacts appropriately with its/or target molecule to enhance the expression of the ligand binding polypeptide from the host cell. It can be provided to reduce. For methods of identifying spacers and preferred spacers, see, for example, George et al. (2003) Protein Engineering 15:871-879, which is expressly incorporated herein by reference. The spacer sequence may comprise one or more amino acids naturally linked to the receptor component, or enhances the expression of the ligand binding polypeptide, provides the specific desired site of interest, and allows the component domain to form an optimal tertiary structure. It may be an added sequence used to enhance the interaction of a component or group of components with their/their target molecule. In one embodiment, the spacer comprises one or more peptide sequences between one or more components, which are 1-100 amino acids, preferably 1-50 amino acids long. In a preferred embodiment, the spacer between the two component domains consists essentially of amino acids naturally linked to the receptor component within the wild-type receptor. In the case of a ligand binding molecule comprising multiple constituent domains from the same receptor, the domains are adjacent to each other in the natural receptor, for example D1, D2 and D3 of VEGFR-3, in one embodiment, the domain Are linked to each other (eg D1 to D2 and D2 to D3) using spacers corresponding to the naturally occurring amino acid linkage sequences.

In some variations, each ligand binding polypeptide is expressed as a fusion with a fusion partner protein, such as an immunoglobulin constant region, and the heterologous fusion partner is combined to form a ligand binding molecule.

Multimers, multimerizing components, fusion partners and linkers

The fusion partner is any heterologous component that enhances the functionality of the ligand binding molecule. Thus, for example, the fusion partner increases the solubility of the ligand binding polypeptide, modulates clearance, facilitates targeting of specific cell or tissue types, enhances biological activity, aids in production and/or recovery, and , Improve pharmacological properties or improve pharmacokinetic (PK) profile. With regard to enhancing the PK profile, this can be achieved, for example, by enhancing the serum half-life, tissue permeability, immunogenicity or lack of stability of the ligand binding molecule. In a preferred embodiment, the fusion partner is selected from the group consisting of a multimerizing component, a serum protein or a molecule capable of binding to a serum protein.

When the fusion partner is a serum protein or fragment thereof, it is α-1-microglobulin, AGP-1, orosomucoid, α-1-acid glycoprotein, vitamin D binding protein (DBP), hemopexin, Human serum albumin (hSA), transferrin, ferritin, apamine, haptoglobin, α-fetoprotein thyroglobulin, α-2-HS-glycoprotein, β-2-glycoprotein, hyaluronan-binding protein, trustacin , C1R, C1q a chain, galectin 3-Mac2 binding protein, fibrinogen, polymeric Ig receptor (PIGR), α-2-macroglobulin, urea transfer protein, haptoglobin, IGFBP, macrophage scavenger receptor, fibronectin , Ziontin, Fc, α-1-antichymotrypsin, α-1-antitrypsin, antithrombin III, apolipoprotein A-1, apolipoprotein B, β-2-microglobulin, ceruloplasmin, complement Component C3 or C4, a CI esterase inhibitor, a C-reactive protein, cystatin C, and protein C. In a more specific embodiment, the fusion partner is α-1-microglobulin, AGP-1, orosomucoid, α-1-acid glycoprotein, vitamin D binding protein (DBP), hemopexin, human serum albumin (hSA ), apamine, and haptoglobin. The inclusion of a fusion partner component can, if desired, extend the serum half-life of the fusion polypeptide of the invention. For example, for serum albumin fusion polypeptides, the U.S. Patents, in their entirety, are expressly incorporated herein by reference. See 6,423,512, 5,876,969, 6,593,295, and 6,548,653. hSA is widely distributed throughout the body, especially in the intestines and blood components, and plays an important role in maintaining osmotic and plasma volume. It is cleared slowly in the liver, typically 14-20 days in vivo in humans. It has a half-life (Waldmann et al. (1977) Albumin, Structure Function and Uses; Pergamon Press; pp. 255-275).

When the fusion partner is a molecule capable of binding to a serum protein, the molecule may be a synthetic small molecule, a lipid or a nucleic acid including a synthetic nucleic acid such as a liposome or an aptamer, a peptide, or an oligosaccharide. The molecule may further be a protein, such as, for example, FcγR1, FcγR2, FcγR3, polymeric Ig receptor (PIGR), ScFv, and other antibody fragments specific for serum proteins.

When the fusion partner is a multimerization component, it operably connects the first ligand-binding molecule with another ligand-binding molecule or another multimerization component of another ligand-binding molecule, resulting in higher order structures such as dimers, trimers, Any natural or synthetic sequence or compound capable of forming, etc. Suitable multimeric components include leucine zippers comprising leucine zipper domains derived from c-jun or c-fos; Sequences derived from the constant region of the kappa or lambda light chain; Synthetic sequences such as helical-ring-helical motifs (Muller et al. (1998) FEBS Lett. 432:45-49), coil-coil motifs, etc., or other generally accepted multimerization domains known in the art. have. In some embodiments, the fusion component comprises an immunoglobulin-derived domain, for example from human IgG, IgM or IgA.

In one aspect, the ligand binding molecules described herein are produced as multimers. Each subunit of the multimer comprises or consists of a ligand binding molecule, for example a ligand binding polypeptide. Such multimers may be homodimeric, heterodimeric, or multimeric soluble receptors, wherein the multimeric receptor is 9 or less subunits, preferably 6 or less subunits, even more preferably 3 or less. It consists of a subunit, and most preferably two subunits. Preferably, these multimeric soluble receptors are homodimers of ligand binding molecules.

At least two subunits in the multimer are operably connected to each other. The term “operably linked” refers to that the subunits are associated through covalent and/or non-covalent bonds. The subunits may be covalently linked by any suitable means, such as through a crosslinking reagent or a linker such as a polypeptide or peptide linker. In another embodiment, the subunits are linked through non-covalent linkages. In some variations, the two subunits (eg, two ligand binding polypeptides) are attached either directly or via a “peptide linker” by peptide linkage. The peptide linker is as short as or more than 1 to 3 amino acid residues in length (preferably consisting of small amino acids such as glycine, serine, threonine or alanine), introduced between the subunits, e.g. 13, 15 Or it may be 16 amino acid residues long. Preferably, the peptide linker is an immunologically inactive peptide. The linker is a tripeptide of the sequence EFM (Glu-Phe-Met), for example, Glu-Phe-Gly-Ala-Gly-Leu-Val-Leu-Gly-Gly-Gln-Phe-Met (SEQ ID NO: 7 ) Consisting of a 13-amino acid linker sequence, (G4S)3 (SEQ ID NO: 8) consisting of a 15-amino acid linker sequence, GGSGG SGGGG SGGGG S (SEQ ID NO: 9) consisting of a 16-amino acid linker sequence or human IgG (such as IgGl , IgG2, IgG3 or IgG4). In some variations, the two subunits are ligand binding polypeptides comprising two distinct polypeptide chains linked to each other, eg, by disulfide bonds or other bonds.

In some embodiments, the ligand binding molecule is in the form of a fusion protein comprising at least two subunits each comprising a ligand binding polypeptide. In this way, the fusion protein can be produced recombinantly by direct expression in a host cell of a nucleic acid molecule encoding the fusion protein as a single open reading frame.

In some variations, the ligand binding polypeptide is expressed as a fusion with a heterologous protein fusion partner, such as an immunoglobulin constant region, and the heterologous fusion partner is combined to form a multimeric ligand binding molecule. In one embodiment, the subunit is operably linked to the multimerization component. Multimerization components include any natural or synthetic sequence capable of operably linking two or more subunits to form higher order structures such as dimers, trimers, and the like. The multimerization component can operably link two or more subunits by interacting "directly" with the subunit. Alternatively, a multimerization component for one subunit may interact with another multimerization component for another subunit to operably link the subunit.

In one embodiment, the subunit is operably linked to an additional amino acid domain that provides for multimerization of the subunit (in particular, the additional domain comprises any functional region that provides for dimerization of the subunit. do). The term “operably linked” refers to a VEGFR-3-based subunit, and the additional amino acid domains are associated either directly or through a “peptide linker” (as described herein), via peptide linkage, wherein It indicates that the VEGFR-3-based subunit retains ligand binding properties. The additional amino acid domain may be located upstream (N-ter) or downstream (C-ter) from the VEGFR-3 subunit sequence. Preferably it is located downstream (ie away from the first immunoglobulin-like domain (Ig-I domain)). In this way, the fusion protein can be produced recombinantly, by direct expression in the host cell of the nucleic acid molecule encoding it. In such embodiments, the ligand binding molecules described herein are of a fusion protein containing a multimerization component capable of interacting with a multimerization component present in a ligand binding polypeptide and another fusion protein to form a higher order structure, such as a dimer. It is a multimer. Fusion proteins of this type can be prepared by operably linking a VEGFR-3 subunit sequence (i.e., a ligand binding polypeptide) with a domain isolated from another protein to form dimers, trimers, etc. Examples of protein sequences that enable multimerization of the ligand polypeptide described herein include, but are not limited to, immunoglobulins, hCG (WO 97/30161), collagen X (WO 04/33486), C4BP ( WO 04/20639), Erb protein (WO 98/02540) or coiled coil peptide (WO 01/00814), the disclosure of which is incorporated by reference in its entirety. It is incorporated herein.

The multimerization component may be selected from, for example, (i) an amino acid sequence of 1 to about 500 amino acids in length, (ii) a leucine zipper, (iii) a helical ring motif and (iv) a coil-coil motif. When the multimerization component comprises an amino acid sequence of 1 to about 500 amino acids in length, the sequence will form a disulfide bond with a corresponding cysteine residue on another fusion polypeptide comprising a multimerization component having at least one cysteine residue. May contain one or more cysteine residues.

In a particular aspect, the multimer is a dimer of a ligand binding polypeptide, wherein the polypeptide is operably linked to an immunoglobulin or a portion of an immunoglobulin as a fusion partner, which can also act as a multimerization component. The term “operably linked” refers to a ligand binding polypeptide and an immunoglobulin or a portion thereof, which are associated directly or through a “peptide linker” (as defined herein), through a peptide linkage, of the ligand binding polypeptide It indicates that the ligand binding properties are retained. In this embodiment, the ligand binding polypeptide is operably linked to an immunoglobulin, in particular all or a portion of a human immunoglobulin, even more particularly to the Fc portion of a human immunoglobulin. Typically the Fc portion of a human immunoglobulin contains two constant region domains (CH2 and CH3 domains) and a hinge region, but lacks the variable region. (See, e.g., U.S. Patent Nos. 6,018,026 and 5,750,375, incorporated herein by reference) The immunoglobulins are any of the major families of immunoglobulins, including IgA, IgD, IgE, IgG and IgM, and any subclasses. Or isotypes such as IgG1, IgG2, IgG3 and IgG4; It can be selected from IgA-I and IgA-2. In one embodiment, the Fc moiety is a moiety of human IgG4, which is stable in solution and has little or no complement activating activity. In another embodiment, the Fc moiety is a moiety of human IgGl. The Fc moiety can be mutated to prevent unwanted activities such as complement binding, binding to Fc receptors, and the like. The amino acid sequence derived from the immunoglobulin may be linked to the C-terminus or N-terminus, preferably the C-terminus, of the ligand binding polypeptide. Such fusion proteins can be prepared by transfecting cells with DNA encoding the VEGFR-3 subunit:Fc fusion protein and expressing the dimer in the cells. In certain embodiments, the ligand binding polypeptide is identical on each monomeric subunit (ie, the dimer is a homodimer). Methods of preparing immunoglobulin fusion proteins are described, for example, in Hollenbaugh and Aruffo ("Construction of Immunoglobulin Fusion Proteins", in Current Protocols in Immunology, Suppl. 4, pages 10.19.1-10.19. 11, 1992)] or WO 01/03737, which is well known in the art.

Alternatively, the dimer of the ligand-binding polypeptide of the present invention is operably linked to one of the ligand-binding polypeptides to the constant region of the immunoglobulin heavy chain and the other ligand-binding polypeptide to the constant region of the immunoglobulin light chain. It can be made by connecting. For example, a ligand binding polypeptide can be operably linked to the CH1-hinge-CH2-CH3 region of human IgG1, and another or the same ligand binding polypeptide can be operably linked to the C kappa region of the Ig kappa light chain. have. In one embodiment, the heavy chain constant chain is human γ4, which is stable in solution and has little or no complement activation activity. In another embodiment, the heavy chain constant chain is human γl. The heavy chain constant chain can be mutated to prevent unwanted activities such as complement binding, binding to the Fc receptor, and the like.

In addition, if desired, the fusion proteins described herein can contain any functional region that facilitates purification or production. Specific examples of such additional amino acid sequences include GST sequences or hist tag sequences. In some variations, the area that facilitates the purification is removed for formulation of the composition for pharmaceutical use.

The amino acid sequence derived from the immunoglobulin may be linked to the C-terminus or N-terminus, preferably the C-terminus, of the ligand binding polypeptide. Cells transfected with DNA encoding the immunoglobulin light chain fusion protein and the immunoglobulin heavy chain fusion protein each express a heavy/light chain heterodimer containing a ligand binding polypeptide. Both ligand binding polypeptides advantageously comprise a natural or heterologous signal peptide when initially synthesized to promote secretion from cells, but the signal sequence is cleaved upon secretion. Modifications of any of the above-described embodiments are contemplated including the signal peptide. The natural signal peptide of human VEGFR-3 comprises residues 1-24 of SEQ ID NO: 2. Many other signal peptide proteins are taught in the literature.

In another specific aspect of the invention, the multimeric ligand binding polypeptide is linked via a non-covalent linkage. Non-covalent binding of the subunit can be achieved by any suitable means that does not interfere with its biological activity (ie the ability to bind human VEGF-C and/or VEGF-D). In certain aspects, these multimers are dimers of ligand binding polypeptides, wherein one ligand binding polypeptide is operably linked to a first compound and another or the same ligand binding polypeptide is non-covalently linked to the first compound. Operably linked to the second compound. Examples of such compounds are biotin and avidin. Dimers of the ligand binding polypeptides can be prepared by operably linking one VEGFR-3 subunit to biotin and operably linking another ligand binding polypeptide to avidin. Thus, the receptor is formed through a non-covalent interaction between biotin and avidin. Other examples include subunits of heterodimeric proteinaceous hormones. In these embodiments, a DNA construct encoding one ligand binding protein is fused to a DNA construct encoding a subunit of a heterodimeric proteinaceous hormone, such as hCG, and a DNA construct encoding another ligand binding polypeptide. This heterodimeric proteinaceous hormone, such as hCG (as disclosed in US 6,193,972), is fused to DNA encoding other subunits. Since each co-expressed sequence contains a corresponding hormonal subunit to form a heterodimer upon expression, this DNA construct is co-expressed in the same cell resulting in the expression of the ligand binding molecule. The amino acid sequence derived from the heterodimeric proteinaceous hormone may be linked to the C-terminus or N-terminus, preferably the C-terminus, of the ligand-binding polypeptide. Both subunits advantageously comprise a natural or heterologous signal peptide when initially synthesized to promote secretion from the cell, but the signal sequence is cleaved upon secretion.

In one embodiment, the ligand binding molecule is operably linked to a non-VEGFR-3 derived binding unit, ie a binding unit that does not contain a component domain derived from VEGFR-3. Such chimeric ligand binding molecules may contain heterologous binding units based, for example, on other tyrosine kinase receptors. In one embodiment, such heterologous binding unit binds to at least one ligand polypeptide selected from VEGF-A (VEGF), VEGF-B, PlGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D. In a preferred embodiment, such heterologous binding units bind at least to VEGF-A (VEGF).

In one embodiment, such heterologous binding units comprise component domains derived from VEGFR-1 or VEGFR-2 or both. Examples of heterologous binding units that can be used in combination with the ligand binding molecule of the present invention in the form of a chimeric ligand binding molecule are, for example, WO 2000/75319, WO 2005/000895 and WO 2006/088650. And VEGF-trap molecules described in. Preferred heterologous binding units comprise Ig-domain 2 from VEGFR-1 (R1D2) and Ig-domain 3 from VEGFR-2 (R2D3), optionally with immunoglobulins fused to the Fc portion. In one embodiment, a chimeric molecule comprising a ligand binding polypeptide of the present invention linked to an Fc portion of an immunoglobulin operably linked with an R1D2R2D3 binding unit fused to the Fc portion of an immunoglobulin is expected. The two binding units are operably linked via a disulfide bond between the two Fc moieties.

Linker

Although the Ig-like domains of human VEGFR-3 can be attached directly to each other (via peptide, disulfide or other types of covalent bonds) or to the Ig-like domains of other receptors, the ligand binding molecules described herein can optionally be at least two It further comprises (one or more) linkers that link the different binding units together, eg linking a VEGFR-3 ECD fragment with another VEGFR-3 ECD fragment, or even a copy thereof. Linkers may also link one binding unit to another substituent described herein. In some embodiments, the linker comprises a heterologous polypeptide. For example, in some embodiments, the linker comprises a peptide linking the binding units to form a single contiguous peptide that can be expressed as a single ligand binding molecule. The linker may be chosen so that it is less likely to cause an allergic reaction. Polysaccharides or other moieties may also be used to link the binding units to form a ligand binding molecule.

More than one linker per ligand binding molecule may be used. The linker is an optimal conformation (stereoscopic) between the various ligand-binding units in order to allow the various ligand-binding units to interact with each other if desired, for example , to form a dimer, or to allow the various ligand-binding units to interact with the ligand. Can be chosen for freedom. The linker may be linear such that successive bonding units are connected continuously, or the linker may act as a backbone to which various bonding units are attached, such as a branched linker. Linkers are also described, eg , in Tam, J. Immunol. Methods 196:17 (1996) can have multiple branches. The binding units may be attached to each other or to the linker backbone through an N-terminal amino group, C-terminal carboxyl group, side chain, chemically modified group, side chain, or other means.

Linker peptides can be designed to have sequences that allow for the desired characteristics. For example, the use of a glycyl moiety allows a relatively large degree of conformational freedom, while proline will likely have the opposite effect. Peptide linkers can be selected to achieve specific secondary and tertiary structures, such as alpha helix, beta sheet or beta barrel. Quaternary structures can also be used to make a linker that non-covalently connects the two binding units. For example, fusing a protein domain having a hydrophobic side to each binding unit may enable linkage of two binding units through an interaction between the hydrophobic interactions of the two molecules. In some embodiments, the linker is capable of providing polar interactions. For example, the leucine zipper domains of the proto-oncoprotein Myc and Max can be used, respectively. Luscher and Larsson, Ongogene 18:2955-2966 (1999). In some embodiments, the linker allows the formation of salt bridges or disulfide bonds. The linker may include non-natural amino acids as well as natural amino acids that are not naturally incorporated into the polypeptide. In some embodiments, the linker comprises a coordination complex between various residues from a metal or other ion and a plurality of peptides linked thereby.

Linear peptide linkers of at least one amino acid residue are contemplated. In some embodiments, the linker has more than 10,000 residues. In some embodiments, the linker has 1-10,000 residues, 1-1000 residues, 1-100 residues, 1-50 residues, or 1-10 residues. In some embodiments, a linear peptide linker comprises a moiety with a relatively inactive side chain. The peptide linker amino acid residues need not be linked in whole or all through the alpha-carboxy and alpha-amino groups. That is, the peptides may be linked through side chain groups of various residues.

The linker may affect whether the polypeptide(s) to which the linker is fused can dimerize to each other or to another polypeptide. The linker serves many functions. Natural receptor monomers, confined to the approximately two-dimensional side of the cell membrane, have a relatively high local concentration and increase the likelihood of finding a partner in the availability of co-receptors (binding units). Free-state receptors in solution that lack such an advantage can be aided by a linker that increases the effective concentration of the monomer.

In some embodiments, the ligand binding molecule may comprise more than one type of linker. Suitable linkers may also include the chemical modifications discussed above.

Ligand binding molecules described herein may contain additional N-terminal amino acid residues, preferably methionine. Indeed, depending on the expression system and conditions, the polypeptide can be expressed in recombinant host cells with the starting methionine. These additional amino acids can then be retained in the resulting recombinant protein, or can be removed by exopeptidase such as methionine aminopeptidase according to the methods disclosed in the literature (Van Valkenburgh HA and Kahn RA, Methods Enzymol. (2002) 344: 186-93; Ben-Bassat A, Bioprocess Technol. (1991) 12:147-59).

Substituents and other chemical modifications

The ligand binding molecules described herein are optionally chemically modified using a variety of substituents. Such modifications preferably do not substantially reduce the growth factor binding affinity or specificity of the ligand binding molecule. Rather, the chemical modification imparts additional desirable characteristics as discussed herein. Chemical modifications can take many different forms, such as heterologous peptides, polysaccharides, lipids, radioactive isotopes, non-standard amino acid residues and nucleic acids, metal chelates, and various toxins.

The receptor fragments (or “binding units” or “constituent domains”) and ligand binding molecules described herein are selectively fused to heterologous fusion partners such as heterologous polypeptides to provide a variety of properties, such as increased solubility, regulation of clearance, specific cells Or targeting to the type of tissue. In some embodiments, the receptor fragment binds to the Fc domain of an IgG or other immunoglobulin. In some embodiments, the receptor fragment is fused to alkaline phosphatase (AP). Methods of making Fc or AP fusion constructs are found in WO 02/060950. By fusing the ligand binding polypeptide or molecule with a protein domain having specific properties ( e.g., half-life, bioavailability, interaction partner), these properties can be imparted to the ligand binding molecule ( e.g. , the molecule is Distribution or engineered to have a specific biological half-life). In some embodiments, the ligand binding molecule comprises a co-receptor and a VEGFR fragment.

The specific fusion partner (e.g., heterologous polypeptide) used in a particular ligand binding molecule can affect whether the VEGR-3 fragment dimerizes and, in turn, can affect ligand binding.

For substituents such as the Fc region of human IgG, the fusion may be fused directly to the ligand binding molecule or may be fused through an intervening sequence. For example, the human IgG hinge, CH2 and CH3 regions can be fused to either the N-terminus or C-terminus of the ligand binding molecule to attach the Fc region. The obtained Fc-fusion construct allows purification through a Protein A affinity column (Pierce, Rockford, Ill.). Peptides and proteins fused to the Fc region are substantially larger in vivo than their non-fused counterparts . May represent half-life. Fusion to the Fc region enables dimerization/multimerization of the fusion polypeptide. The Fc region may be a naturally occurring Fc region, or may be modified for superior characteristics such as therapeutic quality, circulation time, reduced aggregation.

Polypeptides can be modified, for example, by saccharification, amidation, carboxylation, or phosphorylation, or by production of acid addition salts, amides, esters, especially C-terminal esters, and N-acyl derivatives. The Ig-like domains I-III of VEGFR-3 contain five putative N-glycosylation sites (referred to as the N1, N2, N3, N4, and N5 sequences or regions of VEGFR-3, respectively). N1 corresponds to amino acids 33-35 of SEQ ID NO: 2; N2 corresponds to amino acids 104-106 of SEQ ID NO: 2; N3 corresponds to amino acids 166-168 of SEQ ID NO: 2; N4 corresponds to amino acids 251-253 of SEQ ID NO: 2 and N5 corresponds to positions 299-301 of SEQ ID NO: 2. In some embodiments, a ligand binding molecule described herein comprises a modification in the N2 region of the molecule. For example, in some embodiments, the amino acid in the ligand binding molecule corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with another amino acid. Conservative substitutions are preferred. In some embodiments, the amino acid corresponding to position 104 of SEQ ID NO: 2 is deleted and replaced with an amino acid selected from the group consisting of glutamine, aspartate, glutamate, arginine and lysine. In another variation, position 106 is substituted to remove the N2 sequence. In an embodiment in which the N2 sequence of SEQ ID NO: 2 is modified as described above, the N1, N3, N4 and N5 sequences of SEQ ID NO: 2 are preferably not modified.

These proteins can also be modified to produce peptide derivatives by forming covalent or non-covalent complexes with other moieties. Covalently bonded complexes can be prepared by linking the chemical moiety to a functional group on the side chain of an amino acid of the polypeptide, or a functional group at the N- or C-terminus.

Polypeptides include, but are not limited to, radiolabels, fluorescent labels, enzymes ( e.g. , enzymes that catalyze calorimetric or fluorometric reactions), substrates, solid matrices, or carriers ( e.g. , biotin or avidin). Can be joined. Examples of analogs are described in WO 98/28621 and Olofsson, et al . , Proc . Nat'l . Acad . Sci . USA , 95:11709-11714 (1998), US Pat. Nos. 5,512,545, and 5,474,982; US patent applications 20020164687 and 20020164710.

Cysteinyl residues are most often reacted with haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to produce carboxymethyl or carbosiamidomethyl derivatives. Cysteinyl residues are also bromotrifluoroacetone, α-bromo-β(5-imidazolyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimide, 3-nitro-2-pyridyl disulfide, methyl 2 It is derivatized by reaction with pyridyl disulfide, p-chloromercurybenzoate, 2-chloromercury-4-nitrophenol, orchloro-7-nitrobenzo-2-oxa-1,3-diazole.

The histidyl residue is derivatized by reaction with diethylprocarbonate at pH 5.5-7.0, as this agent is relatively specific for the histidyl side chain. Para-bromophenacyl bromide is also useful, and the reaction is preferably carried out in 0.1M sodium cacodylate at pH 6.0.

Lysinyl and amino terminal moieties react with succinic or carboxylic anhydride. Derivatization using these agents has the effect of reversing the charge of the lysine residue. Other suitable reagents for derivatizing α-amino-containing moieties include imidoesters such as methyl picolinimidate; Pyridoxal phosphate; Pyridoxal; Chloroborohydride; Trinitrobenzenesulfonic acid; O-methylisourea; 2,4 pentanedione; And an amino group transferase catalyzed reaction using glyoxylate.

Arginine residues are modified by reaction with one or several conventional reagents, particularly phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin. Derivatization of the arginine residue requires that the reaction be carried out in alkaline conditions due to the high pH of the guanidine functional group. Moreover, these reagents can react with lysine groups as well as arginine epsilon-amino groups.

Certain modifications of the tyrosyl moiety itself have been studied extensively and are of particular interest in introducing a spectroscopic label into the tyrosyl moiety by reaction with an aromatic diazonium compound or tetranitromethane. Most often, N-acetylimidisol and tetranitromethane are used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively. Tyrosyl residues are iodized using 125I or 131I to prepare labeled proteins for use in radioimmunoassay.

The carboxyl side group (aspartyl or glutamyl) is a carbodiimide (R1), such as 1-cyclohexyl-3-(2-morpholinyl-(4-ethyl) carbodiimide or 1-ethyl-3 (4 azonia It is selectively modified by reaction with 4,4-dimethylpentyl)carbodiimide Moreover, aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.

Derivatization using a bifunctional agent is useful for crosslinking the ligand binding molecule to a water-insoluble support matrix. Such derivatization can provide a linker capable of linking adjacent binding elements, or binding elements in the ligand binding molecule, to a heterologous peptide, such as an Fc fragment. Commonly used crosslinking agents are, for example , 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, with 4-azidosalicylic acid. Esters, homo-difunctional imidoesters including disuccinimidyl esters such as 3,3′-dithiobis(succinimidylpropionate), and difunctional maleimides such as bis-N-maleimido-1, Contains 8-octane. Derivatizing agents such as methyl-3-[(p-azidophenyl) dithio] propioimidate produce photoactivatable intermediates capable of forming cross-links in the presence of light. Alternatively, cyanogen bromide-activated carbohydrates and U.S. Patent No. 3,969,287, incorporated herein by reference; 3,691,016; 4,195,128; 4,247,642; 4,229,537; And a reactive water-insoluble matrix such as the reactive substrate described in No. 4,330,440 is used for protein immobilization.

Glutaminyl and asparaginyl residues are often deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. The form of any one of these moieties is within the scope of the present invention.

Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of α-amino groups of lysine, arginine, and histidine side chains (TE Creighton, Proteins: Structure and Molecule Properties , WH Freeman & Co., San Francisco, pp. 79-86,1983), acetylation of N-terminal amines, and, in some cases, amidation of C-terminal carboxyl groups. Such derivatives are chemically modified polypeptide compositions in which the ligand binding molecular polypeptide is linked to a polymer. The selected polymer is typically water soluble so that the protein to which the polymer is attached does not precipitate in an aqueous environment such as a physiological environment. The polymers selected are generally modified to have a single reactive group, such as an active ester for acylation or an aldehyde for alkylation, so that the degree of polymerization can be controlled when provided for the process of the present invention. The polymer may be of any molecular weight, and may or may not be branched. Mixtures of polymers are included within the scope of the ligand binding molecular polypeptide polymer. Preferably, for the therapeutic use of the end-product formulation, the polymer will be pharmaceutically acceptable.

Each of the above polymers may be of any molecular weight and may or may not be branched. Each of these polymers typically has an average molecular weight of about 2 kDa to about 100 kDa (the term “about” indicates that in the preparation of the water soluble polymer, some molecules will be heavier or slightly lighter than the molecular weights mentioned above). The average molecular weight of each polymer is about 5 kDa to about 50 kDa, more preferably about 12 kDa to about 40 kDa and most preferably about 20 kDa to about 35 kDa.

Suitable water soluble polymers or mixtures thereof include, but are not limited to, N-linked or O-linked carbohydrates, sugars, phosphates, carbohydrates; Party; phosphate; Polyethylene glycol (PEG) (including forms of PEG that have been used to derivatize proteins, including mono-(C1-C10) alkoxy- or aryloxy-polyethylene glycol); Monomethoxy-polyethylene glycol; Dextran (eg, low molecular weight dextran of about 6 kD), cellulose; cellulose; Other carbohydrate-based polymers, poly-(N-vinyl pyrrolidone)polyethylene glycol, propylene glycol homopolymers, polypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols ( e.g. , glycerol) and polyvinyl alcohol Includes. Also encompassed by the present invention are bifunctional crosslinking molecules that can be used to prepare covalently attached multimers.

In general, chemical derivatization can be carried out under any suitable conditions used to react the protein with the activated polymer molecule. A method for preparing a chemical derivative of a polypeptide is generally (a) the activated polymer molecule (reactive ester or aldehyde derivative of the polymer molecule) of the polypeptide under conditions in which the ligand-binding molecule is attached to one or more polymer molecules. And (b) obtaining the reaction product(s). Optimal reaction conditions will be determined based on known parameters and desired results. For example, the greater the polymer molecule:protein ratio, the greater the amount of polymer molecules attached. In one embodiment, the ligand-binding molecule polypeptide derivative may have a single polymer molecular moiety at the amino terminus. (See, for example , U.S. Patent No. 5,234,784).

A particularly preferred water soluble polymer for use herein is polyethylene glycol (PEG). As used herein, polyethylene glycol is meant to encompass any of the forms of PEG that can be used to derivatize other proteins such as mono-(C1-C10) alkoxy- or aryloxy-polyethylene glycol. PEG is a linear or branched neutral polyether, available in a wide range of molecular weights, and is soluble in water and in most organic solvents. PEG is effective in creating water shells or hydration spheres when attached to other proteins or polymer surfaces by excluding other polymers or peptides primarily through their active chain mobility and hydrophilic properties when present in water. PEG is non-toxic, non-immunogenic, and is approved by the US Food and Drug Administration for use in the body.

Proteins or enzymes conjugated to PEG demonstrated bioactivity, non-antigenic properties, and reduced clearance when administered to animals. FM Veronese et al., Preparation and Properties of Monomethoxypoly(ethylene glycol)-modified Enzymes for Therapeutic Applications, in JM Harris ed., Poly (Ethylene Glycol) Chemistry--Biotechnical and Biomedical Applications , 127-36, 1992, incorporated herein by reference . This phenomenon is due to the exclusion property of PEG in preventing recognition by the immune system. In addition, PEG has been widely used in the surface modification process to reduce protein adsorption and improve blood compatibility. SW Kim et al . , Ann. NY . Acad . Sci . 516: 116-30 1987; Jacobs et al . , Artif . Organs 12: 500-501, 1988; Park et al . , J. Poly. Sci , Part A 29:1725-31, 1991, incorporated herein by reference. Hydrophobic polymeric surfaces such as polyurethane and polystyrene can be modified by grafting of PEG (MW 3,400) and used as antithrombotic surfaces. The surface properties (contact angle) can better match the hydrophilic surface due to the hydration effect of PEG. More importantly, protein (albumin and other plasma proteins) adsorption can be greatly reduced, resulting from the high chain mobility, hydration spheres, and protein exclusion properties of PEG.

PEG (MW 3,400) was determined as the optimal size in surface immobilization studies, while Park et al . , J. Biomed . Mat. Res. 26:739-45, 1992, PEG (MW 5,000) was most beneficial in reducing protein antigenicity. (FM Veronese et al., In JM Harris, et al., Poly(Ethylene Glycol) Chemistry- Biotechnical and Biomedical Applications , 127-36.)

The method of preparing a pegylated ligand binding molecule is generally (a) reacting the polypeptide with polyethylene glycol (e.g., a reactive ester or aldehyde derivative of PEG) under conditions in which the ligand molecule is attached to one or more PEG groups. And (b) obtaining the reaction product(s). In general, the optimal reaction conditions for the acylation reaction will be determined based on known parameters and desired results. For example, the greater the ratio of PEG:protein, the greater the percentage of poly-pegylated product. In some embodiments, the ligand binding molecule will have a single PEG moiety at the N-terminus. See US Pat. No. 8,234,784, incorporated herein by reference. In some embodiments, a ligand binding molecule described herein optionally comprises at least one PEG moiety attached to the molecule. For example, in some embodiments, about 20-40 kDa of PEG is attached to the amino terminus of the ligand binding molecule.

Derivatized ligand binding molecules disclosed herein may have additional activity, enhanced or decreased biological activity, or other characteristics, such as increased or decreased half-life compared to non-derivatized molecules.

Polynucleotides encoding ligand binding molecules and expression systems

The present invention includes ligand binding molecules, binding units, and polypeptides described herein, as well as nucleic acids encoding the molecules, vectors comprising the molecules, and host cells comprising the vectors. Methods of using any of the above molecules, units, polypeptides, nucleic acids, vectors and host cells are all contemplated aspects of the invention.

An exemplary human VEGFR-3 coding sequence is shown in SEQ ID NO: 1, and a fragment of SEQ ID NO: 1 (modified in the N2 sequence) is considered as the coding sequence for the ligand binding polypeptides described herein. (For example, fragments encoding all or part of the VEGFR-3 ECD are contemplated.) Due to the well-known degeneracy of the genetic code, many equivalent coding sequences are possible for any polypeptide-encoding sequence. And all such equivalents are considered as aspects of the present invention.

Moreover, as described above, when amino acid sequence variations from VEGFR-3 wild-type ECD are considered, nucleic acid sequence variations are also considered. The nucleic acid sequence variation may be characterized by percent identity (eg, at least 80, 85, 90, 92, 93, 94, 95, 96, 97, 98, or 99% identity) relative to SEQ ID NO: 1.

Nucleotide sequence variations can also be characterized by the ability to hybridize to the complement of the desired coding sequence. The nucleic acid molecule is the ECD-encoding sequence of the nucleic acid molecule set forth in SEQ ID NO: 1, or the ECD-encoding sequence of a molecule encoding a polypeptide comprising the receptor tyrosine kinase amino acid sequence set forth in SEQ ID NOs: 2 and 3, or as described herein. An ECD-encoding sequence of a nucleic acid fragment as described herein, or an ECD-encoding sequence of a nucleic acid fragment encoding a polypeptide as described herein and a molecule comprising a nucleotide that hybridizes under medium or high stringent conditions as defined herein. do.

The term “high stringency conditions” refers to conditions designed to allow hybridization of DNA strands whose sequence is highly complementary, and to exclude hybridization of significantly mismatched DNAs. Hybridization stringency is largely determined by the temperature, ionic strength, and concentration of denaturants such as formamide. Examples of “high stringent conditions” for hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate at 65-68° C. or 0.015 M sodium chloride, 0.0015 M sodium citrate at 42° C., and 50% formamide. Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, NY 1989); And Anderson et al., Nucleic Acid Hybridization: a Practical approach, Ch. 4, IRL Press Limited (Oxford, England). Limited, Oxford, England]. Other agents may be included in the hybridization and wash buffers to reduce non-specific and/or background hybridization. Examples are 0.1% bovine serum albumin, 0.1% polyvinyl-pyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium dodecyl sulfate (NaDodSO ₄ Or SDS), Ficoll, Denhardt solution, sonicated salmon sperm DNA (or another non-complementary DNA), and dextran sulfate, other suitable agents may also be used. The concentration and type of these additives can be varied without substantially affecting the stringency of the hybridization conditions. Hybridization experiments can generally be performed at pH 6.8-7.4; In typical ionic strength conditions, the rate of hybridization is almost independent of pH. Anderson et al., Nucleic Acid Hybridization: a Practical Approach, Ch. 4, IRL Press Limited (Oxford, England)].

Factors affecting the stability of the DNA duplex include base composition, length, and degree of base pair mismatch. Hybridization conditions can be adjusted by one of ordinary skill in the art to accommodate these variables and allow DNAs with different sequence relationships to hybridize. The melting temperature of a perfectly matched DNA duplex can be estimated by the following equation:

Tm (℃) = 81.5 + 16.6 (log[Na+]) + 0.41 (%G+C)-600/N-0.72 (% formamide)

In the above formula, N is the length of the formed duplex, [Na+] is the molar concentration of sodium ions in the hybridization or washing solution, and %G+C is the percentage of (guanine+cytosine) base in the hybridization. For incompletely matched hybrids, the melting temperature is reduced by approximately 1° C. for each 1% mismatch.

The term “medium” stringent condition” refers to conditions under which DNA duplexes with a greater degree of base pair mismatch can be formed than would occur under “high stringency conditions.” Examples of typical “medium stringent conditions” are 50-65. 0.015 M sodium chloride, 0.0015 M sodium citrate at °C or 0.015 M sodium chloride, 0.0015 M sodium citrate and 20% formamide at 37-50 °C. For example, the "medium stringent" condition of 50 °C at 0.015 M sodium ion It will tolerate about 21% mismatches.

A good estimate of the melting temperature in 1M NaCl ^* for oligonucleotide probes up to about 20 nt is given by:

Tm = 2 °C per A-T base pair + 4 °C per G-C base pair

^* The sodium ion concentration in 6x salt sodium citrate (SSC) is 1 M. Suggs et al., Developmental Biology Using Purified Genes, p. 683, Brown and Fox (eds.) (1981).

High stringency washing conditions for oligonucleotides are generally 0-5° C. lower than the Tm of the oligonucleotide at 6x SSC, 0.1% SDS. The difference in the nucleic acid sequence may result in conservative and/or non-conservative modifications of the amino acid sequence to the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3. The invention also relates to isolated and/or purified DNA that corresponds to any of the aforementioned DNA sequences or hybridizes to any of the aforementioned DNA sequences under stringent conditions.

Nucleic acid molecules encoding all or portions of a polypeptide of the invention, such as a ligand binding molecule or binding unit described herein, include, but are not limited to, chemical synthesis, cDNA or genomic library screening, expression library screening, and/or cDNA or genome It can be prepared by a variety of methods, including PCR amplification of DNA. These methods and other methods useful for isolating the DNA are described, for example, in Sambrook, et al. , “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989), by Ausubel, Et al., eds., "Current Protocols In Molecular Biology," Current Protocols Press (1994), and by Berger and Kimmel, "Methods In Enzymology: Guide To Molecular Cloning Techniques," vol. 152, Academic Press, Inc., San Diego, Calif. (1987)]. Preferred nucleic acid sequences are mammalian sequences, such as human, rat, and mouse.

Chemical synthesis of nucleic acid molecules is described in Engels, et al . , Angew . Chem . Intl . Ed. , 28:716-734 (1989)], which can be achieved using methods well known in the art. These methods include, inter alia , the phosphotriester, phosphoramidite, and H-phosphonate methods of nucleic acid synthesis. Nucleic acids greater than about 100 nucleotides in length can be synthesized as several fragments up to about 100 nucleotides in length. The fragment can then be ligated as described below to form the full-length nucleic acid of interest. A preferred method is a polymer-supported synthesis using standard phosphoramidite chemistry.

The term “vector” refers to a nucleic acid molecule amplification, replication, and/or expression vehicle, often derived or in the form of a plasmid or viral DNA or RNA system, wherein the plasmid or viral DNA or RNA is a selected host cell, such as bacteria, It is functional in yeast, plant, invertebrate, and/or mammalian host cells. The vector may be maintained independently of the host cell genomic DNA or may be wholly or partially integrated with the genomic DNA. The vector will contain all necessary elements to be functional in any compatible host cell. Such elements are presented below.

When a nucleic acid encoding a polypeptide or fragment thereof is isolated, to increase the number of copies of the gene and/or to express the encoded polypeptide in a suitable host cell and/or to transform the cell in the target organism (in vivo In order to express the polypeptide), the nucleic acid is preferably amplified and/or inserted into an expression vector. Many commercially available vectors are suitable, although “customer-made” vectors can also be used. The vector is selected to be functional in a particular host cell or host tissue ( ie , for replication and/or expression). The polypeptide or fragment thereof can be amplified and/or expressed in prokaryotic and/or eukaryotic host cells, such as yeast, insect (baculovirus system), plant, and mammalian cells. The choice of host cell will depend at least in part on whether the polypeptide or fragment thereof will be glycosylated. If so, yeast, insect, or mammalian host cells are preferred; If a glycosylation site is present on the amino acid sequence, yeast and mammalian cells will glycosylate the polypeptide.

Typically, the vector used in any host cell is a complete intron sequence containing 5'flanking sequences and other regulatory elements such as enhancer(s), promoters, origin of replication elements, transcription termination elements, donor and acceptor splice sites, It will contain a signal peptide sequence, a ribosome binding site element, a polyadenylation sequence, a polylinker region for inserting a nucleic acid encoding the polypeptide to be expressed, and a selectable marker element. Optionally, the vector may contain a "tag" sequence, ie an oligonucleotide sequence located at the 5'or 3'end of the coding sequence encoding polyhis (eg, hexahise) or another small immunogenic sequence. . This tag will be expressed with the protein and can serve as an affinity tag for purification of the polypeptide from host cells. Optionally, the tag can be subsequently removed from the purified polypeptide by various methods, such as using a selected peptidase.

The vector/expression construct may optionally contain elements such as a 5'flanking sequence, an origin of replication, a transcription termination sequence, a selection marker sequence, a ribosome binding site, a signal sequence, and one or more intron sequences. The 5'flanking sequence may be homologous ( i.e. , from the same species and/or strain as the host cell), heterologous ( i.e. , from a species different from the host cell species or strain), hybridization ( i.e. , 5 from more than one source). 'Combination of flanking sequences), synthetic, or it may be a natural polypeptide 5'flanking sequence. As such, the source of the 5'flanking sequence is any single-celled prokaryotic or eukaryotic organism, any vertebrate or invertebrate organism, or if the 5'flanking sequence is functional in the host cellular machinery and can be activated thereby. It can be any plant.

The transcription termination element is typically located 3'of the end of the polypeptide coding sequence and serves to terminate the transcription of the polypeptide. Generally, in prokaryotic cells, the transcription termination element is a poly T sequence after the G-C rich fragment. The elements can be cloned from libraries, purchased commercially as part of a vector, and can be easily synthesized.

Selectable marker genes encode proteins necessary for the survival and growth of host cells in the selective culture medium. Typical selectable marker genes include (a) confer resistance to antibiotics or other toxins, such as ampicillin, tetracycline, or kanamycin in the case of prokaryotic host cells, or (b) supplement the auxotrophic deficiency of the cell; Or (c) encoding a protein that supplies important nutrients not available from the complex medium.

Ribosome binding elements, often referred to as the Shine-Dalgano sequence (prokaryote) or Kozak sequence (eukaryote), are required for the initiation of translation of mRNA. The element is typically located 3'of the promoter and 5'of the coding sequence of the polypeptide to be synthesized. The Shine-Dalgano sequence varies, but is typically polypurine ( ie , has a high AG content). Many Shine-Dalgano sequences have been identified, each of which can be easily synthesized using the method presented above.

All of the elements presented above, as well as other elements useful in the present invention, are well known to the skilled person, for example, Sambrook, et al., "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Berger, et al., eds., “Guide To Molecular Cloning Techniques,” Academic Press, Inc., San Diego, Calif. (1987]).

For this embodiment of the invention in which the recombinant polypeptide is secreted, a signal sequence is preferably included to direct secretion from the cell from which it was synthesized. Typically, the polynucleotide encoding the signal sequence is located at the 5'end of the coding region. Many signal sequences have been identified, and any of these functional in the target cell or species can be used with the transgene.

In many cases, gene transcription is increased by the presence of one or more introns on the vector. The intron may be naturally occurring, particularly when the transgene is a full length or fragment of a genomic DNA sequence. The intron may be homologous or heterologous to the transgene and/or to the transgenic mammal into which the gene is to be inserted. The promoter and the position of the intron relative to the transgene are important, as the intron must be effectively transcribed. The preferred position for the intron is 3'to the transcription start site and 5'to the polyA transcription termination sequence. In the case of a cDNA transgene, the intron is located on one side or the other ( ie , 5′ or 3′) of the transgene coding sequence. Any intron from any source, including any viral, prokaryotic and eukaryotic (plant or animal) organism, can be used to express the polypeptide provided it is compatible with the host cell(s) into which it is inserted. Also included herein are synthetic introns. Optionally, more than one intron can be used in the vector.

Exemplary vectors for recombinant expression are vectors compatible with bacterial, insect, and mammalian host cells. Such vectors include, inter alia, pCRII (Invitrogen Company, San Diego, Calif.), pBSII (Stratagene Company, La Jolla, Calif.), and pETL (BlueBacII; Invitrogen).

After the vector is constructed and the nucleic acid is inserted into the appropriate site of the vector, the completed vector can be inserted into a suitable host cell for amplification and/or polypeptide expression. Commonly used include: prokaryotic cells such as Gram-negative or Gram-positive bacteria, ie , any strain of E. coli , Bacillus , Streptomyces , Saccharomyces , Salmonella, etc.; Eukaryotic cells such as CHO (Chinese Hamster Ovary) cells; Human kidney 293 cells; COS-7 cells; Insect cells such as Sf4, Sf5, Sf9, and Sf21 and High 5 (all from Invitrogen Company, San Diego, Calif.); Various yeast cells such as Pichia my process and a plant cell and Saccharomyces. Any transformable or transfectable cell or cell line derived from any organism such as bacteria, yeast, fungi, monocotyledons and dicotyledons, plant cells, and animals is suitable.

Insertion of the vector into selected host cells (also referred to as “transformation” or “transfection”) can be accomplished using methods such as calcium chloride, electroporation, microinjection, lipofection or DEAE-dextran methods. The method chosen will be a function of the type of host cell to be used in some way. These and other suitable methods are well known to the skilled person and are presented, for example, in Sambrook, et al., supra.

Host cells containing the vector ( ie , transformed or transfected) can be cultured using standard media well known to those skilled in the art. The medium will generally contain all the nutrients necessary for the growth and survival of cells. Suitable media for culturing E. coli cells are, for example, Luria medium (LB) and/or teripic medium (TB). Suitable media for culturing eukaryotic cells are RPMI 1640, MEM, DMEM, all of which can be supplemented with serum and/or growth factors required by the particular cell line to be cultured. A suitable medium for culturing insects is Grace's medium supplemented with yeastolate, lactalbumin hydrolyzate, and/or fetal calf serum as needed.

Typically, antibiotics or other compounds useful for the selective growth of transformed cells only are added as a supplement to the medium. The compound to be used will be determined by the selection marker element present on the plasmid into which the host cell has been transformed. For example, if the selectable marker element is kanamycin resistance, the compound added to the culture medium will be kanamycin.

The amount of polypeptide produced in a host cell can be assessed using standard methods known in the art. Such methods include, but are not limited to, Western blot analysis, SDS-polyacrylamide gel electrophoresis, non-denaturing gel electrophoresis, HPLC separation, immunoprecipitation, and/or binding analysis.

If the polypeptide is designed to be secreted from the host cell, it is likely that the majority of the polypeptide will be found in the cell culture medium. However, if the polypeptide is not secreted from the host cell, it will be present in the cytoplasm (for eukaryotic, Gram-positive bacteria, and insect host cells) or in the periplasm (for Gram-negative bacterial host cells).

In the case of intracellular polypeptides, the host cell is first mechanically or osmoticly disrupted to release the cytoplasmic contents into the buffer. Then, the polypeptide is isolated from this solution.

For long-term, high-yield production of the recombinant polypeptide, stable expression is desirable. For example, cell lines stably expressing the polypeptide of interest are transformed using expression vectors that may contain viral origins of replication and/or endogenous expression elements and selectable marker genes on the same vector or on separate vectors. Can be. After introduction of the vector, cells can be grown for 1-2 days in concentrated medium, and then converted to selective medium. The purpose of the selection marker is to confer resistance to selection, and its presence enables the growth and recovery of cells that successfully express the introduced sequence. Resistant clones of stably transformed cells can be propagated using tissue culture techniques appropriate to the cell type. Cell lines that are substantially enriched in such cells can then be isolated to provide stable cell lines.

A particularly preferred high-yield production method of the recombinant polypeptide of the present invention is the use of continuously increasing levels of methotrexate as described in US 4,889,803, of amplification of dihydrofolate reductase (DHFR) in DHFR-deficient CHO cells. It is through use. The obtained polypeptide may be in a glycosylated form.

Purification of the polypeptide from solution can be accomplished using a variety of techniques. If the polypeptide is synthesized to contain a tag, such as hexahistidine or other small peptide, at its carboxyl or amino terminus, it is possible to direct the solution to the tag or to the polypeptide ( i.e. , the polypeptide is specific Monoclonal antibodies recognized as) can be essentially purified in a one-step process by passing through an affinity column with high affinity. For example, polyhistidine binds with great substitution and specificity for nickel, so an affinity column of nickel (eg, Qiagen nickel column) can be used for purification of histagged polypeptides. (See, for example, Ausubel, et al., eds., “Current Protocols In Molecular Biology,” Section 10.11.8, John Wiley & Sons, New York (1993)).

The strong affinity of the ligand for its receptor allows for affinity purification of the ligand binding molecule using the ligand binding molecule, and an affinity matrix using a complementary binding partner. Affinity chromatography is, for example , a natural binding partner ( e.g., a ligand when purifying a ligand binding molecule having an affinity for that partner) or standard procedures ( e.g. , immunizing a mouse, rabbit or other animal with an appropriate polypeptide). Thing), it can be used by using the produced antibody. The peptides of the present invention can be used to generate the above antibodies. Known antibodies or antibodies to known growth factor receptors can be used when they share an epitope with a targeted ligand binding molecule.

In addition, other well known procedures for purification can be used. Such procedures include, but are not limited to, ion exchange chromatography, molecular sieve chromatography, HPLC, natural gel electrophoresis in combination with gel elution, and preparative isopotential focusing (“isoprime” machine/technology, Hoefer Scientific). In some cases, two or more of these techniques may be combined to achieve increased purity. Preferred purification methods include polyhistidine tagging and ion exchange chromatography in combination with preparative isopotential focusing.

Polypeptides found in the periplasmic space of bacteria or in the cytoplasm of eukaryotic cells, if the processed polypeptide forms the complex, the periplasm or cytoplasm contents, including inclusion bodies (bacteria), are any standard known to the skilled person Technology can be used to extract from host cells. For example, host cells can be lysed by French press, homogenization, and/or sonication to release the contents of the periplasm. The homogenate can then be centrifuged.

If the polypeptide forms an inclusion body in the periplasm, the inclusion body can often bind to the inner and/or outer cell membrane and thus will be found mainly in the pellet material after centrifugation. The pellet material can then be treated with a chaotropic agent such as guanidine or urea to release, cleave and dissolve the inclusion body. The solubilized polypeptide can then be analyzed using gel electrophoresis, immunoprecipitation, or the like. If you want to isolate the polypeptide, and [Marston, et al . , Meth . Enz . , 182:264-275 (1990)], the isolation can be achieved using standard methods.

Gene therapy

In some embodiments, polynucleotides of the invention further comprise additional sequences that facilitate gene therapy. In one embodiment, a “naked” transgene encoding a ligand binding molecule described herein (ie, a transgene without a virus, liposome, or other vector that facilitates transfection) is used for gene therapy. .

Vectors are also useful in "gene therapy" therapeutic regimens, wherein the ligand binding polypeptide or polypeptide encoding the molecule results in cells in a subject expressing the ligand binding molecule of the invention in vivo , wherein It is administered into a subject in need of inhibition. The gene therapy aspects described in US Patent Publication Nos. 2002/0151680 and WO 01/62942, which are incorporated herein by reference, may also be applied herein.

Any suitable vector can be used to introduce the polynucleotide encoding the ligand binding molecule described herein into the host. Exemplary vectors that have been described in the literature include, but are not limited to, replication-deficient retroviral vectors including, but not limited to, lentiviral vectors (Kim et al., J. Virol., 72(1): 811-816,1998; Kingsman & Johnson, Scrip Magazine, October, 1998, pp. 43-46); Adeno-associated virus (AAV) vectors (U.S. Pat. ; Gnatenko et al., J. Invest. Med., 45: 87-98, 1997); Adenovirus (AV) vectors (US Pat. Nos. 5,792,453; 5,824,544; 5,707,618; 5,693,509; 5,670,488; 5,585,362; Quantin et al., Proc. Natl. Acad. Sci. USA, 89: 2581- 2584, 1992; Stratford Perricadet et al., J. Clin. Invest., 90:626-630, 1992; And Rosenfeld et al., Cell, 68: 143-155, 1992); Adenovirus adeno-associated virus chimera (US Pat. No. 5,856,152) or vaccina virus or herpesvirus (US Pat. No. 5,879,934; 5,849,571; 5,830,727; 5,661,033; 5,328,688); Lipofectin mediated gene transfer (BRL); Liposome vectors (US Pat. No. 5,631,237, Liposomes comprising Sendai virus proteins); And combinations thereof. All of the foregoing documents are incorporated herein by reference in their entirety.

Other non-viral delivery mechanisms considered include, but are not limited to, calcium phosphate precipitation (Graham and Van Der Eb, Virology, 52:456-467, 1973; Chen and Okayama, Mol. Cell Biol., 7:2745-2752, 1987; Rippe et al., Mol.Cell Biol., 10:689-695, 1990) DEAE-dextran (Gopal, Mol.Cell Biol., 5:1188-1190, 1985), electroporation (Tur-Kaspa et al., Mol Cell Biol., 6:716-718, 1986; Potter et al., Proc. Nat. Acad. Sci. USA, 81:7161-7165, 1984), direct microinjection (Harland and Weintraub, J. Cell Biol., 101) :1094-1099, 1985.), DNA-loaded liposomes (Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982; Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348- 3352, 1979; Felgner, Sci Am. 276(6):102-6, 1997; Felgner, Hum Gene Ther. 7(15):1791-3, 1996), cell sonication (Fechheimer et al., Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987), gene shock using high-speed microprojectiles (Yang et al., Proc. Natl. Acad. Sci USA, 87:9568-9572, 1990), and receptor-mediated transfection (Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987; Wu and Wu, Biochemistry, 27:887-892, 1988; Wu and Wu, Adv. Drug Delivery Rev., 12:159-167 , 1993).

The expression construct (or indeed the ligand binding molecule described herein) can be captured in liposomes. Liposomes are vesicle structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multi-layered liposomes have multiple lipid layers separated by an aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid component undergoes self-rearrangement prior to the formation of a closed structure and traps water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, In: Liver diseases, targeted diagnosis and therapy using specific receptors and ligands, Wu G, Wu C ed., New York: Marcel Dekker, pp. 87-104, 1991). The addition of DNA to cationic liposomes causes a topological transition from liposomes to selectively birefringent liquid-crystalline condensed globules (Radler et al., Science, 275(5301):810-4, 1997). These DNA-lipid complexes are potential non-viral vectors for use in gene therapy and delivery.

Liposomal-mediated nucleic acid delivery and expression of foreign DNA in vitro has been successful. Various commercial approaches are also contemplated in the present invention, including “repofection” techniques. In certain embodiments of the present invention, the liposome may be complexed with hemagglutinated virus (HVJ). It has been shown to facilitate fusion with cell membranes and promote cellular influx of liposome-encapsulated DNA (Kaneda et al., Science, 243:375-378, 1989). In another embodiment, the liposome may be complexed or used with nuclear nonhistone chromosomal protein (HMG-1) (Kato et al., J. Biol. Chem., 266:3361-3364, 1991). In another embodiment, the liposome may be complexed or used with both HVJ and HMG-1. Such expression constructs are applicable to the present invention in that they have been successfully used in the delivery and expression of nucleic acids in vitro and in vivo .

Another embodiment of the invention for delivery of naked DNA expression constructs into cells may include particle bombardment. This method relies on the ability to accelerate DNA-coated micropropellants at high speed, allowing them to pass through cell membranes and enter cells without killing them (Klein et al., Nature, 327:70-73, 1987). Several devices have been developed for accelerating small particles. One such device relies on a high voltage discharge to generate an electric current, which in turn provides the driving force (Yang et al., Proc. Natl. Acad. Sci USA, 87:9568-9572, 1990). The micropropellants used have been made of biologically inert materials such as tungsten or gold beads.

In embodiments using viral vectors, the preferred polynucleotide still comprises a suitable promoter and polyadenylation sequence as described above. Moreover, in these embodiments, it will be readily apparent that the polynucleotide further comprises a vector polynucleotide sequence (e.g., adenovirus polynucleotide sequence) operably linked to a sequence encoding a polypeptide of the invention.

Therapeutic uses of ligand binding molecules

The ligand binding polypeptides and molecules described herein, and the polynucleotides and vectors encoding them, are useful for inhibiting cellular processes mediated through endothelial growth factors that induce signaling through VEGFR-2 or VEGFR-3, and these receptors There are indications for the prevention or therapy of disorders associated with abnormal angiogenesis and/or lymphangiogenesis (eg, various ocular disorders and cancers) stimulated by the action of these growth factors in the phase. Ligand binding polypeptides and molecules described herein, and polynucleotides and vectors encoding them, are any disease that is ameliorated, ameliorated, inhibited or prevented by the elimination, inhibition or reduction of VEGF-C and/or VEGF-D. Or it is therapeutically useful for treating or preventing a condition. A non-limiting list of specific conditions ameliorated by inhibition or reduction of VEGF-C and/or VEGF-D (and particularly at least VEGF-C) includes: excessive vascular endothelial cell proliferation, vascular permeability, edema or inflammation , For example, brain edema associated with injury, stroke or tumor; Edema associated with inflammatory disorders, such as arthritis, including psoriasis or rheumatoid arthritis; asthma; General edema associated with burns; Ascites and pleural effusion, inflammation or trauma associated with tumors; Chronic airway inflammation; Capillary leak syndrome; blood poisoning; Kidney disease associated with increased leakage of protein; And eye disorders such as age-related macular degeneration and diabetic retinopathy.

For the sake of brevity, many methods have been described with respect to compositions comprising ligand binding molecules, but any of the constructs described herein (ligand binding polypeptides, molecules, and constructs, and polynucleotides, dimers, and It should be understood that the practice of the invention using other multimers, etc.) is contemplated.

An exemplary therapeutic use is a method of inhibiting neovascularization in a subject in need thereof, comprising administering to the subject a composition comprising a ligand binding molecule described herein in an amount effective to inhibit neovascularization in the subject. . In some embodiments, the neovascularization comprises choroidal or retinal neovascularization. In some embodiments, the neovascularization is tumor neovascularization occurring in malignant cancers and other tumors.

In another aspect, provided herein is a method of preventing or treating an ocular disorder associated with neovascularization comprising administering a composition comprising a ligand binding molecule described herein to a subject in need thereof. It is described.

In another aspect, a method of prevention or therapy of an ocular disorder causing retinal edema comprising administering a composition comprising a ligand binding molecule described herein to a subject in need of prophylaxis or therapy for the ocular disorder or disease It is described herein.

Examples of ocular disorders that can be treated include choroidal neovascularization, diabetic macular edema, age-related macular degeneration, proliferative diabetic retinopathy, retinal vein occlusion and corneal neovascularization/transplant rejection. Preferably, the amount of ligand binding molecule used is the binding of VEGF-C and/or VEGF-D ligand to VEGFR-3 (and preferably also VEGFR-2) or VEGFR-3 (and preferably also VEGFR- It is effective in inhibiting the stimulating effect of VEGF-C and/or VEGF-D on 2).

In one embodiment, the ocular disorder is age-related macular degeneration. Examples of age-related macular degeneration are non-angiogenic (also known as "dry") and angiogenic (also known as "wet") macular degeneration. In a preferred embodiment, the ocular disorder is wet age-related macular degeneration. Treating or preventing wet age-related macular degeneration also includes treating or preventing choroidal neovascularization or pigment epithelial detachment.

In one embodiment, the ocular disorder is nodular choroidal angiopathy. Nodular choroidal angiopathy is characterized by lesions from the inner choroidal vascular network of blood vessels ending with an aneurysm bulge or outward projection (Ciardella et al. (2004) Surv Ophthalmol. 49:25-37).

In one embodiment, the ocular disorder is a condition associated with choroidal neovascularization. Examples of conditions associated with choroidal neovascularization include degenerative, inflammatory, traumatic or idiopathic conditions. Treating or preventing a degenerative disorder associated with choroidal neovascularization also encompasses treating or preventing a genetically degenerative disorder. Examples of genetic degenerative disorders include vitelliform macular dystrophy, fundus flavimaculatus, and optic nerve head drusen. Examples of degenerative conditions associated with choroidal neovascularization include myopic degeneration or retinal angioid streaks. Treating or preventing inflammatory disorders associated with choroidal neovascularization can also include ocular histoplasmosis syndrome, polysomal choroiditis, enveloping choroiditis, toxoplasmosis, toxocaratosis, rubella, Vogt Goyanagi Harada syndrome, Behcet It encompasses treating or preventing the syndrome or sympathetic blepharitis. Treating or preventing traumatic disorders associated with choroidal neovascularization also encompasses treating or preventing traumatic conditions caused by choroidal rupture or strong photocoagulation.

In one embodiment, the eye disorder is hypertensive retinopathy.

In one embodiment, the eye disorder is diabetic retinopathy. Diabetic retinopathy may be non-proliferative or proliferative diabetic retinopathy. Examples of non-proliferative diabetic retinopathy include macular edema and macular ischemia.

In one embodiment, the eye disorder is sickle cell retinopathy.

In one embodiment, the ocular disorder is a condition associated with peripheral retinal neovascularization. Examples of conditions associated with peripheral retinal neovascularization include ischemic vascular disease, possible inflammatory diseases associated with ischemia, ataxia, retinitis pigmentosa, retinitis detachment, or chronic retinal detachment.

Examples of ischemic vascular disease include proliferative diabetic retinopathy, branch retinal vein occlusion, branch retinal artery occlusion, carotid cavernous fistula, sickle hemoglobinosis, non-sickle hemoglobinosis, IRVAN syndrome (idiopathic retinal vasculitis, Aneurysms, and retinal vasculitis disorders characterized by optic neuroretinitis), retinal obstruction, retinopathy of prematurity, familial effusion vitreoretinopathy, oligopolypseudomonas syndrome, aortic arch syndrome or Ilse's disease. Examples of sickle hemoglobinosis include SS hemoglobinemia and SC hemoglobinosis. Examples of non-sickle hemoglobinosis include AC hemoglobinosis and AS hemoglobinosis. Examples of oligopoly syndrome include leukemia, vandenström macroglobulinemia, multiple myeloma, erythropoiesis or myeloproliferative disorder.

Treating or preventing inflammatory diseases with possible ischemia also encompasses treating or preventing retinal vasculitis associated with systemic diseases, retinal vasculitis associated with infectious agents, uveitis or birdshot retinopathy. Examples of systemic diseases include systemic lupus erythematosus, Behcet's disease, inflammatory bowel disease, sarcoidosis, multiple sclerosis, Wegener's granulomatosis and polyarteritis nodosa. Examples of infectious agents include bacterial agents that are causative agents for syphilis, tuberculosis, Lyme disease or feline scratching disease, viruses such as herpesvirus, or toxocara. Cannis Or toxoplasma Gondii contains parasites such as these . Examples of uveitis include pars planitis or Pucci uveitis syndrome.

In one embodiment, the eye disorder is retinopathy of prematurity. Retinopathy of prematurity can result from abnormal growth of blood vessels in the vascular bed supporting the developing cornea (Pollan C (2009) Neonatal Netw. 28:93-101).

In one embodiment, the eye disorder is venous occlusion. Examples of venous occlusion include branched retinal vein occlusion and central retinal vein occlusion. Branch retinal vein occlusion can be a blockage of the part of the circulation that drains the retina of blood. The blockage can cause back-up pressure in the capillaries, which can lead to bleeding and also leakage of fluid and other components of the blood.

In one embodiment, the eye disorder is an arterial obstruction disease. Examples of arterial occlusive disease include branched retinal artery occlusion, central retinal artery occlusion, or ocular ischemic syndrome. Branch retinal artery occlusion (BRAO) can occur when one of the branches of the arterial supply to the retina is occluded.

In one embodiment, the ocular disorder is central serous chorioretinopathy (CSC). In one embodiment, the CSC is characterized by leakage of fluid in the central macula.

In one embodiment, the eye disorder is cystic macular edema (CME). In one embodiment, CME affects the central retina or macula. In another embodiment, CME occurs after cataract surgery.

In one embodiment, the eye disorder is retinal telangiectasia. In one embodiment, retinal telangiectasia is characterized by dilation and twisting of retinal blood vessels and the formation of multiple aneurysms. Idiopathic JXT, Leber's miliary aneurysm, and Kotz's disease are the three types of retinal telangiectasia.

In one embodiment, the ocular disorder is arterial great blood perfusion.

In one embodiment, the eye disorder is retinal hemangioma. In one embodiment, the retinal hemangioma occurs when the ocular blood vessels form multiple hemangiomas.

In one embodiment, the eye disorder is radiation-induced retinopathy (RIRP). In one embodiment, RIRP may exhibit symptoms such as macular edema and non-proliferative and proliferative retinopathy.

In one embodiment, the eye disorder is rubeosis iridis. In another embodiment, iris scarring causes the formation of angiogenic glaucoma. In another embodiment, iris scarring is caused by diabetic retinopathy, central retinal vein occlusion, ocular ischemic syndrome, or chronic retinal detachment.

In one embodiment, the ocular disorder is neoplasm. Examples of neoplasms include eyelid tumors, conjunctival tumors, choroidal tumors, iris tumors, optic nerve tumors, retinal tumors, invasive intraocular tumors or orbital tumors. Examples of eyelid tumors include basal cell carcinoma, squamous cell carcinoma, sebaceous carcinoma, malignant melanoma, capillary hemangioma, sweat gland cyst, nevus or seborrheic keratosis. Examples of conjunctival tumors include conjunctival Kaposi's sarcoma, squamous cell carcinoma, intraepithelial tumor of the conjunctiva, ocular dermoid cyst, lymphoma of the conjunctiva, melanoma, censorship plaque, or pterygium. Examples of choroidal tumors include choroidal nevus, choroidal hemangioma, metastatic choroidal tumor, choroidal osteoma, choroidal melanoma, ciliary melanoma or nevus of Ota. Examples of iris tumors include anterior uveal metastases, iris cysts, iris pigmentocytoma, iris melanoma, or pearl cysts of the iris. Examples of optic nerve tumors include optic neurochromocytoma, optic nerve sheath meningioma, choroidal melanoma affecting the optic nerve, or peripapillary metastases with optic neuropathy. Examples of retinal tumors include retinal pigment epithelial (RPE) hypertrophy, RPE adenoma, RPE carcinoma, retinoblastoma, hematoma of RPE, or von Hippel hemangioma. Examples of invasive intraocular tumors include chronic lymphocytic leukemia, invasive choroidal disease, or intraocular lymphoma. Examples of orbital tumors include adenocarcinoma of the lacrimal gland, cavernous hemangioma of the orbit, lymphangioma of the orbit, orbital bursa, orbital pseudotumor, orbital rhabdomyosarcoma, periorbital hemangioma in childhood, or sclerosing orbital pseudotumor.

In a further aspect, the invention features a method of treating eye damage comprising topically administering to a subject in need thereof an effective amount of a ligand binding molecule described herein such that the damage to the eye is ameliorated or ameliorated. Preferably, the eye damage is corneal damage or conjunctival damage and the treatment method reduces angiogenesis and inflammation associated with the eye damage. In some embodiments, the method is useful for treating acute and sub-acute corneal injury or conjunctival injury. Acute corneal damage can be treated within 24 hours of onset, including corneal damage or conjunctival damage caused by penetrating objects, foreign objects, or chemical damage or burns. Sub-acute injuries can be treated up to 2 weeks after injury and can include infectious etiology as well as injuries listed above. In some embodiments, the eye injury is caused by a trauma, such as a surgical injury, a chemical burn, a corneal transplant, an infectious or inflammatory disease.

The length of treatment will depend on the injury, but the duration of treatment can be as short as, for example, up to 1 month, which can include 3-6 months observation while retreatment can be given. Administration also includes an immunosuppressant, for example one or more corticosteroids, dexamethasone, or a second agent such as cyclosporine A. Topical administration includes, for example, administration of a ligand binding molecule in eye drops applied to the eye, or subconjunctival injection of the eye.

In a further aspect, described herein is a method of treating eye damage comprising topically administering to a subject in need thereof an effective amount of a ligand binding molecule described herein to cure the eye damage.

In a further aspect, reducing or improving angiogenesis associated with eye damage, comprising topically administering an effective amount of a ligand binding molecule described herein to a subject in need thereof to reduce or ameliorate angiogenesis associated with eye damage, or Methods of improving are described herein.

In a further aspect, reducing or ameliorating inflammation associated with eye damage comprising topically administering to a subject in need an effective amount of a ligand binding molecule described herein to reduce or ameliorate inflammation associated with eye damage. The method is described herein.

In a further aspect, the present invention is for the treatment of angiogenesis and/or inflammation associated with eye damage or infection, including topical administration by eye drops comprising a ligand binding molecule described herein, or subconjunctival administration by injection or insertion. Methods of administering the ligand binding molecule of are described herein.

In a further aspect, prolonging corneal graft survival after corneal transplantation in a patient by administering to the patient an effective amount of a pharmaceutical composition containing a ligand binding molecule described herein (whereby angiogenesis and/or lymphangiogenesis is inhibited in the patient's cornea). The method of doing is described herein.

Dose response studies allow accurate determination of the appropriate amount of ligand binding molecule to be used. Effective amounts are, for example, determination of the binding affinity of the polypeptide for the target receptor, determination of the amount of receptor present on the target cell, the expected dilution volume (e.g., patient weight and blood volume for in vivo embodiments). From the measurement of, and the measurement of the polypeptide scavenging rate, it can be predicted. For example, existing literature relating to the administration of known VEGF-C antibodies also provides guidance on administration of the ligand binding molecules described herein. The literature describing the administration of aflibercept (Regeneron), a ligand trap based on VEGFR-1/VEGFR-2, can also be used to provide guidance for administration of the therapeutic molecules described herein.

In some embodiments, when administered by intravitreal injection, the ligand binding molecule is about 2 mg to about 4 mg per eye (or about 1 mg to about 3 mg per eye, or about 1 mg to about 4 mg, or about 3 mg per eye). mg to about 4 mg, or about 1 mg to about 2 mg per eye). In some embodiments, the ligand binding molecule is administered at a concentration of about 1 mg, or about 2 mg, or about 3 mg, or about 4 mg, or about 5 mg, or about 6 mg per eye. The ligand binding molecule is, in some embodiments, 10 μl, 15 μl, 20 μl, 25 μl, 30 μl, 35 μl, 40 μl, 45 μl, 50 μl, 60 μl, 70 μl, 80 μl, 90 μl, It is present in any of the concentrations listed above in a volume of 95 μl or 100 μl. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4 mg/50 μl.

The ligand binding molecule described herein is for the purpose of inhibiting neovascularization in the eye of a subject in need thereof, and in a subject at risk of developing an ocular disease associated with neovascularization (eg, diabetic retinopathy, macular degeneration). It can be administered as a prophylactic treatment for preventing angiogenesis or as a therapeutic treatment to a subject suffering from an ocular disease.

Subjects at risk of developing diabetic retinopathy or macular degeneration include subjects over 50 years of age; Subjects with rheumatoid arthritis, subjects with diabetes, subjects with thyroid abnormalities, subjects with asthma, subjects with cataracts, subjects with glaucoma, subjects with lupus, subjects with hypertension, and subjects with retinal detachment . Other risk factors include genetics, diet, smoking and light exposure.

In some embodiments, for a subject in need thereof, comprising screening the subject for one or more symptoms of an ocular disorder associated with retinal neovascularization and prescribing the subject administration of a composition comprising a ligand binding molecule described herein. Methods of selecting a treatment regimen are described herein. In another embodiment, treating a subject suffering from an ocular disorder associated with retinal neovascularization comprising identifying the subject as having one or more symptoms of an ocular disorder and administering to the subject a composition comprising a ligand binding molecule. The method is described herein. Symptoms associated with eye disorders associated with retinal neovascularization include, but are not limited to, blurred vision and slow vision loss over time, floating small particles in the eye, shadows or missing areas of the field of view, astigmatism and night blindness. do.

In some embodiments, the methods described herein further comprise prescribing (or administering) a standard of care therapy for the treatment of dry eye disease. In the context of the methods described herein, “standard of care” refers to treatment generally accepted by a clinician for a particular type of patient for whom one type of disease has been diagnosed. For diabetic retinopathy and macular degeneration, for example, an aspect of the invention is to improve the standard of care therapy with co-therapy with the ligand binding molecules described herein that inhibit retinal neovascularization. Exemplary standard of care treatments for diabetic retinopathy and macular degeneration include, but are not limited to, eyelid hygiene, topical antibiotics (including but not limited to erythromycin or bacitracin ointment), oral tetracycline (tetracycline, doxycycline, or Minocycline), anti-inflammatory compounds (including, but not limited to, cyclosporine), corticosteroids, laser photocoagulation and photodynamic therapy.

A method of treating a mammalian subject having an ocular disorder associated with retinal neovascularization that is hyporesponsive to a standard of care regimen for the treatment of an ocular disorder comprising administering to the subject a ligand binding molecule in an amount effective to treat the ocular disorder. It is also considered.

The mammalian subject is preferably a human subject. Also contemplated is the practice of the methods of the invention in mammals (eg, primate, pig, dog, or rabbit animals) that are commonly used as models for demonstrating therapeutic efficacy in other mammalian subjects, particularly humans.

Combination therapy and additional active agents

Combination therapy and prophylactic embodiments of the invention include products and methods. Exemplary compounds that can be administered in combination with one or more of the ligand binding molecules described herein include, but are not limited to, the compounds provided in Table 2 below.

The ligand binding molecule can be administered in combination with one or more additional active compounds or therapy, including a second receptor trap molecule, cytotoxic agent, surgery, catheter device and radiation. Exemplary combination products include two or more formulations formulated as a single composition or packaged together in separate compositions, eg, as unit dose packages or kits. Exemplary combination methods include the regimen of administration, or administration of two or more agents simultaneously or together or at staggered times (ie, sequentially).

The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells. The term is intended to include radioactive isotopes (eg I ¹³¹ , I ¹²⁵ , Y ⁹⁰ and Re ¹⁸⁶ ), chemotherapeutic agents, and toxins, such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof. Is to do.

"Chemotherapeutic agents" are chemical compounds useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide (Cytoxan®); Alkyl sulfonates such as busulfan, improsulfan and piposulfan; Aziridines such as benzodopa, carboquene, meturedopa, and uredopa; Ethyleneimine and methylamelamine such as altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylol melamine; Nitrogen mustards such as chlorambucil, clonafagin, chlorophosphamide, estramustine, ifosfamide, mechloretamine, mechlorethamine oxide hydrochloride, melphalan, nobembicine, phenesterine, prednim Mustine, trophosphamide, uracil mustard; Nitrosoureas, such as carmustine, chlorozotosine, fotemustine, lomustine, nimmustine, ranimmustine; Antibiotics such as aclacinomycin, actinomycin, automycin, azaserine, bleomycin, cactinomycin, caliteamycin, carabicin, carminomycin, carginophylline, chromomycin, dactinomycin, dow Norubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin, epirubicin, esoleubicin, darubicin, marcelomycin, mitomycin, mycophenolic acid, nogalamycin, olivo Mycin, peplomycin, potpyromycin, furomycin, kelamycin, rhodorubicin, streptonigrin, streptozosine, tubercidine, ubenimex, zinostatin, zorubicin; Anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); Folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; Purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; Pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, camofur, cytarabine, dideoxyuridine, doxyfluridine, enocitabine, phloxuridine; Androgens such as calosterone, dromostanolone propionate, epithiostanol, mepithiostan, testrolactone; Anti-adrenals such as aminogluteglutetimide, mitotan, trilostan; Folic acid supplements such as prolinic acid; Aceglatone; Aldophosphamide glycoside; Aminolevulinic acid; Amsaclean; Best Labusil; Bisantrene; Edatroxate; Depopamine; Demecolchin; Diazyn; Elfornitine; Elliptinium acetate; Etogluside; Gallium nitrate; Hydroxyurea; Lentinan; Ronidamine; Mitoguazone; Mitoxantrone; Fur damole; Nitraclean; Pentostatin; Pennamet; Pyrarubicin; Grapephilic acid; 2-ethylhydrazide; Procarbazine; PSK®; Lajok acid; Siropyran; Spirogermanium; Tenuazonic acid; Triazequen; 2,2',2"-Trichlorotriethylamine; Urethane; Vindesine; Dacarbazine; Mannomustine; Mitobronitol; Mitolactol; Pipobroman; Gashitosine; Arabinoside ("Ara-C"); Cyclophosphamide; Thiotepa; Taxanes such as paclitaxel (Taxol®, Bristol-Myers Squibb Oncology, Princeton, NJ) and docetaxel (Taxotere®; Aventis Antony, France); chlorambucil; gemcitabine; 6-thioguanine; Mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; esophoside (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; na Belbin; Novantrone; Tenofoside; Daunomycin; Aminopterin; Zeloda; Ibandronate; CPT-11; Topoisomerase Inhibitor RFS 2000; Difluoromethylornithine (DMFO); Retinoic Acid; S. And pharmaceutically acceptable salts, acids or derivatives of any of the above, and anti-hormonal agents, such as anti-hormonal agents, which act to modulate or inhibit hormonal action on tumors. -Estrogens such as tamoxifen, raloxifene, aromatase inhibition 4(5)-imidazole, 4-hydroxytamoxifen, trioxyfen, keoxyfen, LY 117018, onapristone, and toremifene (Fareston); and anti Androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above are included in this definition.

As used herein, “growth inhibitor” refers to in vitro or In vivo , it refers to a compound or composition that inhibits the growth of cells, particularly cancer cells. Examples of growth inhibitory agents include agents that block cell cycle progression (at sites other than phase S), such as agents that induce G 1 arrest and M-phase arrest. Traditional M-phase blockers include vinca (vincristine and vinblastine), Taxol ®, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. Such agents that arrest G 1, e.g., tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and DNA alkylating agents such as ara-C, also diffuse to S-phase arrest. do.

VEGF-A (VEGF) inhibitor products

In some embodiments, the methods described herein optionally comprise administering a therapeutic activity that inhibits binding of VEGF-A to one or more of its receptors, particularly to VEGFR-2. The VEGF-A inhibitor product can be administered in combination with one or more of the ligand binding molecules described herein. In some embodiments, the VEGF-A inhibitor product and the ligand binding molecule are co-administered in a single composition. In another embodiment, the VEGF-A inhibitor product is administered as a separate composition from the ligand binding molecule.

In one embodiment, the VEGF-A inhibitor product is ranibizumab, bevacizumab, aflibercept, KH902 VEGF receptor-Fc fusion protein, 2C3 antibody, ORA102, pegatanib, bevaciranib, SIRNA-027, decursin , Decurcinol, picropodophylline, gugulsterone, PLG101, eicosanoid LXA4, PTK787, pazopanib, axitinib, CDDO-Me, CDDO-Imm, shikonin, beta-hydroxyisovalerylschonine , EYE001, Ganglioside GM3, DC101 antibody, Mab25 antibody, Mab73 antibody, 4A5 antibody, 4E10 antibody, 5F12 antibody, VA01 antibody, BL2 antibody, VEGF-related protein, sFLT01, sFLT02, peptide B3, TG100801, sorafenib, or G6- 31 antibodies, or pharmaceutically acceptable salts thereof of any of the foregoing.

The cDNA and amino acid sequences of human VEGFR-2 ECD are shown in SEQ ID NOs: 5 and 6, respectively. The "VEGF-A inhibitor product" acts with a specificity to reduce the VEGF-A/VEGFR-2 interaction, for example by blocking VEGF-A binding to VEGFR-2 or by reducing the expression of VEGFR-2. It can be any molecule. As used herein, the term "VEGF-A" refers to a vascular endothelial growth factor that induces angiogenesis or angiogenesis process, which induces angiogenesis or angiogenesis process, VEGF ₁₂₁ , VEGF ₁₆₅ And various subtypes of VEGF caused by alternative splicing of the VEGF-A gene, including VEGF ₁₈₉ . The term "VEGF" may be used to refer to a "VEGF" polypeptide or "VEGF" encoding gene or nucleic acid.

The term “VEGF-A inhibitor product” refers to an agent that partially or completely reduces or inhibits the activity or production of VEGF-A. VEGF-A inhibitor products can directly or indirectly reduce or inhibit the activity or production of certain VEGF-A, such as VEGF ₁₆₅ . Moreover, “VEGF-A inhibitor products” include agents that act on a VEGF-A ligand or its cognate receptor to reduce or inhibit VEGF-A associated receptor signaling. Examples of “VEGF-A inhibitor products” include antisense molecules, ribozymes, or RNAi targeting VEGF-A nucleic acids; VEGF-A aptamer; VEGF-A antibody; Soluble VEGF receptor decori that prevents binding of VEGF-A to its cognate receptors; RNAi targeting antisense molecules, ribozymes, or cognate VEGF-A receptor (VEGFR-1 and/or VEGFR-2) nucleic acids; VEGFR-1 and VEGFR-2 aptamer or VEGFR-1 and VEGFR-2 antibodies; And VEGFR-1 and/or VEGFR-2 tyrosine kinase inhibitors.

The VEGF-A inhibitor is a soluble VEGFR-2 ECD fragment that binds to VEGF (amino acids 20-764 of SEQ ID NO: 6); Soluble VEGFR-1 ECD fragments, ligand traps based on soluble VEGFR-1/R2, such as aflibercept (Regeneron); VEGFR-2 anti-sense polynucleotide or short interfering RNA (siRNA); Anti-VEGFR-2 antibody; A VEGFR-2 inhibitory polypeptide comprising an antigen-binding fragment of an anti-VEGFR-2 antibody that inhibits the binding between VEGFR-2 and VEGF; It may be a polypeptide containing an aptamer that inhibits the binding between VEGFR-2 and VEGF-A. In some variations, the VEGFR-2 based ligand trap comprises a fusion protein comprising a soluble VEGFR-2 polypeptide fragment fused to an immunoglobulin constant region fragment (Fc). In some embodiments, the VEGFR-2 polypeptide fragment is fused to alkaline phosphatase (AP). Methods of making Fc or AP fusion constructs are found in WO 02/060950, the disclosure of which is incorporated herein by reference in its entirety.

Many VEGF-A antibodies have been described and are described, for example, in US Pat. Nos. 8,349,322; 8,236,312; 8,216,571; 8,101,177; 8,102,797; 8,088,375; 8,034,905; 5,730,977; 6,342,219, 6,524,583, 6,451,764, 6,448,077, 6,416,758, 6,342,221 and PCT Publication Nos. WO 96/30046, WO 97/44453, and WO 98/45331, , The contents of which are incorporated herein by reference in their entirety. Exemplary VEGF-A antibodies include bevacizumab (Avastin®) and ranibizumab (Lucentis®). In some embodiments, one or more of the ligand binding molecules described herein are administered in combination with bevacizumab. In some embodiments, one or more of the one or more ligand binding molecules described herein are administered in combination with ranibizumab.

In some embodiments, the VEGF-A inhibitor is EYE001 (previously also referred to as NX1838), which is a modified, pegylated apttimer that binds with high specific affinity to the major soluble human VEGF subtype (U.S. Patent No. 6,011,020. No. 6,051,698; and 6,147,204). The aptamer binds to and inactivates VEGF in a manner similar to a high-affinity antibody for VEGF. Another useful VEGF aptamer is EYE001 in its non-pegylated form.

In a preferred embodiment, one or more of the ligand binding molecules described herein are administered in combination with aflibercept (Eylea®) (Holash et al., Proc. Natl. Acad. Sci. USA, 99:11393-11398, 2002, thereof. The disclosure is incorporated herein by reference in its entirety).

Many VEGFR-2 antibodies have been described, see, e.g., US Pat. No. 6,334,339 and US Patent Publication Nos. 2002/0064528, 2005/0214860, and 2005/0234225 (all of which are in their entirety Is incorporated herein by reference). Antibodies are useful for modulating the VEGFR-2/VEGF interaction because of their ability to easily generate antibodies with relative affinity, and because of the continuous improvement in the technology of adopting antibodies in human therapy. Accordingly, the present invention provides antibodies specific for VEGFR-2 (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, bifunctional/bispecific antibodies, humanized antibodies, human antibodies, and polyclonal antibodies of the invention). Consider the use of a complementarity determining region (CDR)-grafted antibody) comprising a compound comprising a CDR sequence that specifically recognizes the peptide. Human antibodies can also be produced using a variety of techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)]. Techniques of Cole et al. and Boerner et al. are also available for the production of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(1):86 95 (1991)].Similarly, human antibodies can be prepared by introducing a human immunoglobulin locus into a transgenic animal, eg, a mouse in which the endogenous immunoglobulin gene has been partially or completely inactivated. Upon challenge, human antibody production is observed, which is very similar to that observed in humans in all respects including gene rearrangement, assembly, and antibody repertoire This approach is described, for example, in US Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and scientific literature: Marks et al., Bio/Technology 10, 779 783 (1992); Lonberg et al., Nature 368 856 859 (1994); Morrison , Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13:65- 93 (1995).

PDGF inhibitor products

In some embodiments, the methods described herein optionally comprise administering a therapeutic agent that is active in inhibiting PDGF binding to one or more of its receptors. PDGF Inhibitor Product The inhibitor product can be administered in combination with one or more of the ligand binding molecules described herein. In some embodiments, the PDGF inhibitor product and the ligand binding molecule are co-administered in a single composition. In another embodiment, the PDGF inhibitor product is administered as a separate composition from the ligand binding molecule .

The term “PDGF” refers to a platelet-derived growth factor that regulates cell growth or division. As used herein, the term "PDGF" refers to PDGF-B, PDGF-A, PDGF-C, PDGF-D, variant forms thereof and PDGF-AA, PDGF-AB, PDGF-BB, PDGF-CC, and PDGF Includes various subtypes of PDGF, including its dimer form, including -DD. Platelet-derived growth factors are two related receptor tyrosine kinase platelet-derived growth factor cell surface receptors (i.e. PDGFR), the A-chain that exerts their action through binding to and dimerization of PDGFR-α and PDGFR-β ( PDGF-A) and a homo- or heterodimer of the B-chain (PDGF-B). In addition, two additional protease-activated ligands for PDGF-C and PDGF-D, namely the PDGFR complex, have been identified (Li et al., (2000) Nat. Cell. Biol. 2: 302-9; Bergsten et al., (2001) Nat. Cell. Biol . 3: 512-6; and Uutele et al., (2001) Circulation 103: 2242-47). Because of the different ligand binding specificities of PDGFR, PDGFR-α/α binds to PDGF-AA, PDGF-BB, PDGF-AB, and PDGF-CC; PDGFR-β/β binds to PDGF-BB and PDGF-DD; It is known that PDGFR-α/β binds to PDGF-AB, PDGF-BB, PDGF-CC, and PDGF-DD (Betsholtz et al., (2001) BioEssays 23: 494-507). As used herein, the term “PDGF” also refers to a member of a family of growth factors that induce DNA synthesis and mitogenesis through binding and activation of PDGFR to reactive cell types. PDGF, for example: directed cell migration (chemotactic) and cell activation; Phospholipase activation; Increased phosphatidylinosine reversal and prostaglandin metabolism; Stimulation of both collagen and collagenase synthesis by reactive cells; Changes in cellular metabolic activity including matrix synthesis, cytokine production, and lipoprotein uptake; Indirect induction of a proliferative response in cells lacking the PDGF receptor; And strong vasoconstrictor activity. The term “PDGF” may be used to refer to a “PDGF” polypeptide, a “PDGF” encoding gene or nucleic acid, or a dimerized form thereof.

The term “PDGF inhibitor product” refers to an agent that partially or completely reduces or inhibits the activity or production of PDGF. PDGF inhibitor products can directly or indirectly reduce or inhibit the activity or production of certain PDGFs, such as PDGF-B. Moreover, “PDGF inhibitor products” include agents that act on PDGF ligands or their cognate receptors to reduce or inhibit PDGF-associated receptor signaling. Examples of “PDGF inhibitor products” include antisense molecules, ribozymes, or RNAi that target PDGF nucleic acids; PDGF aptamer, PDGF itself or a PDGF antibody against its receptor, or a soluble PDGF receptor decor that prevents binding of PDGF and its cognate receptor; Antisense molecules, ribozymes, or RNAi targeting cognate PDGF receptor (PDGFR) nucleic acids; PDGFR aptamer or PDGFR antibody that binds to the cognate PDGFR receptor; And PDGFR tyrosine kinase inhibitors.

In one embodiment, the PDGF inhibitor product is selected from Formulas A, B, C, D or E as described and defined in US 2012/0100136, the entire contents of which are incorporated herein by reference. Compound, p1B3 antibody, CDP860, IMC-3G3, 162.62 antibody, 163.31 antibody, 169.14 antibody, 169.31 antibody, αR1 antibody, 2A1E2 antibody, M4TS.11 antibody, M4TS.22 antibody, Hyb 120.1.2.1.2 antibody, Hyb 121.6. .1.1.1 Antibody, Hyb 127.5.7.3.1 Antibody, Hyb 127.8.2.2.2 Antibody, Hyb 1.6.1 Antibody, Hyb 1.11.1 Antibody, Hyb 1.17.1 Antibody, Hyb 1.18.1 Antibody, Hyb 1.19.1 Antibody, Hyb 1.23.1 Antibody, Hyb 1.24 Antibody, Hyb 1.25 Antibody, Hyb 1.29 Antibody, Hyb 1.33 Antibody, Hyb 1.38 Antibody, Hyb 1.39 Antibody, Hyb 1.40 Antibody, Hyb 1.45 Antibody, Hyb 1.46 Antibody, Hyb 1.48 Antibody, Hyb 1.49 Antibody, Hyb 1.51 Antibody, Hyb 6.4.1 Antibody, F3 Antibody, Humanized F3 Antibody, C1 Antibody, Humanized C1 Antibody, 6.4 Antibody, Anti-mPDGF-C Goat IgG Antibody, C3.1 Antibody, PDGFR-B1 Monoclonal Antibody, PDGFR-B2 Monoclonal Antibody, 6D11 Monoclonal Antibody, Sis 1 Monoclonal Antibody, PR7212 Monoclonal Antibody, PR292 Monoclonal Antibody, HYB 9610 Monoclonal Antibody, HYB 9611 Monoclonal Antibody, HYB 9612 Monoclonal Antibody, or HYB 9613 monoclonal antibody, or a pharmaceutically acceptable salt thereof, of any of the foregoing.

In a preferred embodiment, one or more ligand binding molecules described herein are PDGFR-beta antibodies (e.g., those developed by Regeneron for ocular indications) or anti-PDGF aptamers (e.g., by Ophthotech for ocular indications). It is administered in combination with E10030).

Antibody fragments of VEGF-A and PGDF inhibitor products are also contemplated, including for example Fab, Fab', F(ab')2, Fv, scFv. As used to describe the antibody of the present invention, the term "specific to" the variable region of the antibody of the present invention exclusively recognizes and binds to the polypeptide of interest (ie, localized sequence identity, homology, or similarity between family members. Notwithstanding the possible presence of, by measurable differences in binding affinity, the polypeptide of interest can be distinguished from other known polypeptides of the same family). Specific antibodies can also interact with other proteins (e.g., staphylococcal protein A or other antibodies in ELISA techniques) through interaction with sequences outside the variable region of the antibody, and especially sequences within the constant region of the molecule. This will make sense. Screening assays to determine the binding specificity of the antibodies of the present invention are well known and are commonly practiced in the art. For a comprehensive discussion of this assay, see Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor, NY (1988), Chapter 6]. Antibodies of the invention can be produced using any method well known and commonly practiced in the art.

In another embodiment, the methods described herein optionally comprise administering to the subject an anti-sense (eg, antisense against VEGFR-2) nucleic acid molecule. Antisense nucleic acid molecules for a specific protein (such as VEGFR-2) are therapeutically useful to inhibit the translation of the mRNA encoding the protein (such as VEGFR-2), and the therapeutic purpose is to eliminate the presence of the protein or It entails a demand to downregulate his level. VEGFR-2 anti-sense RNA may be useful as a VEGFR-2 antagonist, for example in the treatment of diseases in which VEGFR-2 is included as a causative factor of, for example, inflammatory diseases.

Antisense nucleic acids include a nucleotide sequence that is complementary to a “sense” nucleic acid encoding a protein (eg, complementary to the coding strand of a double-stranded cDNA molecule or to an mRNA sequence). (See, e.g., the VEGFR-3 cDNA sequence of SEQ ID NO: 1). For a method of designing and optimizing antisense nucleotides, see Lima et al ., ( J Biol Chem ;272:626-38. 1997) and Kurreck et al., ( Nucleic Acids Res .;30:1911-8. 2002). In certain aspects, antisense nucleic acid molecules are provided comprising a sequence that is complementary only to at least about 10, 25, 50, 100, 250 or 500 nucleotides or the entire protein (such as VEGFR-2) coding strand, or a portion thereof. Antisense nucleic acids that are complementary to nucleic acid molecules or protein (VEGFR-2) nucleic acid sequences encoding fragments, homologs, derivatives and analogs of proteins (such as VEGFR-2) are also contemplated.

In one embodiment, the antisense nucleic acid molecule is antisense against the “coding region” of the coding strand of the nucleotide sequence encoding a protein, such as VEGFR-2. The term “coding region” refers to a region of a nucleotide sequence that contains codons that are translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is antisense against the “conceding region” of the coding strand of the nucleotide sequence encoding the protein, such as VEGFR-2. The term “conciding region” refers to 5'and 3'sequences flanking the coding region that are not translated into amino acids (ie, also referred to as 5'and 3'untranslated regions).

The antisense nucleic acids of the present invention can be designed according to the rules of Watson and Crick or Hoogsteen base pairs. The antisense nucleic acid molecule may be complementary to the entire coding region of the protein mRNA, but more preferably is an oligonucleotide that is antisense only to a part of the coding or non-coding region of the protein mRNA. Antisense oligonucleotides can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides in length. The antisense nucleic acid of the present invention can be prepared using chemical synthesis or enzymatic ligation using processes known in the art. For example, antisense nucleic acids (e.g., antisense oligonucleotides) are naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids. Can be chemically synthesized using (eg, phosphorothioate derivatives and acridine substituted nucleotides can be used).

Examples of modified nucleotides that can be used to generate antisense nucleic acids include: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4 -Acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenin, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenin, 7- Methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio -N6-isopentenyladenin, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2 -Carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid may be biologically produced using an expression vector in which the nucleic acid is subcloned in the antisense direction.

The antisense nucleic acid molecules are typically administered to a subject or generated in situ, so that they inhibit expression of the protein by binding the protein (e. G. VEGFR-2) cells which encode the mRNA and / or genomic DNA and hybridization, or In (Eg, by inhibiting transcription and/or translation). The hybridization is due to conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to a DNA duplex, a specific interaction in the major groove of the double helix. It can be through.

In another embodiment , protein RNA is used to introduce RNA interference (RNAi) using double stranded (dsRNA) (Fire et al . , Nature 391 : 806-811. 1998) or short-interfering RNA (siRNA) sequence. Can (Yu et al., Proc Natl Acad Sci USA . 99:6047-52, 2002). “RNAi” is the process by which dsRNA induces homology-dependent degradation of complementary mRNA. In one embodiment, a nucleic acid molecule of the invention is hybridized with a "sense" ribonucleic acid of the invention by complementary base pairing to form a double stranded RNA. DsRNA antisense and sense nucleic acid molecules are provided that correspond to at least about 20, 25, 50, 100, 250 or 500 nucleotides or the entire protein (such as VEGFR-2) coding strand, or only a portion thereof. In an alternative embodiment, the siRNA is less than 30 nucleotides in length, and more preferably 21- to 23-nucleotides, and is produced by ribonuclease III cleavage from a longer dsRNA, characterized by 2- to 3- It has a nucleotide 3'-overhang end. See, for example, Tuschl T. ( Nat Biotechnol . 20:446-48. 2002). The preparation and use of RNAi compounds are described in US Patent Publication No. 2004/0023390, the disclosure of which is incorporated herein by reference in its entirety.

Intracellular transcription of small RNA molecules can be achieved by cloning the siRNA template into an RNA polymerase III (Pol III) transcription unit, which usually encodes small nuclear RNA (snRNA) U6 or human RNAse P RNA H1. Two approaches can be used to express siRNA: In one embodiment, the sense and antisense strands constituting the siRNA duplex are transcribed by separate promoters (Lee, et al . Nat. Biotechnol . 20, 500-505. 2002). ; In an alternative embodiment, the siRNA is expressed as a stem-ring hairpin RNA structure to produce siRNA after intracellular processing (Brummelkamp et al. Science 296:550-553. 2002) (incorporated herein by reference).

The dsRNA/siRNA is most often administered by annealing the sense and antisense RNA strands in vitro prior to delivery to an organism. In an alternative embodiment, RNAi can be performed by administering the sense and antisense nucleic acids of the invention in the same solution without annealing prior to administration, or by administering the nucleic acids in separate vehicles within a very close period of time. Nucleic acid molecules encoding fragments, homologs, derivatives and analogs of proteins (such as VEGFR-2) or antisense nucleic acids complementary to the mVEGFR-2 nucleic acid sequence are also contemplated.

Aptamer is another nucleic acid based method for interfering with the interaction of receptors and their cognate ligands such as VEGFR-2 and VEGF-A and PDGFR and PGDF. Aptamers are DNA or RNA molecules that have been selected from a random pool based on their ability to bind to other molecules. Nucleic acids, proteins, small organic compounds, and even aptamers that bind to whole organisms have been selected. Methods and compositions for identifying and preparing aptamers are known to those skilled in the art and are described, for example, in U.S. Patent Nos. 5,840,867 and 5,582,981, each of which is incorporated herein by reference in its entirety.

Recent progress in the field of combinatorial science has identified short polymer sequences with high affinity and specificity for a given target. For example, SELEX technology has been used to identify DNA and RNA aptamers with binding properties that compete with mammalian antibodies, and the field of immunology has produced antibodies or antibody fragments that bind to a myriad of compounds, and phage display is very It has been used to discover new peptide sequences with advantageous binding properties. Based on the success of these molecular evolution techniques, it is clear that molecules that bind to any target molecule can be created. Ring structure is often associated with imparting the desired binding properties, such as in the following cases: aptamers often using hairpin rings created from short regions without complementary base pairing, using combinatorial arrangements of cyclized hyper-variable regions. New phage display library using cyclic peptides showing improved results compared to naturally derived antibodies and linear peptide phage display results. Thus, sufficient evidence has been generated to suggest that high affinity ligands can be generated and identified by combinatorial molecular evolution techniques. For the present invention, molecular evolution techniques can be used to isolate ligand binding molecules specific for the ligands described herein. For more information on aptamers, see in general, Gold, L., Singer, B., He, Y.Y., Brody. E., “Aptamers As Therapeutic And Diagnostic Agents,” J. Biotechnol. 74:5-13 (2000). Related techniques for generating aptamers are described in US Pat. No. 6,699,843, the whole of which is incorporated herein by reference.

In some embodiments, the aptamer prepares a library of nucleic acids; Contacting a library of nucleic acids with a growth factor, wherein a nucleic acid having a greater binding affinity for the growth factor (compared to other library nucleic acids) is selected and amplified to achieve a relatively higher affinity and specificity for the growth factor. A nucleic acid having can be produced by producing a mixture of concentrated nucleic acids. The process can be repeated, and the selected nucleic acid can be mutated and rescreened, thereby identifying the growth factor aptamer.

In another variation, the VEGF-A inhibitor product comprises a soluble ECD fragment of VEGFR-1 that binds VEGF and inhibits VEGF binding to VEGFR-2. The cDNA and amino acid sequences for VEGFR-1 are shown in SEQ ID NOs: 10 and 11. Exemplary ECD fragments of VEGFR-1 are described in US Patent Publication No. 2006/0030000 and International Patent Publication No. WO 2005/087808, the disclosure of which is incorporated herein by reference in its entirety.

Anti-inflammatory agent

In another embodiment, the methods described herein optionally comprise administering to the subject one or more anti-inflammatory agents. In some embodiments, the anti-inflammatory agent and the ligand binding molecule are co-administered in a single composition. In another embodiment, the anti-inflammatory agent is administered as a separate composition from the ligand binding molecule. Combinations comprising a ligand binding molecule, a VEGF-A inhibitor product, and an anti-inflammatory agent are particularly contemplated. As used herein, the term “anti-inflammatory agent” generally refers to any agent that reduces inflammation or swelling in a subject. While many exemplary anti-inflammatory agents are mentioned herein, it will be appreciated that although not explicitly mentioned herein, there may be additional suitable anti-inflammatory agents encompassed by the present invention.

In one variation, the anti-inflammatory agent is a non-steroidal anti-inflammatory drug (NSAID). Exemplary NSAIDs include, but are not limited to: Aspirin, Sulfasalazine ^™ , Asacol ^™ , Dipendtum ^™ , Pentasa ^™ , Anaprox ^™ , Anaprox DS ^™ (naproxen sodium); Ansaid ^™ (flurbiprofen); Arthrotec ^™ (Diclofenac Sodium + Misoprostilmisoprostil); Cataflam ^™ /Voltaren ^™ (diclofenac potassium); Clinoril ^™ (Sulindak); Daypro ^™ (oxaprozin); Disalcid ^™ (salsarate); Dolobid ^™ (diflunisal); EC Naprosyn ^™ (Naproxen sodium); Feldene ^™ (piroxicam); Indocin ^™ , Indocin SR ^™ (Indomethacin); Lodine ^™ , Lodine XL ^™ (ethodolac); Motrin ^™ (ibuprofen); Naprelan ^™ (naproxen); Naprosyn ^TMM (naproxen); Orudis ^™ , (ketoprofen); Oruvail ^™ (ketoprofen); Relafen ^™ (nabumetone); Tolectin ^™ , (tolmethine sodium); Trilisate ^™ (choline magnesium trisalicylate); Cox-1 inhibitor; Cox-2 inhibitors such as Vioxx ^™ (rofecoximab); Arcoxia ^tm (ethricoximab), Celebrex ^™ (Celecoximab); Mobic ^™ (meloxicam); Bextra ^™ (valdecoximab), Dynastat ^™ paracoximab sodium; Prexige ^™ (lumiracoximab), and southern meton. Additional suitable NSAIDs include, but are not limited to, 5-aminosalicylic acid (5-ASA, mesalamine, resalazine), ε-acetamidocaproic acid, S-adenosylmethionine, 3-amino -4-hydroxybutyric acid, amicentrin, anitrazafen, antrafenin, bendazac, bendazac ricinate, benzidamine, beprozin, broperamol, bucolome, bufezolac, ciproquazone, clock Simate, Dazidamine, Deboxamet, Detomidine, Difenpyramide, Difenpyramide, Dipicalamine, Ditazole, Emorphazone, Panetizole Mesylate, Fenflumisol, Floctaphenin, Flumizole, Flunixin , Fluproquazone, Popyrtoline, Phosphosal, Guaimesal, Guaiazolene, Isonicsirn, Repetamine HCl, Leflunomide, Lofenazole, Rotifasol, Lysine Clonicsinate, Meseclazone, Nabumetone, Nitindol, Nimesulide, Orgotein, Orphanoxin, Oxaceprom, Oxafadol, Paraniline, Perisoxal, Perisoxal Citrate, Exposure Sim, Piproxen, Pyrazolac, Pirfenidone, proquazone, proxazole, thierabine B, tripramisol, thimegadine, tolectin, tolfadol, tryptamide and 480156S, AA861, AD1590, AFP802, AFP860, AI77B, AP504, AU8001, BPPC , BW540C, CHINOIN 127, CN100, EB382, EL508, F1044, FK-506, GV3658, ITF182, KCNTEI6090, KME4, LA2851, MR714, MR897, MY309, ONO3144, PR823, PV102, PV108, R830, RS2131, SCR152, SH440, SIR133, SPAS510, SQ27239, ST281, SY6001, TA60, TAI-901 (4-benzoyl-1-indanecarboxylic acid), TVX2706, U60257, UR2301 and WY41770.

In another variation, the anti-inflammatory agent comprises a compound that inhibits the interaction of inflammatory cytokines with their receptors. Examples of cytokine inhibitors useful in combination with a specific binding agent of the present invention include, for example, antagonists of TGF-α (e.g., antibodies) (e.g. Remicade), as well as antagonists against interleukin associated with inflammation (e.g., Antibody). Such interleukins are described herein and are preferably, but not limited to, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-8, IL-9, IL- 12, IL - 13, IL-17, and IL-18. Feghali, et al., Frontiers in Biosci . , 2:12-26 (1997).

In another variation, the anti-inflammatory agent is a corticosteroid. Exemplary corticosteroids include, but are not limited to, difluoroasone diacetate, clobetasol propionate, halobetasol propionate, betamethasone, betamethasone dipropionate, budesonide, cortisone, dexamethasone, fluocinoside, halsy Noside desoxymethasone, triamcinolone, fluticasone propionate, fluocinolone acetonide, flulandlenolid, mometasone furoate, betamethasone, fluticasone propionate, fluticasone acetonide, a Clometasome dipropionate, methylprednisolone, prednisolone, prednisone, triamicinolone, desonide and hydrocortisone.

In another variation, the anti-inflammatory agent is cyclosporine.

Antibiotic

In another embodiment, the methods described herein optionally further comprise administering an antibiotic to the subject. In some embodiments, the antibiotic and the ligand binding molecule are co-administered in a single composition. In another embodiment, the antibiotic is administered as a separate composition from the ligand binding molecule. Exemplary antibiotics include, but are not limited to, tetracycline, aminoglycoside, penicillin, cephalosporin, sulfonamide drug, chloramphenicol sodium succinate, erythromycin, vancomycin, lincomycin, clindamycin, nystatin, amphotericin B, amanti Dean, idoxuridine, p-amino salicylic acid, isoniazid, rifampin, antinomycin D, mithramycin, daunomycin, adriamycin, bleomycin, vinblastine, vincristine, procarbazine, and imidazole carbox Contains amides.

Tyrosine kinase inhibitor

In another embodiment, the methods described herein further comprise administering a tyrosine kinase inhibitor that optionally inhibits VEGFR-2 and/or VEGFR-3 activity.

Exemplary tyrosine kinase inhibitors for use in the methods described herein include, but are not limited to, AEE788 (TKI, VEGFR-2, EGFR: Novartis); ZD6474 (TKI, VEGFR-1, -2,-3, EGFR: Zactima: AstraZeneca); AZD2171 (TKI, VEGFR-1, -2: AstraZeneca); SU 11248 (TKI, VEGFR-1, -2, PDGFR: sunitinib: Pfizer); AG13925 (TKI, VEGFR-1, -2: Pfizer); AG013736 (TKI, VEGFR-1, -2: Pfizer); CEP-7055 (TKI, VEGFR-1, -2,-3: Cephalon); CP-547,632 (TKI, VEGFR-1, -2: Pfizer); GW7S6024 (TKL VEGFR-1, -2, -3: GlaxoSmithKline); GW786034 (TKI, VEGFR-1, -2, -3: GlaxoSmithKline); Sorafenib (TKI, Bay 43-9006, VEGFR-1, -2, PDGFR: Bayer/Onyx); SU4312 (TKI, VEGFR-2, PDGFR: Pfizer); AMG706 (TKI, VEGFR-1, -2, -3: Amgen); XL647 (TKI, EGFR, HER2, VEGFR, ErbB4: Exelixis); XL999 (TKl, FGFR, VEGFR, PDGFR, Fll-3: Exelixis); PKC412 (TKI, KIT, PDGFR, PKC, FLT3, VEGFR-2: Novartis); AEE788 (TKI, EGFR, VEGFR2, VEGFR-1: Novartis): OSI-030 (TKI, c-kil, VEGFR: OSI Pharmaceuticals); OS1-817 (TKI c-kit, VEGFR: OSI Pharmaceuticals); DMPQ (TKI, ERGF, PDGFR, ErbB2. p56. pkA, pkC); MLN518 (TKI, Flt3, PDGFR, c-KIT (T53518: Millennium Pharmaceuticals); Restaurinib (TKI, FLT3, CEP-701, Cephalon); ZD 1839 (TKI, EGFR: Gefitinib, Iressa: AstraZcneca); OSI-774 (TKI, EGFR: Erlotinib: Tarceva: OSI Pharmaceuticals); Lafatinib (TKI, ErbB-2, EGFR, and GD-2016: Tycurve: GlaxoSmithKline).

In some embodiments, the methods described herein further comprise administering to the subject a tyrosine kinase inhibitor that inhibits angiogenesis. Exemplary anti-angiogenic tyrosine kinase inhibitors and their targets are provided in Table 2 below.

The ligand binding molecule may be administered in combination with more than one additional active compound or therapy. In one embodiment, a ligand binding molecule of the invention is administered in combination with a PDGF inhibitor product and a VEGF-A inhibitor product. For example, a ligand binding molecule (e.g., one comprising the amino acid sequence of SEQ ID NO: 3) is (i) aflibercept (Eylea®) and (ii) PDGFR antibodies (e.g., by Regeneron for ocular indications). Under development) or PDGF aptamer (eg, E10030 (Fovista ^™ ) being developed by Ophthotech for ocular indications.

Administration of combination therapy

Combination therapy with one or more additional active agents described herein can be achieved by administering to the subject a single composition or pharmacological formulation comprising the ligand binding molecule and the one or more additional active agents, or by administering to the subject one composition is ligand binding. Compositions comprising molecules and other compositions can be achieved by administering two (or more) distinct compositions or formulations simultaneously comprising additional active agents.

Alternatively, the combination therapy using the ligand binding molecules described herein may precede or follow the second agent treatment at intervals ranging from minutes to weeks. In embodiments in which the second agent and the ligand binding molecule are administered separately, ensuring that no significant time has elapsed between the time of each delivery so that the agent and the ligand binding molecule can still exert an advantageously combined effect. something to do. In such cases, it is contemplated to administer the two forms within about 12-24 hours of each other, more preferably within about 6-12 hours of each other, with a delay time of only about 12 hours being most preferred. In some situations, it may be desirable to significantly increase the duration of treatment, but from a few days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or It may be desirable for 8) to pass. Repeated treatment with one or both agents is specifically contemplated.

Formulation and pharmaceutically acceptable carrier

The invention also provides a pharmaceutical composition comprising the ligand binding molecule of the invention. Such compositions comprise a therapeutically effective amount of one or more ligand binding molecules and a pharmaceutically acceptable carrier. In one embodiment, such compositions comprise one or more ligand binding molecules and, optionally, one or more additional active agents (for combination therapy). In one embodiment, such compositions comprise one or more ligand binding molecules and optionally one or more additional active agents selected from PDGF inhibitor products and VEGF-A inhibitor products. In yet another embodiment, a composition comprising one or more ligand binding molecules of the invention and another composition comprising a PDGF inhibitor product or a VEGF-A inhibitor product are administered.

The term “pharmaceutically acceptable” is meant to be approved by a federal or state administrative agency or listed in the United States Pharmacopeia or other generally recognized pharmacopoeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic agent is administered. Such pharmaceutical carriers may be sterile liquids such as water and oils, including those of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, Includes water, ethanol, and the like. The composition, if desired, may also contain small amounts of wetting or emulsifying agents, or pH buffering agents.

The composition includes solutions, suspensions, emulsions, tablets, pills, capsules, powders, granules, gels including hydrogels, pastes, ointments, creams, delivery devices, sustained release formulations, suppositories, injections, inserts, sprays, eye drops, aerosols, etc. It can be in the form of. Compositions comprising a ligand binding molecule, one or more additional active agents, or both can be formulated according to conventional pharmaceutical practice (eg, Remington: The Science and Practice of Pharmacy, (20th ed.) ed. AR Gennaro, 2000, Lippincott Williams & Wilkins, Philadelphia, Pa. and Encyclopedia of Pharmaceutical Technology, eds., J. Swarbrick and JC Boylan, 1988-2002, Marcel Dekker, New York). Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EW Martin.

Administration of the composition may be by any suitable means resulting in an amount of an additional active agent and/or a ligand binding molecule effective in the treatment or prevention of a particular disease or disorder. Each ligand binding molecule can be mixed with a suitable carrier material, for example, and is generally present in an amount of 1-95% by weight of the total weight of the composition. The composition may be provided in a dosage form suitable for ophthalmic, oral, parenteral (eg, intravenous, intramuscular, subcutaneous), rectal, transdermal, nasal, or inhalation administration. In one embodiment, the composition is in a form suitable for direct injection into the eye.

The ligand binding molecules of the invention, and, if present in combination therapy, the one or more additional active agents may be formulated in neutral or salt form. Pharmaceutically acceptable salts are those formed with free amino groups such as those derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., and sodium, potassium, ammonium, calcium, iron hydroxide, isopropylamine, Includes those formed using free carboxy groups such as those derived from triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

The ligand binding molecules and additional active agents of the present invention may have functional groups that are sufficiently basic to react with many inorganic and organic acids to form pharmaceutically acceptable salts. Pharmaceutically-acceptable acid addition salts are prepared from pharmaceutically-acceptable acids, as is well known in the art. Such salts are described in Journal of Pharmaceutical Science, 66, 2-19 (1977) and The Handbook of Pharmaceutical Salts; Properties, Selection, and Use. P. H. Stahl and C. G. Wermuth (ED.s), Verlag, Zurich (Switzerland) 2002, the pharmaceutically acceptable salts of which are incorporated herein by reference in their entirety.

Pharmaceutically acceptable salts are sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid sheet. Rate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate , Glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, pamoate, phenylacetate, trifluoroacetate, acrylate, chlorobenzoate, dinitrobenzoate, hydroxy Benzoate, methoxybenzoate, methylbenzoate, o-acetoxybenzoate, naphthalene-2-benzoate, isobutyrate, phenylbutyrate, .alpha.-hydroxybutyrate, butine-1,4-dicarboxylate, Hexine-1,4-dicarboxylate, caprate, caprylate, cinnamate, glycolate, heptanoate, hyporate, maleate, hydroxymaleate, malonate, mandelate, mesylate, nicotinate , Phthalate, terephthalate, propiolate, propionate, phenylpropionate, sebacate, suberate, p-bromobenzenesulfonate, chlorobenzenesulfonate, ethylsulfonate, 2-hydroxyethylsulfonate, Methylsulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, naphthalene-1,5-sulfonate, xylenesulfonate, and tartrate salts.

The term “pharmaceutically acceptable salt” also refers to a salt of an additional active agent having an acidic functional group such as a ligand binding molecule and a carboxylic acid functional group, and a base. Suitable bases include, but are not limited to, hydroxides of alkali metals such as sodium, potassium, and lithium; Hydroxides of alkaline earth metals such as calcium and magnesium; Hydroxides of other metals such as aluminum and zinc; Ammonia and organic amines, such as unsubstituted or hydroxy-substituted mono-, di-, or tri-alkylamines, dicyclohexylamines; Tributyl amine; Pyridine; N-methyl, N-ethylamine; Diethylamine; Triethylamine; Mono-, bis-, or tris-(2-OH-lower alkylamine), such as mono-, bis-, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine, or tris (Hydroxymethyl)methylamine, N,N-di-lower alkyl-N(hydroxyl-lower alkyl)-amine, such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-( 2-hydroxyethyl)amine; N-methyl-D-glucamine; And amino acids such as arginine, lysine, and the like. The term "pharmaceutically acceptable salt" also includes hydrates of the compounds of the present invention.

The composition is, in one useful aspect, parenterally (e.g., intramuscular, intraperitoneal, intravenous, intraocular, intravitreal, retro-bulbar, subconjunctival, subtenon, or subcutaneous injection or By implant) or systemically. Formulations for parenteral or systemic administration include sterile aqueous or non-aqueous solutions, suspensions, or emulsions. Various aqueous carriers such as water, buffered water, saline and the like can be used. Examples of other suitable vehicles include polypropylene glycol, polyethylene glycol, vegetable oils, gelatin, hydrogels, hydrogenated naphthalene, and injectable organic esters such as ethyl oleate. The formulation may also contain adjuvants such as preservatives, wetting agents, buffering agents, emulsifying agents, and/or dispersing agents. Biocompatible, biodegradable lactide polymers, lactide/glycolide copolymers, or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of the active ingredient.

Alternatively, the composition can be administered by oral ingestion. Compositions for oral use may be prepared in solid or liquid form according to any method known in the art of making pharmaceutical compositions.

Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In general, these pharmaceutical formulations contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients. These include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, sucrose, glucose, mannitol, cellulose, starch, calcium phosphate, sodium phosphate, kaolin, and the like. Binders, buffers, and/or lubricants (eg, magnesium stearate) can also be used. Tablets and pills can additionally be prepared using an enteric coating. The composition may optionally contain sweetening agents, flavoring agents, coloring agents, flavoring agents, and preservatives to provide a more palatable formulation.

Solid dosage forms can be useful for the treatment of ocular disorders. Compositions useful for ocular use include tablets comprising one or more ligand binding molecules mixed with a pharmaceutically acceptable excipient. Such excipients are, for example, inert diluents or fillers (such as sucrose and sorbitol), lubricants, glidants, and anti-adhesive agents (such as magnesium stearate, zinc stearate, stearic acid, silica, hydrogenated vegetable oils). , Or talc).

The composition of the present invention can be administered intraocularly by intravitreal injection into the eye, as well as by subconjunctival and subtenon injection. Other routes of administration include transscleral, retrobulbar, intraperitoneal, intramuscular, and intravenous. Alternatively, the composition can be administered using a drug delivery device or an intraocular implant.

Liquid dosage forms for oral administration may include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and soft gelatin capsules. These forms may contain inert diluents commonly used in the art, such as water or oil media, and may also contain adjuvants such as wetting agents, emulsifying agents, and suspending agents.

In some cases, the composition may also be administered topically, by patch or by direct application to areas such as the epidermis or eye that are susceptible to or affected by a vascular disorder, or by iontophoresis.

In the case of the combination therapy of the present invention, the ligand binding molecule and one or more additional active agents may be mixed in tablets or other vehicles, or may be divided. In one example, the ligand binding molecule is contained inside the tablet, and the additional active agent is external, such that a substantial portion of the additional active agent is released prior to release of the contained ligand binding molecule.

In one embodiment, a composition comprising a ligand binding molecule (and optionally one or more additional active agents) may comprise one or more pharmaceutically acceptable excipients. In one embodiment, the excipients include, but are not limited to, buffering agents, non-ionic surfactants, preservatives, isotonic agents, amino acids, sugars and pH-adjusting agents. Suitable buffering agents include, but are not limited to, monobasic sodium phosphate, dibasic sodium phosphate, and sodium acetate. Suitable non-ionic surfactants include, but are not limited to, polyoxyethylene sorbicane fatty acid esters such as polysorbate 20 and polysorbate 80. Suitable preservatives include, but are not limited to, benzyl alcohol. Suitable isotonic agents include, but are not limited to, sodium chloride, mannitol, and sorbitol. Suitable sugars include, but are not limited to, α,α-trehalose anhydride. Suitable amino acids include, but are not limited to, glycine and histidine. Suitable pH-adjusting agents include, but are not limited to, hydrochloric acid, acetic acid, and sodium hydroxide. In one embodiment, the pH-adjusting agent or regulators are present in an amount effective to provide a pH of about 3 to about 8, about 4 to about 7, about 5 to about 6, about 6 to about 7, or about 7 to about 7.5. do. In one embodiment, the composition comprising the ligand binding molecule does not include a preservative. In another embodiment, the composition comprising the ligand binding molecule does not include an antimicrobial agent. In another embodiment, the composition comprising the ligand binding molecule does not comprise a bacteriostatic agent.

In one embodiment, the composition comprising the ligand binding molecule (and optionally one or more additional active agents) is in the form of an aqueous solution suitable for injection. In one embodiment, the composition comprises a ligand binding molecule, a buffer, a pH-adjusting agent, and water for injection. In another embodiment, the composition comprises a ligand binding molecule, monobasic sodium phosphate, dibasic sodium phosphate, sodium chloride, hydrochloride acid, and sodium hydroxide. In another embodiment, the composition comprises a ligand binding molecule, a phosphate salt (such as monobasic sodium phosphate), trehalose, sodium chloride and polysorbate.

Aqueous compositions useful for practicing the methods of the invention in an ocular environment have an ophthalmic compatible pH and osmotic pressure. One or more ophthalmically acceptable pH adjusting agents and/or buffering agents may be included in the compositions of the present invention, including acids such as acetic acid, boric acid, citric acid, lactic acid, phosphoric acid and hydrochloric acid; Bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, and sodium lactate; And buffering agents such as citrate/dextrose, sodium hydrogen carbonate and ammonium chloride. Such acids, bases, and buffers are included in the amount necessary to maintain the pH of the composition in an ophthalmically acceptable range. One or more ophthalmically acceptable salts may be included in the composition in an amount sufficient to adjust the osmotic pressure of the composition to an ophthalmically acceptable range. Such salts include those with sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions.

In some embodiments, compositions comprising a ligand binding molecule of the present invention are formulated for delivery to a subject's eye. Suitable ophthalmic carriers are known to those skilled in the art, and all such conventional carriers can be used in the present invention. Exemplary compounds incorporated to facilitate and facilitate the transdermal delivery of topical compositions into the eye or appendage tissue include, but are not limited to, alcohols (ethanol, propanol, and nonanol), fatty alcohols (lauyl alcohol), fatty acids ( Valeric acid, caproic acid and capric acid), fatty acid esters (isopropyl myristate and isopropyl n-hexanoate), alkyl esters (ethyl acetate and butyl acetate), polyols (propylene glycol, propanedione and hexanetriol) , Sulfoxide (dimethylsulfoxide and decylmethylsulfoxide), amides (urea, dimethylacetamide and pyrrolidone derivatives), surfactants (sodium lauryl sulfate, cetyltrimethylammonium bromide, poloxamer, span, tween, bile salts And lecithin), terpenes (d-limonene, alpha terpenol, 1,8-cineol and menthone), and alkanones (N-heptane and N-nonane). Furthermore, topically administered compositions include, but are not limited to, surface adhesion molecule modulators, including, but not limited to, cadherin antagonists, celetin antagonists, and integrin antagonists. Thus, certain carriers may take the form of sterile, ophthalmic ointments, creams, gels, solutions, or suspensions. Also included as suitable ophthalmic carriers are sustained-release polymers such as "Ocusert" polymers, "Hydron" polymers and the like.

Exemplary ophthalmic viscosity enhancers that can be used in this formulation include: sodium carboxymethyl cellulose; Methyl cellulose; Hydroxypropyl cellulose; Hydroxypropylmethyl cellulose; Hydroxyethyl cellulose; Polyethylene glycol 300; Polyethylene glycol 400; Polyvinyl alcohol; And povidone.

Some natural products, such as veegum, alginate, xanthan gum, gelatin, acacia and tragacanth, can also be used to increase the viscosity of ophthalmic solutions.

Tonicity is important because low-tension eye drops cause corneal swelling, and high-tension eye drops cause corneal deformation. The ideal tension is about 300 mOsM. The tension can be achieved by the method described in Remington: The Science and Practice of Pharmacy, known to those skilled in the art.

Stabilizers such as, for example, chelating agents such as EDTA, can also be used. Antioxidants such as sodium bisulfite, sodium thiosulfite, 8-hydroxyquinolone or ascorbic acid can also be used. Sterilization will typically be maintained by conventional ophthalmic preservatives for aqueous formulations, such as chlorobutanol, benzalkonium chloride, cetylpyridium chloride, phenyl mercuric salt, thimerosal, etc., and are non-toxic and drug in aqueous solutions. It is used in an amount ranging from 0.001 to about 0.1% by weight. Conventional preservatives for ointments include methyl and propyl parabens. Typical ointment bases include white petrolatum and mineral oil or liquid petrolatum. However, preserved aqueous carriers are preferred. The solution may be delivered manually to the eye in a suitable dosage form, such as as an eye drop, or may be delivered by a suitable microdrop or nebulizing device that typically allows a metered dose of the medicament. Examples of suitable ophthalmic carriers are sterile, substantially isotonic, aqueous solutions containing small amounts, i.e. less than about 5% by weight of hydroxypropylmethylcellulose, polyvinyl alcohol, carboxymethylcellulose, hydroxyethylcellulose, glycerin and EDTA. Includes. The solution is preferably maintained at a substantially neutral pH and isotonicity using appropriate amounts of conventional buffers such as phosphate, borate, acetate, tris.

In some embodiments, a penetration enhancer is added to the ophthalmic carrier.

The amount of ligand binding molecule that will be effective for its intended therapeutic use can be determined by standard clinical techniques based on this specification. In addition, in vitro to help ascertain the optimal dosage range Analysis can be used optionally. The amount of ligand binding molecule mixed with the carrier material to produce a single dosage can vary depending on the mammal being treated and the particular mode of administration.

Administration of the ligand binding molecule can depend on several factors including the severity of the condition, whether the condition will be treated or prevented, and the age, weight, and health of the person being treated. In addition, genomic pharmacology (effect of genotype on the pharmacokinetic, pharmacodynamic or efficacy profile of a therapeutic agent) information for a particular patient can affect the dosage used. Moreover, the exact individual dosages depend on the particular combination therapy being administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disease being treated (e.g., the particular ocular disorder being treated), the severity of the disorder, and the angiogenic disorder. It can be adjusted to some extent depending on various factors, including anatomical location. Slight variations in the dosage can be expected.

In general, when administered orally to a mammal, the dosage of the ligand-binding molecule of the present invention is generally 0.001 mg/kg/day to 100 mg/kg/day, 0.01 mg/kg/day to 50 mg/kg/day. , Or 0.1 mg/kg/day to 10 mg/kg/day. In general, when administered orally to humans, the administration of the antagonist of the present invention is generally 0.001 mg to 300 mg per day, 1 mg to 200 mg per day, or 5 mg to 50 mg per day. Doses of up to 200 mg per day may be required.

For administration of the antagonists of the present invention by parenteral injection, the dosage is generally 0.1 mg to 250 mg per day, 1 mg to 20 mg per day, or 3 mg to 5 per day. Injections can be given up to 4 times daily.

In general, when administered orally or parenterally, the dosage of the ligand-binding molecule for use in the present invention is generally 0.1 mg to 1500 mg per day, or 0.5 mg to 10 mg per day, or 0.5 mg to 5 mg per day. mg. Doses of up to 3000 mg per day can be administered.

When administered to humans, e.g. intravitreally, ophthalmically, the administration of a ligand binding molecule per eye per dose is generally 0.003 mg, 0.03 mg, 0.03 mg, 0.1 mg or 0.5 mg to 5.0 mg, 4 mg, 3 mg, 2 mg or 1 mg, or 0.5 mg to 1.0 mg. Administration of the ligand binding molecule is generally 0.003 mg to 5.0 mg per eye per administration, or 0.03 mg to 4.0 mg per eye per administration, or 0.1 mg to 4.0 mg per eye per administration, or 0.03 mg to 3.0 mg per eye per administration, or per administration. 0.1 mg to 3.0 mg per eye, or 0.1 mg to 1.0 mg per eye per administration, or 0.5 mg to 4.0 mg per eye per administration, or 0.5 mg to 3.0 mg per eye per administration, 0.5 mg to 2.0 mg per eye per administration, or per eye per administration 1.0 mg to 4.0 mg, or 1.0 mg to 3.0 mg per eye per administration, or 1.0 mg to 2.0 mg per eye per administration. In some embodiments, the ligand binding molecule is administered at a concentration of about 1 mg, or about 2 mg, or about 3 mg, or about 4 mg, or about 5 mg, or about 6 mg per eye per administration. The ligand binding molecule is, in some embodiments, 10 μl, 15 μl, 20 μl, 25 μl, 30 μl, 35 μl, 40 μl, 45 μl, 50 μl, 60 μl, 70 μl, 80 μl, 90 μl, It is present in any of the concentrations listed above in a volume of 95 μl or 100 μl. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4 mg/50 μl. The dosage volume may range from 0.01 mL to 0.2 mL administered per eye, or 0.03 mL to 0.15 mL administered per eye, or 0.05 mL to 0.10 mL administered per eye.

In some embodiments, when administered by intravitreal injection, the ligand binding molecule is about 2 mg to about 4 mg per eye (or about 1 mg to about 3 mg per eye, or about 1 mg to about 4 mg, or about 3 mg per eye). mg to about 4 mg, or about 1 mg to about 2 mg per eye). In some embodiments, the ligand binding molecule is administered at a concentration of about 1 mg, or about 2 mg, or about 3 mg, or about 4 mg, or about 5 mg, or about 6 mg per eye. The ligand binding molecule is, in some embodiments, 10 μl, 15 μl, 20 μl, 25 μl, 30 μl, 35 μl, 40 μl, 45 μl, 50 μl, 60 μl, 70 μl, 80 μl, 90 μl, It is present in any of the concentrations listed above in a volume of 95 μl or 100 μl. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4 mg/50 μl.

In general, a suitable dosage range for intravenous administration is generally about 50-5000 micrograms of active compound per kilogram body weight. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight to 1 mg/kg body weight. Effective dosage is in vitro Or it can be extrapolated from a dose response curve derived from an animal model test system.

For systemic administration, a therapeutically effective dose is first tested in vitro Can be estimated from the analysis. For example, doses can be formulated in an animal model to achieve a circulating concentration range that includes the IC50 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. The initial dosage is in vivo using techniques well known in the art. It can be estimated from data such as animal models. One of ordinary skill in the art can easily optimize administration to humans based on animal data.

Dosage and interval can be adjusted individually to provide plasma levels of the compound sufficient to maintain the therapeutic effect. In the case of topical administration or selective absorption, the effective local concentration of the compound may not be related to plasma concentration. Those of ordinary skill in the art will be able to optimize therapeutically effective topical dosages without undue experimentation.

The amount of compound administered will, of course, depend on the subject being treated, the subject's weight, the severity of the disease, the mode of administration, and the judgment of the prescribing physician. The therapy may be repeated intermittently even if the symptoms are detectable or even not detectable. The therapy may be given alone or in combination with other drugs.

Administration of the ligand binding molecule and the additional agent when present in combination therapy, independently, 1 to 4 times a day or 1 to 4 times per month or 1 to 6 times per year or 2 years, 3 years, 4 It can be once a year or every 5 years. Administration may be for a duration of 1 day or 1 month, 2 months, 3 months, 6 months, 1 year, 2 years, 3 years, and even for the lifetime of the patient. In one embodiment, the administration is performed once a month for 3 months. In many cases, chronic, long-term administration will be recommended. The dosage may be administered as a single dose or divided into multiple doses. In general, although longer administrations of several months or more than several years may be required, the desired dosage may be administered for an extended period of time, typically at least several weeks or months, at defined intervals.

In addition to treating existing disorders, the compositions can be administered prophylactically to prevent or slow the onset of these disorders. In prophylactic application, the composition may be administered to a patient who is sensitive to, or at risk for, a particular disorder, such as an ocular disorder.

Route of administration

Compositions containing the ligand binding molecules described herein can be administered to a patient in a variety of ways, depending in part on the type of agent being administered and the patient's history, risk factors, and symptoms. Routes of administration suitable for the methods of the present invention include both systemic and local administration. As used herein, the term “systemic administration” essentially refers to a mode of administration that results in delivery of a pharmaceutical composition throughout the body of a patient. Exemplary systemic modes of administration include, but are not limited to, intravenous injection and oral administration. As used herein, the term “topical administration” refers to a mode of administration that delivers significantly more pharmaceutical composition to or around the eye than to an area (or tumor or other target tissue) further away from the eye.

Systemic and topical routes of administration useful in the methods of the present invention include, but are not limited to, oral gavage; Intravenous injection; Intraperitoneal injection; Intramuscular injection; Subcutaneous injection; Transdermal diffusion and electrophoresis; Topical eye drops and ointments; Periocular and intraocular injection, including subconjunctival injection; An extended release delivery device comprising a locally inserted extended release device; And intraocular and periocular implants, including biodegradable and reservoir-based implants.

Thus, in one aspect, a method of treating an ocular disorder associated with retinal neovascularization is practiced by topically administering the ligand binding molecule to a subject. For example, in some embodiments, the pharmaceutical composition comprising the ligand binding molecule is administered topically, or by local injection (e.g., intraocularly, such as intravitreal, by injection), or biodegradable or in storage -Emitted from intraocular or peri-ocular implants such as base implants. The composition is preferably VEGF-C and / or VEGF-D in the eye of the subject binds to VEGFR-2 and / or VEGFR-3 expressed in the cells of the eye or blood vessels of the eye or VEGFR-2 and / Or in an amount effective to inhibit stimulating VEGFR-3.

In the case of combination therapy, administration of the ligand binding molecule and the additional agent may occur in consecutive times or simultaneously. When administered sequentially, each administration may be by the same or different routes. In one embodiment, the additional agent (such as VEGF-A or PDGF inhibitor product) is 90 days, 30 days, 10 days, 5 days, 24 hours, 1 hour, 30 minutes, 10 minutes, 5 days of administration of the ligand binding molecule. It is administered within minutes or 1 minute. When the additional agent is administered prior to the ligand binding molecule, the ligand binding molecule is administered in an amount and within a time effective to treat or prevent a targeted indication, such as an ocular disorder, of the total amount of the additional agent and the ligand binding molecule. Is administered. When the ligand binding molecule is administered prior to the additional agent, the additional agent may be administered in an amount and within a time effective to treat or prevent the targeted indication, such as an ocular disorder, in which the total amount of the additional agent and the ligand binding molecule is Is administered.

The pharmaceutical composition according to the present invention may be formulated to release the ligand binding molecule and optionally additional agents in combination therapy substantially immediately upon administration or at any predetermined period after administration, using controlled release formulations. . For example, the pharmaceutical composition may be provided in a sustained release form. The use of an immediate or sustained release composition depends on the nature of the condition being treated. When the condition consists of an acute disorder, treatment using immediate release may be used rather than an extended release composition. For certain prophylactic or long-term treatments, sustained release compositions may also be suitable.

Administration of the ligand-binding molecule or both the ligand-binding molecule and one or more additional agents in a controlled release formulation allows the ligand-binding molecule to (i) cause a narrow therapeutic index (e.g., adverse side effects or toxic reactions), alone or in combination. The difference between the plasma concentration resulting in a therapeutic effect and the plasma concentration resulting in a therapeutic effect is small; in general, the therapeutic index TI is defined as the ratio of the median effective dose (ED 50) to the median lethal dose (LD50)); (ii) narrow absorption window in the gastrointestinal tract; Or (iii) it may be useful if it has a short biological half-life, so frequent dosing over one day is required to maintain plasma levels at therapeutic levels.

Many strategies can be pursued in order to obtain controlled release where the rate of release is greater than the rate of degradation or metabolism of the active ingredient. Controlled release can be obtained by appropriate selection of formulation parameters and ingredients, including, for example, appropriate controlled release compositions and coatings. Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, nanoparticles, patches, and liposomes. Methods of preparing such sustained or controlled release formulations are well known in the art.

The ligand binding molecule and, if present, an additional agent, can also be delivered using a drug-delivery device such as an insert. As used herein, the term “implant” refers to any material that does not significantly migrate from the site of insertion after insertion. The insert may be biodegradable, non-biodegradable, or may be composed of biodegradable and non-biodegradable materials. Non-biodegradable inserts can, if desired, include a fillable reservoir. Inserts useful in the method of the present invention include, for example, patches, particles, sheets, plaques, microcapsules, etc., and can be of any shape and size compatible with the selected insertion site, which is, without limitation, It may be posterior chamber, anterior chamber, suprachoroid or subconjunctival. It is understood that implants useful in the present invention generally release the implanted pharmaceutical composition in an effective dose to the patient's eye for an extended period of time.

Various ocular inserts and extended release formulations suitable for ocular release are widely used in the art, for example, as described in U.S. Patents 5,869,079 and 5,443,505, the disclosures of which are incorporated herein by reference in their entirety. Is known. The ocular drug delivery device may be inserted into the anterior chamber, such as an anterior or posterior chamber, or may be inserted into or over an avascularized area outside the sclera, choroid space, or vitreous body. In one embodiment, in order to allow the transscleral diffusion of the ligand binding molecule and any additional agents to the desired treatment site, e.g., the intraocular space and dark spots of the eye, the insert is over an avascular area, such as over the sclera. Can be located. Moreover, the site of transscleral diffusion may be proximal to the site of neovascularization, such as the proximal area of the black spot. Suitable drug delivery devices are described, for example, in US 2008/0286334; 2008/0145406; 2007/0184089; 2006/0233860; 2005/0244500; 2005/0244471; And 2005/0244462, and US Pat. Nos. 6,808,719 and 5,322,691, the contents of each of which are incorporated herein by reference in their entirety.

In other embodiments, the ligand binding molecules described herein are applied to the eye via liposomes. In another embodiment, the ligand binding molecule is contained within a continuous or selective-release device, such as, but not limited to, a membrane such as used in the Ocusert™ System (Alza Corp., Palo Alto, Calif.). In an additional embodiment, the ligand binding molecule is contained within, carried by, or attached to a contact lens positioned over the eye. In another embodiment, the ligand binding molecule is contained within a swab or sponge that can be applied to the ocular surface. Another embodiment of the present invention includes a ligand binding molecule contained within a liquid spray that can be applied to the ocular surface.

In one embodiment, the insert comprises a ligand binding molecule and, optionally, an additional agent, if present, dispersed in a biodegradable polymer matrix. The matrix may comprise PLGA (polylactic acid-polyglycolic acid copolymer), ester-terminated capped polymer, acid end-capped polymer, or mixtures thereof. In another embodiment, the insert comprises a ligand binding molecule and optionally, if present, additional agents, surfactants and lipophilic compounds. The lipophilic compound may be present in an amount of about 80-99% by weight of the insert. Suitable lipophilic compounds include, but are not limited to, glyceryl palmitostearate, diethylene glycol monostearate, propylene glycol monostearate, glyceryl monostearate, glyceryl monolinoleate, glyceryl monooleate, glyceryl Ryl Monopalmitate, Glyceryl Monolaurate, Glyceryl Dilaurate, Glyceryl Monomyristate, Glyceryl Dimyristate, Glyceryl Monopalmitate, Glyceryl Dipalmitate, Glyceryl Monostearate, Glyceryl Dis Thearate, glyceryl monooleate, glyceryl dioleate, glyceryl monolinoleate, glyceryl dilinoleate, glyceryl monoarachidate, glyceryl diarachidate, glyceryl monobehenate, glyceryl dibehe Nate, and mixtures thereof. In another embodiment, the insert comprises a ligand binding molecule, and optionally, an additional agent, if present, within a hollow sleeve. The ligand binding molecule and optionally, if present, an additional agent is delivered to the eye by inserting the sleeve into the eye, releasing the insert from the sleeve into the eye, and then removing the sleeve from the eye. . Examples of such delivery devices are described in US Publication No. 2005/0244462, which is incorporated herein by reference in its entirety.

In one embodiment, the insert is a flexible ocular insertion device adapted for controlled sustained release of the ligand binding molecule and optionally, additional agents, if present, into the eye. In one embodiment, the device comprises an elongated body of a polymeric material in the form of a rod or tube containing a ligand binding molecule and, optionally, an additional agent, if present, extending radially out of the body. It has at least two fixing protrusions. The device may have a length of at least 8 mm and the diameter of its body portion including the protrusion does not exceed 1.9 mm. The sustained-release mechanism may be, for example, by diffusion or by osmotic or bioerosion. The insertion device can be inserted into the upper or lower circumference of the eye so as to be independent of the movement of the eye by formix anatomy. The protrusion may be of various shapes, such as ribs, screws, threads, concave portions, protrusions, truncated cone-shaped portions or wound string portions, for example. In a further embodiment, the polymeric material for the body is selected to expand in a liquid environment. Thus, a smaller initial size device can be used. The insertion device may be sized and arranged such that when inserted into the upper or lower circumference, the device remains well in place for an extended period of use and remains out of view so as not to be detected by the recipient. The device may be held on the upper or lower column for 7 to 14 days or longer. Examples of such devices are described in US Pat. No. 5,322,691, which is incorporated herein by reference in its entirety.

In another aspect, a method of inhibiting neovascularization in a subject diagnosed with a tumor is implemented by topically administering the ligand binding molecule to the subject. For example, in some embodiments, a pharmaceutical composition comprising the ligand binding molecule is administered topically to the tumor or to an organ or tissue from which the tumor has been surgically removed. In such embodiments, the composition is preferably administered in an amount effective to inhibit neovascularization in the tumor.

When the ligand-binding molecule is a nucleic acid molecule, administration of a pharmaceutical composition containing the nucleic acid molecule may be performed using one of many methods well known in the field of gene therapy. Such methods include, but are not limited to, lentiviral transformation, adenovirus transformation, cytomegalovirus transformation, microinjection and electroporation.

Kit And unit capacity

The invention also relates to kits and instructions for use comprising one or more pharmaceutical compositions. Ligand binding molecules may be packaged or formulated with another ligand binding molecule or other therapeutic agent described herein, eg, in a kit or package or unit dose, to enable co-administration; These two components can be formulated together (ie mixed) or in separate compositions (ie not mixed) and in separate dosages. Each of the compositions of the kit may be contained in one container. In some embodiments, the two components of the kit/unit dose are packaged with instructions for administering the two compounds to a human subject for the treatment of one of the disorders and diseases described herein.

The kit may include a container. The container can be used to separate the ingredients, and contains, for example, divided bottles or divided foil packets. The separate compositions may also, if desired, be contained within a single, non-divided container. The kit contains instructions for the administration of the components. The kit is particularly advantageous when the separate components are administered in different dosage forms, when administered at different dosage levels, or when a titration of each antagonist is desired.

All publications and patents mentioned herein are incorporated herein by reference in their entirety as if each individual publication or patent was expressly and individually indicated to be incorporated herein by reference. In case of conflict, the present application, including any definitions herein, will control this.

Example

Example One - VEGFR Protein ECD snippet.

Experiments were conducted to identify fragments and variants and fusions of VEGFR-3 and/or VEGFR-2 and/or VEGFR-1 that are effective in binding to target ligands such as VEGF-C and/or VEGF-D and/or VEGF-A. Performed. International Patent Publication Nos. WO 2005/087808, WO 2005/000895, WO 2006/088650, WO 2006/099154, WO 2004/106378, WO 2005/123104 and US Patent No. 7,855,178 Reference, all of which are incorporated herein by reference in their entirety. These studies demonstrate that the ECD of these receptors can be cleaved and that domains from different receptors can also be recombined to form ligand binding molecules.

Example 2 - VGX -301- ΔN2 Generation of ligand binding molecules

Ligand binding molecules comprising the Ig-like domain I-III of VEGFR-3 (referred to herein as “VGX-300”) are described in Makinen et al., Nat. Med., 7:199-205, 2001].

A key feature of the VGX-300 molecule is that it contains 12 glycosylation sites (2 x 6 potential N-linked glycosylation sites, on each receptor fragment (VEGFR-3 Ig-like domains I, II, and III). 5 on and 1 on each Fc region gamma chain). There is no evidence for O-linked glycosylation.

Glycosylation characteristics can affect PK, but Fc glycans have little effect on PK (Jones et al, Glycobiology, 17(5), 2007 pp. 529-540). In summary, the asialoglycoprotein receptor binds to a complex-type N-linked glycan structure in the absence of two or more sialic acids, and the underlying galactose (Gal) residue becomes a terminal polysaccharide. In addition, the mannose (Man) receptor recognizes high-mannose N-linked glycans and terminal N-acetylglucosamine (tGlcNAc) residues. Both of these receptors can trigger rapid metabolic clearance of proteins.

In order to confirm that the glycosylation site is important for product activity, successive deletions of each of the five putative N-linked sites were performed. A single mutation was introduced into the VGX-300 coding region using five primer pairs to break the consensus attachment for each of the five N-linked glycans (N-Q).

The primer pairs used are as follows:

N1 sense: 5'GACCCCCCCGACCTTGCAGATCACGGAGGAGTCACAC 3'(SEQ ID NO: 12)

N1 anti-sense: 5'GTGTGACTCCTCCGTGATCTGCAAGGTCGGGGGGGTC 3'(SEQ ID NO: 13)

N2 sense: 5'CTGCACGAGGTACATGCCCAGGACACAGGCAGCTACGTC 3'(SEQ ID NO: 14)

N2 anti-sense: 5'GACGTAGCTGCCTGTGTCCTGGGCATGTACCTCGTGCAG 3'(SEQ ID NO: 15)

N3 sense: 5'GTCCATCCCCGGCCTCCAAGTCACGCTGCGCTCGC 3'(SEQ ID NO: 16)

N3 anti-sense: 5'GCGAGCGCAGCGTGACTTGGAGGCCGGGGATGGAC 3'(SEQ ID NO: 17)

N4 sense: 5'GGGAGAAGCTGGTCCTCCAGTGCACCGTGTGGGCTGA 3'(SEQ ID NO: 18)

N4 anti-sense: 5'TCAGCCCACACGGTGCACTGGAGGACCAGCTTCTCCC 3'(SEQ ID NO: 19)

N5 sense: 5'AGCATCCTGACCATCCACCAGGTCAGCCAGCACGACCT 3'(SEQ ID NO: 20)

N5 anti-sense: 5'AGGTCGTGCTGGCTGACCTGGTGGATGGTCAGGATGCT 3'(SEQ ID NO: 21)

The plasmid vector was transiently transfected into 293T cells (HEK), and then the presence of the mutation was confirmed by sequencing. Culture samples were analyzed by Western blot. The viable construct was then run into transient suspension-adapted 293F cells (HEK), the supernatant was purified by ProSepA chromatography and gel filtration, and enzyme-linked immunosorbent assay (ELISA) and BaF/3 bio Further testing by assay was performed to determine yield and activity. Table 3 below summarizes the expression data and activity of each obtained mutation.

Table 3

Table 3 shows that only the N2 mutation (referred to herein as “VGX-301-ΔN2”) showed superior expression and activity characteristics compared to the parent molecule (ie, VGX-300). VGX-301-ΔN2 and VGX-300 hairs were produced in CHO and HEK cells by transient expression, and the pharmacokinetics (PK) of each molecule were investigated as follows. Sprague-Daulay rats were assigned to groups of 2, 3 or 5 per compound in each experiment. Rats in each group received a single dose of VGX-300 or VGX-301-ΔN2 via intravenous administration as a bolus injection at a dose concentration of 1 mg/kg. Intermediate blood samples were collected by lateral tail vein puncture on day -1 (before dosing) and at a total of 12 time points after dosing, ranging from 5 minutes to 14 days after initial treatment. Serum samples were prepared from each blood sample and tested using a quantitative VEGF-C ligand-capture ELISA to determine the circulating concentration of each compound. The results of these analyzes were then used to calculate pharmacokinetic parameters. PK data of VGX-300 and VGX-301-ΔN2 are provided in Table 4 below.

Table 4.

The PK curve provided in Figure 1 and the data from Table 4 show that VGX-301-ΔN2 can have a beneficial effect on PK compared to VGX-300 produced in the same expression system.

Example 3- VGX -301- ΔN2 is VEGF -C and VEGF -D to Combine

To determine the specificity of VGX-300 and VGX-301-ΔN2 binding to VEGF-C and VEGF-D, VEGF-C or VEGF-D (2 μg/mL) was pre-coated on an ELISA plate and captured antigen Was used as. Increasing concentrations of VGX-300 or VGX-301-ΔN2 (0-10 μg/mL) were applied to the plate and detected with rabbit anti-human IgG-horseradish peroxidase conjugate using a tetramethylbenzidine substrate kit. I did. The results showed that both VGX-300 and VGX-301-ΔN2 bound to both VEGF-C and VEGF-D. See FIG. 2. Surprisingly, VGX-301-ΔN2 demonstrated stronger binding to both ligands than VGX-300.

Example 4 - VGX -300 and VGX -301- ΔN2 Binding affinity

The binding of VEGF-C and VEGF-D to VGX-300 or VGX-301-ΔN2 was analyzed by surface plasmon resonance (SPR) performed using a ProteOn XPR36 biosensor (Bio-Rad). VGX-300 or VGX-301-ΔN2 was captured onto protein G'immobilized on a GLM sensor chip and the affinity of the molecule for VEGF-C or VEGF-D was measured. The results of the affinity experiment are provided in Table 5.

Table 5.

The data provided in Table 5 above show that the VGX-300 and VGX-301-ΔN2 samples bound to human VEGF-C and VEGF-D with approximately the same affinity, and the two molecules showed stronger binding to VEGF-C than to VEGF-D. Show that

Example 5- VGX -301- ΔN2 is VEGF -C and VEGF -D combine and VEGFR Cross-linking of -3 Shut off

A cell-based assay was developed to evaluate the ability of the VEGF family ligands to bind and crosslink VEGFR-2 and VEGFR-3. This bioassay has been used to study the neutralizing activity of VGX-300 and VGX-301-ΔN2. The bioassay cell line was stably transfected with a chimeric receptor consisting of ECD of VEGFR-2 or VEGFR-3 fused in-frame to the transmembrane and intracellular domain of the mouse erythropoietin receptor, mouse IL- Consists of a three dependent Pro-B cell line Ba/F3 (as described in Example 5 of WO 2005/087808, the disclosure of which is incorporated herein by reference in its entirety). In the absence of IL-3, these cells survive and proliferate only in the presence of growth factors capable of binding and cross-linking the ECD of each VEGFR.

Briefly, Ba/F3 cells (10,000 cells/well; 96 well plate) transfected with VEGFR-2 or VEGFR-3 were treated with increasing concentrations of VGX-300 of VGX-301-ΔN2 at 37° C. for 48 hours (0- 100 μg/mL) in the presence of VEGF-C or VEGF-D supplemented medium. Cell proliferation was measured using the WST 1 reagent; Cells were incubated with WST-1 at 37° C. for 4 hours, and absorbance was measured at 450 nm (n=3; error bar = standard error of the mean, SEM).

The results showed that VGX-300 neutralized the activity of VEGF-C and VEGF-D, as evidenced by the dose-responsive inhibition of VEGF-C and VEGF-D in the VEGFR-2 and VEGFR-3 Ba/F3 bioassay. Showed. VGX-300 showed improved efficacy in neutralizing VEGF-C compared to VEGF-D in both VEGFR-2 and -3 assays. See Figures 3 and 4.

Analysis of VGX-301-ΔN2 demonstrated that this molecule was also able to block the binding of VEGF-C and VEGF-D to VEGFR-3. The neutralizing activity of VGX-301-N2 was slightly stronger than that of VGX-300. See FIG. 4. Table 6 shows the binding (IC50) of VGX-300 and VGX-301-ΔN2 to VEGF-C and VEGF-D in the VEGFR-3 Ba/F3 bioassay.

Table 6

Example 6- Intravitreal After administration VGX -300 and VGX - 301ΔN2 Eye distribution and Pharmacokinetics

This study was conducted to investigate the ocular distribution and pharmacokinetics of VGX-300, VGX-301-ΔN2 and aflibercept (EYLEA) after a single intravitreal dose in colored rabbits.

The study design consisted of 3 groups, with 8 female rabbits assigned per group. Animals are administered radiolabeled VGX-300, VGX-301-ΔN2 or 500 μg of aflibercept via 50 μL bolus intravitreal injection into both eyes.

One animal per group was euthanized at 1, 12, 24, 72, 168, 366, 504 and 672 hours after dose administration. Blood processed into serum, and selected ocular tissues were collected at each time point and the concentration of radioactivity was determined by radioactivity analysis. The collected ocular tissues are aqueous humor, choroid, cornea, iris-shaped body (ICB), lens, optic nerve, retina, retinal pigment epithelium (RPE), sclera, trabecular meshwork, and vitreous humor. ). 5 shows the average concentration of radioactivity in various tissues and serum over the observed time.

Test products, [ ¹²⁵ I] VGX-300, [ ¹²⁵ I] aflibercept (EYLEA) and [ ¹²⁵ I] VGX-301-ΔN2 were well tolerated, stable in glass fluid, and ocular tissue in both posterior and anterior parts Had prolonged exposure to Although there was a difference in serum exposure of [ ¹²⁵ I]VGX-300 and [ ¹²⁵ I]VGX-301-ΔN2 after intravitreal administration, both [ ¹²⁵ I]VGX-300 and [ ¹²⁵ I]VGX-301-ΔN2 Had only a small systemic exposure compared to that of aflibercept (EYLEA), possibly as a result of absorption into the choroid and also clearance by amniotic fluid outflow. The PK and biodistribution of [ ¹²⁵ I]VGX-300 and [ ¹²⁵ I] VGX-301-ΔN2 observed in this study were similar to those of the two compounds, and were comparable to [ ¹²⁵ I] aflibercept (EYLEA).

Example 7-Retinopathy model of prematurity

The following example is an exemplary assay evaluating the ability of VGX-300 and VGX-301-ΔN2 to inhibit the onset of retinal neovascularization using the ROP model. In this model, mice are exposed to excess oxygen (75% oxygen) for 5 days (up to P12) 7 days after birth (P7). After oxygen overexposure, P12 mice were returned to normal oxygen and the human isotype control antibody, VGX-300, VGX-301-ΔN2, Eylea (VEGF-Trap), VGX-300 + Eylea or VGX-301-ΔN2 + Eylea. Intravitreal injection is administered. Then, after raising all mice for 5 days under normal oxygen conditions, they were sacrificed to P17, and the eyes were removed and fixed in 10% formalin/PBS. Blood vessels in each group will be quantified using H&E and/or IHC staining methods.

Example 8-Argon laser-induced choroidal neovascularization (CNV)

In this model of age-related macular degeneration (AMD), CNV is induced by argon laser-induced rupture of Bruch's membrane in mice on day 0 (3 burns per mouse). A group of 10 mice was studied and weekly intravitreal injection of human isotype control antibodies, VGX-301-ΔN2, VGX-300, Eylea (VEGF-Trap), VGX-301-ΔN2 + Eylea or VGX-300 + Eylea. The treatment is administered through (Days 0 and 7). On day 14, animals are sacrificed and choroid flat mounts are prepared and stained with ICAM-2 to visualize neovascularization by fluorescence microscopy.

As a single-agent, it is considered that VGX-301-ΔN2 will significantly inhibit choroidal neovascularization in a mouse model of angiogenic AMD, which is comparable to the effect demonstrated by Eylea®.

Example 9- VEGF -C Mediated Inhibitory effect of ligand binding molecules on tumor growth and metastasis

To demonstrate the ability of the ligand binding molecules described herein to inhibit tumor growth and/or metastasis, any accepted tumor model can be used. Exemplary models include animals prone to develop various types of cancer, the same or different species, optionally comprising cells transformed to recombinantly overexpress one or more growth factors such as VEGF-C, or VEGF-D. Tumors or tumor cells or animals injected with tumor cell lines. To provide an in vivo tumor model in which multiple growth factors are detectable, tumor cell lines can be transformed with exogenous DNA that causes the expression of multiple growth factors.

The ligand binding molecules described herein can be administered directly, for example , by intravenous infusion or in the form of a protein by an inserted micropump, or in the form of a nucleic acid as part of a gene therapy. Subjects are preferably classified by sex, weight, age, and medical history to help minimize variations between subjects.

Efficacy is measured by tumor, size (volume) and weight loss. It is also possible to characterize the effect on tumor size, spread (metastasis) and number of tumors. For example, the effect on angiogenesis versus lymphangiogenesis, a VEGF-A binding construct that is expected to have a greater effect on angiogenesis, and a VEGF-C binding construct that is expected to have a greater effect on lymphangiogenesis. The use of specific cellular markers can be used to indicate. Animals as a whole can observe changes in survival time and body weight. Tumors and specimens were examined for evidence of angiogenesis, lymphangiogenesis, and/or necrosis.

SCID mice can be used as subjects for the ability of the ligand binding molecules described herein to inhibit or prevent tumor growth. The ligand binding molecule used in the therapy is generally selected such that the molecule binds to a growth factor ligand expressed on the tumor cell, in particular a growth factor that is overexpressed by the tumor cell versus non-neoplastic cells in the subject. In the SCID model, tumor cells, such as MCF-7 cells, are transfected with a virus encoding a specific growth factor under the control of a promoter or other expression control sequence that provides overexpression of the growth factor as described in WO 02/060950. Can be. Alternatively, other cell lines such as HT-1080 as described in US Pat. No. 6,375,929 can be used. The tumor cells may be transfected with as many growth factor ligands as intended to be overexpressed, or a tumor cell line that already overexpresses one or more growth factor ligands of interest may be selected. One group of subjects is inserted into cells with vectors that are co-transfected, ie lacking a growth factor ligand insert.

Prior to, concurrently, or after tumor insertion of the aforementioned cells, the subject is treated with a specific ligand binding molecule. There are many different ways of administering the ligand binding molecule. In vivo and/or ex vivo gene therapy can be used. For example, a cell may be transfected with an adenovirus encoding the ligand-binding molecule, or another vector and inserted into a tumor cell expressing the growth factor(s), and the cell transfected with the ligand-binding molecule may grow It may be the same as those transformed with the factor(s) (or those that already overexpress the growth factor(s)). In some embodiments, an adenovirus encoding the ligand binding molecule is injected in vivo , such as intravenously. In some embodiments, the ligand binding molecule itself ( eg , in the form of a protein) is administered systemically or topically, eg, using a micropump. When testing the efficacy of a particular binding construct, at least one control is generally used. For example, for vector-based therapy, a blank insert or a vector with LacZ is used, or the insert is a ligand comprising a complete ECD of VEGFR-3 capable of binding to binding VEGF-C or VEGF-D. It can be a binding molecule, and such a control can use more than one ECD construct if necessary ( eg , to bind multiple ligands when a binding construct with multiple ligand binding affinity is used).

A. Example process

Preparation of plasmid expression vector, transfection of cells, and testing thereof

The cDNA encoding VEGF-C or VEGF-D or a combination thereof is introduced into the pEBS7 plasmid (Peterson and Legerski, Gene , 107: 279-84, 1991.). These same vectors can be used for expression of the ligand binding molecule.

The MCF-7S1 subclone of the human MCF-7 breast carcinoma cell line is transfected with plasmid DNA by electroporation, a stable cell pool is selected and cultured as previously described (Egeblad and Jaattela, Int . J. Cancer , 86: 617-25, 2000). The cells are metabolically labeled in methionine and cysteine free MEM (Gibco) supplemented with 100 μCi/ml [35S]-methionine and [35S]-cysteine (Redivue Pro-Mix, Amersham Pharmacia Biotech). The labeled growth factor is immunoprecipitated from the conditioned medium using an antibody against the expressed growth factor(s). The immunocomplex and binding complex were precipitated using Protein A Sepharose (Amersham Pharmacia Biotech), washed twice in 0.5% BSA, 0.02% Tween 20 in PBS and once in PBS, and washed on SDS-PAGE under reducing conditions. Is analyzed.

Subject manufacturing and treatment

Cells (20,000/well) are plated in 4 replicates in 24-wells, trypsinized on 2 replicate plates after 1, 4, 6, or 8 days and counted using a hemocytometer. Fresh medium is provided after 4 and 6 days. For tumorigenic analysis, sub-confluent cultures were collected by trypsinization, washed twice, and 10 ⁷ cells in PBS were washed with 0.72 mg 17β-estradiol (Innovative Research of America). Inoculated into the fat pad of the second (axillar) mammary gland of ovariectomized SCID mice with subcutaneous 60-day sustained release tablets containing. Ovariectomy and insertion of pellets are performed 4-8 days before tumor cell inoculation.

The cDNA encoding the binding construct(s) is subcloned into the pAdBglII plasmid and adenoviruses are produced as previously described (Laitinen et al . , Hum. Gene Ther . , 9: 1481-6, 1998). The ligand binding molecule(s) or LacZ control (Laitinen et al . , Hum. Gene Ther . , 9: 1481-6, 1998) adenovirus, 10 ⁹ pfu/mouse is injected intravenously into SCID mice 3 hours before tumor cell inoculation. .

Analysis of treatment efficacy

Tumor length and width are measured twice weekly in a blinded manner, and assuming that the tumor is semi-elliptic and equal to the depth and width, the tumor volume is calculated as length x width x depth x 0.5 (Benz et al., Breast Cancer Res. Treat . , 24: 85-95, 1993).

The tumor is excised, fixed in 4% formaldehyde (pH 7.0) for 24 hours and embedded in paraffin. Fragments (7 μm), for example, PECAM-1 (Pharmingen), VEGFR-1, VEGFR-2, VEGFR-3 (Kubo et al., Blood , 96: 546-553, 2000) or PCNA (Zymed Laboratories), PDGFR -α, a monoclonal antibody against PDGFR-β or LYVE-1 (Banerji et al., J Cell Biol, 144: 789-801, 1999), VEGF-C (Joukov et al., EMBO J. , 16: 3898-911, 1997 ), laminin according to published protocols (Partanen et al., Cancer , 86: 2406-12, 1999), or immunostaining with polyclonal antibodies against any growth factor. The average of the number of PECAM-1 positive vessels is determined from the three regions (60x magnification) of the largest vascular hot spots in the section. All histological analyzes are performed using blinded tumor samples.

Three weeks after injection of adenovirus constructs and/or protein therapy, 4 mice from each group are anesthetized, abdominal skin is opened, and several microliters of 3% Evan Blue dye in PBS are injected into the tumor. Drainage of dye from the tumor is followed macroscopically.

Imaging or monitoring of blood and blood proteins may also be performed to provide indications of the subject's health and degree of tumor vasculature.

Example 10- Effect on tumor progression in subjects using combination therapy of ligand binding molecule and chemotherapeutic agent

This study is conducted to test the efficacy of using the ligand binding molecules described herein in combination with other anti-cancer therapies. Such therapy includes chemotherapy, radiation therapy, anti-sense therapy, RNA interference, and monoclonal antibodies against cancer targets. The combination effect may be additive, but is preferably synergistic in its anti-cancer effect, such as prevention, inhibition, regression, and elimination of cancer, prolongation of ??, and/or reduction of side effects.

Subjects are divided into one group receiving chemotherapeutic agents, one group receiving ligand binding molecules, and one group receiving both chemotherapeutic agents and ligand binding molecules at regular, repeating intervals, such as daily, weekly or monthly. In human studies, the subjects are generally classified by sex, weight, age, and medical history to help minimize variations between subjects. Ideally, the subject was diagnosed with the same type of cancer. In human or non-human subjects, progression can be tracked by measuring tumor size, metastasis, weight gain/decrease, vascularization in the tumor, and white blood cell count.

Tumor biopsies are taken at regular intervals before and after treatment initiation. For example, a biopsy is taken just before, 1 week, after, or whenever possible, eg, when the tumor is dissected. Biopsies are examined for cell markers and overall cell and tissue morphology to assess the effectiveness of treatment. Additionally, or alternatively, imaging techniques can be used.

For non-human animal studies, an additional placebo control can be used. Animal studies conducted according to NIH guidelines also provide the advantage of insertion of a relatively uniform population of cancer cells, and of tumors selectively overproducing one or more growth factors targeted by ligand binding molecules.

<110> Vegenics Pty Limited Commonwealth Scientific and Industrial Research Organization <120> LIGAND BINDING MOLECULES AND USES THEREOF <130> 28967/47459A <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 4195 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (20)..(3913) <400> 1 ccacgcgcag cggccggag atg cag cgg ggc gcc gcg ctg tgc ctg cga ctg 52 Met Gln Arg Gly Ala Ala Leu Cys Leu Arg Leu 1 5 10 tgg ctc tgc ctg gga ctc ctg gac ggc ctg gtg agt ggc tac tcc atg 100 Trp Leu Cys Leu Gly Leu Leu Asp Gly Leu Val Ser Gly Tyr Ser Met 15 20 25 acc ccc ccg acc ttg aac atc acg gag gag tca cac gtc atc gac acc 148 Thr Pro Pro Thr Leu Asn Ile Thr Glu Glu Ser His Val Ile Asp Thr 30 35 40 ggt gac agc ctg tcc atc tcc tgc agg gga cag cac ccc ctc gag tgg 196 Gly Asp Ser Leu Ser Ile Ser Cys Arg Gly Gln His Pro Leu Glu Trp 45 50 55 gct tgg cca gga gct cag gag gcg cca gcc acc gga gac aag gac agc 244 Ala Trp Pro Gly Ala Gln Glu Ala Pro Ala Thr Gly Asp Lys Asp Ser 60 65 70 75 gag gac acg ggg gtg gtg cga gac tgc gag ggc aca gac gcc agg ccc 292 Glu Asp Thr Gly Val Val Arg Asp Cys Glu Gly Thr Asp Ala Arg Pro 80 85 90 tac tgc aag gtg ttg ctg ctg cac gag gta cat gcc aac gac aca ggc 340 Tyr Cys Lys Val Leu Leu Leu His Glu Val His Ala Asn Asp Thr Gly 95 100 105 agc tac gtc tgc tac tac aag tac atc aag gca cgc atc gag ggc acc 388 Ser Tyr Val Cys Tyr Tyr Lys Tyr Ile Lys Ala Arg Ile Glu Gly Thr 110 115 120 acg gcc gcc agc tcc tac gtg ttc gtg aga gac ttt gag cag cca ttc 436 Thr Ala Ala Ser Ser Tyr Val Phe Val Arg Asp Phe Glu Gln Pro Phe 125 130 135 atc aac aag cct gac acg ctc ttg gtc aac agg aag gac gcc atg tgg 484 Ile Asn Lys Pro Asp Thr Leu Leu Val Asn Arg Lys Asp Ala Met Trp 140 145 150 155 gtg ccc tgt ctg gtg tcc atc ccc ggc ctc aat gtc acg ctg cgc tcg 532 Val Pro Cys Leu Val Ser Ile Pro Gly Leu Asn Val Thr Leu Arg Ser 160 165 170 caa agc tcg gtg ctg tgg cca gac ggg cag gag gtg gtg tgg gat gac 580 Gln Ser Ser Val Leu Trp Pro Asp Gly Gln Glu Val Val Trp Asp Asp 175 180 185 cgg cgg ggc atg ctc gtg tcc acg cca ctg ctg cac gat gcc ctg tac 628 Arg Arg Gly Met Leu Val Ser Thr Pro Leu Leu His Asp Ala Leu Tyr 190 195 200 ctg cag tgc gag acc acc tgg gga gac cag gac ttc ctt tcc aac ccc 676 Leu Gln Cys Glu Thr Thr Trp Gly Asp Gln Asp Phe Leu Ser Asn Pro 205 210 215 ttc ctg gtg cac atc aca ggc aac gag ctc tat gac atc cag ctg ttg 724 Phe Leu Val His Ile Thr Gly Asn Glu Leu Tyr Asp Ile Gln Leu Leu 220 225 230 235 ccc agg aag tcg ctg gag ctg ctg gta ggg gag aag ctg gtc ctg aac 772 Pro Arg Lys Ser Leu Glu Leu Leu Val Gly Glu Lys Leu Val Leu Asn 240 245 250 tgc acc gtg tgg gct gag ttt aac tca ggt gtc acc ttt gac tgg gac 820 Cys Thr Val Trp Ala Glu Phe Asn Ser Gly Val Thr Phe Asp Trp Asp 255 260 265 tac cca ggg aag cag gca gag cgg ggt aag tgg gtg ccc gag cga cgc 868 Tyr Pro Gly Lys Gln Ala Glu Arg Gly Lys Trp Val Pro Glu Arg Arg 270 275 280 tcc cag cag acc cac aca gaa ctc tcc agc atc ctg acc atc cac aac 916 Ser Gln Gln Thr His Thr Glu Leu Ser Ser Ile Leu Thr Ile His Asn 285 290 295 gtc agc cag cac gac ctg ggc tcg tat gtg tgc aag gcc aac aac ggc 964 Val Ser Gln His Asp Leu Gly Ser Tyr Val Cys Lys Ala Asn Asn Gly 300 305 310 315 atc cag cga ttt cgg gag agc acc gag gtc att gtg cat gaa aat ccc 1012 Ile Gln Arg Phe Arg Glu Ser Thr Glu Val Ile Val His Glu Asn Pro 320 325 330 ttc atc agc gtc gag tgg ctc aaa gga ccc atc ctg gag gcc acg gca 1060 Phe Ile Ser Val Glu Trp Leu Lys Gly Pro Ile Leu Glu Ala Thr Ala 335 340 345 gga gac gag ctg gtg aag ctg ccc gtg aag ctg gca gcg tac ccc ccg 1108 Gly Asp Glu Leu Val Lys Leu Pro Val Lys Leu Ala Ala Tyr Pro Pro 350 355 360 ccc gag ttc cag tgg tac aag gat gga aag gca ctg tcc ggg cgc cac 1156 Pro Glu Phe Gln Trp Tyr Lys Asp Gly Lys Ala Leu Ser Gly Arg His 365 370 375 agt cca cat gcc ctg gtg ctc aag gag gtg aca gag gcc agc aca ggc 1204 Ser Pro His Ala Leu Val Leu Lys Glu Val Thr Glu Ala Ser Thr Gly 380 385 390 395 acc tac acc ctc gcc ctg tgg aac tcc gct gct ggc ctg agg cgc aac 1252 Thr Tyr Thr Leu Ala Leu Trp Asn Ser Ala Ala Gly Leu Arg Arg Asn 400 405 410 atc agc ctg gag ctg gtg gtg aat gtg ccc ccc cag ata cat gag aag 1300 Ile Ser Leu Glu Leu Val Val Asn Val Pro Pro Gln Ile His Glu Lys 415 420 425 gag gcc tcc tcc ccc agc atc tac tcg cgt cac agc cgc cag gcc ctc 1348 Glu Ala Ser Ser Pro Ser Ile Tyr Ser Arg His Ser Arg Gln Ala Leu 430 435 440 acc tgc acg gcc tac ggg gtg ccc ctg cct ctc agc atc cag tgg cac 1396 Thr Cys Thr Ala Tyr Gly Val Pro Leu Pro Leu Ser Ile Gln Trp His 445 450 455 tgg cgg ccc tgg aca ccc tgc aag atg ttt gcc cag cgt agt ctc cgg 1444 Trp Arg Pro Trp Thr Pro Cys Lys Met Phe Ala Gln Arg Ser Leu Arg 460 465 470 475 cgg cgg cag cag caa gac ctc atg cca cag tgc cgt gac tgg agg gcg 1492 Arg Arg Gln Gln Gln Asp Leu Met Pro Gln Cys Arg Asp Trp Arg Ala 480 485 490 gtg acc acg cag gat gcc gtg aac ccc atc gag agc ctg gac acc tgg 1540 Val Thr Thr Gln Asp Ala Val Asn Pro Ile Glu Ser Leu Asp Thr Trp 495 500 505 acc gag ttt gtg gag gga aag aat aag act gtg agc aag ctg gtg atc 1588 Thr Glu Phe Val Glu Gly Lys Asn Lys Thr Val Ser Lys Leu Val Ile 510 515 520 cag aat gcc aac gtg tct gcc atg tac aag tgt gtg gtc tcc aac aag 1636 Gln Asn Ala Asn Val Ser Ala Met Tyr Lys Cys Val Val Ser Asn Lys 525 530 535 gtg ggc cag gat gag cgg ctc atc tac ttc tat gtg acc acc atc ccc 1684 Val Gly Gln Asp Glu Arg Leu Ile Tyr Phe Tyr Val Thr Thr Ile Pro 540 545 550 555 gac ggc ttc acc atc gaa tcc aag cca tcc gag gag cta cta gag ggc 1732 Asp Gly Phe Thr Ile Glu Ser Lys Pro Ser Glu Glu Leu Leu Glu Gly 560 565 570 cag ccg gtg ctc ctg agc tgc caa gcc gac agc tac aag tac gag cat 1780 Gln Pro Val Leu Leu Ser Cys Gln Ala Asp Ser Tyr Lys Tyr Glu His 575 580 585 ctg cgc tgg tac cgc ctc aac ctg tcc acg ctg cac gat gcg cac ggg 1828 Leu Arg Trp Tyr Arg Leu Asn Leu Ser Thr Leu His Asp Ala His Gly 590 595 600 aac ccg ctt ctg ctc gac tgc aag aac gtg cat ctg ttc gcc acc cct 1876 Asn Pro Leu Leu Leu Asp Cys Lys Asn Val His Leu Phe Ala Thr Pro 605 610 615 ctg gcc gcc agc ctg gag gag gtg gca cct ggg gcg cgc cac gcc acg 1924 Leu Ala Ala Ser Leu Glu Glu Val Ala Pro Gly Ala Arg His Ala Thr 620 625 630 635 ctc agc ctg agt atc ccc cgc gtc gcg ccc gag cac gag ggc cac tat 1972 Leu Ser Leu Ser Ile Pro Arg Val Ala Pro Glu His Glu Gly His Tyr 640 645 650 gtg tgc gaa gtg caa gac cgg cgc agc cat gac aag cac tgc cac aag 2020 Val Cys Glu Val Gln Asp Arg Arg Ser His Asp Lys His Cys His Lys 655 660 665 aag tac ctg tcg gtg cag gcc ctg gaa gcc cct cgg ctc acg cag aac 2068 Lys Tyr Leu Ser Val Gln Ala Leu Glu Ala Pro Arg Leu Thr Gln Asn 670 675 680 ttg acc gac ctc ctg gtg aac gtg agc gac tcg ctg gag atg cag tgc 2116 Leu Thr Asp Leu Leu Val Asn Val Ser Asp Ser Leu Glu Met Gln Cys 685 690 695 ttg gtg gcc gga gcg cac gcg ccc agc atc gtg tgg tac aaa gac gag 2164 Leu Val Ala Gly Ala His Ala Pro Ser Ile Val Trp Tyr Lys Asp Glu 700 705 710 715 agg ctg ctg gag gaa aag tct gga gtc gac ttg gcg gac tcc aac cag 2212 Arg Leu Leu Glu Glu Lys Ser Gly Val Asp Leu Ala Asp Ser Asn Gln 720 725 730 aag ctg agc atc cag cgc gtg cgc gag gag gat gcg gga cgc tat ctg 2260 Lys Leu Ser Ile Gln Arg Val Arg Glu Glu Asp Ala Gly Arg Tyr Leu 735 740 745 tgc agc gtg tgc aac gcc aag ggc tgc gtc aac tcc tcc gcc agc gtg 2308 Cys Ser Val Cys Asn Ala Lys Gly Cys Val Asn Ser Ser Ala Ser Val 750 755 760 gcc gtg gaa ggc tcc gag gat aag ggc agc atg gag atc gtg atc ctt 2356 Ala Val Glu Gly Ser Glu Asp Lys Gly Ser Met Glu Ile Val Ile Leu 765 770 775 gtc ggt acc ggc gtc atc gct gtc ttc ttc tgg gtc ctc ctc ctc ctc 2404 Val Gly Thr Gly Val Ile Ala Val Phe Phe Trp Val Leu Leu Leu Leu 780 785 790 795 atc ttc tgt aac atg agg agg ccg gcc cac gca gac atc aag acg ggc 2452 Ile Phe Cys Asn Met Arg Arg Pro Ala His Ala Asp Ile Lys Thr Gly 800 805 810 tac ctg tcc atc atc atg gac ccc ggg gag gtg cct ctg gag gag caa 2500 Tyr Leu Ser Ile Ile Met Asp Pro Gly Glu Val Pro Leu Glu Glu Gln 815 820 825 tgc gaa tac ctg tcc tac gat gcc agc cag tgg gaa ttc ccc cga gag 2548 Cys Glu Tyr Leu Ser Tyr Asp Ala Ser Gln Trp Glu Phe Pro Arg Glu 830 835 840 cgg ctg cac ctg ggg aga gtg ctc ggc tac ggc gcc ttc ggg aag gtg 2596 Arg Leu His Leu Gly Arg Val Leu Gly Tyr Gly Ala Phe Gly Lys Val 845 850 855 gtg gaa gcc tcc gct ttc ggc atc cac aag ggc agc agc tgt gac acc 2644 Val Glu Ala Ser Ala Phe Gly Ile His Lys Gly Ser Ser Cys Asp Thr 860 865 870 875 gtg gcc gtg aaa atg ctg aaa gag ggc gcc acg gcc agc gag cac cgc 2692 Val Ala Val Lys Met Leu Lys Glu Gly Ala Thr Ala Ser Glu His Arg 880 885 890 gcg ctg atg tcg gag ctc aag atc ctc att cac atc ggc aac cac ctc 2740 Ala Leu Met Ser Glu Leu Lys Ile Leu Ile His Ile Gly Asn His Leu 895 900 905 aac gtg gtc aac ctc ctc ggg gcg tgc acc aag ccg cag ggc ccc ctc 2788 Asn Val Val Asn Leu Leu Gly Ala Cys Thr Lys Pro Gln Gly Pro Leu 910 915 920 atg gtg atc gtg gag ttc tgc aag tac ggc aac ctc tcc aac ttc ctg 2836 Met Val Ile Val Glu Phe Cys Lys Tyr Gly Asn Leu Ser Asn Phe Leu 925 930 935 cgc gcc aag cgg gac gcc ttc agc ccc tgc gcg gag aag tct ccc gag 2884 Arg Ala Lys Arg Asp Ala Phe Ser Pro Cys Ala Glu Lys Ser Pro Glu 940 945 950 955 cag cgc gga cgc ttc cgc gcc atg gtg gag ctc gcc agg ctg gat cgg 2932 Gln Arg Gly Arg Phe Arg Ala Met Val Glu Leu Ala Arg Leu Asp Arg 960 965 970 agg cgg ccg ggg agc agc gac agg gtc ctc ttc gcg cgg ttc tcg aag 2980 Arg Arg Pro Gly Ser Ser Asp Arg Val Leu Phe Ala Arg Phe Ser Lys 975 980 985 acc gag ggc gga gcg agg cgg gct tct cca gac caa gaa gct gag gac 3028 Thr Glu Gly Gly Ala Arg Arg Ala Ser Pro Asp Gln Glu Ala Glu Asp 990 995 1000 ctg tgg ctg agc ccg ctg acc atg gaa gat ctt gtc tgc tac agc ttc 3076 Leu Trp Leu Ser Pro Leu Thr Met Glu Asp Leu Val Cys Tyr Ser Phe 1005 1010 1015 cag gtg gcc aga ggg atg gag ttc ctg gct tcc cga aag tgc atc cac 3124 Gln Val Ala Arg Gly Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His 1020 1025 1030 1035 aga gac ctg gct gct cgg aac att ctg ctg tcg gaa agc gac gtg gtg 3172 Arg Asp Leu Ala Ala Arg Asn Ile Leu Leu Ser Glu Ser Asp Val Val 1040 1045 1050 aag atc tgt gac ttt ggc ctt gcc cgg gac atc tac aaa gac cct gac 3220 Lys Ile Cys Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp 1055 1060 1065 tac gtc cgc aag ggc agt gcc cgg ctg ccc ctg aag tgg atg gcc cct 3268 Tyr Val Arg Lys Gly Ser Ala Arg Leu Pro Leu Lys Trp Met Ala Pro 1070 1075 1080 gaa agc atc ttc gac aag gtg tac acc acg cag agt gac gtg tgg tcc 3316 Glu Ser Ile Phe Asp Lys Val Tyr Thr Thr Gln Ser Asp Val Trp Ser 1085 1090 1095 ttt ggg gtg ctt ctc tgg gag atc ttc tct ctg ggg gcc tcc ccg tac 3364 Phe Gly Val Leu Leu Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr 1100 1105 1110 1115 cct ggg gtg cag atc aat gag gag ttc tgc cag cgg ctg aga gac ggc 3412 Pro Gly Val Gln Ile Asn Glu Glu Phe Cys Gln Arg Leu Arg Asp Gly 1120 1125 1130 aca agg atg agg gcc ccg gag ctg gcc act ccc gcc ata cgc cgc atc 3460 Thr Arg Met Arg Ala Pro Glu Leu Ala Thr Pro Ala Ile Arg Arg Ile 1135 1140 1145 atg ctg aac tgc tgg tcc gga gac ccc aag gcg aga cct gca ttc tcg 3508 Met Leu Asn Cys Trp Ser Gly Asp Pro Lys Ala Arg Pro Ala Phe Ser 1150 1155 1160 gag ctg gtg gag atc ctg ggg gac ctg ctc cag ggc agg ggc ctg caa 3556 Glu Leu Val Glu Ile Leu Gly Asp Leu Leu Gln Gly Arg Gly Leu Gln 1165 1170 1175 gag gaa gag gag gtc tgc atg gcc ccg cgc agc tct cag agc tca gaa 3604 Glu Glu Glu Glu Val Cys Met Ala Pro Arg Ser Ser Gln Ser Ser Glu 1180 1185 1190 1195 gag ggc agc ttc tcg cag gtg tcc acc atg gcc cta cac atc gcc cag 3652 Glu Gly Ser Phe Ser Gln Val Ser Thr Met Ala Leu His Ile Ala Gln 1200 1205 1210 gct gac gct gag gac agc ccg cca agc ctg cag cgc cac agc ctg gcc 3700 Ala Asp Ala Glu Asp Ser Pro Pro Ser Leu Gln Arg His Ser Leu Ala 1215 1220 1225 gcc agg tat tac aac tgg gtg tcc ttt ccc ggg tgc ctg gcc aga ggg 3748 Ala Arg Tyr Tyr Asn Trp Val Ser Phe Pro Gly Cys Leu Ala Arg Gly 1230 1235 1240 gct gag acc cgt ggt tcc tcc agg atg aag aca ttt gag gaa ttc ccc 3796 Ala Glu Thr Arg Gly Ser Ser Arg Met Lys Thr Phe Glu Glu Phe Pro 1245 1250 1255 atg acc cca acg acc tac aaa ggc tct gtg gac aac cag aca gac agt 3844 Met Thr Pro Thr Thr Tyr Lys Gly Ser Val Asp Asn Gln Thr Asp Ser 1260 1265 1270 1275 ggg atg gtg ctg gcc tcg gag gag ttt gag cag ata gag agc agg cat 3892 Gly Met Val Leu Ala Ser Glu Glu Phe Glu Gln Ile Glu Ser Arg His 1280 1285 1290 aga caa gaa agc ggc ttc agg tagctga agcagagaga gagaaggcag 3940 Arg Gln Glu Ser Gly Phe Arg 1295 catacgtcag cattttcttc tctgcactta taagaaagat caaagacttt aagactttcg 4000 ctatttcttc tactgctatc tactacaaac ttcaaagagg aaccaggagg acaagaggag 4060 catgaaagtg gacaaggagt gtgaccactg aagcaccaca gggaaggggt taggcctccg 4120 gatgactgcg ggcaggcctg gataatatcc agcctcccac aagaagctgg tggagcagag 4180 tgttccctga ctcct 4195 <210> 2 <211> 1298 <212> PRT <213> Homo sapiens <400> 2 Met Gln Arg Gly Ala Ala Leu Cys Leu Arg Leu Trp Leu Cys Leu Gly 1 5 10 15 Leu Leu Asp Gly Leu Val Ser Gly Tyr Ser Met Thr Pro Pro Thr Leu 20 25 30 Asn Ile Thr Glu Glu Ser His Val Ile Asp Thr Gly Asp Ser Leu Ser 35 40 45 Ile Ser Cys Arg Gly Gln His Pro Leu Glu Trp Ala Trp Pro Gly Ala 50 55 60 Gln Glu Ala Pro Ala Thr Gly Asp Lys Asp Ser Glu Asp Thr Gly Val 65 70 75 80 Val Arg Asp Cys Glu Gly Thr Asp Ala Arg Pro Tyr Cys Lys Val Leu 85 90 95 Leu Leu His Glu Val His Ala Asn Asp Thr Gly Ser Tyr Val Cys Tyr 100 105 110 Tyr Lys Tyr Ile Lys Ala Arg Ile Glu Gly Thr Thr Ala Ala Ser Ser 115 120 125 Tyr Val Phe Val Arg Asp Phe Glu Gln Pro Phe Ile Asn Lys Pro Asp 130 135 140 Thr Leu Leu Val Asn Arg Lys Asp Ala Met Trp Val Pro Cys Leu Val 145 150 155 160 Ser Ile Pro Gly Leu Asn Val Thr Leu Arg Ser Gln Ser Ser Val Leu 165 170 175 Trp Pro Asp Gly Gln Glu Val Val Trp Asp Asp Arg Arg Gly Met Leu 180 185 190 Val Ser Thr Pro Leu Leu His Asp Ala Leu Tyr Leu Gln Cys Glu Thr 195 200 205 Thr Trp Gly Asp Gln Asp Phe Leu Ser Asn Pro Phe Leu Val His Ile 210 215 220 Thr Gly Asn Glu Leu Tyr Asp Ile Gln Leu Leu Pro Arg Lys Ser Leu 225 230 235 240 Glu Leu Leu Val Gly Glu Lys Leu Val Leu Asn Cys Thr Val Trp Ala 245 250 255 Glu Phe Asn Ser Gly Val Thr Phe Asp Trp Asp Tyr Pro Gly Lys Gln 260 265 270 Ala Glu Arg Gly Lys Trp Val Pro Glu Arg Arg Ser Gln Gln Thr His 275 280 285 Thr Glu Leu Ser Ser Ile Leu Thr Ile His Asn Val Ser Gln His Asp 290 295 300 Leu Gly Ser Tyr Val Cys Lys Ala Asn Asn Gly Ile Gln Arg Phe Arg 305 310 315 320 Glu Ser Thr Glu Val Ile Val His Glu Asn Pro Phe Ile Ser Val Glu 325 330 335 Trp Leu Lys Gly Pro Ile Leu Glu Ala Thr Ala Gly Asp Glu Leu Val 340 345 350 Lys Leu Pro Val Lys Leu Ala Ala Tyr Pro Pro Pro Glu Phe Gln Trp 355 360 365 Tyr Lys Asp Gly Lys Ala Leu Ser Gly Arg His Ser Pro His Ala Leu 370 375 380 Val Leu Lys Glu Val Thr Glu Ala Ser Thr Gly Thr Tyr Thr Leu Ala 385 390 395 400 Leu Trp Asn Ser Ala Ala Gly Leu Arg Arg Asn Ile Ser Leu Glu Leu 405 410 415 Val Val Asn Val Pro Pro Gln Ile His Glu Lys Glu Ala Ser Ser Pro 420 425 430 Ser Ile Tyr Ser Arg His Ser Arg Gln Ala Leu Thr Cys Thr Ala Tyr 435 440 445 Gly Val Pro Leu Pro Leu Ser Ile Gln Trp His Trp Arg Pro Trp Thr 450 455 460 Pro Cys Lys Met Phe Ala Gln Arg Ser Leu Arg Arg Arg Gln Gln Gln 465 470 475 480 Asp Leu Met Pro Gln Cys Arg Asp Trp Arg Ala Val Thr Thr Gln Asp 485 490 495 Ala Val Asn Pro Ile Glu Ser Leu Asp Thr Trp Thr Glu Phe Val Glu 500 505 510 Gly Lys Asn Lys Thr Val Ser Lys Leu Val Ile Gln Asn Ala Asn Val 515 520 525 Ser Ala Met Tyr Lys Cys Val Val Ser Asn Lys Val Gly Gln Asp Glu 530 535 540 Arg Leu Ile Tyr Phe Tyr Val Thr Thr Ile Pro Asp Gly Phe Thr Ile 545 550 555 560 Glu Ser Lys Pro Ser Glu Glu Leu Leu Glu Gly Gln Pro Val Leu Leu 565 570 575 Ser Cys Gln Ala Asp Ser Tyr Lys Tyr Glu His Leu Arg Trp Tyr Arg 580 585 590 Leu Asn Leu Ser Thr Leu His Asp Ala His Gly Asn Pro Leu Leu Leu 595 600 605 Asp Cys Lys Asn Val His Leu Phe Ala Thr Pro Leu Ala Ala Ser Leu 610 615 620 Glu Glu Val Ala Pro Gly Ala Arg His Ala Thr Leu Ser Leu Ser Ile 625 630 635 640 Pro Arg Val Ala Pro Glu His Glu Gly His Tyr Val Cys Glu Val Gln 645 650 655 Asp Arg Arg Ser His Asp Lys His Cys His Lys Lys Tyr Leu Ser Val 660 665 670 Gln Ala Leu Glu Ala Pro Arg Leu Thr Gln Asn Leu Thr Asp Leu Leu 675 680 685 Val Asn Val Ser Asp Ser Leu Glu Met Gln Cys Leu Val Ala Gly Ala 690 695 700 His Ala Pro Ser Ile Val Trp Tyr Lys Asp Glu Arg Leu Leu Glu Glu 705 710 715 720 Lys Ser Gly Val Asp Leu Ala Asp Ser Asn Gln Lys Leu Ser Ile Gln 725 730 735 Arg Val Arg Glu Glu Asp Ala Gly Arg Tyr Leu Cys Ser Val Cys Asn 740 745 750 Ala Lys Gly Cys Val Asn Ser Ser Ala Ser Val Ala Val Glu Gly Ser 755 760 765 Glu Asp Lys Gly Ser Met Glu Ile Val Ile Leu Val Gly Thr Gly Val 770 775 780 Ile Ala Val Phe Phe Trp Val Leu Leu Leu Leu Ile Phe Cys Asn Met 785 790 795 800 Arg Arg Pro Ala His Ala Asp Ile Lys Thr Gly Tyr Leu Ser Ile Ile 805 810 815 Met Asp Pro Gly Glu Val Pro Leu Glu Glu Gln Cys Glu Tyr Leu Ser 820 825 830 Tyr Asp Ala Ser Gln Trp Glu Phe Pro Arg Glu Arg Leu His Leu Gly 835 840 845 Arg Val Leu Gly Tyr Gly Ala Phe Gly Lys Val Val Glu Ala Ser Ala 850 855 860 Phe Gly Ile His Lys Gly Ser Ser Cys Asp Thr Val Ala Val Lys Met 865 870 875 880 Leu Lys Glu Gly Ala Thr Ala Ser Glu His Arg Ala Leu Met Ser Glu 885 890 895 Leu Lys Ile Leu Ile His Ile Gly Asn His Leu Asn Val Val Asn Leu 900 905 910 Leu Gly Ala Cys Thr Lys Pro Gln Gly Pro Leu Met Val Ile Val Glu 915 920 925 Phe Cys Lys Tyr Gly Asn Leu Ser Asn Phe Leu Arg Ala Lys Arg Asp 930 935 940 Ala Phe Ser Pro Cys Ala Glu Lys Ser Pro Glu Gln Arg Gly Arg Phe 945 950 955 960 Arg Ala Met Val Glu Leu Ala Arg Leu Asp Arg Arg Arg Pro Gly Ser 965 970 975 Ser Asp Arg Val Leu Phe Ala Arg Phe Ser Lys Thr Glu Gly Gly Ala 980 985 990 Arg Arg Ala Ser Pro Asp Gln Glu Ala Glu Asp Leu Trp Leu Ser Pro 995 1000 1005 Leu Thr Met Glu Asp Leu Val Cys Tyr Ser Phe Gln Val Ala Arg Gly 1010 1015 1020 Met Glu Phe Leu Ala Ser Arg Lys Cys Ile His Arg Asp Leu Ala Ala 1025 1030 1035 1040 Arg Asn Ile Leu Leu Ser Glu Ser Asp Val Val Lys Ile Cys Asp Phe 1045 1050 1055 Gly Leu Ala Arg Asp Ile Tyr Lys Asp Pro Asp Tyr Val Arg Lys Gly 1060 1065 1070 Ser Ala Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Ser Ile Phe Asp 1075 1080 1085 Lys Val Tyr Thr Thr Gln Ser Asp Val Trp Ser Phe Gly Val Leu Leu 1090 1095 1100 Trp Glu Ile Phe Ser Leu Gly Ala Ser Pro Tyr Pro Gly Val Gln Ile 1105 1110 1115 1120 Asn Glu Glu Phe Cys Gln Arg Leu Arg Asp Gly Thr Arg Met Arg Ala 1125 1130 1135 Pro Glu Leu Ala Thr Pro Ala Ile Arg Arg Ile Met Leu Asn Cys Trp 1140 1145 1150 Ser Gly Asp Pro Lys Ala Arg Pro Ala Phe Ser Glu Leu Val Glu Ile 1155 1160 1165 Leu Gly Asp Leu Leu Gln Gly Arg Gly Leu Gln Glu Glu Glu Glu Val 1170 1175 1180 Cys Met Ala Pro Arg Ser Ser Gln Ser Ser Glu Glu Gly Ser Phe Ser 1185 1190 1195 1200 Gln Val Ser Thr Met Ala Leu His Ile Ala Gln Ala Asp Ala Glu Asp 1205 1210 1215 Ser Pro Pro Ser Leu Gln Arg His Ser Leu Ala Ala Arg Tyr Tyr Asn 1220 1225 1230 Trp Val Ser Phe Pro Gly Cys Leu Ala Arg Gly Ala Glu Thr Arg Gly 1235 1240 1245 Ser Ser Arg Met Lys Thr Phe Glu Glu Phe Pro Met Thr Pro Thr Thr 1250 1255 1260 Tyr Lys Gly Ser Val Asp Asn Gln Thr Asp Ser Gly Met Val Leu Ala 1265 1270 1275 1280 Ser Glu Glu Phe Glu Gln Ile Glu Ser Arg His Arg Gln Glu Ser Gly 1285 1290 1295 Phe Arg <210> 3 <211> 537 <212> PRT <213> Homo sapiens <400> 3 Tyr Ser Met Thr Pro Pro Thr Leu Asn Ile Thr Glu Glu Ser His Val 1 5 10 15 Ile Asp Thr Gly Asp Ser Leu Ser Ile Ser Cys Arg Gly Gln His Pro 20 25 30 Leu Glu Trp Ala Trp Pro Gly Ala Gln Glu Ala Pro Ala Thr Gly Asp 35 40 45 Lys Asp Ser Glu Asp Thr Gly Val Val Arg Asp Cys Glu Gly Thr Asp 50 55 60 Ala Arg Pro Tyr Cys Lys Val Leu Leu Leu His Glu Val His Ala Gln 65 70 75 80 Asp Thr Gly Ser Tyr Val Cys Tyr Tyr Lys Tyr Ile Lys Ala Arg Ile 85 90 95 Glu Gly Thr Thr Ala Ala Ser Ser Tyr Val Phe Val Arg Asp Phe Glu 100 105 110 Gln Pro Phe Ile Asn Lys Pro Asp Thr Leu Leu Val Asn Arg Lys Asp 115 120 125 Ala Met Trp Val Pro Cys Leu Val Ser Ile Pro Gly Leu Asn Val Thr 130 135 140 Leu Arg Ser Gln Ser Ser Val Leu Trp Pro Asp Gly Gln Glu Val Val 145 150 155 160 Trp Asp Asp Arg Arg Gly Met Leu Val Ser Thr Pro Leu Leu His Asp 165 170 175 Ala Leu Tyr Leu Gln Cys Glu Thr Thr Trp Gly Asp Gln Asp Phe Leu 180 185 190 Ser Asn Pro Phe Leu Val His Ile Thr Gly Asn Glu Leu Tyr Asp Ile 195 200 205 Gln Leu Leu Pro Arg Lys Ser Leu Glu Leu Leu Val Gly Glu Lys Leu 210 215 220 Val Leu Asn Cys Thr Val Trp Ala Glu Phe Asn Ser Gly Val Thr Phe 225 230 235 240 Asp Trp Asp Tyr Pro Gly Lys Gln Ala Glu Arg Gly Lys Trp Val Pro 245 250 255 Glu Arg Arg Ser Gln Gln Thr His Thr Glu Leu Ser Ser Ile Leu Thr 260 265 270 Ile His Asn Val Ser Gln His Asp Leu Gly Ser Tyr Val Cys Lys Ala 275 280 285 Asn Asn Gly Ile Gln Arg Phe Arg Glu Ser Thr Glu Val Ile Val His 290 295 300 Glu Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 305 310 315 320 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 325 330 335 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 340 345 350 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 355 360 365 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 370 375 380 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 385 390 395 400 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 405 410 415 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 420 425 430 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 435 440 445 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 450 455 460 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 465 470 475 480 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 485 490 495 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 500 505 510 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 515 520 525 Lys Ser Leu Ser Leu Ser Pro Gly Lys 530 535 <210> 4 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic linker <400> 4 Pro Ile Glu Gly Arg Gly Gly Gly Gly Gly 1 5 10 <210> 5 <211> 2292 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1)..(2292) <400> 5 atg gag agc aag gtg ctg ctg gcc gtc gcc ctg tgg ctc tgc gtg gag 48 Met Glu Ser Lys Val Leu Leu Ala Val Ala Leu Trp Leu Cys Val Glu 1 5 10 15 acc cgg gcc gcc tct gtg ggt ttg cct agt gtt tct ctt gat ctg ccc 96 Thr Arg Ala Ala Ser Val Gly Leu Pro Ser Val Ser Leu Asp Leu Pro 20 25 30 agg ctc agc ata caa aaa gac ata ctt aca att aag gct aat aca act 144 Arg Leu Ser Ile Gln Lys Asp Ile Leu Thr Ile Lys Ala Asn Thr Thr 35 40 45 ctt caa att act tgc agg gga cag agg gac ttg gac tgg ctt tgg ccc 192 Leu Gln Ile Thr Cys Arg Gly Gln Arg Asp Leu Asp Trp Leu Trp Pro 50 55 60 aat aat cag agt ggc agt gag caa agg gtg gag gtg act gag tgc agc 240 Asn Asn Gln Ser Gly Ser Glu Gln Arg Val Glu Val Thr Glu Cys Ser 65 70 75 80 gat ggc ctc ttc tgt aag aca ctc aca att cca aaa gtg atc gga aat 288 Asp Gly Leu Phe Cys Lys Thr Leu Thr Ile Pro Lys Val Ile Gly Asn 85 90 95 gac act gga gcc tac aag tgc ttc tac cgg gaa act gac ttg gcc tcg 336 Asp Thr Gly Ala Tyr Lys Cys Phe Tyr Arg Glu Thr Asp Leu Ala Ser 100 105 110 gtc att tat gtc tat gtt caa gat tac aga tct cca ttt att gct tct 384 Val Ile Tyr Val Tyr Val Gln Asp Tyr Arg Ser Pro Phe Ile Ala Ser 115 120 125 gtt agt gac caa cat gga gtc gtg tac att act gag aac aaa aac aaa 432 Val Ser Asp Gln His Gly Val Val Tyr Ile Thr Glu Asn Lys Asn Lys 130 135 140 act gtg gtg att cca tgt ctc ggg tcc att tca aat ctc aac gtg tca 480 Thr Val Val Ile Pro Cys Leu Gly Ser Ile Ser Asn Leu Asn Val Ser 145 150 155 160 ctt tgt gca aga tac cca gaa aag aga ttt gtt cct gat ggt aac aga 528 Leu Cys Ala Arg Tyr Pro Glu Lys Arg Phe Val Pro Asp Gly Asn Arg 165 170 175 att tcc tgg gac agc aag aag ggc ttt act att ccc agc tac atg atc 576 Ile Ser Trp Asp Ser Lys Lys Gly Phe Thr Ile Pro Ser Tyr Met Ile 180 185 190 agc tat gct ggc atg gtc ttc tgt gaa gca aaa att aat gat gaa agt 624 Ser Tyr Ala Gly Met Val Phe Cys Glu Ala Lys Ile Asn Asp Glu Ser 195 200 205 tac cag tct att atg tac ata gtt gtc gtt gta ggg tat agg att tat 672 Tyr Gln Ser Ile Met Tyr Ile Val Val Val Val Gly Tyr Arg Ile Tyr 210 215 220 gat gtg gtt ctg agt ccg tct cat gga att gaa cta tct gtt gga gaa 720 Asp Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu 225 230 235 240 aag ctt gtc tta aat tgt aca gca aga act gaa cta aat gtg ggg att 768 Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile 245 250 255 gac ttc aac tgg gaa tac cct tct tcg aag cat cag cat aag aaa ctt 816 Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu 260 265 270 gta aac cga gac cta aaa acc cag tct ggg agt gag atg aag aaa ttt 864 Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe 275 280 285 ttg agc acc tta act ata gat ggt gta acc cgg agt gac caa gga ttg 912 Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu 290 295 300 tac acc tgt gca gca tcc agt ggg ctg atg acc aag aag aac agc aca 960 Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr 305 310 315 320 ttt gtc agg gtc cat gaa aaa cct ttt gtt gct ttt gga agt ggc atg 1008 Phe Val Arg Val His Glu Lys Pro Phe Val Ala Phe Gly Ser Gly Met 325 330 335 gaa tct ctg gtg gaa gcc acg gtg ggg gag cgt gtc aga atc cct gcg 1056 Glu Ser Leu Val Glu Ala Thr Val Gly Glu Arg Val Arg Ile Pro Ala 340 345 350 aag tac ctt ggt tac cca ccc cca gaa ata aaa tgg tat aaa aat gga 1104 Lys Tyr Leu Gly Tyr Pro Pro Pro Glu Ile Lys Trp Tyr Lys Asn Gly 355 360 365 ata ccc ctt gag tcc aat cac aca att aaa gcg ggg cat gta ctg acg 1152 Ile Pro Leu Glu Ser Asn His Thr Ile Lys Ala Gly His Val Leu Thr 370 375 380 att atg gaa gtg agt gaa aga gac aca gga aat tac act gtc atc ctt 1200 Ile Met Glu Val Ser Glu Arg Asp Thr Gly Asn Tyr Thr Val Ile Leu 385 390 395 400 acc aat ccc att tca aag gag aag cag agc cat gtg gtc tct ctg gtt 1248 Thr Asn Pro Ile Ser Lys Glu Lys Gln Ser His Val Val Ser Leu Val 405 410 415 gtg tat gtc cca ccc cag att ggt gag aaa tct cta atc tct cct gtg 1296 Val Tyr Val Pro Pro Gln Ile Gly Glu Lys Ser Leu Ile Ser Pro Val 420 425 430 gat tcc tac cag tac ggc acc act caa acg ctg aca tgt acg gtc tat 1344 Asp Ser Tyr Gln Tyr Gly Thr Thr Gln Thr Leu Thr Cys Thr Val Tyr 435 440 445 gcc att cct ccc ccg cat cac atc cac tgg tat tgg cag ttg gag gaa 1392 Ala Ile Pro Pro Pro His His Ile His Trp Tyr Trp Gln Leu Glu Glu 450 455 460 gag tgc gcc aac gag ccc agc caa gct gtc tca gtg aca aac cca tac 1440 Glu Cys Ala Asn Glu Pro Ser Gln Ala Val Ser Val Thr Asn Pro Tyr 465 470 475 480 cct tgt gaa gaa tgg aga agt gtg gag gac ttc cag gga gga aat aaa 1488 Pro Cys Glu Glu Trp Arg Ser Val Glu Asp Phe Gln Gly Gly Asn Lys 485 490 495 att gaa gtt aat aaa aat caa ttt gct cta att gaa gga aaa aac aaa 1536 Ile Glu Val Asn Lys Asn Gln Phe Ala Leu Ile Glu Gly Lys Asn Lys 500 505 510 act gta agt acc ctt gtt atc caa gcg gca aat gtg tca gct ttg tac 1584 Thr Val Ser Thr Leu Val Ile Gln Ala Ala Asn Val Ser Ala Leu Tyr 515 520 525 aaa tgt gaa gcg gtc aac aaa gtc ggg aga gga gag agg gtg atc tcc 1632 Lys Cys Glu Ala Val Asn Lys Val Gly Arg Gly Glu Arg Val Ile Ser 530 535 540 ttc cac gtg acc agg ggt cct gaa att act ttg caa cct gac atg cag 1680 Phe His Val Thr Arg Gly Pro Glu Ile Thr Leu Gln Pro Asp Met Gln 545 550 555 560 ccc act gag cag gag agc gtg tct ttg tgg tgc act gca gac aga tct 1728 Pro Thr Glu Gln Glu Ser Val Ser Leu Trp Cys Thr Ala Asp Arg Ser 565 570 575 acg ttt gag aac ctc aca tgg tac aag ctt ggc cca cag cct ctg cca 1776 Thr Phe Glu Asn Leu Thr Trp Tyr Lys Leu Gly Pro Gln Pro Leu Pro 580 585 590 atc cat gtg gga gag ttg ccc aca cct gtt tgc aag aac ttg gat act 1824 Ile His Val Gly Glu Leu Pro Thr Pro Val Cys Lys Asn Leu Asp Thr 595 600 605 ctt tgg aaa ttg aat gcc acc atg ttc tct aat agc aca aat gac att 1872 Leu Trp Lys Leu Asn Ala Thr Met Phe Ser Asn Ser Thr Asn Asp Ile 610 615 620 ttg atc atg gag ctt aag aat gca tcc ttg cag gac caa gga gac tat 1920 Leu Ile Met Glu Leu Lys Asn Ala Ser Leu Gln Asp Gln Gly Asp Tyr 625 630 635 640 gtc tgc ctt gct caa gac agg aag acc aag aaa aga cat tgc gtg gtc 1968 Val Cys Leu Ala Gln Asp Arg Lys Thr Lys Lys Arg His Cys Val Val 645 650 655 agg cag ctc aca gtc cta gag cgt gtg gca ccc acg atc aca gga aac 2016 Arg Gln Leu Thr Val Leu Glu Arg Val Ala Pro Thr Ile Thr Gly Asn 660 665 670 ctg gag aat cag acg aca agt att ggg gaa agc atc gaa gtc tca tgc 2064 Leu Glu Asn Gln Thr Thr Ser Ile Gly Glu Ser Ile Glu Val Ser Cys 675 680 685 acg gca tct ggg aat ccc cct cca cag atc atg tgg ttt aaa gat aat 2112 Thr Ala Ser Gly Asn Pro Pro Pro Gln Ile Met Trp Phe Lys Asp Asn 690 695 700 gag acc ctt gta gaa gac tca ggc att gta ttg aag gat ggg aac cgg 2160 Glu Thr Leu Val Glu Asp Ser Gly Ile Val Leu Lys Asp Gly Asn Arg 705 710 715 720 aac ctc act atc cgc aga gtg agg aag gag gac gaa ggc ctc tac acc 2208 Asn Leu Thr Ile Arg Arg Val Arg Lys Glu Asp Glu Gly Leu Tyr Thr 725 730 735 tgc cag gca tgc agt gtt ctt ggc tgt gca aaa gtg gag gca ttt ttc 2256 Cys Gln Ala Cys Ser Val Leu Gly Cys Ala Lys Val Glu Ala Phe Phe 740 745 750 ata ata gaa ggt gcc cag gaa aag acg aac ttg gaa 2292 Ile Ile Glu Gly Ala Gln Glu Lys Thr Asn Leu Glu 755 760 <210> 6 <211> 764 <212> PRT <213> Homo sapiens <400> 6 Met Glu Ser Lys Val Leu Leu Ala Val Ala Leu Trp Leu Cys Val Glu 1 5 10 15 Thr Arg Ala Ala Ser Val Gly Leu Pro Ser Val Ser Leu Asp Leu Pro 20 25 30 Arg Leu Ser Ile Gln Lys Asp Ile Leu Thr Ile Lys Ala Asn Thr Thr 35 40 45 Leu Gln Ile Thr Cys Arg Gly Gln Arg Asp Leu Asp Trp Leu Trp Pro 50 55 60 Asn Asn Gln Ser Gly Ser Glu Gln Arg Val Glu Val Thr Glu Cys Ser 65 70 75 80 Asp Gly Leu Phe Cys Lys Thr Leu Thr Ile Pro Lys Val Ile Gly Asn 85 90 95 Asp Thr Gly Ala Tyr Lys Cys Phe Tyr Arg Glu Thr Asp Leu Ala Ser 100 105 110 Val Ile Tyr Val Tyr Val Gln Asp Tyr Arg Ser Pro Phe Ile Ala Ser 115 120 125 Val Ser Asp Gln His Gly Val Val Tyr Ile Thr Glu Asn Lys Asn Lys 130 135 140 Thr Val Val Ile Pro Cys Leu Gly Ser Ile Ser Asn Leu Asn Val Ser 145 150 155 160 Leu Cys Ala Arg Tyr Pro Glu Lys Arg Phe Val Pro Asp Gly Asn Arg 165 170 175 Ile Ser Trp Asp Ser Lys Lys Gly Phe Thr Ile Pro Ser Tyr Met Ile 180 185 190 Ser Tyr Ala Gly Met Val Phe Cys Glu Ala Lys Ile Asn Asp Glu Ser 195 200 205 Tyr Gln Ser Ile Met Tyr Ile Val Val Val Val Gly Tyr Arg Ile Tyr 210 215 220 Asp Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu 225 230 235 240 Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile 245 250 255 Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu 260 265 270 Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe 275 280 285 Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu 290 295 300 Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr 305 310 315 320 Phe Val Arg Val His Glu Lys Pro Phe Val Ala Phe Gly Ser Gly Met 325 330 335 Glu Ser Leu Val Glu Ala Thr Val Gly Glu Arg Val Arg Ile Pro Ala 340 345 350 Lys Tyr Leu Gly Tyr Pro Pro Pro Glu Ile Lys Trp Tyr Lys Asn Gly 355 360 365 Ile Pro Leu Glu Ser Asn His Thr Ile Lys Ala Gly His Val Leu Thr 370 375 380 Ile Met Glu Val Ser Glu Arg Asp Thr Gly Asn Tyr Thr Val Ile Leu 385 390 395 400 Thr Asn Pro Ile Ser Lys Glu Lys Gln Ser His Val Val Ser Leu Val 405 410 415 Val Tyr Val Pro Pro Gln Ile Gly Glu Lys Ser Leu Ile Ser Pro Val 420 425 430 Asp Ser Tyr Gln Tyr Gly Thr Thr Gln Thr Leu Thr Cys Thr Val Tyr 435 440 445 Ala Ile Pro Pro Pro His His Ile His Trp Tyr Trp Gln Leu Glu Glu 450 455 460 Glu Cys Ala Asn Glu Pro Ser Gln Ala Val Ser Val Thr Asn Pro Tyr 465 470 475 480 Pro Cys Glu Glu Trp Arg Ser Val Glu Asp Phe Gln Gly Gly Asn Lys 485 490 495 Ile Glu Val Asn Lys Asn Gln Phe Ala Leu Ile Glu Gly Lys Asn Lys 500 505 510 Thr Val Ser Thr Leu Val Ile Gln Ala Ala Asn Val Ser Ala Leu Tyr 515 520 525 Lys Cys Glu Ala Val Asn Lys Val Gly Arg Gly Glu Arg Val Ile Ser 530 535 540 Phe His Val Thr Arg Gly Pro Glu Ile Thr Leu Gln Pro Asp Met Gln 545 550 555 560 Pro Thr Glu Gln Glu Ser Val Ser Leu Trp Cys Thr Ala Asp Arg Ser 565 570 575 Thr Phe Glu Asn Leu Thr Trp Tyr Lys Leu Gly Pro Gln Pro Leu Pro 580 585 590 Ile His Val Gly Glu Leu Pro Thr Pro Val Cys Lys Asn Leu Asp Thr 595 600 605 Leu Trp Lys Leu Asn Ala Thr Met Phe Ser Asn Ser Thr Asn Asp Ile 610 615 620 Leu Ile Met Glu Leu Lys Asn Ala Ser Leu Gln Asp Gln Gly Asp Tyr 625 630 635 640 Val Cys Leu Ala Gln Asp Arg Lys Thr Lys Lys Arg His Cys Val Val 645 650 655 Arg Gln Leu Thr Val Leu Glu Arg Val Ala Pro Thr Ile Thr Gly Asn 660 665 670 Leu Glu Asn Gln Thr Thr Ser Ile Gly Glu Ser Ile Glu Val Ser Cys 675 680 685 Thr Ala Ser Gly Asn Pro Pro Pro Gln Ile Met Trp Phe Lys Asp Asn 690 695 700 Glu Thr Leu Val Glu Asp Ser Gly Ile Val Leu Lys Asp Gly Asn Arg 705 710 715 720 Asn Leu Thr Ile Arg Arg Val Arg Lys Glu Asp Glu Gly Leu Tyr Thr 725 730 735 Cys Gln Ala Cys Ser Val Leu Gly Cys Ala Lys Val Glu Ala Phe Phe 740 745 750 Ile Ile Glu Gly Ala Gln Glu Lys Thr Asn Leu Glu 755 760 <210> 7 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Synthetic linker <400> 7 Glu Phe Gly Ala Gly Leu Val Leu Gly Gly Gln Phe Met 1 5 10 <210> 8 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Synthetic linker <400> 8 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 9 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Synthetic linker <400> 9 Gly Gly Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 10 <211> 5777 <212> DNA <213> Homo sapiens <220> <221> misc_feature <222> (250)..(4263) <223> VEGFR-1 <220> <221> CDS <222> (250)..(4263) <400> 10 gcggacactc ctctcggctc ctccccggca gcggcggcgg ctcggagcgg gctccggggc 60 tcgggtgcag cggccagcgg gcctggcggc gaggattacc cggggaagtg gttgtctcct 120 ggctggagcc gcgagacggg cgctcagggc gcggggccgg cggcggcgaa cgagaggacg 180 gactctggcg gccgggtcgt tggccggggg agcgcgggca ccgggcgagc aggccgcgtc 240 gcgctcacc atg gtc agc tac tgg gac acc ggg gtc ctg ctg tgc gcg ctg 291 Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu 1 5 10 ctc agc tgt ctg ctt ctc aca gga tct agt tca ggt tca aaa tta aaa 339 Leu Ser Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys 15 20 25 30 gat cct gaa ctg agt tta aaa ggc acc cag cac atc atg caa gca ggc 387 Asp Pro Glu Leu Ser Leu Lys Gly Thr Gln His Ile Met Gln Ala Gly 35 40 45 cag aca ctg cat ctc caa tgc agg ggg gaa gca gcc cat aaa tgg tct 435 Gln Thr Leu His Leu Gln Cys Arg Gly Glu Ala Ala His Lys Trp Ser 50 55 60 ttg cct gaa atg gtg agt aag gaa agc gaa agg ctg agc ata act aaa 483 Leu Pro Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys 65 70 75 tct gcc tgt gga aga aat ggc aaa caa ttc tgc agt act tta acc ttg 531 Ser Ala Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu 80 85 90 aac aca gct caa gca aac cac act ggc ttc tac agc tgc aaa tat cta 579 Asn Thr Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu 95 100 105 110 gct gta cct act tca aag aag aag gaa aca gaa tct gca atc tat ata 627 Ala Val Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile 115 120 125 ttt att agt gat aca ggt aga cct ttc gta gag atg tac agt gaa atc 675 Phe Ile Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile 130 135 140 ccc gaa att ata cac atg act gaa gga agg gag ctc gtc att ccc tgc 723 Pro Glu Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys 145 150 155 cgg gtt acg tca cct aac atc act gtt act tta aaa aag ttt cca ctt 771 Arg Val Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu 160 165 170 gac act ttg atc cct gat gga aaa cgc ata atc tgg gac agt aga aag 819 Asp Thr Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys 175 180 185 190 ggc ttc atc ata tca aat gca acg tac aaa gaa ata ggg ctt ctg acc 867 Gly Phe Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr 195 200 205 tgt gaa gca aca gtc aat ggg cat ttg tat aag aca aac tat ctc aca 915 Cys Glu Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr 210 215 220 cat cga caa acc aat aca atc ata gat gtc caa ata agc aca cca cgc 963 His Arg Gln Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg 225 230 235 cca gtc aaa tta ctt aga ggc cat act ctt gtc ctc aat tgt act gct 1011 Pro Val Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys Thr Ala 240 245 250 acc act ccc ttg aac acg aga gtt caa atg acc tgg agt tac cct gat 1059 Thr Thr Pro Leu Asn Thr Arg Val Gln Met Thr Trp Ser Tyr Pro Asp 255 260 265 270 gaa aaa aat aag aga gct tcc gta agg cga cga att gac caa agc aat 1107 Glu Lys Asn Lys Arg Ala Ser Val Arg Arg Arg Ile Asp Gln Ser Asn 275 280 285 tcc cat gcc aac ata ttc tac agt gtt ctt act att gac aaa atg cag 1155 Ser His Ala Asn Ile Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln 290 295 300 aac aaa gac aaa gga ctt tat act tgt cgt gta agg agt gga cca tca 1203 Asn Lys Asp Lys Gly Leu Tyr Thr Cys Arg Val Arg Ser Gly Pro Ser 305 310 315 ttc aaa tct gtt aac acc tca gtg cat ata tat gat aaa gca ttc atc 1251 Phe Lys Ser Val Asn Thr Ser Val His Ile Tyr Asp Lys Ala Phe Ile 320 325 330 act gtg aaa cat cga aaa cag cag gtg ctt gaa acc gta gct ggc aag 1299 Thr Val Lys His Arg Lys Gln Gln Val Leu Glu Thr Val Ala Gly Lys 335 340 345 350 cgg tct tac cgg ctc tct atg aaa gtg aag gca ttt ccc tcg ccg gaa 1347 Arg Ser Tyr Arg Leu Ser Met Lys Val Lys Ala Phe Pro Ser Pro Glu 355 360 365 gtt gta tgg tta aaa gat ggg tta cct gcg act gag aaa tct gct cgc 1395 Val Val Trp Leu Lys Asp Gly Leu Pro Ala Thr Glu Lys Ser Ala Arg 370 375 380 tat ttg act cgt ggc tac tcg tta att atc aag gac gta act gaa gag 1443 Tyr Leu Thr Arg Gly Tyr Ser Leu Ile Ile Lys Asp Val Thr Glu Glu 385 390 395 gat gca ggg aat tat aca atc ttg ctg agc ata aaa cag tca aat gtg 1491 Asp Ala Gly Asn Tyr Thr Ile Leu Leu Ser Ile Lys Gln Ser Asn Val 400 405 410 ttt aaa aac ctc act gcc act cta att gtc aat gtg aaa ccc cag att 1539 Phe Lys Asn Leu Thr Ala Thr Leu Ile Val Asn Val Lys Pro Gln Ile 415 420 425 430 tac gaa aag gcc gtg tca tcg ttt cca gac ccg gct ctc tac cca ctg 1587 Tyr Glu Lys Ala Val Ser Ser Phe Pro Asp Pro Ala Leu Tyr Pro Leu 435 440 445 ggc agc aga caa atc ctg act tgt acc gca tat ggt atc cct caa cct 1635 Gly Ser Arg Gln Ile Leu Thr Cys Thr Ala Tyr Gly Ile Pro Gln Pro 450 455 460 aca atc aag tgg ttc tgg cac ccc tgt aac cat aat cat tcc gaa gca 1683 Thr Ile Lys Trp Phe Trp His Pro Cys Asn His Asn His Ser Glu Ala 465 470 475 agg tgt gac ttt tgt tcc aat aat gaa gag tcc ttt atc ctg gat gct 1731 Arg Cys Asp Phe Cys Ser Asn Asn Glu Glu Ser Phe Ile Leu Asp Ala 480 485 490 gac agc aac atg gga aac aga att gag agc atc act cag cgc atg gca 1779 Asp Ser Asn Met Gly Asn Arg Ile Glu Ser Ile Thr Gln Arg Met Ala 495 500 505 510 ata ata gaa gga aag aat aag atg gct agc acc ttg gtt gtg gct gac 1827 Ile Ile Glu Gly Lys Asn Lys Met Ala Ser Thr Leu Val Val Ala Asp 515 520 525 tct aga att tct gga atc tac att tgc ata gct tcc aat aaa gtt ggg 1875 Ser Arg Ile Ser Gly Ile Tyr Ile Cys Ile Ala Ser Asn Lys Val Gly 530 535 540 act gtg gga aga aac ata agc ttt tat atc aca gat gtg cca aat ggg 1923 Thr Val Gly Arg Asn Ile Ser Phe Tyr Ile Thr Asp Val Pro Asn Gly 545 550 555 ttt cat gtt aac ttg gaa aaa atg ccg acg gaa gga gag gac ctg aaa 1971 Phe His Val Asn Leu Glu Lys Met Pro Thr Glu Gly Glu Asp Leu Lys 560 565 570 ctg tct tgc aca gtt aac aag ttc tta tac aga gac gtt act tgg att 2019 Leu Ser Cys Thr Val Asn Lys Phe Leu Tyr Arg Asp Val Thr Trp Ile 575 580 585 590 tta ctg cgg aca gtt aat aac aga aca atg cac tac agt att agc aag 2067 Leu Leu Arg Thr Val Asn Asn Arg Thr Met His Tyr Ser Ile Ser Lys 595 600 605 caa aaa atg gcc atc act aag gag cac tcc atc act ctt aat ctt acc 2115 Gln Lys Met Ala Ile Thr Lys Glu His Ser Ile Thr Leu Asn Leu Thr 610 615 620 atc atg aat gtt tcc ctg caa gat tca ggc acc tat gcc tgc aga gcc 2163 Ile Met Asn Val Ser Leu Gln Asp Ser Gly Thr Tyr Ala Cys Arg Ala 625 630 635 agg aat gta tac aca ggg gaa gaa atc ctc cag aag aaa gaa att aca 2211 Arg Asn Val Tyr Thr Gly Glu Glu Ile Leu Gln Lys Lys Glu Ile Thr 640 645 650 atc aga gat cag gaa gca cca tac ctc ctg cga aac ctc agt gat cac 2259 Ile Arg Asp Gln Glu Ala Pro Tyr Leu Leu Arg Asn Leu Ser Asp His 655 660 665 670 aca gtg gcc atc agc agt tcc acc act tta gac tgt cat gct aat ggt 2307 Thr Val Ala Ile Ser Ser Ser Thr Thr Leu Asp Cys His Ala Asn Gly 675 680 685 gtc ccc gag cct cag atc act tgg ttt aaa aac aac cac aaa ata caa 2355 Val Pro Glu Pro Gln Ile Thr Trp Phe Lys Asn Asn His Lys Ile Gln 690 695 700 caa gag cct gga att att tta gga cca gga agc agc acg ctg ttt att 2403 Gln Glu Pro Gly Ile Ile Leu Gly Pro Gly Ser Ser Thr Leu Phe Ile 705 710 715 gaa aga gtc aca gaa gag gat gaa ggt gtc tat cac tgc aaa gcc acc 2451 Glu Arg Val Thr Glu Glu Asp Glu Gly Val Tyr His Cys Lys Ala Thr 720 725 730 aac cag aag ggc tct gtg gaa agt tca gca tac ctc act gtt caa gga 2499 Asn Gln Lys Gly Ser Val Glu Ser Ser Ala Tyr Leu Thr Val Gln Gly 735 740 745 750 acc tcg gac aag tct aat ctg gag ctg atc act cta aca tgc acc tgt 2547 Thr Ser Asp Lys Ser Asn Leu Glu Leu Ile Thr Leu Thr Cys Thr Cys 755 760 765 gtg gct gcg act ctc ttc tgg ctc cta tta acc ctc ctt atc cga aaa 2595 Val Ala Ala Thr Leu Phe Trp Leu Leu Leu Thr Leu Leu Ile Arg Lys 770 775 780 atg aaa agg tct tct tct gaa ata aag act gac tac cta tca att ata 2643 Met Lys Arg Ser Ser Glu Ile Lys Thr Asp Tyr Leu Ser Ile Ile 785 790 795 atg gac cca gat gaa gtt cct ttg gat gag cag tgt gag cgg ctc cct 2691 Met Asp Pro Asp Glu Val Pro Leu Asp Glu Gln Cys Glu Arg Leu Pro 800 805 810 tat gat gcc agc aag tgg gag ttt gcc cgg gag aga ctt aaa ctg ggc 2739 Tyr Asp Ala Ser Lys Trp Glu Phe Ala Arg Glu Arg Leu Lys Leu Gly 815 820 825 830 aaa tca ctt gga aga ggg gct ttt gga aaa gtg gtt caa gca tca gca 2787 Lys Ser Leu Gly Arg Gly Ala Phe Gly Lys Val Val Gln Ala Ser Ala 835 840 845 ttt ggc att aag aaa tca cct acg tgc cgg act gtg gct gtg aaa atg 2835 Phe Gly Ile Lys Lys Ser Pro Thr Cys Arg Thr Val Ala Val Lys Met 850 855 860 ctg aaa gag ggg gcc acg gcc agc gag tac aaa gct ctg atg act gag 2883 Leu Lys Glu Gly Ala Thr Ala Ser Glu Tyr Lys Ala Leu Met Thr Glu 865 870 875 cta aaa atc ttg acc cac att ggc cac cat ctg aac gtg gtt aac ctg 2931 Leu Lys Ile Leu Thr His Ile Gly His His Leu Asn Val Val Asn Leu 880 885 890 ctg gga gcc tgc acc aag caa gga ggg cct ctg atg gtg att gtt gaa 2979 Leu Gly Ala Cys Thr Lys Gln Gly Gly Pro Leu Met Val Ile Val Glu 895 900 905 910 tac tgc aaa tat gga aat ctc tcc aac tac ctc aag agc aaa cgt gac 3027 Tyr Cys Lys Tyr Gly Asn Leu Ser Asn Tyr Leu Lys Ser Lys Arg Asp 915 920 925 tta ttt ttt ctc aac aag gat gca gca cta cac atg gag cct aag aaa 3075 Leu Phe Phe Leu Asn Lys Asp Ala Ala Leu His Met Glu Pro Lys Lys 930 935 940 gaa aaa atg gag cca ggc ctg gaa caa ggc aag aaa cca aga cta gat 3123 Glu Lys Met Glu Pro Gly Leu Glu Gln Gly Lys Lys Pro Arg Leu Asp 945 950 955 agc gtc acc agc agc gaa agc ttt gcg agc tcc ggc ttt cag gaa gat 3171 Ser Val Thr Ser Ser Glu Ser Phe Ala Ser Ser Gly Phe Gln Glu Asp 960 965 970 aaa agt ctg agt gat gtt gag gaa gag gag gat tct gac ggt ttc tac 3219 Lys Ser Leu Ser Asp Val Glu Glu Glu Glu Asp Ser Asp Gly Phe Tyr 975 980 985 990 aag gag ccc atc act atg gaa gat ctg att tct tac agt ttt caa gtg 3267 Lys Glu Pro Ile Thr Met Glu Asp Leu Ile Ser Tyr Ser Phe Gln Val 995 1000 1005 gcc aga ggc atg gag ttc ctg tct tcc aga aag tgc att cat cgg gac 3315 Ala Arg Gly Met Glu Phe Leu Ser Ser Arg Lys Cys Ile His Arg Asp 1010 1015 1020 ctg gca gcg aga aac att ctt tta tct gag aac aac gtg gtg aag att 3363 Leu Ala Ala Arg Asn Ile Leu Leu Ser Glu Asn Asn Val Val Lys Ile 1025 1030 1035 tgt gat ttt ggc ctt gcc cgg gat att tat aag aac ccc gat tat gtg 3411 Cys Asp Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asn Pro Asp Tyr Val 1040 1045 1050 aga aaa gga gat act cga ctt cct ctg aaa tgg atg gct ccc gaa tct 3459 Arg Lys Gly Asp Thr Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Ser 1055 1060 1065 1070 atc ttt gac aaa atc tac agc acc aag agc gac gtg tgg tct tac gga 3507 Ile Phe Asp Lys Ile Tyr Ser Thr Lys Ser Asp Val Trp Ser Tyr Gly 1075 1080 1085 gta ttg ctg tgg gaa atc ttc tcc tta ggt ggg tct cca tac cca gga 3555 Val Leu Leu Trp Glu Ile Phe Ser Leu Gly Gly Ser Pro Tyr Pro Gly 1090 1095 1100 gta caa atg gat gag gac ttt tgc agt cgc ctg agg gaa ggc atg agg 3603 Val Gln Met Asp Glu Asp Phe Cys Ser Arg Leu Arg Glu Gly Met Arg 1105 1110 1115 atg aga gct cct gag tac tct act cct gaa atc tat cag atc atg ctg 3651 Met Arg Ala Pro Glu Tyr Ser Thr Pro Glu Ile Tyr Gln Ile Met Leu 1120 1125 1130 gac tgc tgg cac aga gac cca aaa gaa agg cca aga ttt gca gaa ctt 3699 Asp Cys Trp His Arg Asp Pro Lys Glu Arg Pro Arg Phe Ala Glu Leu 1135 1140 1145 1150 gtg gaa aaa cta ggt gat ttg ctt caa gca aat gta caa cag gat ggt 3747 Val Glu Lys Leu Gly Asp Leu Leu Gln Ala Asn Val Gln Gln Asp Gly 1155 1160 1165 aaa gac tac atc cca atc aat gcc ata ctg aca gga aat agt ggg ttt 3795 Lys Asp Tyr Ile Pro Ile Asn Ala Ile Leu Thr Gly Asn Ser Gly Phe 1170 1175 1180 aca tac tca act cct gcc ttc tct gag gac ttc ttc aag gaa agt att 3843 Thr Tyr Ser Thr Pro Ala Phe Ser Glu Asp Phe Phe Lys Glu Ser Ile 1185 1190 1195 tca gct ccg aag ttt aat tca gga agc tct gat gat gtc aga tat gta 3891 Ser Ala Pro Lys Phe Asn Ser Gly Ser Ser Asp Asp Val Arg Tyr Val 1200 1205 1210 aat gct ttc aag ttc atg agc ctg gaa aga atc aaa acc ttt gaa gaa 3939 Asn Ala Phe Lys Phe Met Ser Leu Glu Arg Ile Lys Thr Phe Glu Glu 1215 1220 1225 1230 ctt tta ccg aat gcc acc tcc atg ttt gat gac tac cag ggc gac agc 3987 Leu Leu Pro Asn Ala Thr Ser Met Phe Asp Asp Tyr Gln Gly Asp Ser 1235 1240 1245 agc act ctg ttg gcc tct ccc atg ctg aag cgc ttc acc tgg act gac 4035 Ser Thr Leu Leu Ala Ser Pro Met Leu Lys Arg Phe Thr Trp Thr Asp 1250 1255 1260 agc aaa ccc aag gcc tcg ctc aag att gac ttg aga gta acc agt aaa 4083 Ser Lys Pro Lys Ala Ser Leu Lys Ile Asp Leu Arg Val Thr Ser Lys 1265 1270 1275 agt aag gag tcg ggg ctg tct gat gtc agc agg ccc agt ttc tgc cat 4131 Ser Lys Glu Ser Gly Leu Ser Asp Val Ser Arg Pro Ser Phe Cys His 1280 1285 1290 tcc agc tgt ggg cac gtc agc gaa ggc aag cgc agg ttc acc tac gac 4179 Ser Ser Cys Gly His Val Ser Glu Gly Lys Arg Arg Phe Thr Tyr Asp 1295 1300 1305 1310 cac gct gag ctg gaa agg aaa atc gcg tgc tgc tcc ccg ccc cca gac 4227 His Ala Glu Leu Glu Arg Lys Ile Ala Cys Cys Ser Pro Pro Pro Asp 1315 1320 1325 tac aac tcg gtg gtc ctg tac tcc acc cca ccc atc tagagtt 4270 Tyr Asn Ser Val Val Leu Tyr Ser Thr Pro Pro Ile 1330 1335 tgacacgaag ccttatttct agaagcacat gtgtatttat acccccagga aactagcttt 4330 tgccagtatt atgcatatat aagtttacac ctttatcttt ccatgggagc cagctgcttt 4390 ttgtgatttt tttaatagtg cttttttttt ttgactaaca agaatgtaac tccagataga 4450 gaaatagtga caagtgaaga acactactgc taaatcctca tgttactcag tgttagagaa 4510 atccttccta aacccaatga cttccctgct ccaacccccg ccacctcagg gcacgcagga 4570 ccagtttgat tgaggagctg cactgatcac ccaatgcatc acgtacccca ctgggccagc 4630 cctgcagccc aaaacccagg gcaacaagcc cgttagcccc aggggatcac tggctggcct 4690 gagcaacatc tcgggagtcc tctagcaggc ctaagacatg tgaggaggaa aaggaaaaaa 4750 agcaaaaagc aagggagaaa agagaaaccg ggagaaggca tgagaaagaa tttgagacgc 4810 accatgtggg cacggagggg gacggggctc agcaatgcca tttcagtggc ttcccagctc 4870 tgacccttct acatttgagg gcccagccag gagcagatgg acagcgatga ggggacattt 4930 tctggattct gggaggcaag aaaaggacaa atatcttttt tggaactaaa gcaaatttta 4990 gacctttacc tatggaagtg gttctatgtc cattctcatt cgtggcatgt tttgatttgt 5050 agcactgagg gtggcactca actctgagcc catacttttg gctcctctag taagatgcac 5110 tgaaaactta gccagagtta ggttgtctcc aggccatgat ggccttacac tgaaaatgtc 5170 acattctatt ttgggtatta atatatagtc cagacactta actcaatttc ttggtattat 5230 tctgttttgc acagttagtt gtgaaagaaa gctgagaaga atgaaaatgc agtcctgagg 5290 agagttttct ccatatcaaa acgagggctg atggaggaaa aaggtcaata aggtcaaggg 5350 aagaccccgt ctctatacca accaaaccaa ttcaccaaca cagttgggac ccaaaacaca 5410 ggaagtcagt cacgtttcct tttcatttaa tggggattcc actatctcac actaatctga 5470 aaggatgtgg aagagcatta gctggcgcat attaagcact ttaagctcct tgagtaaaaa 5530 ggtggtatgt aatttatgca aggtatttct ccagttggga ctcaggatat tagttaatga 5590 gccatcacta gaagaaaagc ccattttcaa ctgctttgaa acttgcctgg ggtctgagca 5650 tgatgggaat agggagacag ggtaggaaag ggcgcctact cttcagggtc taaagatcaa 5710 gtgggccttg gatcgctaag ctggctctgt ttgatgctat ttatgcaagt tagggtctat 5770 gtattta 5777 <210> 11 <211> 1338 <212> PRT <213> Homo sapiens <400> 11 Met Val Ser Tyr Trp Asp Thr Gly Val Leu Leu Cys Ala Leu Leu Ser 1 5 10 15 Cys Leu Leu Leu Thr Gly Ser Ser Ser Gly Ser Lys Leu Lys Asp Pro 20 25 30 Glu Leu Ser Leu Lys Gly Thr Gln His Ile Met Gln Ala Gly Gln Thr 35 40 45 Leu His Leu Gln Cys Arg Gly Glu Ala Ala His Lys Trp Ser Leu Pro 50 55 60 Glu Met Val Ser Lys Glu Ser Glu Arg Leu Ser Ile Thr Lys Ser Ala 65 70 75 80 Cys Gly Arg Asn Gly Lys Gln Phe Cys Ser Thr Leu Thr Leu Asn Thr 85 90 95 Ala Gln Ala Asn His Thr Gly Phe Tyr Ser Cys Lys Tyr Leu Ala Val 100 105 110 Pro Thr Ser Lys Lys Lys Glu Thr Glu Ser Ala Ile Tyr Ile Phe Ile 115 120 125 Ser Asp Thr Gly Arg Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu 130 135 140 Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val 145 150 155 160 Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr 165 170 175 Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe 180 185 190 Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu 195 200 205 Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg 210 215 220 Gln Thr Asn Thr Ile Ile Asp Val Gln Ile Ser Thr Pro Arg Pro Val 225 230 235 240 Lys Leu Leu Arg Gly His Thr Leu Val Leu Asn Cys Thr Ala Thr Thr 245 250 255 Pro Leu Asn Thr Arg Val Gln Met Thr Trp Ser Tyr Pro Asp Glu Lys 260 265 270 Asn Lys Arg Ala Ser Val Arg Arg Arg Ile Asp Gln Ser Asn Ser His 275 280 285 Ala Asn Ile Phe Tyr Ser Val Leu Thr Ile Asp Lys Met Gln Asn Lys 290 295 300 Asp Lys Gly Leu Tyr Thr Cys Arg Val Arg Ser Gly Pro Ser Phe Lys 305 310 315 320 Ser Val Asn Thr Ser Val His Ile Tyr Asp Lys Ala Phe Ile Thr Val 325 330 335 Lys His Arg Lys Gln Gln Val Leu Glu Thr Val Ala Gly Lys Arg Ser 340 345 350 Tyr Arg Leu Ser Met Lys Val Lys Ala Phe Pro Ser Pro Glu Val Val 355 360 365 Trp Leu Lys Asp Gly Leu Pro Ala Thr Glu Lys Ser Ala Arg Tyr Leu 370 375 380 Thr Arg Gly Tyr Ser Leu Ile Ile Lys Asp Val Thr Glu Glu Asp Ala 385 390 395 400 Gly Asn Tyr Thr Ile Leu Leu Ser Ile Lys Gln Ser Asn Val Phe Lys 405 410 415 Asn Leu Thr Ala Thr Leu Ile Val Asn Val Lys Pro Gln Ile Tyr Glu 420 425 430 Lys Ala Val Ser Ser Phe Pro Asp Pro Ala Leu Tyr Pro Leu Gly Ser 435 440 445 Arg Gln Ile Leu Thr Cys Thr Ala Tyr Gly Ile Pro Gln Pro Thr Ile 450 455 460 Lys Trp Phe Trp His Pro Cys Asn His Asn His Ser Glu Ala Arg Cys 465 470 475 480 Asp Phe Cys Ser Asn Asn Glu Glu Ser Phe Ile Leu Asp Ala Asp Ser 485 490 495 Asn Met Gly Asn Arg Ile Glu Ser Ile Thr Gln Arg Met Ala Ile Ile 500 505 510 Glu Gly Lys Asn Lys Met Ala Ser Thr Leu Val Val Ala Asp Ser Arg 515 520 525 Ile Ser Gly Ile Tyr Ile Cys Ile Ala Ser Asn Lys Val Gly Thr Val 530 535 540 Gly Arg Asn Ile Ser Phe Tyr Ile Thr Asp Val Pro Asn Gly Phe His 545 550 555 560 Val Asn Leu Glu Lys Met Pro Thr Glu Gly Glu Asp Leu Lys Leu Ser 565 570 575 Cys Thr Val Asn Lys Phe Leu Tyr Arg Asp Val Thr Trp Ile Leu Leu 580 585 590 Arg Thr Val Asn Asn Arg Thr Met His Tyr Ser Ile Ser Lys Gln Lys 595 600 605 Met Ala Ile Thr Lys Glu His Ser Ile Thr Leu Asn Leu Thr Ile Met 610 615 620 Asn Val Ser Leu Gln Asp Ser Gly Thr Tyr Ala Cys Arg Ala Arg Asn 625 630 635 640 Val Tyr Thr Gly Glu Glu Ile Leu Gln Lys Lys Glu Ile Thr Ile Arg 645 650 655 Asp Gln Glu Ala Pro Tyr Leu Leu Arg Asn Leu Ser Asp His Thr Val 660 665 670 Ala Ile Ser Ser Ser Thr Thr Leu Asp Cys His Ala Asn Gly Val Pro 675 680 685 Glu Pro Gln Ile Thr Trp Phe Lys Asn Asn His Lys Ile Gln Gln Glu 690 695 700 Pro Gly Ile Ile Leu Gly Pro Gly Ser Ser Thr Leu Phe Ile Glu Arg 705 710 715 720 Val Thr Glu Glu Asp Glu Gly Val Tyr His Cys Lys Ala Thr Asn Gln 725 730 735 Lys Gly Ser Val Glu Ser Ser Ala Tyr Leu Thr Val Gln Gly Thr Ser 740 745 750 Asp Lys Ser Asn Leu Glu Leu Ile Thr Leu Thr Cys Thr Cys Val Ala 755 760 765 Ala Thr Leu Phe Trp Leu Leu Leu Thr Leu Leu Ile Arg Lys Met Lys 770 775 780 Arg Ser Ser Ser Glu Ile Lys Thr Asp Tyr Leu Ser Ile Ile Met Asp 785 790 795 800 Pro Asp Glu Val Pro Leu Asp Glu Gln Cys Glu Arg Leu Pro Tyr Asp 805 810 815 Ala Ser Lys Trp Glu Phe Ala Arg Glu Arg Leu Lys Leu Gly Lys Ser 820 825 830 Leu Gly Arg Gly Ala Phe Gly Lys Val Val Gln Ala Ser Ala Phe Gly 835 840 845 Ile Lys Lys Ser Pro Thr Cys Arg Thr Val Ala Val Lys Met Leu Lys 850 855 860 Glu Gly Ala Thr Ala Ser Glu Tyr Lys Ala Leu Met Thr Glu Leu Lys 865 870 875 880 Ile Leu Thr His Ile Gly His His Leu Asn Val Val Asn Leu Leu Gly 885 890 895 Ala Cys Thr Lys Gln Gly Gly Pro Leu Met Val Ile Val Glu Tyr Cys 900 905 910 Lys Tyr Gly Asn Leu Ser Asn Tyr Leu Lys Ser Lys Arg Asp Leu Phe 915 920 925 Phe Leu Asn Lys Asp Ala Ala Leu His Met Glu Pro Lys Lys Glu Lys 930 935 940 Met Glu Pro Gly Leu Glu Gln Gly Lys Lys Pro Arg Leu Asp Ser Val 945 950 955 960 Thr Ser Ser Glu Ser Phe Ala Ser Ser Gly Phe Gln Glu Asp Lys Ser 965 970 975 Leu Ser Asp Val Glu Glu Glu Glu Asp Ser Asp Gly Phe Tyr Lys Glu 980 985 990 Pro Ile Thr Met Glu Asp Leu Ile Ser Tyr Ser Phe Gln Val Ala Arg 995 1000 1005 Gly Met Glu Phe Leu Ser Ser Arg Lys Cys Ile His Arg Asp Leu Ala 1010 1015 1020 Ala Arg Asn Ile Leu Leu Ser Glu Asn Asn Val Val Lys Ile Cys Asp 1025 1030 1035 1040 Phe Gly Leu Ala Arg Asp Ile Tyr Lys Asn Pro Asp Tyr Val Arg Lys 1045 1050 1055 Gly Asp Thr Arg Leu Pro Leu Lys Trp Met Ala Pro Glu Ser Ile Phe 1060 1065 1070 Asp Lys Ile Tyr Ser Thr Lys Ser Asp Val Trp Ser Tyr Gly Val Leu 1075 1080 1085 Leu Trp Glu Ile Phe Ser Leu Gly Gly Ser Pro Tyr Pro Gly Val Gln 1090 1095 1100 Met Asp Glu Asp Phe Cys Ser Arg Leu Arg Glu Gly Met Arg Met Arg 1105 1110 1115 1120 Ala Pro Glu Tyr Ser Thr Pro Glu Ile Tyr Gln Ile Met Leu Asp Cys 1125 1130 1135 Trp His Arg Asp Pro Lys Glu Arg Pro Arg Phe Ala Glu Leu Val Glu 1140 1145 1150 Lys Leu Gly Asp Leu Leu Gln Ala Asn Val Gln Gln Asp Gly Lys Asp 1155 1160 1165 Tyr Ile Pro Ile Asn Ala Ile Leu Thr Gly Asn Ser Gly Phe Thr Tyr 1170 1175 1180 Ser Thr Pro Ala Phe Ser Glu Asp Phe Phe Lys Glu Ser Ile Ser Ala 1185 1190 1195 1200 Pro Lys Phe Asn Ser Gly Ser Ser Asp Asp Val Arg Tyr Val Asn Ala 1205 1210 1215 Phe Lys Phe Met Ser Leu Glu Arg Ile Lys Thr Phe Glu Glu Leu Leu 1220 1225 1230 Pro Asn Ala Thr Ser Met Phe Asp Asp Tyr Gln Gly Asp Ser Ser Thr 1235 1240 1245 Leu Leu Ala Ser Pro Met Leu Lys Arg Phe Thr Trp Thr Asp Ser Lys 1250 1255 1260 Pro Lys Ala Ser Leu Lys Ile Asp Leu Arg Val Thr Ser Lys Ser Lys 1265 1270 1275 1280 Glu Ser Gly Leu Ser Asp Val Ser Arg Pro Ser Phe Cys His Ser Ser 1285 1290 1295 Cys Gly His Val Ser Glu Gly Lys Arg Arg Phe Thr Tyr Asp His Ala 1300 1305 1310 Glu Leu Glu Arg Lys Ile Ala Cys Cys Ser Pro Pro Pro Asp Tyr Asn 1315 1320 1325 Ser Val Val Leu Tyr Ser Thr Pro Pro Ile 1330 1335 <210> 12 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 12 gacccccccg accttgcaga tcacggagga gtcacac 37 <210> 13 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 13 gtgtgactcc tccgtgatct gcaaggtcgg gggggtc 37 <210> 14 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 14 ctgcacgagg tacatgccca ggacacaggc agctacgtc 39 <210> 15 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 15 gacgtagctg cctgtgtcct gggcatgtac ctcgtgcag 39 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 16 gtccatcccc ggcctccaag tcacgctgcg ctcgc 35 <210> 17 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 17 gcgagcgcag cgtgacttgg aggccgggga tggac 35 <210> 18 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 18 gggagaagct ggtcctccag tgcaccgtgt gggctga 37 <210> 19 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 19 tcagcccaca cggtgcactg gaggaccagc ttctccc 37 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 20 agcatcctga ccatccacca ggtcagccag cacgacct 38 <210> 21 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Synthetic primer <400> 21 aggtcgtgct ggctgacctg gtggatggtc aggatgct 38

Claims (62)

A purified or isolated ligand-binding polypeptide comprising an amino acid sequence defined by positions 25-314 of SEQ ID NO: 2, provided that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is NXS or Purified or isolated ligand binding polypeptides not identical to NXT. delete delete delete The method of claim 1, wherein 4 corresponding to positions 33-35 of SEQ ID NO: 2, positions 166-168 of SEQ ID NO: 2, positions 251-253 of SEQ ID NO: 2, and positions 299-301 of SEQ ID NO: 2 Ligand binding polypeptides glycosylated at the canine N-glycosylation sequence (sequon) site, purified or isolated. delete delete delete delete delete delete The method of claim 1, comprising an amino acid sequence identical to the amino acid sequence defined by positions 25-752 of SEQ ID NO: 2, provided that the position of the polypeptide corresponding to positions 104-106 of SEQ ID NO: 2 is NXS or Purified or isolated ligand binding polypeptides not identical to NXT. The purified or isolated ligand binding polypeptide according to any one of claims 1, 5, and 12, which binds to at least one ligand polypeptide selected from human VEGF-C and human VEGF-D. . The method of claim 13, wherein inhibiting VEGF-C- or VEGF-D- binding to VEGFR-3 in cells expressing VEGFR-3 on the surface, or VEGF-C- or VEGF-D-mediated VEGFR-3 stimulation To inhibit, a purified or isolated ligand binding polypeptide. The purified or isolated ligand binding according to any one of claims 1, 5, and 12, wherein the amino acid in the polypeptide corresponding to position 104 of SEQ ID NO: 2 is deleted or substituted with another amino acid. Polypeptide. The purified or isolated ligand-binding polypeptide of claim 15, wherein the amino acid at position 104 of SEQ ID NO: 2 is substituted with another amino acid selected from the group consisting of glutamine, aspartate, glutamate, arginine and lysine. . The purified or isolated ligand binding polypeptide of claim 16, wherein the polypeptide comprises amino acids 1-290 of SEQ ID NO: 3. The purified or isolated ligand binding polypeptide according to any one of claims 1, 5, and 12, further comprising a signal peptide. 13. The ligand binding polypeptide of any one of claims 1, 5, and 12, which is soluble, purified or isolated. A ligand binding molecule comprising the ligand binding polypeptide according to any one of claims 1, 5, and 12 linked to a heterologous peptide. 21. The ligand binding molecule of claim 20, wherein the heterologous peptide comprises an immunoglobulin constant domain fragment. 22. The ligand binding molecule of claim 21, wherein the immunoglobulin constant domain fragment is an IgG constant domain fragment. 23. The ligand binding molecule of claim 22, wherein said immunoglobulin constant domain fragment comprises amino acids 306-537 of SEQ ID NO: 3. The ligand-binding molecule of claim 20, further comprising a linker connecting the heterologous peptide to the ligand-binding polypeptide. The ligand-binding molecule of claim 20, wherein the C-terminal amino acid of the ligand-binding polypeptide comprises a polypeptide directly attached to the N-terminal amino acid of the heterologous peptide by a peptide bond. The ligand binding molecule of claim 20, further comprising a signal peptide that directs secretion of the molecule from cells expressing the molecule. The ligand binding molecule of claim 20, wherein the molecule comprises the amino acid sequence shown in SEQ ID NO: 3. 21. The ligand binding molecule of claim 20, which is soluble. An isolated polynucleotide comprising a coding nucleotide sequence encoding a ligand binding polypeptide according to any one of claims 1, 5, and 12. An isolated polynucleotide comprising a coding polynucleotide sequence encoding a ligand binding molecule according to claim 20. 31. The isolated polynucleotide of claim 30, further comprising a promoter sequence operably linked to the coding nucleotide sequence to facilitate transcription of the coding nucleotide sequence in the host cell. A vector comprising the polynucleotide according to claim 29. A vector comprising the polynucleotide according to claim 30. 34. The vector of claim 33, further comprising an expression control sequence operably linked to the coding nucleotide sequence. The vector of claim 33, wherein the vector is selected from the group consisting of lentiviral vectors, adeno-associated viral vectors, adenovirus vectors, liposome vectors, and combinations thereof. 36. The vector of claim 35, wherein the vector comprises a replication-deficient adenovirus, and the adenovirus comprises a polynucleotide operably linked to a promoter and flanked by an adenovirus polynucleotide sequence. An isolated cell or cell line transformed or transfected with the polynucleotide according to claim 29. An isolated cell or cell line transformed or transfected with the polynucleotide according to claim 30. 39. The isolated cell or cell line of claim 38, which is a eukaryotic cell. 40. The isolated cell or cell line of claim 39, which is a human cell. 40. The isolated cell or cell line of claim 39, which is a Chinese hamster ovary (CHO) cell. As a method for producing a ligand-binding polypeptide,
A method comprising proliferating the cell or cell line according to claim 37 under conditions in which the ligand-binding polypeptide encoded by the polynucleotide is expressed. As a method for preparing a ligand-binding molecule,
A method comprising proliferating the cell or cell line according to claim 38 under conditions in which the ligand-binding molecule encoded by the polynucleotide is expressed. 43. The method of claim 42, further comprising purifying or isolating the ligand binding polypeptide or ligand binding molecule from the cell or from the growth medium of the cell. A pharmaceutical composition for inhibiting angiogenesis, comprising the purified ligand-binding polypeptide according to any one of claims 1, 5, and 12, and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier. . A pharmaceutical composition for inhibiting angiogenesis, comprising the purified ligand-binding molecule according to claim 20, and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier. A pharmaceutical composition for inhibiting angiogenesis, comprising the polynucleotide according to claim 29, and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier. A pharmaceutical composition for inhibiting angiogenesis, comprising the polynucleotide according to claim 30, and a pharmaceutically acceptable diluent, adjuvant, excipient, or carrier. The pharmaceutical composition of claim 46, which is formulated for topical administration. The pharmaceutical composition according to claim 49, which is in the form of a solid preparation, pasta preparation, ointment, gel, liquid, aerosol, mist, polymer, film, emulsion, or suspension. The pharmaceutical composition of claim 46, which is formulated for intravitreal administration. The pharmaceutical composition of claim 46 for use in inhibiting choroidal or retinal angiogenesis in a subject. 53. The pharmaceutical composition of claim 52 for use in treating an eye disease associated with retinal angiogenesis in a subject. The pharmaceutical composition of claim 46 for use in inhibiting tumor angiogenesis in a subject. The pharmaceutical composition of claim 46, wherein the composition is for topical administration to the eye of a subject. The pharmaceutical composition of claim 55, wherein the composition is for administration by intravitreal injection. The pharmaceutical composition of claim 55, wherein the composition is for administration by an intravitreal implant. The pharmaceutical composition of claim 55, wherein the composition is for administration by topical administration. The pharmaceutical composition according to claim 53, wherein the eye disease is selected from the group consisting of a disease consisting of muscle degeneration, diabetic retinopathy, and muscular telangiectasia. delete delete delete

Images